WO2013038940A1 - Method for producing sugar - Google Patents

Abstract

Provided is a method for producing a sugar with excellent productivity, which is capable of efficiently producing a sugar from a cellulose-containing starting material. A method for producing a sugar, which comprises the following step (1) and step (2). Step (1): a step wherein a cellulose-containing starting material is pulverized in the presence of a basic compound under such a condition that the water content relative to the dry weight of the cellulose-containing starting material is 40% by mass or less, thereby obtaining a cellulose-containing pulverized material Step (2): a step wherein the cellulose-containing pulverized material obtained in step (1) is saccharified with an enzyme

Description

Method for producing sugar

The present invention relates to a method for producing sugar.

In recent years, attempts have been made to produce sugar from biomass material containing cellulose and convert it to ethanol, lactic acid, etc. by fermentation or the like due to efforts to address environmental issues. In a method for producing a sugar by treating a biomass material containing cellulose with an enzyme such as cellulase, and saccharifying the cellulose, the pretreatment step may include a treatment for amorphizing the crystal structure of the cellulose. Useful. For example, as a pretreatment step, it has been disclosed that a cellulose is made amorphous using a cellulose solvent such as lithium chloride / dimethylacetamide (Patent Document 1).

On the other hand, as a saccharification method of cellulose, there are a method using a specific cellulase (Patent Document 2), a method of hydrolyzing cellulose or hemicellulose with hydrogen peroxide, and then an enzyme treatment (Patent Documents 3 and 4). Are known.
As a method for producing sugar from a cellulose-containing raw material, a cellulose-containing raw material is treated with a vibration mill filled with a rod to prepare amorphous cellulose having reduced cellulose I-type crystallinity, and then the amorphous cellulose is converted into the amorphous cellulose. A method of saccharification by acting cellulase and / or hemicellulase is known (Patent Document 5).

JP 2006-223152 A JP 2003-135052 A JP 2007-74992 A JP 2007-74993 A JP 2009-171951 A

However, the methods described in Patent Documents 1 to 4 are not satisfactory in terms of saccharification efficiency and productivity. Although the method described in Patent Document 5 can achieve excellent saccharification efficiency, it is required to further improve saccharification efficiency.
This invention makes it a subject to provide the manufacturing method of the saccharide | sugar excellent in productivity which can manufacture saccharide | sugar efficiently from a cellulose containing raw material.

The present inventors have found that the above-mentioned problems can be solved by pulverizing a cellulose-containing raw material in the presence of a basic compound and under a condition where the amount of water is not more than a certain amount.
That is, this invention provides the manufacturing method of sugar which has the following process (1) and process (2).
Step (1): Step (2) of pulverizing the cellulose-containing raw material in the presence of a basic compound under the condition that the moisture content relative to the dry weight of the cellulose-containing raw material is 40% by mass or less to obtain a cellulose-containing pulverized product. ): A step of saccharifying the cellulose-containing pulverized product obtained in step (1) with an enzyme.

According to the sugar production method of the present invention, the cellulose-containing raw material is pulverized under specific conditions and then subjected to an enzyme treatment, whereby the saccharification efficiency of cellulose by the enzyme treatment is improved, and the sugar is efficiently obtained from the cellulose-containing raw material. Can be manufactured.

[Method for producing sugar]
The sugar production method of the present invention includes the following steps (1) and (2).
Step (1): Step (2) of pulverizing the cellulose-containing raw material in the presence of a basic compound under the condition that the water content with respect to the dry weight of the cellulose-containing raw material is 40% by mass or less, ): A step of saccharifying the cellulose-containing pulverized product obtained in step (1) with an enzyme.

<Step (1)>
Step (1) is a step of obtaining a cellulose-containing pulverized product by pulverizing the cellulose-containing raw material in the presence of a basic compound under a condition that the water content relative to the dry weight of the cellulose-containing raw material is 40% by mass or less. .
In step (1), a cellulose-containing raw material (hereinafter sometimes referred to as “raw cellulose”) is pulverized together with a basic compound under a condition where the water content is a predetermined amount or less, whereby a base is contained in the cellulose-containing raw material. The active compound can be uniformly dispersed. Moreover, a cellulose containing raw material can be efficiently grind | pulverized by performing a grinding | pulverization process on the conditions whose moisture content is below predetermined amount. As a result, cellulose can be amorphized and reduced in particle size, and can be delignified and dehemicellulosed by the action of a basic compound.

(Cellulose-containing raw material)
The type of cellulose-containing raw material is not particularly limited, and various woods obtained from conifers such as larch and cedar, hardwoods such as oil palm and cypress; wood pulp produced from wood, cotton obtained from fibers around cotton seeds Pulp such as linter pulp; Paper such as newspaper, cardboard, magazine, and fine paper; Plant stems, leaves, fruit bunches such as bagasse (sugar cane squeezed), palm empty fruit bunches (EFB), rice straw, corn stalks, etc. Plant shells such as rice husk, palm husk and coconut husk; algae and the like.
Among the above, from the viewpoint of improving saccharification efficiency, availability, and raw material costs, it is selected from pulp, paper, wood obtained from conifers or broadleaf trees, plant stems / leaves / fruits, and algae 1 One or more species are preferred, one or more species selected from wood, plant stems / leaves / fruit bunches are more preferred, one or more species selected from bagasse, EFB and oil palm (stem) are more preferred, and bagasse is still more preferred.

The cellulose-containing raw material used in the present invention preferably has a holocellulose content of 20% by mass or more, more preferably 40% by mass or more, still more preferably 45% by mass or more, and 50% by mass. The above is even more preferable. In the present invention, the content of holocellulose refers to the total content of cellulose and hemicellulose.

The water content in the cellulose-containing raw material is 40% by mass or less, preferably 35% by mass or less, more preferably 30%, based on the dry weight of the raw material cellulose, from the viewpoint of improving the grinding efficiency and reducing the crystallinity. It is below mass%. Although the lower limit of the moisture content is 0% by mass with respect to the raw material cellulose, it is difficult to reduce the moisture content in the cellulose-containing raw material to 0% by mass. Therefore, the moisture content is preferably based on the dry weight of the raw material cellulose. Is 0.01% by mass or more, more preferably 0.1% by mass or more, and further preferably 1% by mass or more. The water content is preferably 0.01 to 40% by mass, more preferably 0.1 to 35% by mass, and more preferably 1 to 30% by mass with respect to the dry weight of the raw material cellulose. Is more preferable.
When the water content in the cellulose-containing raw material exceeds 40% by mass, the cellulose-containing raw material is dried by a known method (hereinafter sometimes referred to as “drying treatment”), and the water content is cellulose. It can be used by adjusting so that it may become 40 mass% or less with respect to the dry weight of a containing raw material.
The water content in the cellulose-containing raw material can be measured using a commercially available infrared moisture meter or the like, and specifically can be measured by the method described in the examples.

(Basic compound)
The basic compound used in the step (1) is preferably an inorganic basic compound, and includes at least one selected from alkali metal or alkaline earth metal hydroxides, oxides and sulfides.
Examples of the alkali metal or alkaline earth metal hydroxide include sodium hydroxide, potassium hydroxide, and lithium hydroxide. Examples of the alkali metal or alkaline earth metal oxide include sodium oxide, potassium oxide, magnesium oxide, and calcium oxide. Examples of the alkali metal or alkaline earth metal sulfide include sodium sulfide, potassium sulfide, Examples thereof include magnesium sulfide and calcium sulfide.
Of the above basic compounds, alkali metal hydroxides or alkaline earth metal hydroxides are more preferably used, alkali metal hydroxides are more preferably used, and sodium hydroxide or potassium hydroxide is used. Is even more preferable. These basic compounds can be used alone or in combination of two or more.

The amount of the basic compound used in the step (1) may be referred to as an anhydroglucose unit (hereinafter, “AGU”) constituting the cellulose, assuming that the holocellulose in the cellulose-containing raw material is all cellulose. ) Is preferably 0.01 times mol or more, more preferably 0.05 times mol or more, still more preferably 0.1 times mol or more, and preferably 10 times mol or less, more preferably 8 times mol. In the following, it is more preferably 5 times mol or less, and still more preferably 1.5 times mol or less. Further, the amount of the basic compound is preferably 0.01 to 10 times mol, and 0.05 to 8 times mol for the anhydroglucose unit constituting holocellulose in the cellulose-containing raw material. Is more preferably 0.1 to 5 times mol, and still more preferably 0.1 to 1.5 times mol. If the usage-amount of a basic compound is 0.01 times mole or more, saccharification efficiency will improve in the process (2) mentioned later. Moreover, if this usage-amount is 10 times mole or less, it is preferable from the viewpoint of the neutralization of a basic compound and / or the ease of washing | cleaning, and the viewpoint of the cost of a basic compound.

There is no particular limitation on the method of adding the basic compound to the cellulose-containing raw material, and the basic compound may be added all at once or dividedly in the cellulose-containing raw material. When adding a basic compound all at once, from the viewpoint of uniformly dispersing the basic compound in the cellulose-containing raw material, the basic compound is added to the cellulose-containing raw material and then stirred or mixed, or the cellulose-containing raw material is stirred. It is preferable to add and mix a basic compound.
The addition of the basic compound may be performed in an apparatus for performing a pulverization process described later, or may be performed in an apparatus for separately stirring and mixing.
The apparatus for performing the stirring and mixing is not particularly limited as long as the apparatus can disperse the basic compound in the raw material cellulose. For example, a ribbon type mixer, a paddle type mixer, a conical planetary screw type mixer, a mixer such as a kneader used for kneading powders, high-viscosity substances, and resins can be used. Among these, a horizontal shaft type paddle type mixer is more preferable. Specifically, a Redige mixer (manufactured by Chuo Kiko Co., Ltd .; characteristic ski shape) which is a horizontal shaft type paddle type mixer having chopper blades. Mixer using excavator, chopper blade can be installed), Pro-share mixer (manufactured by Taiheiyo Kiko Co., Ltd .; mixer with two functions: floating diffusion mixing with uniquely shaped shovel blade and high-speed shear dispersion with multi-stage chopper blade Is more preferable.

There is no particular limitation on the form when the basic compound is added, but from the viewpoint of grinding efficiency, it is preferably added in the raw material cellulose in a solid state. When the basic compound is added in a solid state, the basic compound is in the form of pellets, granules or powders from the viewpoint of handleability during production and from the viewpoint of uniformly dispersing the basic compound in the cellulose-containing raw material. Is preferred. Note that the fact that the basic compound is in a solid state does not mean that it does not contain moisture, and may contain moisture by absorbing moisture in the air or the like.

(amount of water)
Step (1) is performed under the condition that the water content with respect to the dry weight of the raw material cellulose is 40% by mass or less. When the water content is 40% by mass or less with respect to the dry weight of the raw material cellulose, the grinding efficiency of the cellulose-containing raw material and the mixing / penetration / diffusibility of the cellulose-containing raw material and the basic compound are improved. ) Saccharification treatment proceeds efficiently. The lower limit of the moisture content is 0% by mass.
From the viewpoint of reducing the crystallinity of cellulose, improving productivity, and improving saccharification efficiency, the water content in step (1) is preferably 0.1% by mass or more, more preferably 0.5%, based on the dry weight of the raw material cellulose. % By mass or more, more preferably 1% by mass or more, still more preferably 5% by mass or more, still more preferably 7% by mass or more, preferably 35% by mass or less, more preferably 30% by mass or less, still more preferably. It is 25 mass% or less, More preferably, it is 20 mass% or less, More preferably, it is 15 mass% or less. In addition, the water content in the step (1) is preferably 0.1 to 35% by mass, more preferably 0.5 to 35% by mass with respect to the dry weight of the raw material cellulose, and 1 to 30% by mass. Is more preferably 1 to 25% by mass, still more preferably 5 to 25% by mass, still more preferably 7 to 20% by mass, and 7 to 15% by mass. % Is even more preferable.
The amount of water at the time of the pulverization treatment in step (1) means the amount of water relative to the dry weight of the raw material cellulose. The amount of water contained in the raw material cellulose and the basic compound is reduced by a drying treatment or the like. Can be adjusted to a predetermined moisture content.

(Nitrogen-containing compounds)
Moreover, it is preferable to perform a process (1) or the process (2) mentioned later, a process (1), and a process (2) in presence of a nitrogen-containing compound from a viewpoint of saccharification efficiency improvement. The reason why saccharification efficiency is improved by using nitrogen-containing compounds is not clear, but the cellulose-containing raw material has a smaller particle size, lower molecular weight of cellulose, increased specific surface area, amorphization, and removal of impurities such as lignin. Is presumed to be performed.
In the production method of the present invention, it is preferable to perform step (1) in the presence of a nitrogen-containing compound from the viewpoint of further improving saccharification efficiency.

In the present invention, the “nitrogen-containing compound” refers to a compound containing one or more nitrogen atoms excluding the compound used as the basic compound in step (1). Examples of the nitrogen-containing compound include one or more selected from ammonia, amine, ammonia or an addition salt of an amine and an acid, and a quaternary ammonium salt.

Examples of the amine include primary amines such as methylamine, butylamine, 2-ethylhexylamine, laurylamine, stearylamine; secondary amines such as dimethylamine, dibutylamine, dioctylamine, distearylamine; trimethylamine, triethylamine, lauryldimethyl. Tertiary amines such as amine and distearylmethylamine; cyclic amines such as pyrrolidine, piperidine and morpholine, polyvalent amines such as ethylenediamine, hexamethylenediamine, diethylenetriamine and piperazine; ethanolamine, triethanolamine and 2-amino-2- Examples thereof include hydroxyamines such as methylpropanol and trishydroxymethylaminomethane.
In addition, aromatic amines such as pyridine, pyrrole, quinoline and imidazole; guanidine, amidine and the like can be mentioned.

Examples of acids that form addition salts with ammonia or amines include inorganic acids such as hydrochloric acid, phosphoric acid, and sulfuric acid, acetic acid, propionic acid, lauric acid, stearic acid, glycolic acid, lactic acid, succinic acid, adipic acid, and fumaric acid. And organic acids such as citric acid. Water can also act with ammonia as a kind of acid to produce ammonium hydroxide.
As the addition salt of ammonia or amine and acid, primary to tertiary ammonium salts such as octyl ammonium chloride, lauryl ammonium chloride, cetyl pyridinium chloride, and inorganic ammonium salts such as ammonium chloride and ammonium hydroxide are preferable. Can be mentioned. Among these, from the viewpoint of improving saccharification efficiency and improving the grinding efficiency of cellulose raw materials, primary to tertiary ammonium salts and inorganic ammonium salts having an alkyl group are preferred, inorganic ammonium salts are more preferred, and ammonium chloride is further preferred. preferable.
The alkyl group preferably has 1 or more carbon atoms, more preferably 6 or more carbon atoms from the viewpoint of improving saccharification efficiency. Moreover, it is preferable that it is C30 or less, and it is more preferable that it is C22 or less. In addition, the alkyl group preferably has 1 to 30 carbon atoms, and more preferably 6 to 22 carbon atoms, from the viewpoint of improving saccharification efficiency.

Examples of the quaternary ammonium salt include tetramethylammonium chloride, tetrapropylammonium chloride, tetrabutylammonium hydroxide, octyltrimethylammonium chloride, lauryltrimethylammonium chloride, cetyltrimethylammonium bromide, octyldimethylbenzylammonium chloride, dimethyldiallylammonium chloride. , Alkylbenzyldimethylammonium chloride, choline chloride and the like. Among these, lauryltrimethylammonium chloride, alkylbenzyldimethylammonium chloride, tetramethylammonium chloride, and dimethyldiallylammonium chloride are preferable from the viewpoint of improving saccharification efficiency and improving grinding efficiency.

The nitrogen-containing compound used in the present invention may be a polymer. Examples of the polymer include a polymer having an amine moiety, an addition salt between a polymer having an amine moiety and an acid, and a polymer having a quaternary ammonium salt moiety. The nitrogen atom in the “amine moiety” may be any of primary to tertiary. The “addition salt of a polymer having an amine moiety and an acid” refers to a polymer having at least one structure in which the aforementioned acid is added to the amine moiety.
Specific examples of such polymers include allylamine polymers such as diallyldimethylammonium chloride polymer, diallylmethylamine hydrochloride / sulfur dioxide copolymer; dimethylaminoethyl (meth) acrylate polymer, trimethylammonioethyl (meth) acrylate polymer Examples thereof include (meth) acrylate polymers such as polymers, aromatic amine polymers such as poly (4-vinylpyridine) and vinylmethylimidazolinium chloride, and polyethyleneimine. Among these, from the viewpoint of improving the saccharification efficiency and the viewpoint of improving the pulverization efficiency, one or more selected from a dimethyldiallylammonium chloride polymer and a diallylamine hydrochloride / sulfur dioxide copolymer are preferable. In addition, you may use these polymers individually or in combination of 2 or more types.
The weight average molecular weight (Mw) of the polymer is preferably 100,000 or less, more preferably 1,000 to 50,000, from the viewpoint of improving saccharification efficiency. In addition, the weight average molecular weight of the said polymer is a value measured by the method as described in an Example.

As described above, the nitrogen-containing compound includes primary to tertiary ammonium salts having an alkyl group, inorganic ammonium salts, quaternary ammonium salts, and amine sites from the viewpoint of improving saccharification efficiency and improving grinding efficiency. It is preferably at least one selected from a polymer having an amine moiety, an addition salt of a polymer having an amine moiety and an acid, and a polymer having a quaternary ammonium salt moiety, ammonium chloride, tetramethylammonium chloride, lauryltrimethylammonium chloride, It is more preferably at least one selected from alkylbenzyldimethylammonium chloride, dimethyldiallylammonium chloride, dimethyldiallylammonium chloride polymer, and diallylamine hydrochloride / sulfur dioxide copolymer.

The amount of nitrogen-containing compound used in step (1) or step (2) is based on the anhydroglucose unit (AGU) constituting the cellulose, assuming that holocellulose in the cellulose-containing raw material is all cellulose. It is preferably 0.001 times mol or more in terms of nitrogen atom, more preferably 0.002 times mol or more, and further preferably 0.005 times mol or more. Moreover, it is preferably 1 mol or less, more preferably 0.5 mol or less, still more preferably 0.3 mol or less, and even more preferably 0.2 mol or less. preferable. Further, the amount of the nitrogen-containing compound used in the step (1) or the step (2) is preferably 0.001 to 1 times mol, and preferably 0.002 to 0.5 times mol in terms of nitrogen atom. More preferably, the amount is 0.005 to 0.3 times mol, and further preferably 0.005 to 0.2 times mol. If the usage-amount of a nitrogen-containing compound is 0.001 times mole or more, saccharification efficiency will improve. Moreover, if this usage-amount is 10 times or less, it is preferable from a viewpoint of the grinding | pulverization efficiency improvement of a cellulose raw material.
In addition, in this invention, when performing both a process (1) and a process (2) in presence of a nitrogen-containing compound, the usage-amount of a nitrogen-containing compound said above is process (1) and process (2). ) Means the total amount of nitrogen-containing compound used.

In the step (1) or the step (2), there is no particular limitation on the form in which the nitrogen-containing compound is added, but the nitrogen-containing compound is uniformly dispersed from the viewpoint of pulverization efficiency, handling at the time of production, and the like. From a viewpoint, it is preferable to add in the state of a solid, a liquid, or aqueous solution in a cellulose containing raw material or a cellulose ground material.
The method for adding the nitrogen-containing compound is not particularly limited, and it may be added simultaneously with the basic compound used in step (1) or the enzyme used in step (2), or may be added individually. Further, nitrogen-containing compounds may be added all at once or in divided portions. In the case of batch addition, from the viewpoint of uniformly dispersing the nitrogen-containing compound in the cellulose-containing raw material or in the cellulose pulverized product, the mixture is stirred and mixed or stirred after adding the nitrogen-containing compound in the cellulose-containing raw material or cellulose pulverized product. However, it is preferable to add and mix the nitrogen-containing compound.

(Crushing process)
The pulverization treatment is an operation of reducing the particle size of the cellulose-containing raw material and dispersing the basic compound or the basic compound and the nitrogen-containing compound as uniformly as possible in the cellulose-containing raw material. When a basic compound in a solid state is used, the basic compound is pulverized simultaneously by the pulverization treatment.

The pulverization treatment can be performed using a known pulverizer. There is no particular limitation on the pulverizer used, so long as the cellulose-containing raw material can be made into small particles and the basic compound, or the basic compound and the nitrogen-containing compound can be dispersed in the cellulose-containing raw material as much as possible. Good.
Specific examples of the pulverizer include a high pressure compression roll mill, a roll mill such as a roll rotating mill, a vertical roller mill such as a ring roller mill, a roller race mill or a ball race mill, a rolling ball mill, a vibration ball mill, a vibration rod mill, and a vibration tube. Container driven media mills such as mills, planetary ball mills or centrifugal fluidization mills, tower crushers, stirring tank mills, medium stirring mills such as flow tank mills or annular mills, compaction such as high-speed centrifugal roller mills and angling mills Examples include a shear mill, a mortar, a stone mortar, a mass collider, a fret mill, an edge runner mill, a knife mill, a pin mill, and a cutter mill. Among these, from the viewpoint of pulverization efficiency and productivity of the cellulose-containing raw material, a container-driven medium mill or a medium stirring mill is preferable, a container-driven medium mill is more preferable, a vibrating ball mill, a vibrating rod mill, and a vibrating tube mill. Is more preferable, and a vibration rod mill is still more preferable.

The pulverization method may be either batch type or continuous type.
There are no particular restrictions on the material of the apparatus and medium used for pulverization, and examples include iron, stainless steel, alumina, zirconia, silicon carbide, silicon nitride, and glass. From the viewpoint of cellulose crystallinity reduction efficiency, iron Stainless steel, zirconia, silicon carbide, and silicon nitride are preferable, and iron or stainless steel is preferable from the viewpoint of industrial use.
When the apparatus to be used is a vibration mill and the medium is a rod, the outer diameter of the rod is preferably 0.1 mm or more, more preferably 0.5 mm or more, from the viewpoint of grinding efficiency of the cellulose-containing raw material. Is 100 mm or less, more preferably 50 mm or less. Further, from the viewpoint of the pulverization efficiency of the cellulose-containing raw material, the outer diameter of the rod is preferably in the range of 0.1 to 100 mm, more preferably 0.5 to 50 mm. If the size of the rod is in the above range, the cellulose-containing raw material can be efficiently made into small particles, and there is little risk of contamination of the cellulose due to mixing of fragments of the rod and the like.
The rod filling rate varies depending on the type of vibration mill, but is preferably 10% or more, more preferably 15% or more, preferably 97% or less, more preferably 95% or less, and still more preferably 90%. % Or less, more preferably 80% or less. The filling rate of the rod is preferably 10 to 97%, more preferably 10 to 95%, still more preferably 15 to 90%, and still more preferably 15 to 80%. If the filling rate is within this range, the contact frequency between the cellulose and the rod can be improved, and the grinding efficiency of the raw material cellulose can be improved without hindering the movement of the medium. Here, the filling rate refers to the apparent volume of the rod relative to the volume of the stirring section of the vibration mill.

The temperature during the pulverization treatment is not particularly limited, but from the viewpoint of operation cost and suppression of deterioration of raw material cellulose, it is preferably −100 ° C. or higher, more preferably 0 ° C. or higher, further preferably 5 ° C. or higher, and 200 ° C. or lower. Is preferable, 150 degrees C or less is more preferable, and 100 degrees C or less is still more preferable. Further, from the same viewpoint as described above, −100 to 200 ° C. is preferable, 0 to 150 ° C. is more preferable, and 5 to 100 ° C. is still more preferable.
The pulverization time may be appropriately adjusted so that the cellulose-containing raw material after pulverization is reduced in size. Although it varies depending on the pulverizer to be used and the amount of energy to be used, it is usually 1 minute to 12 hours, preferably 2 minutes or more from the viewpoint of reducing the particle size of the cellulose-containing raw material and energy cost, and 5 minutes or more. More preferably, it is preferably 6 hours or less, more preferably 3 hours or less, and even more preferably 2 hours or less. From the same viewpoint as described above, 2 minutes to 6 hours are preferable, 5 minutes to 3 hours are more preferable, and 5 minutes to 2 hours are more preferable.
By performing the step (1) as described above, a cellulose-containing pulverized product is obtained.

(Aging process)
From the viewpoint of improving the saccharification efficiency by further promoting the hydrolysis of lignin and hemicellulose bonds by the action of the basic compound after the step (1), that is, lignin desorption and hemicellulose desorption. Before the step (2), preferably before the neutralization step and the washing step described later, the cellulose-containing pulverized product obtained in the step (1) has a water content of 50 to 50%. It is preferable to have a process of aging under the condition of 10,000% by mass (hereinafter sometimes referred to as “aging process”). It is considered that the saccharification efficiency is further improved by aging the cellulose-containing pulverized product containing a basic compound under a predetermined moisture condition, thereby promoting lignin elimination and hemicellulose elimination by the action of the basic compound.
In the production method of the present invention, in the aging step, for example, water is added to and mixed with the cellulose-containing pulverized product obtained in step (1), and the mixture is stirred or allowed to stand for a certain period of time while being heated as desired. Can be performed.
From the viewpoint of uniformly dispersing water in the cellulose-containing pulverized product, after adding water to the cellulose-containing pulverized product, stirring and mixing, or stirring the cellulose-containing pulverized product, adding water and mixing preferable.
There is no particular limitation on the method of adding water, and batch addition or divided addition may be used.

The amount of water in the ripening step is determined from the cellulose-containing pulverized product from the viewpoint of improving the saccharification efficiency by further promoting lignin and hemicellulose bond hydrolysis by the action of the basic compound, that is, lignin desorption and hemicellulose desorption. On the other hand, it is preferably 50% by mass or more, more preferably 100% by mass or more, still more preferably 200% by mass or more, still more preferably 230% by mass or more, and preferably 10000% by mass from the viewpoint of reducing production costs. % Or less, More preferably, it is 8000 mass% or less, More preferably, it is 5000 mass% or less, More preferably, it is 4000 mass% or less, More preferably, it is 3500 mass% or less. From the above viewpoint, the water content in the ripening step is preferably 50 to 10000% by mass, more preferably 100 to 8000% by mass, still more preferably 200 to 5000% by mass, and still more preferably, with respect to the cellulose-containing pulverized product. 230 to 3500% by mass.
In addition, the moisture content with respect to a cellulose containing ground material is the mass% with respect to the dry raw material remove | excluding the basic compound from the cellulose containing ground material.

There is no particular limitation on the aging apparatus. Specific examples thereof include an apparatus used for stirring and mixing the basic compound.

The aging temperature is preferably 0 ° C. or higher, more preferably 20 ° C. or higher, further preferably 50 ° C. or higher, more preferably 80 ° C. or higher, from the viewpoint of promoting detachment of lignin and hemicellulose and improving saccharification efficiency. From the viewpoint of suppressing the excessive decomposition of components derived from hemicellulose and reducing the production cost, it is preferably 250 ° C. or lower, more preferably 200 ° C. or lower, still more preferably 150 ° C. or lower, and still more preferably 100 ° C. or lower.
From the same viewpoint as described above, the aging temperature is preferably 0 ° C. or higher and 250 ° C. or lower, more preferably 20 ° C. or higher and 200 ° C. or lower, further preferably 50 ° C. or higher and 150 ° C. or lower, and further preferably 80 ° C. or higher and 100 ° C. or lower. is there. Further, from the viewpoint of simplification of production equipment and reduction of production cost, it is preferably 0 to 100 ° C., more preferably 20 to 100 ° C., still more preferably 50 to 100 ° C., and still more preferably 80 to 100 ° C.
In addition, you may perform operation which evaporates an excess water | moisture content at the time of a ripening process so that the cellulose containing ground material in the solution used for the process (2) mentioned later may become a moderate density | concentration. For example, it is possible to evaporate water at the same time by using an open system during aging.

The aging time is preferably 0.01 hours or more, more preferably 0.1 hours or more, still more preferably 0.5 hours or more, and still more preferably, from the viewpoint of promoting detachment of lignin and hemicellulose and improving saccharification efficiency. Preferably, it is 1 hour or more, and preferably 24 hours or less, more preferably 18 hours or less, still more preferably 12 hours or less, and still more preferably, from the viewpoint of suppressing the excessive decomposition of components derived from hemicellulose and reducing the production cost. Preferably it is 6 hours or less. From the above viewpoint, the aging time is preferably 0.01 to 24 hours, more preferably 0.1 to 18 hours, still more preferably 0.5 to 12 hours, and still more preferably 1 to 6 hours.

In addition, in order to remove impurities contained in the basic compound, nitrogen-containing compound, and cellulose-containing raw material used in step (1), it is preferable to perform the aging step before step (2). The following neutralization step and washing step may be included.

(Neutralization process)
In the production method of the present invention, from the viewpoint of improving the saccharification efficiency in the step (2) described later, a step of neutralizing the cellulose-containing pulverized product obtained in the step (1) with an acid before the step (2). It is preferable to have this (hereinafter, this may be referred to as “neutralization step”).
Examples of the acid used include inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid and boric acid, and organic acids such as acetic acid and citric acid. From the viewpoint of improving productivity, saccharification efficiency and sugar yield. Therefore, it is more preferable to use one or more selected from hydrochloric acid, acetic acid, sulfuric acid, nitric acid and phosphoric acid, and it is more preferable to use one or more selected from hydrochloric acid, acetic acid and sulfuric acid.
In addition, when an inorganic acid such as hydrochloric acid or sulfuric acid is used, it is more preferable from the viewpoint of improving the yield of sugar because it has little adverse effect on the saccharification reaction of the salt produced in the neutralization step.
The neutralization step can be performed by adding an appropriate amount of acid to the cellulose-containing pulverized product and stirring. In the neutralization step, for example, after the cellulose-containing pulverized product is dispersed in water so as to have a concentration of 0.1 to 50% by mass, 0.01 to 37% An acid such as hydrochloric acid or 0.01 to 75% sulfuric acid can be added by adding an appropriate amount until the pH is near neutral, preferably pH 4 to 8, more preferably pH 4 to 7. At that time, it is preferable that the suspension is appropriately stirred to make it uniform.

(Washing process)
From the viewpoint of removing impurities contained in the basic compound, nitrogen-containing compound and cellulose-containing raw material used in step (1) and improving saccharification efficiency in step (2), before step (2), step The cellulose-containing pulverized product obtained in (1) may have a step of washing with water (hereinafter, this may be referred to as a “washing step”).
For washing the cellulose-containing pulverized product, for example, the cellulose-containing pulverized product is dispersed in ion-exchanged water so as to have a concentration of 0.1 to 50%. The operation of dispersing and centrifuging to a similar concentration can be performed by a method of repeating washing until the pH is near neutral, preferably pH 4 to 8, more preferably pH 4 to 7.

In the neutralization step and the washing step, only one of the steps may be performed, or the washing step may be further performed after the neutralization step. Moreover, it is also possible to perform only the neutralization process using an inorganic acid from a viewpoint of the yield improvement of the saccharide | sugar obtained by process (2).

<Step (2)>
Step (2) is a step of saccharifying the cellulose-containing pulverized product obtained in step (1) with an enzyme.
The cellulose-containing pulverized product obtained in step (1) is amorphized, reduced in particle size, and delignified / dehemicellulosed, so that it can be treated with an enzyme to give a monosaccharide such as glucose or xylose. Or a mixture of oligosaccharides such as cellobiose, cellotriose, xylobiose, and xylotriose can be efficiently obtained. Considering the case of using it for ethanol fermentation or lactic acid fermentation after saccharification treatment, it is preferable to decompose to monosaccharide.

Examples of the enzyme used in the step (2) include cellulase and hemicellulase from the viewpoint of improving saccharification efficiency.
Here, cellulase refers to an enzyme that hydrolyzes the glycosidic bond of β-1,4-glucan of cellulose, and is a generic term for enzymes called endoglucanase, exoglucanase or cellobiohydrolase, and β-glucosidase. is there. Hemicellulase refers to an enzyme that hydrolyzes hemicellulose, and is a general term for enzymes called xylanase, galactanase, and the like. The cellulase and hemicellulase used in the present invention include commercially available cellulase preparations and those derived from animals, plants and microorganisms.

Specific examples of cellulases include cellulase preparations derived from Trichoderma reesei such as Cellcrust 1.5L (trade name, manufactured by Novozymes) and Bacillus sp. KSM-N145 (FERM P-19727) strain. cellulase derived from or Bacillus sp., (Bacillus sp.) KSM- N252 (FERM P-17474), Bacillus sp. (Bacillus sp.) KSM-N115 (FERM P-19726), Bacillus sp. (Bacillus sp.) KSM-N440 ( FERM P-19728), Bacillus sp (Bacillus sp.) KSM-N659 (FERM P-19730) cellulase from each strain, such as, furthermore, Trichoderma viride (Trichoderma viride), Aspergillus Akureatasu (Aspergillus acleatus), Clostridium thermocellum ( Clostridium thermocellum), Clostridium stercorarium (Clostridium stercorarium), Clostridium josui Clostridium josui) Cellulomonas Fimi (Cellulomonas fimi), Acremonium cell Lori caustics (Acremonium celluloriticus), Irupekkusu Rakuteusu (Irpex lacteus), Aspergillus niger (Aspergillus niger), Humicola insolens (Humicola insolens) derived cellulase mixtures and Pyrococcus horikoshii (Pyrococcus horikoshii ) -derived thermostable cellulase. Among these, cellulase derived from Trichoderma reesei , Trichoderma viride , or Humicola insolens is preferable from the viewpoint of improving saccharification efficiency.

Commercially available cellulase preparations include, for example, Cell Crust 1.5L (trade name, manufactured by Novozymes), TP-60 (trade name, manufactured by Meiji Seika Co., Ltd.), CellicCTec2 (trade name, manufactured by Novozymes), Accelerase DUET (manufactured by Genencor, product name) or Ultraflo L (manufactured by Novozymes, product name) may be mentioned. Among these, from the viewpoint of improving saccharification efficiency, Cellcrust 1.5L (trade name, manufactured by Novozymes), CellicCTec (trade name, manufactured by Novozymes), and CellicCTec2 (trade name, manufactured by Novozymes) are preferable, and CellicCTec (Novozymes) Product, trade name), CellicCTec2 (Novozymes, trade name) is more preferred, and CellicCTec2 (Novozymes, trade name) is more preferred.

Specific examples of β-glucosidase, which is a kind of cellulase, include β-glucosidase derived from Aspergillus niger (for example, Novozyme 188 (manufactured by Novozymes, trade name), β-glucosidase manufactured by Megazyme), Examples thereof include Trichoderma reesei and β-glucosidase derived from Penicillium emersonii .

Specific examples of hemicellulase include commercially available hemicellulase preparations, xylanase derived from Bacillus sp. KSM-N546 (FERM P-19729), Trichoderma reesei , Aspergillus niger ( Aspergillus niger ). ), Trichoderma viride (Trichoderma viride), Humicola insolens (Humicola insolens), Bacillus alcalophilus (Bacillus alcalophilus) derived from a xylanase, further, Thermomyces (Thermomyces), Ou Leo bus Shijiumu (Aureobasidium), Streptomyces (Streptomyces) , Clostridium (Clostridium), Thermotoga (Thermotoga), Thermoascus (Thermoascus), Karudoseramu (Caldocellum), etc. thermo mono Supora (Thermomonospora) derived from the genus of xylanase and the like.

Examples of commercially available hemicellulase preparations include CellicHTec (manufactured by Novozymes, trade name), CellicHTec2 (manufactured by Novozymes, trade name), sucrase (manufactured by Mitsubishi Chemical Foods, trade name), Shearzyme 500L (manufactured by Novozymes). , Product name). Among these, CellicHTec or CellicHTec2 is preferable from the viewpoint of improving saccharification efficiency.

The enzyme used in step (2) is preferably at least one selected from the above cellulases and hemicellulases from the viewpoint of improving saccharification efficiency.

Moreover, it is preferable that the enzyme used in a process (2) contains the endoglucanase which is 1 type of a cellulase. The endoglucanase used in the present invention is preferably at least one selected from endoglucanase I (EGI) and endoglucanase II (EGII) derived from the Trichoderma family from the viewpoint of saccharification efficiency of cellulose. These enzymes may be used after being expressed by a heterologous host. There are no particular restrictions on the preparation method for expression in a heterologous host, but examples include the methods described in the Examples.

The endoglucanase used in the present invention may be a commercially available cellulase preparation or a product obtained by purifying a cellulase derived from animals, plants, or microorganisms. Although there is no restriction | limiting in particular about the purification method, For example, the method of an Example description is mentioned. Examples of the cellulase to be purified include the aforementioned cellulases. Among the aforementioned cellulases, cellulases derived from Trichoderma reesei , Trichoderma viride , or Humicola insolens , such as Cellcrust 1.5L (trade name, manufactured by Novozymes), TP-60 ( Meiji Seika Co., Ltd., trade name) or Ultraflo L (manufactured by Novozymes, trade name) is preferably used.

The blending ratio of the endoglucanase in the enzyme used in the step (2) is preferably 10% by mass or more, more preferably 14% in the total amount of protein in the enzyme, from the viewpoint of improving saccharification efficiency and increasing the amount of glucose produced. % By mass or more, more preferably 16% by mass or more, still more preferably 18% by mass or more, still more preferably 20% by mass or more, preferably 90% by mass or less, more preferably 75% by mass or less, still more preferably. It is 70 mass% or less, More preferably, it is 60 mass% or less, More preferably, it is 50 mass% or less. The blending ratio of the endoglucanase in the enzyme used in the step (2) is preferably 10 to 90% by mass, more preferably 14 to 75% by mass, and still more preferably 16 to 70% by mass in the total amount of protein in the enzyme. %, More preferably 18 to 60% by mass, and still more preferably 20 to 50% by mass. The blending ratio of endoglucanase can be adjusted by the method described in the examples.

From the viewpoint of further improving the saccharification efficiency, the enzyme used in the step (2) preferably contains xylanase, which is one kind of hemicellulase. Specific examples of preferred xylanases used in the step (2) include CellicHTec (trade name, manufactured by Novozymes) and CellicHTec2 (trade name, manufactured by Novozymes).
The mixing ratio of the xylanase in the enzyme used in the step (2) is preferably 2% by mass or more, more preferably 3% by mass in the total protein amount in the enzyme from the viewpoint of improving saccharification efficiency and increasing the amount of reducing sugar. % Or more, more preferably 4% by weight or more, still more preferably 5% by weight or more, still more preferably 6% by weight or more, preferably 75% by weight or less, more preferably 50% by weight or less, still more preferably 40% by weight. It is at most mass%, more preferably at most 25 mass%, even more preferably at most 20 mass%, still more preferably at most 16 mass%. Further, the blending ratio of the xylanase in the enzyme used in the step (2) is preferably 2 to 75% by mass, more preferably 2 to 50% by mass, more preferably 3 to 40% by mass, based on the total amount of protein in the enzyme. Further, it is preferably 4 to 25% by mass, more preferably 5 to 20% by mass, and still more preferably 6 to 16% by mass. In addition, the mixture ratio of a xylanase can be adjusted with the method as described in an Example.

In the step (2), the treatment conditions for saccharifying the cellulose-containing pulverized product with an enzyme can be appropriately selected depending on the crystallinity of cellulose in the pulverized product and the type of enzyme used.
For example, when a cellulose raw material is used as a substrate, an enzyme is used as a substrate with respect to a substrate suspension of 0.5 to 40% (w / v), preferably 0.5 to 20% (w / v). The enzyme protein is added so that the amount of the enzyme protein is 0.04 to 600% by mass, or 0.001 to 15% (v / v), and the reaction time is 10 to 90 ° C. in a buffer solution having a pH of 2 to 10. Sugar can be produced by reacting for 30 minutes to 5 days, preferably 0.5 to 3 days.
The pH of the buffer is preferably selected as appropriate according to the type of enzyme used, preferably pH 3-7, more preferably pH 4-6. The reaction temperature is preferably selected as appropriate according to the type of enzyme used, preferably 20 to 70 ° C, more preferably 40 to 60 ° C.

In relation to the above-described embodiment, the present invention discloses the following manufacturing method.
<1> A method for producing sugar, comprising the following step (1) and step (2).
Step (1): In the presence of a basic compound, the moisture content of the cellulose-containing raw material is 40% by mass or less, preferably 35% by mass or less, more preferably 30% by mass or less, even more preferably, relative to the dry weight of the cellulose-containing raw material. Is 25% by mass or less, more preferably 20% by mass or less, still more preferably 15% by mass or less, preferably 0.1% by mass or more, more preferably 0.5% by mass or more, and further preferably 1% by mass. % Or more, more preferably 5% by mass or more, still more preferably 7% by mass or more, preferably 0.1 to 35% by mass, more preferably 0.5 to 35% by mass, and still more preferably 1 to 30%. % By weight, more preferably 1-25% by weight, even more preferably 5-25% by weight, even more preferably 7-20% by weight, and even more preferably 7-15% by weight. It was pulverized with matter under process step of obtaining a cellulose-containing pulverized material (2): a step of saccharification of cellulose-containing pulverized product obtained in step (1) the enzyme

<2> The method for producing a sugar according to <1>, wherein the basic compound is added in a solid state.

<3> The amount of the basic compound is 0.01 times mol or more, preferably 0.05 times mol or more, more preferably 0.1 times the anhydroglucose unit constituting the holocellulose in the cellulose-containing raw material. It is not less than 10 mol, preferably not more than 8 times mol, more preferably not more than 5 times mol, still more preferably not more than 1.5 times mol, and preferably 0.01 to 10 times mol, preferably 0.05 The method for producing a saccharide according to <1> or <2>, wherein it is ˜8 times mol, more preferably 0.1 to 5 times mol, and still more preferably 0.1 to 1.5 times mol.

<4> The sugar production according to any one of <1> to <3>, further comprising a step of neutralizing the cellulose-containing pulverized product obtained in step (1) with an acid before step (2). Method.

<5> The acid is an inorganic acid or an organic acid, preferably one or more selected from hydrochloric acid, acetic acid, sulfuric acid, nitric acid and phosphoric acid, more preferably one or more selected from hydrochloric acid, acetic acid and sulfuric acid, <4 The method for producing sugar according to>.

<6> The method for producing a saccharide according to <4> or <5>, wherein the acid is an inorganic acid.

<7> The method for producing a saccharide according to any one of <1> to <6>, wherein the enzyme is one or more selected from cellulase and hemicellulase.

<8> The enzyme contains endoglucanase, and the blending ratio of the endoglucanase is 10% by mass or more, preferably 14% by mass or more, more preferably 16% by mass or more, and still more preferably 18% of the total protein content in the enzyme. % By mass or more, more preferably 20% by mass or more, 90% by mass or less, preferably 75% by mass or less, more preferably 70% by mass or less, still more preferably 60% by mass or less, and still more preferably 50% by mass. 10 to 90% by mass, preferably 14 to 75% by mass, more preferably 16 to 70% by mass, still more preferably 18 to 60% by mass, and still more preferably 20 to 50% by mass. The method for producing a sugar according to any one of 1> to <7>.

<9> One or more types of cellulose-containing raw materials selected from pulp, paper, coniferous or hardwood, plant stems / leaves / fruits, and algae, preferably wood or plant stems / leaves / fruits The sugar according to any one of <1> to <8>, which is one or more selected from tufts, more preferably one or more selected from bagasse, EFB, and oil palm (stem), and more preferably bagasse. Manufacturing method.

<10> The enzyme contains xylanase, and the blending ratio of the xylanase is 2% by mass or more, preferably 3% by mass or more, more preferably 4% by mass or more, further preferably 5% by mass, based on the total amount of protein in the enzyme. Or more, more preferably 6% by mass or more, 75% by mass or less, preferably 50% by mass or less, more preferably 40% by mass or less, still more preferably 25% by mass or less, still more preferably 20% by mass or less, More preferably, it is 16% by mass or less, 2 to 75% by mass, preferably 2 to 50% by mass, more preferably 3 to 40% by mass, more preferably 4 to 25% by mass, and further preferably 5 to 20% by mass. %, More preferably 6 to 16% by mass, The method for producing a sugar according to any one of <1> to <9>.

<11> The cellulose-containing raw material has a holocellulose content of 20% by mass or more, preferably 40% by mass or more, more preferably 45% by mass or more, and still more preferably 50% by mass or more. > The method for producing a sugar according to any one of the above.

<12> The basic compound is at least one selected from hydroxides, oxides and sulfides of alkali metals and alkaline earth metals, preferably alkali metal hydroxides or alkaline earth metal hydroxides, more preferably The method for producing a saccharide according to any one of <1> to <11>, wherein is an alkali metal hydroxide, more preferably sodium hydroxide or potassium hydroxide.

<13> The pulverization treatment in the step (1) is performed using a vibration mill selected from a vibration ball mill, a vibration rod mill, and a vibration tube mill, preferably a vibration rod mill. Of sugar production.

<14> In the pulverization process in step (1), the rod filling rate is 10% or more, preferably 15% or more, 97% or less, preferably 95% or less, more preferably 90% or less, and still more preferably 80%. % Or less, 10 to 97%, preferably 10 to 95%, more preferably 15 to 90%, and still more preferably 15 to 80%, using the vibrating rod mill. Method.

<15> The method for producing a saccharide according to any one of <1> to <14>, further comprising a step of washing the cellulose-containing pulverized product obtained in the step (1) with water before the step (2). .

<16> Before the step (2), the cellulose-containing pulverized product obtained in the step (1) has a water content of 50% by mass or more, preferably 100% by mass or more, more preferably 200%. % By mass or more, more preferably 230% by mass or more, 10000% by mass or less, preferably 8000% by mass or less, more preferably 5000% by mass or less, still more preferably 4000% by mass or less, and still more preferably 3500% by mass or less. And aging under the conditions of 50 to 10000% by mass, preferably 100 to 8000% by mass, more preferably 200 to 5000% by mass, and still more preferably 230 to 3500% by mass. 15> The method for producing a sugar according to any one of

<17> The aging temperature is 0 ° C. or higher, preferably 20 ° C. or higher, more preferably 50 ° C. or higher, still more preferably 80 ° C. or higher, 250 ° C. or lower, preferably 200 ° C. or lower, more preferably 150 ° C. or lower, More preferably, it is 100 degrees C or less, The manufacturing method of the sugar as described in said <16>.

<18> Aging time is 0.01 hour or more, preferably 0.1 hour or more, more preferably 0.5 hour or more, further preferably 1 hour or more, 24 hours or less, preferably 18 hours or less, more Preferably it is 12 hours or less, more preferably 6 hours or less, 0.01 to 24 hours, preferably 0.1 to 18 hours, more preferably 0.5 to 12 hours, still more preferably 1 to 6 hours. The method for producing a sugar according to <16> or <17>.

<19> The method for producing a saccharide according to any one of <1> to <18>, wherein the step (1) or the step (2) is performed in the presence of a nitrogen-containing compound.

<20> The method for producing a sugar according to <19>, wherein the step (1) is performed in the presence of a nitrogen-containing compound.

<21> The method for producing a saccharide according to any one of <1> to <18>, wherein the step (1) and the step (2) are performed in the presence of a nitrogen-containing compound.

<22> a nitrogen-containing compound having a primary to tertiary ammonium salt having an alkyl group, an inorganic ammonium salt, a quaternary ammonium salt, a polymer having an amine moiety, an addition salt of a polymer having an amine moiety and an acid, And one or more polymers selected from polymers having a quaternary ammonium salt moiety, preferably a polymer of ammonium chloride, tetramethylammonium chloride, lauryltrimethylammonium chloride, alkylbenzyldimethylammonium chloride, dimethyldiallylammonium chloride, dimethyldiallylammonium chloride. And a method for producing a saccharide according to any one of <19> to <21>, wherein the sugar is one or more selected from diallylamine hydrochloride / sulfur dioxide copolymer.

<23> The nitrogen-containing compound is used in an amount of 0.001 times mol or more, preferably 0.002 times mol or more, more preferably in terms of nitrogen atom, relative to the anhydroglucose unit constituting holocellulose in the cellulose raw material. Is 0.005 times mol or more, 1 times mol or less, preferably 0.5 times mol or less, more preferably 0.3 times mol or less, still more preferably 0.2 times mol or less, 0.001 to <19> to <1 mole, preferably 0.002 to 0.5 mole, more preferably 0.005 to 0.3 mole, and still more preferably 0.005 to 0.2 mole. 22> The method for producing a sugar according to any one of the above.

In the following examples, “%” means “% by mass” unless otherwise specified and excluding crystallinity (%). The holocellulose content was used as the cellulose content in the cellulose-containing raw material (raw material cellulose).

(1) Calculation of holocellulose content in cellulose-containing raw material The pulverized cellulose-containing raw material was subjected to Soxhlet extraction with an ethanol-dichloroethane mixed solvent (1: 1) for 6 hours, and the sample after extraction was vacuum-dried at 60 ° C. . To 2.5 g of the obtained sample, 150 mL of water, 1.0 g of sodium chlorite and 0.2 mL of acetic acid were added and heated at 70 to 80 ° C. for 1 hour. Subsequently, the operation of adding sodium chlorite and acetic acid and heating was repeated 3 to 4 times until the sample was decolorized white. The white residue was filtered through a glass filter (1G-3), washed with cold water and acetone, and then dried at 105 ° C. to a constant weight, and the weight of the residue was determined. The holocellulose content was calculated by the following formula, and this was defined as the cellulose content.
Cellulose content (mass%) = [residue weight (g) / amount of collected cellulose-containing raw material (g: dry raw material equivalent excluding basic compound)] × 100

(2) Calculation of the number of moles of anhydroglucose unit (AGU) The number of moles of AGU was calculated based on the following equation assuming that all the holocellulose in the cellulose-containing raw material was cellulose.
AGU moles = holocellulose weight (g) / 162

(3) Measurement of moisture content of cellulose-containing raw material An infrared moisture meter (product name “FD-610”, manufactured by Kett Science Laboratory Co., Ltd.) was used to measure the moisture content of the cellulose-containing raw material. The measurement was performed at 150 ° C., and the point at which the rate of change in weight for 30 seconds was 0.1% or less was taken as the end point of the measurement. The value of the measured water content was converted to mass% with respect to the dry weight of the cellulose-containing raw material.

(4) Measurement of Reducing Sugar Amount and Saccharification Rate In Examples and Comparative Examples, saccharides were quantified by the following procedure based on the DNS method (“Biochemical Experimental Method, Quantitative Method for Reducing Sugar” published by the Japan Society for Science and Technology).
After completion of the saccharification treatment in step (2), the precipitate and the supernatant were separated by centrifugation. Add an appropriate amount of the supernatant to 1 mL of DNS solution (0.5% -3,5-dinitrosalicylic acid, 30% -potassium sodium tartrate tetrahydrate, 1.6% -sodium hydroxide), and continue at 100 ° C. for 5 minutes. Coloring was performed with a wavelength of 535 nm after coloring by heating and cooling. From the calibration curve using glucose as the standard sugar, the amount of reducing sugar in the supernatant was quantified.
From the value of the amount of reducing sugar obtained, the saccharification rate and the amount of reducing sugar produced when 1 g of the cellulose-containing pulverized product was saccharified were determined. The saccharification rate was calculated by the following formula.
Saccharification rate (%) = reducing sugar concentration in the supernatant (g / ml) / (cellulose-containing ground product concentration (g / ml (in terms of dry raw material excluding basic compounds)) × holocellulose content (g / g-cellulose-containing raw material) /0.9 (molecular weight of glucose / molecular weight of AGU)) × 100

(5) Determination of glucose and xylose production by HPLC Composition analysis of the sugar produced by the method of the present invention was carried out by the following method to determine glucose production and xylose production (Examples 14 to 30 and Comparative Example 6). ).
Dionex DX500 chromatography system; column: CarboPac PA1 (Dionex, trade name, 4 × 250 mm), detector: ED40 pulsed amperometry detector, eluent: solution A; 100 mM sodium hydroxide solution, B Solution: 100 mM sodium hydroxide solution containing 1 M sodium acetate, solution C; ultrapure water was used. From the injection, sugars were analyzed with a linear gradient of 10% initial concentration A solution: 90% C solution, 0 to 15 minutes, A solution 95%: B solution 5%. 0.01% (w / v) glucose as standard (Wako Pure Chemical Industries, Ltd.), xylose (Wako Pure Chemical Industries, Ltd.), xylobiose (Wako Pure Chemical Industries, Ltd.), cellobiose (Seikagaku Corporation) Used).

(6) Protein quantification Using a DC protein assay kit (manufactured by Bio Rad), the protein amount was calculated from a calibration curve using bovine serum albumin as a standard protein.

(7) Measurement of polymer weight average molecular weight The polymer weight average molecular weight (Mw) was determined by gel permeation chromatography (GPC) using the L-6000 type high performance liquid chromatograph manufactured by Hitachi, Ltd. under the following conditions. Was measured as the molecular weight in terms of polyethylene glycol.
<GPC measurement conditions>
Column: Asahipak GS-220HQ (Showa Denko KK, exclusion limit molecular weight 3,000) and Asahipak GS-620HQ (Showa Denko KK, exclusion limit molecular weight 2 million) are connected, column temperature: 30 ° C.
Developing solvent: 0.4 mol / l-sodium chloride aqueous solution Sample concentration: 0.5 g / 100 ml, Sample injection amount: 20 μl, Flow rate: 1.0 ml / min Detector: Differential refractometer (manufactured by Showa Denko KK; Shodex RISE- 61)

Example 1-1
(Drying process)
Bagasse [sugarcane pomace, holocellulose content 71.3 mass%, crystallinity 29%, moisture content 7.0 mass%] reduced pressure dryer (trade name “VO-320” manufactured by Advantech Toyo Co., Ltd.) And dried under reduced pressure for 2 hours under nitrogen flow to obtain a dry bagasse having a holocellulose content of 71.3 mass%, a crystallinity of 29%, and a moisture content of 2.0 mass%.
(Process (1))
100 g of the dried bagasse obtained and 4.4 g of granular sodium hydroxide having a particle size of 0.7 mm (trade name “Tosoh Pearl” manufactured by Tosoh Corporation) equivalent to 0.25 mol per mol of AGU constituting holocellulose ), Batch type vibration mill (Chuo Kako Co., Ltd., trade name “MB-1”: container total volume 3.5 L, φ30 mm as medium, length 218 mm, 13 SUS304 rods with a circular cross-sectional shape are used. , Rod filling rate 57%) and pulverized for 1 hour to obtain a cellulose-containing pulverized product.
(Neutralization process)
150 mg of the cellulose-containing pulverized product obtained in the step (1) (converted to a dry raw material excluding basic compounds, the same applies hereinafter) is put into a screw tube with a lid (No. 5, φ27 × 55 mm, manufactured by Maruemu Co., Ltd.). Neutralized with 1N HCl.
Further, water and 0.3 ml of 100 mM acetate buffer were added to make a 3 ml scale, and the pH was adjusted to 5.0.
(Process (2))
The amount of enzyme protein is 1.5 mg (enzyme use amount: 10 mg / g-cellulose-containing raw material) relative to the neutralized cellulose-containing pulverized product (corresponding to 150 mg in terms of dry raw material excluding basic compounds, the same applies hereinafter) Cellulase enzyme preparation Cellic CTec2 (manufactured by Novozymes, trade name) was added, and saccharification was performed at 50 ° C. for 24 hours while stirring. The cellulose-containing raw material concentration in the solution in the saccharification treatment in the step (2) was 5% by mass.
After completion of the reaction, the precipitate and the supernatant liquid were separated by centrifugation, and the amount of reducing sugar released in the supernatant liquid was quantified by the above-mentioned DNS method to produce a saccharification rate and 1 g of cellulose-containing pulverized material. The amount of reducing sugar was determined. The results are shown in Table 1.

Example 1-2
Sugar was produced in the same manner as in Example 1-1 except that water was added during the pulverization process in step (1) and the amount of water with respect to the dry bagasse was 10% by mass. The results are shown in Table 1.

Example 1-3
Sugar was produced in the same manner as in Example 1-1, except that water was added during the pulverization process in step (1) and the amount of water with respect to the dry bagasse was 20% by mass. The results are shown in Table 1.

Example 1-4
Sugar was produced in the same manner as in Example 1-1, except that water was added during the pulverization process in step (1), and the amount of water with respect to the dry bagasse was 30% by mass. The results are shown in Table 1.

Comparative Example 1-1
A sugar was produced in the same manner as in Example 1-1, except that the step (1) was performed without adding the basic compound and the neutralization step was not performed. The results are shown in Table 1.

Comparative Example 1-2
Sugar was produced in the same manner as in Example 1-1, except that water was added during the pulverization treatment in step (1) and the amount of water with respect to the dry bagasse was 50% by mass. The results are shown in Table 1.

Example 1-5
Example 1 except that the amount of sodium hydroxide, which is a basic compound, was 4.4 g (equivalent to 0.25 mol with respect to 1 mol of AGU constituting holocellulose), and the pulverization time was 2 hours. Sugar was produced in the same manner as in 1. The results are shown in Table 2.

Example 1-6
The amount of sugar was determined in the same manner as in Example 1-5 except that the amount of sodium hydroxide, which is a basic compound, was 8.8 g (corresponding to 0.5 mol corresponding to 1 mol of AGU constituting holocellulose). Manufactured. The results are shown in Table 2.

Example 1-7
The amount of sugar was determined in the same manner as in Example 1-5, except that the amount of sodium hydroxide, which is a basic compound, was 17.6 g (equivalent to 1.0 mol per 1 mol of AGU constituting holocellulose). Manufactured. The results are shown in Table 2.

Example 1-8
Except that 24.7 g of potassium hydroxide was used as the basic compound instead of sodium hydroxide (equivalent to 1.0 mol relative to 1 mol of AGU constituting holocellulose), the same method as in Example 1-7 was used. Sugar was produced. The results are shown in Table 2.

Example 1-9
Palm empty fruit bunch (EFB) is used as the cellulose-containing raw material instead of bagasse, and the amount of sodium hydroxide, which is a basic compound, is 15.2 g (equivalent to 1.0 mol with respect to 1 mol of AGU constituting holocellulose). Except for the above, sugar was produced in the same manner as in Example 1-7. The results are shown in Table 2.

Example 1-10
Using oil palm (stem) instead of bagasse as the cellulose-containing raw material, the amount of sodium hydroxide used as the basic compound was 14.0 g (1.0 mol equivalent to 1 mol of AGU constituting holocellulose). Except for the above, sugar was produced in the same manner as in Example 1-7. The results are shown in Table 2.

Example 1-11
A sugar was produced in the same manner as in Example 1-7, except that Celcrust 1.5L (trade name, manufactured by Novozymes) was used instead of Cellic CTec2. The results are shown in Table 2.

Example 1-12
Sugar was produced in the same manner as in Example 1-7, except that acetic acid was used instead of hydrochloric acid (1N-HCl) in the neutralization step. The results are shown in Table 2.

Example 1-13
A sugar was produced in the same manner as in Example 1-7, except that the neutralization step and the washing step were performed as follows. The results are shown in Table 2.
(Neutralization process and washing process)
The cellulose-containing pulverized product obtained in the step (1) was added to an acetic acid aqueous solution and neutralized by stirring (neutralization step). This was placed in a centrifuge tube (IWAKI, 50 ml, 29 mm × 115 mm), centrifuged, and washed with ion exchange water three or more times until the generated salt was removed (washing step). The sample after washing (150 mg in terms of dry raw material) is put into a screw tube with a lid (manufactured by Maruemu Co., Ltd., No. 5, φ27 × 55 mm), and water and 0.3 ml of 100 mM acetate buffer are added to adjust the pH. Was adjusted to 5.0.

Comparative Example 1-3
A sugar was produced in the same manner as in Example 1-9, except that the step (1) was performed without adding the basic compound and the neutralization step was not performed. The results are shown in Table 2.

Comparative Example 1-4
A sugar was produced in the same manner as in Example 1-10, except that the step (1) was performed without adding the basic compound and the neutralization step was not performed. The results are shown in Table 2.

Comparative Example 1-5
A sugar was produced in the same manner as in Example 1-11 except that the step (1) was performed without adding the basic compound and the neutralization step was not performed. The results are shown in Table 2.

From Tables 1 and 2, the sugar production method of the present invention was carried out in Comparative Example 1-1 and Comparative Examples 1-3 to 1-5, which did not use a basic compound in Step (1), and in Step (1). It can be seen that the saccharification rate of cellulose is improved as compared with Comparative Example 1-2 having a large amount of water, and the productivity is excellent because the amount of reducing sugar produced is improved.

Examples 1-14 to 1-22
As the enzyme, the amount shown in Table 3 (enzyme use amount: 3 mg / g-cellulose-containing raw material) Cellcrust 1.5L (manufactured by Novozymes, trade name) and heterologous expression endoglucanase I (heterologous expression EGI) were used. Except for the above, sugar was produced in the same manner as in Example 1-6. The results are shown in Table 3. As will be described later, the content ratio of 1.5 g of endoglucanase in the cell crust was 9% by mass (EGI: 4% by mass, EGII: 5% by mass).

Comparative Example 1-6
A sugar was produced in the same manner as in Example 1-14, except that the step (1) was performed without adding the basic compound and the neutralization step was not performed. The results are shown in Table 3.
The various proteins used in Examples 1-14 to 1-22 and Comparative Example 1-6 were obtained by purification and preparation as follows. Moreover, in the following description, unless otherwise indicated, the reagent manufactured by Wako Pure Chemical Industries, Ltd. was used.

<Confirmation of purified or prepared enzyme>
Cellobiohydrolase I (CBHI), endoglucanase I (EGI), endoglucanase II (EGII), cellobiohydrolase II (CBHII) and heterologous expression EGI purified from 1.5 C of cell crust are UniProtKB / Swiss-Prot. (Http://au.expasy.org/sprot/) respective enzymes (Endoglucanase EG-1 (P07981), EG2: Endoglucanase EG-II (P07982), CBH1: Exoglucanase 1 (P62694), CBH2: Exoglucanase 2 (P07987)) and confirmed by comparison with the partial amino acid sequence.

(I) Purification of cellobiohydrolase I (CBHI) The following operation was performed at 10 ° C. or lower. Cell crust 1.5L (manufactured by Novozymes, trade name) was diluted 2-fold with deionized water, and then 10 mM acetate buffer (pH 5.) using a desalting column Econo-Pac 10DG column (Bio Rad). Substitution was made to 0). 100 mL of the obtained enzyme solution was subjected to an anion exchanger (a) SuperQ Toyopearl 650M (φ2.5 cm × 25 cm, manufactured by Tosoh Corporation, trade name) previously equilibrated with 10 mM acetate buffer (pH 5.0). After washing the column with 250 mL of the same buffer, linear concentration gradient elution was performed with 2000 mL of 0 to 0.3 M sodium chloride.
The adsorbed fraction adsorbed on the anion exchanger (a) was concentrated to 19 mL with an ultrafiltration membrane PBCC (fraction molecular weight: 5000, manufactured by Millipore, trade name). 3 mL of the concentrated adsorption fraction was subjected to gel filtration using Sephacryl S200HR (φ2.5 cm × 100 cm, manufactured by GE Science, trade name). For the eluted fraction, the pass fraction that was confirmed to be almost single by SDS-polyacrylamide gel electrophoresis (hereinafter also referred to as “SDS-PAGE”) was concentrated using an ultrafiltration membrane, and desalted. The column was replaced with 10 mM citrate buffer (pH 5.0) to obtain cellobiohydrolase I (CBHI).

(Ii) Purification of endoglucanase I (EGI) The path fraction that passed through the anion exchanger (a) was concentrated to 50 mL using the ultrafiltration membrane described above, followed by 10 mM acetate buffer (pH 5. The cation exchanger (b) SP Toyopearl 650M (φ2.5 cm × 26 cm, manufactured by Tosoh Corporation, trade name) equilibrated in 0) was used. After washing the inside of the column with 300 mL of the same buffer, linear concentration gradient elution was performed with 1500 mL of 0 to 0.3 M sodium chloride.
The pass fraction passed through the cation exchanger (b) was concentrated using the ultrafiltration membrane described above, and then replaced with 20 mM Tris hydrochloride buffer (pH 7.8) using a desalting column. Anion exchanger (c) SuperQ Toyopearl 650M (φ2.5 cm × 25 cm, trade name, manufactured by Tosoh Corporation) equilibrated with 40 mL of this pass fraction in the same buffer solution, and 250 mL of the same buffer solution in the column. After washing, linear gradient elution with 2000 mL of 0-0.3M sodium chloride was performed.
The adsorbed fractions adsorbed on the anion exchanger (c) were pooled and concentrated to 12 mL using the ultrafiltration membrane described above. 12 mL of the concentrated adsorption fraction was subjected to gel filtration using Sephacryl S200HR (φ2.5 cm × 100 cm, trade name, manufactured by GE Science). For the eluted fraction, the fraction that was confirmed to be almost single by SDS-PAGE was concentrated using the ultrafiltration membrane described above, and 10 mM citrate buffer (pH 5.0) in the desalting column. To obtain endoglucanase I (EGI).

(Iii) Purification of endoglucanase II (EGII) The pass fraction passed through the anion exchange column (c) is concentrated on the ultrafiltration membrane described above, and then 10 mM acetate buffer (pH 4. Replaced with 5). 16 mL of this pass fraction was subjected to a cation exchanger (d) SP Toyopearl 650M (φ2.5 cm × 26 cm, manufactured by Tosoh Corporation, trade name) equilibrated with the same buffer, and the column was added with 300 mL of the same buffer. After washing the interior, linear concentration gradient elution was performed with 1000 mL of 0 to 0.1 M sodium chloride. For the eluted fraction, the pass fraction that was confirmed to be almost single by SDS-PAGE was concentrated using the ultrafiltration membrane described above, and 10 mM citrate buffer (pH 5.0) was applied to the desalting column. ) To obtain endoglucanase II (EGII).

(Iv) Purification of cellobiohydrolase II (CBHII) The adsorbed fraction adsorbed on the cation exchange column (d) is concentrated on the ultrafiltration membrane described above, and 10 mM citrate buffer solution on the desalting column. (PH 5.0) to obtain cellobiohydrolase II (CBHII).

CBHI was 70% by mass, CBHII was 11% by mass, EGI was 4% by mass, and EGII was 5% by mass in the total protein amount of the above-mentioned Celcrust 1.5L.

(V) Preparation of heterologous expression endoglucanase I (heterologous expression EGI) The heterologous expression EGI was prepared by the following procedure.
(Synthesis of Trichoderma reesei cDNA)
Trichoderma reesei QM9414 (NBRC31329) was cultured on a PDA agar medium at 28 ° C. for 7 days to sufficiently form spores. One platinum ear of the spore was placed in a liquid medium [0.50% (w / v) KC floc (trade name, manufactured by Nippon Paper Chemical Co., Ltd.), 0.14% (w / v) ammonium sulfate, 0.03% ( w / v) urea, 0.25 (w / v) polypeptone S (trade name, manufactured by Nippon Pharmaceutical Co., Ltd.), 0.20 (w / v) monopotassium phosphate, 0.03% (w / v) chloride Calcium dihydrate, 0.03% (w / v) magnesium sulfate heptahydrate, 5.0 ppm iron sulfide heptahydrate, 1.6 ppm manganese sulfate pentapentahydrate, 1.6 ppm sulfuric acid Zinc heptahydrate, 2.0 ppm cobalt chloride hexahydrate] was inoculated into a 500 mL pleated Erlenmeyer flask containing 50 mL, and cultured with shaking at 28 ° C. and 160 rpm for 6 days.
After completion of the culture, total RNA was isolated from the cells obtained by centrifugation (3,000 rpm, 4 ° C., 15 minutes) using TRIzol (registered trademark) Reagent (manufactured by Invitrogen) according to the protocol. Trichoderma reesei cDNA was synthesized from the obtained total RNA according to a protocol using cDNA Synthesis Kit (M-MLV Version) (manufactured by Takara Bio Inc.).

[Acquisition of EGI gene fragment]
Primers designed based on the endoglucanase I gene sequence of T. reesei (Taxonomy ID: 51453) published in the swissprot database using the obtained cDNA as a template [forward primer (SEQ ID NO: 1: atggcgccctcagttacactgccg), reverse primer ( PCR was performed using SEQ ID NO: 2: ttaaaggcattgcgagtagtagtcgtt)].
Specifically, 0.5 μL of template cDNA, 0.5 μL of 50 μM forward primer, 0.5 μL of 50 μM reverse primer, 25 μL of PrimeSTAR (registered trademark) Max DNA Polymerase (manufactured by Takara Bio Inc.), and 23.5 μL of sterile deionized water are mixed. After that, PCR was performed with DNA Engine PTC-200 (manufactured by MJ Japan). PCR conditions were 98 ° C for 10 seconds, 55 ° C for 5 seconds, 72 ° C for 8 seconds for 30 cycles, and the amplified gene fragment was purified with High Pure PCR Product Purification kit (Roche). did.

[Linkage of EGI gene with amyB promoter and terminator]
A forward primer (SEQ ID NO: 3: gtgaattcgagctcggtaccattacgcactacccgaatcg) designed based on the amyB promoter region using the obtained EGI gene and the PCR fragments derived from the A. oryzae-derived α-amylase gene (amyB) -derived promoter and terminator regions as template DNA PCR was performed using a reverse primer (SEQ ID NO: 4: tgattacgccaagcttgagttgtacctagaggagac) designed based on the amyB terminator region.
Specifically, each PCR fragment 3.0 μL, 50 μM forward primer 0.4 μL, 50 μM reverse primer 0.4 μL, PrimeSTAR (registered trademark) Max DNA Polymerase (manufactured by Takara Bio Inc.) 25 μL, sterile deionized water 15.2 μL After mixing, PCR was performed with GeneAmp PCR System 9700 (manufactured by PE Applied Biosystems). PCR conditions were 98 ° C for 10 seconds, 55 ° C for 5 seconds, and 72 ° C for 20 seconds for 30 cycles, and the amplified gene fragment was purified with High Pure PCR Product Purification kit (Roche). did.

[Plasmid construction and mass preparation]
Hind III and Kpn I were added to a solution containing the pPTRI vector (Takara Bio Inc.), and a restriction enzyme reaction was performed overnight at 37 ° C. After inactivating the restriction enzyme at 70 ° C. for 15 minutes, purification was performed with a High Pure PCR Product Purification kit (Roche). The linearized pPTRI vector was mixed with 3 times the ligated EGI fragment (molar ratio) and mixed, and the In-fusion reaction (37 ° C) was performed using In-Fusion ™ Advantage PCR Cloning Kit (Clontech). For 15 minutes and at 50 ° C. for 15 minutes). 40 μL of TE buffer (pH 8.0) was added to the reaction end solution (total amount: 10 μL). The mixture was transformed by adding 50 μL of E. coli competent cell DH5α strain (manufactured by Toyobo Co., Ltd.) to 3 μL of this mixed solution, smeared on LB agar medium (containing 100 ppm ampicillin) supplemented with X-gal and IPTG, and then 37 Culturing was performed at 0 ° C. for 18 hours. Among the grown colonies, white colonies were picked and plasmid insert check was performed by colony direct PCR using Quick Taq ™ HS DyeMix (manufactured by Toyobo Co., Ltd.). A transformed colony in which a band of the target insert size was confirmed by agarose electrophoresis analysis was inoculated into an LB liquid medium containing 100 ppm ampicillin, and cultured overnight (37 ° C., 120 rpm) using a Sakaguchi flask. It was. The culture solution was centrifuged (6000 × g, 4 ° C., 15 minutes) to recover the bacterial cells, and then the plasmid was extracted and purified using QIAfilter Plasmid Midi Kit (manufactured by QIAGEN).

[Transformation of A. oryzae]
As a transformation host, an A. oryzae RIB40 strain (official name: Aspergillus oryzae (Ahlburg) Cohn var brunneus Murakami) purchased from NITE (NBRC100959) was used. This strain was cultured on a PDA agar plate medium at 25 ° C. for 7 days and then subcultured on a PDA slant medium at 25 ° C. for 7 days. The strain was refrigerated and used as a host for transformation. Using the A. oryzae RIB40 strain as a host, transformation with the constructed plasmid was carried out, and the cells were cultured at 30 ° C. for 7 days using a regeneration CD agar medium containing 0.2 ppm pyrithiamine. The transformed colonies that had grown on the CD agar medium were subcultured twice on a CD agar medium at 30 ° C. for 7 days.

[Liquid culture of A. oryzae transformed strain]
A. oryzae transformed strain was inoculated on a CD agar medium with a platinum loop and cultured at 30 ° C. for 5-7 days, and then a spore suspension was prepared. After measuring the spore concentration using a hematometer (Thoma hemocytometer), about 5 × 10 ⁵ spores were added to 50 mL of liquid medium [5% (w / v) Polypeptone S (manufactured by Nippon Pharmaceutical Co., Ltd.), 2.5% (w / v) yeast extract (Difco), 0.5% (w / v) monopotassium phosphate, 0.05% (w / v) magnesium sulfate heptahydrate, 10% (W / v) maltose] and inoculated for about 5 days at a culture temperature of 30 ° C. and a rotation speed of 150 rpm using a flask with a 500 mL baffle. In this manner, a culture solution for 700 mL was finally prepared.

[Purification of heterologous EGI from culture medium]
Filter (pore size 0.45 μm, manufactured by NALGENE) 700 mL of the filtered culture solution was concentrated to 200 mL with a flat membrane (Polyethersulfone, 76 mm, 30,000 cutoff, manufactured by Millipore). Further, centrifugal filter Amicon Ultra (30,000 cutoff, manufactured by Millipore) The product was concentrated to 15 mL. 15 mL of this concentrated solution was replaced with 10 mM acetate buffer (pH 5.0) using a desalting column Econo-Pac 10DG column (manufactured by Bio Rad). 5 mL of the obtained enzyme solution was subjected to an anion exchanger DEAE-650M (φ1.46 cm × 3 cm, trade name, manufactured by Tosoh Corporation) previously equilibrated with 10 mM acetate buffer (pH 5.0), and 15 mL After washing the column with the same buffer, linear concentration gradient elution with 40 mL of 0 to 0.5 M sodium chloride was performed. The pass fraction that passed through the anion exchanger was replaced with a 10 mM citrate buffer (pH 5.0) using a desalting column to obtain heterologous expression endoglucanase I (heterologous expression EGI).

As shown in Table 3, when the blending ratio of endoglucanase in the total amount of protein in the enzyme is 10 to 90% by mass, the amount of glucose produced increases, and also produced when 1 g of cellulose-containing pulverized product is saccharified. It can be seen that the amount of reducing sugar to be improved is improved.

Examples 1-23 to 1-30
Other than the use of Cellclast 1.5L (trade name, manufactured by Novozymes) and CellicHTec (trade name, manufactured by Novozymes) in amounts shown in Table 4 (enzyme use amount: 3 mg / g-cellulose-containing raw material) as enzymes Produced a sugar in the same manner as in Example 1-6. The results are shown in Table 4.

As shown in Table 4, when the mixing ratio of xylanase in the total amount of protein in the enzyme is 2 to 75% by mass, the amount of xylose produced increases, and it is produced when 1 g of cellulose-containing pulverized material is saccharified. It can be seen that the amount of reducing sugar is improved.

Example 1-31
The amount of sodium hydroxide used in step (1) was 8.8 g (corresponding to 0.5 mol per mol of AGU constituting holocellulose in the cellulose-containing raw material), and the pulverization time was 0.5 hours. Except for the above, sugar was produced in the same manner as in Example 1-1. The results are shown in Table 5.

Example 1-32
The amount of sodium hydroxide used in step (1) was 8.8 g (equivalent to 0.5 mol with respect to 1 mol of AGU constituting holocellulose in the cellulose-containing raw material), and the grinding time was 0.5 hours. Were subjected to drying treatment and step (1) in the same manner as in Example 1-1 to obtain a cellulose-containing pulverized product.
(Aging process)
150 mg of the cellulose-containing pulverized product obtained in the step (1) (converted to a dry raw material excluding basic compounds) is put into a screw tube with a lid (No. 5, φ27 × 55 mm, manufactured by Maruemu Co., Ltd.), and then 1245 mg of water. Were added together and mixed, and then the screw tube with a lid was sealed, and allowed to stand at 100 ° C. for 2 hours for aging. The amount of water during the aging step was 830% by mass relative to the cellulose-containing pulverized product (in terms of dry raw material excluding basic compounds).
(Neutralization process)
The mixture after the aging step was neutralized with 1N HCl.
Further, 0.3 ml of 100 mM acetate buffer was added to make a 3 ml scale, and the pH was adjusted to 5.0.
(Process (2))
The amount of enzyme protein is 1.5 mg (enzyme use amount: 10 mg / g-cellulose-containing raw material) with respect to the neutralized cellulose-containing pulverized product (equivalent to 150 mg in terms of dry raw material excluding basic compounds). Cellulase enzyme preparation Cellic CTec2 (manufactured by Novozymes, trade name) was added, and saccharification treatment was performed at 50 ° C. for 24 hours while stirring. The cellulose-containing raw material concentration in the solution in the saccharification treatment in the step (2) was 5% by mass.
After completion of the reaction, the precipitate and the supernatant liquid are separated by centrifugation, and the amount of reducing sugar released in the supernatant liquid is quantified by the above-mentioned DNS method to produce saccharification rate and 1 g of cellulose-containing pulverized product. The amount of reducing sugar was determined. The results are shown in Table 5.

Example 1-33
Sugar was produced in the same manner as in Example 1-32, except that the amount of water added in the aging step was 2490 mg and the amount of water in the aging step was 1660% by mass with respect to the pulverized cellulose-containing product. The results are shown in Table 5.

Example 1-34
Drying and step (1) were performed in the same manner as in Example 1-32. In addition, the amount of water added in the aging step was 4980 mg, the amount of water in the aging step was 3320% by mass with respect to the cellulose-containing pulverized product, and the aging step was performed at 100 ° C. for 2 hours. It was opened to release the sealed state, and excess water was evaporated so that the concentration of the cellulose-containing raw material was 5% by mass.
After the aging step, the neutralization step and step (2) were carried out in the same manner as in Example 1-32 to produce sugar. The cellulose-containing raw material concentration in the solution in the step (2) was 5% by mass. The results are shown in Table 5.

Example 1-35
In the neutralization step, the production of sugar was carried out in the same manner as in Example 1-31, except that 600 mg of the cellulose-containing pulverized product obtained in step (1) (converted into a dry raw material excluding the basic compound) was used. went. The cellulose-containing raw material concentration in the solution in the step (2) was 20% by mass. The results are shown in Table 5.

Example 1-36
In the aging step, 600 mg of the cellulose-containing pulverized product obtained in the step (1) (converted to a dry raw material excluding the basic compound) is used, the amount of water added is 850 mg, and the moisture content during the aging step is determined as the cellulose-containing pulverized product. The sugar was produced in the same manner as in Example 1-32, except that the content was 142% by mass. The cellulose-containing raw material concentration in the solution in the step (2) was 20% by mass. The results are shown in Table 5.

Example 1-37
Sugar was produced in the same manner as in Example 1-36, except that the amount of water added in the ripening step was 1700 mg and the amount of water in the ripening step was 283 mass% with respect to the pulverized cellulose-containing product. The results are shown in Table 5.

Example 1-38
Sugar was produced in the same manner as in Example 1-36, except that the amount of water added in the ripening step was 3400 mg, and the amount of water in the ripening step was 567 mass% with respect to the pulverized cellulose-containing product. The results are shown in Table 5.

Comparative Example 1-7
A sugar was produced in the same manner as in Comparative Example 1-1 except that the pulverization time in the step (1) was 0.5 hour. The results are shown in Table 5.

Comparative Example 1-8
A sugar was produced in the same manner as in Example 1-35, except that the step (1) was performed without adding the basic compound and the neutralization step was not performed. The results are shown in Table 5.

Examples 1-39 to 1-49
Sugar was produced in the same manner as in Example 1-37, except that the temperature and time in the aging step were changed as shown in Table 6. The results are shown in Table 6.

From Tables 5 and 6, the sugar production method of the present invention further improves the saccharification rate of cellulose by performing the aging step, and also improves the yield because the yield of the resulting sugar is improved. Recognize.

Example 2-1
(Drying process)
Bagasse [sugarcane pomace, holocellulose content 71.3 mass%, crystallinity 29%, moisture content 7.0 mass%] reduced pressure dryer (trade name “VO-320” manufactured by Advantech Toyo Co., Ltd.) And dried under reduced pressure for 2 hours under nitrogen flow to obtain a dry bagasse having a holocellulose content of 71.3 mass%, a crystallinity of 29%, and a moisture content of 2.0 mass%.
(Process (1))
100 g of the dried bagasse obtained and 4.4 g of granular sodium hydroxide having a particle size of 0.7 mm (trade name “Tosoh Pearl” manufactured by Tosoh Corporation) equivalent to 0.25 mol per mol of AGU constituting holocellulose ) And a 27% aqueous solution of lauryltrimethylammonium chloride, a nitrogen-containing compound (trade name “Cotamine 24P”, manufactured by Kao Corporation), 4.30 g (effective content: 1.16 g, nitrogen relative to 1 mol of AGU constituting holocellulose) Batch type vibration mill (Chuo Kako Co., Ltd., trade name “MB-1”: total volume 3.5 L, rod 30 mm, length 218 mm, cross-sectional shape) Was put into 13 circular rods made of SUS304 (rod filling rate 57%) and pulverized for 1 hour to obtain a pulverized cellulose product.
(Neutralization process)
150 mg of the pulverized cellulose obtained in step (1) (converted into dry raw materials excluding basic compounds and nitrogen-containing compounds) was put into a screw tube with a lid (No. 5, φ27 × 55 mm, manufactured by Maruemu Co., Ltd.). Neutralized with 1N HCl.
Further, water and 0.3 ml of 100 mM acetate buffer were added to make 3 ml, and the pH was adjusted to 5.0.
(Process (2))
Cellulase enzyme preparation Cellic CTec2 (trade name, manufactured by Novozymes, trade name) of 7.5 μl (enzyme use amount) of the neutralized cellulose pulverized product (equivalent to 150 mg in terms of dry raw material excluding basic compounds and nitrogen-containing compounds) : 10 mg / g-cellulose-containing raw material) and saccharification was performed at 50 ° C. for 24 hours with shaking and stirring. The cellulose-containing raw material concentration in the solution in the saccharification treatment in the step (2) was 5% by mass.
After completion of the reaction, the precipitate and the supernatant liquid are separated by centrifugation, and the amount of reducing sugar released in the supernatant liquid is quantified by the above-mentioned DNS method to produce saccharification rate and 1 g of cellulose-containing pulverized product. The amount of reducing sugar was determined. The results are shown in Table 7.

Example 2-2
In step (1), 3.12 g (effective amount: 1.56 g, constituting holocellulose) of 50% aqueous solution of alkylbenzyldimethylammonium chloride as a nitrogen-containing compound (trade name “Sanisol B-50” manufactured by Kao Corporation) A sugar was produced in the same manner as in Example 2-1, except that 0.01 mol equivalent of 1 mol of AGU) was used. The results are shown in Table 7.

Example 2-3
In step (1), 0.49 g of tetramethylammonium chloride (manufactured by Wako Pure Chemical Industries, Ltd.) was used as the nitrogen-containing compound (equivalent to 0.01 mol in terms of nitrogen atom with respect to 1 mol of AGU constituting holocellulose). Except for the above, sugar was produced in the same manner as in Example 2-1. The results are shown in Table 7.

Example 2-4
In step (1), ammonium chloride (manufactured by Wako Pure Chemical Industries, Ltd.) 0.24 g (equivalent to 0.01 mol in terms of nitrogen atom with respect to 1 mol of AGU constituting holocellulose) was used as the nitrogen-containing compound. In the same manner as in Example 2-1, sugar was produced. The results are shown in Table 7.

Example 2-5
In step (1), 5.00 g (effective amount: 1) of a 28% aqueous solution of diallyldimethylammonium chloride polymer (Mw 40,000) as a nitrogen-containing compound (product name “PAS-H-5L”, manufactured by Nitto Bo Medical Co., Ltd.) A sugar was produced in the same manner as in Example 2-1, except that .40 g was used in an amount equivalent to 0.02 mol in terms of nitrogen atom with respect to 1 mol of AGU constituting holocellulose. The results are shown in Table 7.

Example 2-6
In the step (1), 5.00 g of a 20% aqueous solution of diallylamine hydrochloride / sulfur dioxide copolymer (Mw 5,000) as a nitrogen-containing compound (trade name “PAS-92S” manufactured by Nitto Bo Medical Co., Ltd.) A sugar was produced in the same manner as in Example 2-1, except that 1.00 g and an equivalent amount of 0.02 mol in terms of nitrogen atom per 1 mol of AGU constituting holocellulose were used. The results are shown in Table 7.

Example 2-7
A 27% aqueous solution of lauryltrimethylammonium chloride (trade name “Coatamine 24P” manufactured by Kao Corporation) was added in the step (2) instead of the step (1) in the same manner as in Example 2-1. Sugar was produced. The results are shown in Table 7.

Example 2-8
Except that a 28% aqueous solution of diallyldimethylammonium chloride polymer (Mw 40,000) (trade name “PAS-H-5L”, manufactured by Nitto Bo Medical Co., Ltd.) was added in step (2) instead of step (1). The sugar was produced in the same manner as in Example 2-5. The results are shown in Table 7.

Comparative Example 2-1
A sugar was produced in the same manner as in Example 2-1, except that the step (1) was performed without adding the basic compound and the neutralization treatment was not performed. The results are shown in Table 7.

From Table 7, the sugar production methods of Examples 2-1 to 2-8 using nitrogen-containing compounds have an improved saccharification rate of cellulose compared to Example 1-1 and Comparative Examples 1-1 and 2-1. In addition, it can be seen that the yield of the obtained sugar is improved and the productivity is excellent.

The sugar production method of the present invention is excellent in productivity and can efficiently obtain sugar from a cellulose-containing raw material. The obtained sugar is useful for the production of fermentation such as ethanol and lactic acid.

Claims (15)

1. The manufacturing method of sugar which has the following process (1) and process (2).
   Step (1): Step (2) of pulverizing the cellulose-containing raw material in the presence of a basic compound under the condition that the moisture content relative to the dry weight of the cellulose-containing raw material is 40% by mass or less to obtain a cellulose-containing pulverized product. ): A step of saccharifying the cellulose-containing pulverized product obtained in step (1) with an enzyme.
2. The method for producing sugar according to claim 1, wherein the basic compound is added in a solid state.
3. The method for producing a saccharide according to claim 1 or 2, wherein the amount of the basic compound is 0.01 to 10-fold mol with respect to the anhydroglucose unit constituting the holocellulose in the cellulose-containing raw material.
4. The method for producing a sugar according to any one of claims 1 to 3, further comprising a step of neutralizing the cellulose-containing pulverized product obtained in the step (1) with an acid before the step (2).
5. The method for producing a saccharide according to any one of claims 1 to 4, wherein the enzyme is one or more selected from cellulase and hemicellulase.
6. 6. The method for producing sugar according to claim 1, wherein the enzyme contains endoglucanase, and the blending ratio of the endoglucanase is 10 to 90% by mass in the total amount of protein in the enzyme.
7. The method for producing sugar according to any one of claims 1 to 6, wherein the enzyme contains xylanase, and the mixing ratio of the xylanase is 2 to 75% by mass in the total amount of protein in the enzyme.
8. The cellulose-containing raw material is one or more selected from pulp, paper, wood obtained from conifers or hardwoods, plant stems / leaves / fruits, and algae, according to any one of claims 1 to 7. A method for producing sugar.
9. The method for producing sugar according to any one of claims 1 to 8, wherein the basic compound is at least one selected from hydroxides, oxides and sulfides of alkali metals or alkaline earth metals.
10. Before the step (2), the cellulose-containing pulverized product obtained in the step (1) has a step of aging under the condition that the water content of the cellulose-containing pulverized product is 50 to 10,000% by mass. The method for producing a sugar according to any one of 9.
11. The method for producing sugar according to any one of claims 1 to 10, wherein the step (1) or the step (2) is performed in the presence of a nitrogen-containing compound.
12. The method for producing sugar according to claim 11, wherein step (1) is performed in the presence of a nitrogen-containing compound.
13. The method for producing sugar according to any one of claims 1 to 10, wherein the step (1) and the step (2) are carried out in the presence of a nitrogen-containing compound.
14. A nitrogen-containing compound comprising a primary to tertiary ammonium salt having an alkyl group, an inorganic ammonium salt, a quaternary ammonium salt, a polymer having an amine moiety, an addition salt of a polymer having an amine moiety and an acid, and The method for producing a saccharide according to any one of claims 11 to 13, which is at least one selected from polymers having a quaternary ammonium salt moiety.
15. The amount of the nitrogen-containing compound used is 0.001 to 1 times mol in terms of nitrogen atom with respect to the anhydroglucose unit constituting the holocellulose in the cellulose-containing raw material. Of sugar production.