WO2012007950A2 - Isolated high affinity entities with t-cell receptor like specificity towards native complexes of mhc class ii and diabetes-associated autoantigenic peptides - Google Patents
Isolated high affinity entities with t-cell receptor like specificity towards native complexes of mhc class ii and diabetes-associated autoantigenic peptides Download PDFInfo
- Publication number
- WO2012007950A2 WO2012007950A2 PCT/IL2011/000563 IL2011000563W WO2012007950A2 WO 2012007950 A2 WO2012007950 A2 WO 2012007950A2 IL 2011000563 W IL2011000563 W IL 2011000563W WO 2012007950 A2 WO2012007950 A2 WO 2012007950A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- diabetes
- isolated
- high affinity
- complex
- mhc class
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2833—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against MHC-molecules, e.g. HLA-molecules
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/575—Hormones
- C07K14/62—Insulins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6854—Immunoglobulins
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/32—Immunoglobulins specific features characterized by aspects of specificity or valency specific for a neo-epitope on a complex, e.g. antibody-antigen or ligand-receptor
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/55—Fab or Fab'
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
Definitions
- the present invention in some embodiments thereof, relates to isolated complexes of MHC class II and diabetes-associated autoantigenic peptides, isolated high affinity entities such as antibodies which specifically bind to same and, more particularly, but not exclusively, to uses thereof for diagnosing and treating type I diabetes.
- MHC class II molecules are expressed in professional antigen presenting cells (APCs) such as macrophages, dendritic cells and B cells.
- APCs professional antigen presenting cells
- Each MHC class II molecule is a heterodimer composed of two homologous subunits, alpha chain (with al and a2 domains) and beta chain (with ⁇ and ⁇ 2 domains).
- Peptides which are derived from extracellular proteins, enter the cells via endocytosis, are digested in the lysosomes and further bind to MHC class II molecules for presentation on the membrane.
- Antigen-specific activation or regulation of CD4+T cells is a multistep process in which co-ligation of the T cell receptor (TCR) with complexes of MHC II/peptide on the surface of APCs plays a central role.
- TCR T cell receptor
- MHC class II molecules with bound self peptides presented by professional APCs play a central role in activating specific CD4+ T cells involved in autoimmune diseases such as Type 1 Diabetes (T1D).
- T1D also known as juvenile diabetes
- T1D occurs when the autoimmune destruction of pancreatic beta-islet cells prevents production of the hormone insulin. This causes an inability to regulate glucose metabolism, which results in dangerously raised blood glucose concentrations.
- T cells thymus-derived lymphocytes
- IGRP islet-specific glucose-6-phosphatase catalytic subunit related peptide
- carboxypeptidase H insulinoma-associated antigen
- IA-2 insulinoma-associated antigen
- GAD65 glutamic acid decarboxylase
- carboxypeptidase E heat shock protein 60.
- T1D Genetic factors affecting susceptibility to T1D include the Insulin-Dependent Diabetes Mellitus 1 (IDDM1) gene (GenelD 7924) which is located in the MHC class II region on chromosome 6p21 and which is likely to be responsible for the histocompatibility disorder characteristic of type 1 diabetes in which pancreatic beta cells display improper antigens to T cells.
- IDDM1 Insulin-Dependent Diabetes Mellitus 1
- HLA-DR3 and/or HLA-DR4 including over-representation of the HLA-DR3/DR4 heterozygosity in diabetics as compared with non-diabetic controls.
- HLA-DQ Other non-genetic factors which might affect susceptibility to type 1 diabetes include diet, which affects gut flora, intestinal permeability, and immune function in the gut.
- Glutamate decarboxylase (GAD) enzyme in mammals exists in two isoforms- GAD 65 kDa (GAD2; GenelD 2572) and GAD 67 kDa (GAD1; GenelD 2571). While both isoforms are expressed in brain, GAD 65 kDa is also expressed in the pancreas. Importance of GAD as an islet autoantigen initially highlighted because of the high frequency of auto-antibodies in patient sera directed against this molecule. Subsequent studies led to a large accumulation of data, which support the notion that a dominant CD4+ T-cell response to GAD 65 kDa is a relevant marker for cellular autoimmunity in T1D (Nepom GT. 2003. Conversations with GAD. J Autoimmun.20: 195-8).
- GAD 5 55_5 67 peptide in the context of HLA-DR4 has been shown to be an efficiently processed immunodominant epitope in patients with type 1 diabetes and DR401 transgenic mice (Reijonen, H., et al., 2002; Patel, S. D., et al., 1997).
- DR4/GAD 555 _5 6 7 tetramer detection of autoreactive CD4+ T-cells were observed in the peripheral blood of T1D and at risk subjects but not in healthy controls (Oling, V., et al., 2005).
- an isolated complex comprising a major histocompatibility complex (MHC) class II and a type I diabetes-associated autoantigenic peptide, the isolated complex having a structural conformation which enables isolation of a high affinity entity which comprises an antigen binding domain capable of specifically binding to a native conformation of a complex composed of the MHC class II and the type I diabetes- associated autoantigenic peptide.
- MHC major histocompatibility complex
- an isolated high affinity entity comprising an antigen binding domain capable of specifically binding a complex composed of a major histocompatibility complex (MHC) class II and a type I diabetes-associated autoantigenic peptide, wherein the isolated high affinity entity does not bind to the MHC class II in an absence of the diabetes-associated autoantigenic peptide, wherein the isolated high affinity entity does not bind to the diabetes-associated autoantigenic peptide in an absence of the MHC class II.
- MHC major histocompatibility complex
- an isolated high affinity entity comprising an antigen binding domain being isolatable by the complex of some embodiments of the invention.
- an isolated high affinity entity comprising an antigen binding domain capable of specifically binding to the isolated complex of some embodiments of the invention.
- an isolated high affinity entity comprising complementarity determining regions (CDRs) set forth by SEQ ID NOs:171-173 and 177-179 (CDRs 1-3 of light and heavy chains of G3H8); or SEQ ID NOs:183-185 and 189-191 (CDRs 1-3 of light and heavy chains G1H12).
- CDRs complementarity determining regions
- a method of isolating a high affinity entity which specifically binds to a complex composed of a major histocompatibility complex (MHC) class II and a type I diabetes-associated autoantigenic peptide comprising:
- a molecule comprising the isolated high affinity entity of some embodiments of the invention, being conjugated to a detectable moiety.
- an isolated antibody comprising a multivalent form of the antibody or of the antibody fragment of some embodiments of the invention.
- a molecule comprising the isolated high affinity entity of some embodiments of the invention, being conjugated to a therapeutic moiety.
- a pharmaceutical composition comprising as an active ingredient the isolated high affinity entity of some embodiments of the invention, the molecule of some embodiments of the invention, or the antibody of some embodiments of the invention, and a pharmaceutically acceptable carrier.
- a method of detecting presentation of a type I diabetes-associated autoantigenic peptide on a cell comprising contacting the cell with the high affinity entity of some embodiments of the invention, the molecule of some embodiments of the invention, or the antibody of some embodiments of the invention, under conditions which allow immunocomplex formation, wherein a presence or a level above a predetermined threshold of the immunocomplex is indicative of presentation of the diabetes-associated autoantigenic peptide on the cell.
- a method of diagnosing type 1 diabetes (T1D) in a subject comprising contacting a cell of the subject with the high affinity entity of some embodiments of the invention, the molecule of some embodiments of the invention, or the antibody of some embodiments of the invention under conditions which allow immunocomplex formation, wherein a presence or a level above a pre-determined threshold of the immunocomplex in or on the cell is indicative of the type 1 diabetes in the subject.
- T1D type 1 diabetes
- kits for detecting presence and/or level of a complex which comprises major histocompatibility complex (MHC) class II and a type I diabetes-associated autoantigenic peptide comprising the high affinity entity of some embodiments of the invention, the molecule of some embodiments of the invention, or the antibody of some embodiments of the invention.
- MHC major histocompatibility complex
- an isolated polynucleotide comprising a first nucleic acid sequence encoding an extracellular domain of an MHC class II beta chain and a second nucleic acid sequence encoding a diabetes-associated autoantigenic peptide, wherein the second nucleic acid sequence being translationally fused upstream of the first nucleic acid sequence or between the nucleic acid sequence encoding amino acids 1-6 of the extracellular domain.
- a nucleic acid system comprising:
- composition of matter comprising the isolated complex of some embodiments of the invention and a functional moiety conjugated thereto.
- a pharmaceutical composition comprising the composition of matter of some embodiments of the invention and a therapeutically acceptable carrier.
- the high affinity entity does not bind to the MHC class II in an absence of the diabetes-associated autoantigenic peptide, wherein the isolated high affinity entity does not bind to the diabetes-associated autoantigenic peptide in an absence of the MHC class II.
- the diabetes-associated autoantigenic peptide is covalently bound at a C terminus thereof to an N-terminus of an extracellular domain of a beta chain of the MHC class II.
- the diabetes-associated autoantigenic peptide is covalently embedded between amino acids 1-6 of an extracellular domain of a beta chain of the MHC class II.
- the diabetes-associated autoantigenic peptide is flanked at a C-terminus thereof by a linker peptide.
- diabetes-associated autoantigenic peptide being translationally fused to the extracellular domain.
- the beta chain of the MHC class II comprises a first member of a binding pair which upon expression in eukaryotic cells binds to a second member of the binding pair, wherein the second member is comprised in an alpha chain of the MHC class II, wherein the beta chain and the alpha chain form the MHC class II.
- the antigen binding domain is capable of specifically binding to a native conformation of the complex composed of the MHC class II and the type I diabetes-associated autoantigenic peptide.
- the antigen binding domain of the isolated high affinity entity is capable of specifically binding to a native conformation of a complex composed of the MHC class II and the type I diabetes- associated autoantigenic peptide.
- the antigen binding domain of the isolated high affinity entity is further capable of specifically binding to the isolated complex of some embodiments of the invention.
- the high affinity entity further specifically binds to a native conformation of the complex of the MHC class II and the type I diabetes-associated autoantigenic peptide.
- the native conformation comprises the structural conformation of the complex of the type I diabetes-associated autoantigenic peptide and the MHC class II when presented on an antigen presenting cell (APC).
- APC antigen presenting cell
- the high affinity entity is selected from the group consisting of an antibody, an antibody fragment, a phage displaying an antibody, a peptibody, a bacteria displaying an antibody, a yeast displaying an antibody, and a ribosome displaying an antibody.
- the high affinity entity is an antibody or an antibody fragment.
- the diabetes-associated autoantigenic peptide is derived from a polypeptide selected from the group consisting of preproinsulin (SEQ ID NO:213), proinsulin (SEQ ID NO:223), Glutamic acid decarboxylase (GAD (SEQ ID NO:214), Insulinoma Associated protein 2 (IA-2; SEQ ID NO:215), ⁇ -2 ⁇ (SEQ ID NO:221), Islet-specific Glucose-6-phosphatase catalytic subunit-Related Protein (IGRP isoform 1 (SEQ ID NO:216), and Islet-specific Glucose- 6-phosphatase catalytic subunit-Related Protein (IGRP isoform 2 (SEQ ID NO:217), chromogranin A (ChgA) (SEQ ID NO:218), Zinc Transporter 8 (ZnT8 (SEQ ID NO:219), Heat Shock Protein-60 (HSP-60; SEQ ID NO:220), Heat S
- the diabetes-associated autoantigenic peptide comprises the amino acid sequence selected from the group consisting of SEQ ID NOs:l-157 and no more than 30 amino acids in length.
- the diabetes-associated autoantigenic peptide is selected from the group consisting of SEQ ID NOs: 1-157, 260, and 267-268.
- the diabetes-associated autoantigenic peptide is a Glutamic acid decarboxylase (GAD) autoantigenic peptide.
- GID Glutamic acid decarboxylase
- the GAD autoantigenic peptide comprises a core amino acid sequence set forth by SEQ ID NO:260 (GAD556- 565, FFRMVISNPA).
- the GAD autoantigenic peptide comprises a core amino acid sequence set forth by SEQ ID NO: 260 (GAD556- 565, FFRMVISNPA) and no more than 30 amino acids.
- the GAD autoantigenic peptide is GAD 555 - 56 7 (NFFRMVISNPAAT; SEQ ID NO: 12).
- the MHC class II is selected from the group consisting of HLA-DM, HLA-DO, HLA-DP, HLA-DQ, and HLA-DR.
- the beta chain of the MHC class II is DR-B1*0401.
- the alpha chain of the MHC class II is DR-A1*0101.
- the antigen binding domain comprises complementarity determining regions (CDRs) set forth by SEQ ID NOs: 171- 173 and 177-179 (CDRs 1-3 of light and heavy chains of G3H8); or SEQ ID NOs:183- 185 and 189-191 (CDRs 1-3 of light and heavy chains G1H12).
- CDRs complementarity determining regions
- the multivalent form is an IgG antibody.
- the high affinity entity is capable of blocking presentation of the complex comprising the MHC class II and the type I diabetes-associated autoantigenic peptide on antigen presenting cells.
- the high affinity entity is capable of killing antigen presenting cells which display the complex comprising the MHC class II and the type I diabetes-associated autoantigenic peptide.
- the kit further comprising instructions for use in diagnosing type 1 diabetes.
- the isolated polynucleotide further comprises a nucleic acid sequence encoding a linker peptide being translationally fused downstream of the second nucleic acid sequence.
- the isolated polynucleotide further comprises a third nucleic acid sequence encoding a first member of a binding pair which upon expression in eukaryotic cells binds to a second member of the binding pair.
- the second polynucleotide further comprises a fifth nucleic acid construct encoding the second member of the binding pair.
- the isolated complex does not include a heterologous immunoglobulin attached thereto.
- the functional moiety comprises an antibody or a fragment specific for a cell surface marker.
- the diabetes-associated autoantigenic peptide is covalently attached to the beta chain between the third and forth amino acids of a mature polypeptide of the MHC class II beta chain.
- Implementation of the method and/or system of embodiments of the invention can involve performing or completing selected tasks manually, automatically, or a combination thereof. Moreover, according to actual instrumentation and equipment of embodiments of the method and/or system of the invention, several selected tasks could be implemented by hardware, by software or by firmware or by a combination thereof using an operating system.
- a data processor such as a computing platform for executing a plurality of instructions.
- the data processor includes a volatile memory for storing instructions and/or data and/or a non-volatile storage, for example, a magnetic hard-disk and/or removable media, for storing instructions and/or data.
- a network connection is provided as well.
- a display and/or a user input device such as a keyboard or mouse are optionally provided as well.
- FIGs. 1A-D depict the production of recombinant DR4/GAD 55 5_5 67 complex.
- FIG. 1A A schematic presentation of the DR-A and DR-B constructs for production in S2 cells.
- Figures 1B-C SDS-PAGE analyses of purified DR4/GAD complex.
- the DR4 complex is highly purified and forms SDS-stable hetrodimer. Boiling of the sample disassociates the DR-A and DR-B chains ( Figure IB; "B" - boiled, "NB” - not boiled). High biotinylation levels were verified by incubation of purified DR4-GAD complexes with increasing concentrations of streptavidin prior to SDS-PAGE analysis ( Figure 1C). All detectable DR-A chains were biotinylated and therefore bound to the streptavidin.
- Figure ID - DR4/GAD complex is folded in the right native conformation.
- FIGs. 2A-E depict characterization of G3H8 and G1H12 TCRL Fabs directed at DR4/GAD 5 55 -567 .
- Anti-DR mAb L243 was used to determine the correct conformation and stability of the bound complexes during the binding assay.
- Figure 2D binding intensity of the Fab G3H8 antibody at various antibody's concentrations (20, 50 and 100 ⁇ g/ml).
- Figure 2E binding intensity of the Fab G3H8 to various loaded GAD 5 5 5- 56 7 peptide concentrations (0, 50, 75, 150, 300 and 400 ⁇ g/ml). Note that the binding intensity is dose-dependent on antibody's concentration ( Figure 2D) and peptide concentration ( Figure 2E).
- FIGs. 3A-F are flow cytometry analyses depicting the mapping of the recognition epitope of DR4/GAD TCRLs.
- FIGs. 4A-B are graphs depicting G3H8 Fab ability to inhibit DR4-restricted
- T cell hybridomas were Ag- specific activated by peptide-pulsed DR0401-Tg splenocytes in the presence of increasing Fab concentrations.
- Figure 4A - G2.1.38.1 hybridoma specific to the DR4/GAD 555- 5 67 epitope was inhibited in a dose-depended manner by G3H8 Fab and not by control 1F11 TCRL Fab.
- Figure 4B - Hl.13.2 hybridoma specific to the DR4/Ha 307- 3i9 epitope was not inhibited by G3H8 TCRL Fab.
- FIGs. 5A-E are photographs depicting immunofluorescence analysis using G3H8 Fab antibody demonstrating GADs5 5 .5 67 presentation by DR4 in islets of Langerhans of diabetic mice.
- Frozen sections from diabetic B7/0401 ( Figures 5A-C) and C57BL 6 ( Figures 5D-E) mice were subjected to immunostaining analysis using the G3H8 antibody followed by staining with an anti-human IgG-Alexa-488 (green) and 4',6- diamidino-2-phenylindole (DAPI; blue). Sections were visualized by Cell Observer - Zeiss Fluorescent Microscope. Note the green labeling in islets of Langerhans in B7/041 diabetic mice ( Figures 5A-C) and the absence of labeling in control C57BL/6 mice ( Figures 5D-E).
- FIGs. 6A-D depict the amino acid [Figures 6A (SEQ ID NO:158) and 6C (SEQ ID NO:158)
- FIGs. 7A-D depict the amino acid [Figures 7A (SEQ ID NO: 162) and 7C (SEQ ID NO: 162)
- CDRs (by Kabat definition) are underlined (SEQ ID NOs: 183-185 CDRs 1-3 for light chain; SEQ ID NOs: 189-191 CDRs 1-3 for heavy chain; SEQ ID NO:sl86-188 nucleic acid sequence encoding CDRs 1-3 of light chain; SEQ ID NOs: 192-194 nucleic acid sequence encoding CDRs CHI (constant 1 domain); Red letters - Connector; Purple letters - His tag; Green letters - Myc tag.
- FIGs. 8A-B depict the amino acid sequence of the recombinant beta (DRB 0401; Figure 8A) and alpha (DRA1*0101; Figure 8B) chains according to some embodiments of the invention.
- Figure 8A leader peptide - highlighted in yellow, beta chain (red), GAD-555-567 peptide (blue), linker (black and underlined), Jun dimerization domain (Green);
- Figure 8B leader peptide - highlighted in yellow, alpha chain (red), GAD-555-567 peptide (blue), linker (black and underlined), Jun dimerization domain (Green) BirA tag (purple).
- FIGs. 9A-B depict the nucleic acid sequence of the recombinant beta
- FIGs. 10A-B are histograms depicting flow cytometry analyses depicting binding of G3H8 to murine lymph node cells.
- Y-axis depicts mean fluorescence intensity of positive cells.
- X-axis depicts forward side scatter (FCS) counts.
- FIGs. 11A-C are histograms depicting the increased binding and T-cell blocking capacity of the G3H8 IgGl antibody compared to that of the G3H8 Fab.
- Figure 11A - A histogram depicting binding of Fab or IgG G3H8 antibodies to DR4+ Priess cells loaded with the GAD555-567 peptide. Note that the fully human G3H8 IgGl Ab maintains specificity to DR4/GAD and binds at much higher intensity to cells with 10- fold lower concentration compared to the Fab.
- Figure 11B - A histogram depicting blocking of GAD555-567 specific, DR4 restricted T cell response.
- the present invention in some embodiments thereof, relates to isolated complexes of MHC class II and diabetes-associated autoantigenic peptides, isolated high affinity entities such as antibodies which specifically bind to same and, more particularly, but not exclusively, to uses thereof for diagnosing and treating type I diabetes.
- the present inventors have generated MHC class II-diabetes-associated autoantigenic peptides complexes which were used for the isolation of T-cell receptor like antibodies useful for studying antigen presentation during progression of type I diabetes as well as for diagnosing and treating type I diabetes.
- the present inventors generated an isolated complex of MHC class II and a GAD5 5 5.567 antigenic peptide in which the antigenic peptide is covalently linked to the N-terminus of the MHC class II beta chain ( Figure 1A, Example 1).
- the MHC class II/GAD peptide complex was used for isolating specific soluble antibodies (e.g., Fabs) which specifically bind the MHC class II (e.g., DR4) when bound to the GAD 5 5 5-567 antigenic peptide both in vitro and in the native conformation (e.g., when presented on cells), but not to the MHC class II in the absence of the specific antigenic peptide ( Figures 2A-B).
- these antibodies were found capable of binding to cells loaded with the naturally T1D- associated epitope GAD 5 5 2- 57 2 (SEQ ED NO:203) (Figure 2C, Example 1 and data not shown); exhibit T-cell receptor like specificity at various antibody's concentrations (Figure 2D, Example 1) and various antigenic-peptide concentrations (Figure 2E, Example 1), with increasing antibody's staining in correlation with increases in the total MHC class II/antigenic peptide complexes on the cells.
- the isolated antibodies of the invention exhibit fine specificity to their targeted complex and differentially bind to complexes including a wild type peptide, but not to complexes with a mutated amino acid at position P5 of the MHC class II-GAD restricted antigenic peptide ( Figures 3A- E).
- G3H8 Fab was found to inhibit -80% response of G2.1.36.1 T cell hybridoma specific to GAD-555-567 restricted by HLA- DR*0401 ( Figure 4A) but not the HI.13.2 hybridoma response to HA307-319 peptide restricted by HLA-DR*0401 ( Figures 4B), thus demonstrating an antigen-specific blocking of autoreactive T cells response to the autoreactive GAD-epitope by G3H8 Fab.
- the G3H8 Fab specifically bound to the MHC class II-GAD 555 .5 7 complexes in islets of B7/DR4 diabetic mice ( Figures 5A-C) and in infiltrated islets of B7/DR4 pre-diabetic mice (data not shown) but not to islets of C57B6 control mice ( Figures 5D-E).
- an isolated complex comprising a major histocompatibility complex (MHC) class II and a type I diabetes-associated autoantigenic peptide.
- MHC major histocompatibility complex
- isolated refers to at least partially separated from the natural environment e.g., the human body.
- the isolated complex is soluble.
- MHC major histocompatibility complex
- H-2 human leukocyte antigen
- HLA human leukocyte antigen
- CTLs cytotoxic T-cells
- helper T-cells respond mainly against foreign class II glycoproteins.
- MHC class II molecules are expressed in professional antigen presenting cells
- MHC class II molecule such as macrophages, dendritic cells and B cells.
- Each MHC class II molecule is a heterodimer composed of two homologous subunits, alpha chain (with ccl and a2 extracellular domains, transmembrane domain and short cytoplasmic tail) and beta chain (with ⁇ and ⁇ 2 extracellular domains, transmembrane domain and short cytoplasmic tail).
- Peptides which are derived from extracellular proteins, enter the cells via endocytosis, are digested in the lysosomes and further bind to MHC class II molecules for presentation on the membrane.
- MHC class II molecules are found in humans. Examples include, but are not limited to HLA-DM, HLA-DO, HLA-DP, HLA-DQ (e.g., DQ2, DQ4, DQ5, DQ6, DQ7, DQ8, DQ9), HLA-DR (e.g., DR1, DR2, DR3, DR4, DR5, DR7, DR8, DR9, DR10, DR11, DR12, DR13, DR14, DR15, and DR16).
- HLA-DM HLA-DO
- HLA-DP HLA-DQ
- DQ DQ2, DQ4, DQ5, DQ6, DQ7, DQ8, DQ9
- HLA-DR e.g., DR1, DR2, DR3, DR4, DR5, DR7, DR8, DR9, DR10, DR11, DR12, DR13, DR14, DR15, and DR16.
- Non-limiting examples of DQ Al alleles include 0501, 0201, 0302, 0301, 0401, 0101, 0102, 0104, 0102, 0103, 0104, 0103, 0102, 0303, 0505 and 0601.
- Non-limiting examples of DO Bl alleles include 0201, 0202, 0402, 0501, 0502, 0503, 0504, 0601, 0602, 0603, 0604, 0609, 0301, 0304, 0302 and 0303.
- Non-limiting examples of DPA1 alleles include 01, e.g., 0103, 0104, 0105, 0106, 0107, 0108, 0109; 02, e.g., 0201, 0202, 0203; 03 e.g., 0301, 0302, 0303, 0401.
- Non-limiting examples of DPB1 alleles include 01, e.g., 0101, 0102; 02 e.g., 0201, 0202, 0203; 03; 04, e.g., 0401, 0402, 0403; 05, e.g., 0501, 0502; 06; 08, e.g., 0801, 0802; 09, e.g., 0901, 0902; 10, e.g., 1001, 1002; 11 e.g., 1101, 1102; 13, e.g., 1301, 1302; 14, e.g., 1401, 1402; 15, e.g., 1501, 1502; 16, e.g., 1601, 1602; 17, e.g., 1701, 1702; 18, e.g., 1801, 1802; 19, e.g., 1901, 1902; 20, e.g., 2001, 2002; 21; 22; 23; 24; 25; 26, e.g., 2601, 2602; and 27.
- Non-limiting examples of DP haplotypes include HLA-DPA1*0103/DPB1*0401 (DP401); and HLA-DPA1*0103 DPB1*0402 (DP402).
- Non-limiting examples of DR Bl alleles include 0101, 0102, 0103, 0301, 0401, 0407, 0402, 0403, 0404, 0405, 0701, 0701, 0801, 0803, 0901, 1001, 1101, 1103, 1104, 1201, 1301, 1302, 1302, 1303, 1401, 1501, 1502, 1601 alleles.
- Non-limiting examples of DR-DQ haplotypes include DR1-DQ5, DR3-DQ2, DR4-DQ7, DR4-DQ8, DR7-DQ2, DR7-DQ9, DR8-DQ4, DR8-DQ7, DR9-DQ9, DR10- DQ5, DR11-DQ7, DR12-DQ7, DR13-DQ6, DR13-DQ7, DR14-DQ5, DR15-DQ6, and DR16-DQ5.
- the beta chain of the MHC class II complex is DR-B 0401 (SEQ ID NO:212; native DR-B1*0401 molecule)
- the alpha chain of the MHC class II is DR-A 0101 (SEQ ID NO:211; native DR-A 0101 molecule).
- type I diabetes-associated autoantigenic peptide refers to an antigen derived from a self protein (i.e., an endogenous protein), which is expressed in pancreatic cells such as beta cells of the pancreas, and against which an inflammatory response is elicited as part of an autoimmune inflammatory response.
- a self protein i.e., an endogenous protein
- a type I diabetes-associated autoantigenic peptide is an MHC class II-restricted peptide, which when presented on antigen presenting cells (APCs) is recognized by specific T cells.
- APCs antigen presenting cells
- Such a presentation by APCs generates an inflammatory response that can activate and recruit T cell and B cell responses against beta cells, including the generation of cytotoxic T cells and antibodies which kill and destroy beta cells and thus lead to a decreased insulin production.
- the diabetes-associated autoantigenic peptide is a beta-cell autoantigenic peptide.
- the diabetes-associated autoantigenic peptide is derived from a polypeptide selected from the group consisting of preproinsulin (amino acids 1-110 of GenBank Accession No. NP_000198, SEQ ID NO:213), proinsulin (amino acids 25-110 of GenBank Accession No. NP_000198, SEQ ID NO:223), Glutamic acid decarboxylase (GAD, GenBank Accession No. NP_000809.1, SEQ ID NO:214), Insulinoma Associated protein 2 (IA-2, GenBank accession No.
- NP_115983 SEQ ID NO:215), ⁇ -2 ⁇ [also referred to as phogrin, GenBank Accession No. NP_570857.2 (SEQ ID NO:221), NP_570858.2 (SEQ ID NO:270), NP_002838.2 (SEQ ID NO:222)], Islet-specific ' Glucose-6-phosphatase catalytic subunit-Related Protein [IGRP; GenelD: 57818, GenBank Accession No. NP_066999.1, glucose-6-phosphatase 2 isoform 1 (SEQ ID NO:216) and GenBank Accession No.
- NP_001075155.1 glucose-6-phosphatase 2 isoform 2 (SEQ ID NO:217)] chromogranin A (GenBank Accession No. NP_001266 (SEQ ID NO:218), Zinc Transporter 8 (ZnT8 (GenBank Accession NO. NP_776250.2, SEQ ID NO:219), Heat Shock Protein-60 (GenBank Accession No. NP_955472.1; SEQ ID NO:220), and Heat Shock Protein-70 (GenBank Accession No. NP_005337.2 (SEQ ID NO:271) and NP_005336.3 (SEQ ID NO:224).
- the diabetes-associated autoantigenic peptide is a GAD derived autoantigenic peptide selected from the group consisting of SEQ ID NOs:l-45 and 260, 267-268 (Table 3, Example 5 of the Examples section).
- the diabetes-associated autoantigenic peptide is a ZnT8 derived autoantigenic peptide selected from the group consisting of SEQ ID NOs: 46-53 (Table 3, Example 5 of the Examples section).
- the diabetes-associated autoantigenic peptide is a IA-2 derived autoantigenic peptide selected from the group consisting of SEQ ID NOs: 54-115 (Table 3, Example 5 of the Examples section).
- the diabetes-associated autoantigenic peptide is a preproinsulin derived autoantigenic peptide selected from the group consisting of SEQ ID NOs:116-136 (Table 4, Example 5 of the Examples section).
- the diabetes-associated autoantigenic peptide is a HSP-60 derived autoantigenic peptide selected from the group consisting of SEQ ID NOs: 137-144 (Table 4, Example 5 of the Examples section).
- the diabetes-associated autoantigenic peptide is a HSP-70 derived autoantigenic peptide selected from the group consisting of SEQ ID NOs: 145-153 (Table 3, Example 5 of the Examples section).
- the diabetes-associated autoantigenic peptide is a IGRP derived autoantigenic peptide selected from the group consisting of SEQ ID NOs: 154-157 (Table 5, Example 5 of the Examples section).
- Type I diabetes-associated autoantigenic peptides can be found in Lieberman SM, DiLorenzo TP, 2003. A comprehensive guide to antibody and T-cell responses in type 1 diabetes.
- the length of the autoantigenic peptides according to some embodiments of the invention may vary from at least 6 amino acids, to autoantigenic peptides having at least 8, 10, 25, or up to 30 amino acids.
- the diabetes-associated autoantigenic peptide includes a core amino acids of at least 6 amino acids, e.g., at least 7, at least 8, at least 9 and more.
- the length of the diabetes- associated autoantigenic peptide does not exceed about 100 amino acids, e.g., does not exceed about 50 amino acids, e.g., does not exceed about 30 amino acids.
- the diabetes-associated autoantigenic peptide comprises the amino acid sequence selected from the group consisting of SEQ ID NOs:l-157 260, and267-268 and no more than 30 amino acids in length. According to some embodiments of the invention, the diabetes-associated autoantigenic peptide is selected from the group consisting of SEQ ID NOs: 1-157, 260, and267-268.
- the length of the diabetes- associated autoantigenic peptide includes at least 6 and no more than 30 amino acids.
- each autoantigenic peptide there are at least six amino acids constituting a core amino acid which are required for recognition with the respective MHC class II molecule.
- Identification of the core amino acids for each autoantigenic peptide can be done experimentally, e.g., by mutagenesis of the amino acids constituting the autoantigenic peptide and detection of: (i) binding to the restricted MHC class II molecules; (ii) Stimulating the restricted T cell response.
- the core amino acids are the amino acids at positions 556-565.
- the core amino acid sequence consists of anchor residues and the T-cell receptor (TCR) contact residues.
- Anchor residues in the sequence NFFRMVISNPAAT SEQ ID NO: 12
- Anchor residues in the sequence NFFRMVISNPAAT are the PI (F557), P4 (V560), P6 (S562), and P9 (A565) MHC pocket-binding residues.
- TCR contact residues in the sequence NFFRMVISNPAAT are at positions F556, R558, M559, 1561, N563. Accordingly, the core amino acids of the GAD555- 567 autoantigenic peptide are GAD556-565 (FFRMVISNPA, SEQ ID NO:260).
- the invention also concerns peptide variants whose sequences do not completely correspond with the aforementioned amino acid sequences but which only have identical or closely related "anchor positions".
- anchor position in this connection denotes an essential amino acid residue for binding to a MHC class II complex (e.g., DR1, DR2, DR3, DR4 or DQ).
- the anchor position for the DRB1*0401 binding motif are for example stated in Hammer et al., Cell 74 (1993), 197-203.
- Such anchor positions are conserved in the diabetes-associated autoantigenic peptide or are optionally replaced by amino acid residues with chemically very closely related side chains (e.g.
- the anchor position in the peptides according to some embodiments of the invention can be determined in a simple manner by testing variants of the aforementioned specific peptides for their binding ability to MHC molecules.
- Peptides according to some embodiments of the invention are characterized in that they have an essentially equivalent specificity or/and affinity of binding to MHC molecules as the aforementioned peptides.
- Homologous peptides having at least 50%, e.g., at least 60%, 70%, 80%, 90%, 95% or more identity to the diabetes-associated autoantigenic peptides described herein are also contemplated by some embodiments of the invention.
- each of the above described diabetes-associated autoantigenic peptides can be complexed with an MHC class II allele.
- MHC class II specific alleles are known in the art.
- Non-limiting examples of MHC class II alleles and their restricted autoantigenic peptides are illustrated in Table 3 in Example 5 of the Examples section which follows.
- GAD glutamic acid decarboxylase
- GAD 65 kDa which is expressed in both brain and pancreas (GenelD 2572; encoded by GenBank accession No. NM_000818.2 (SEQ ID NO: 198); NM_ 001134366.1 (SEQ ID NO:199); NP_000809.1 (SEQ ID NO:200)] and GAD 67 kDa which is expressed in brain [GenelD 2571; encoded by GenBank accession No. NM_000817.2 (SEQ ID NO:201); NP_000808.2 (SEQ ID NO:202)].
- GAD 65 kDa has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes.
- the diabetes-associated autoantigenic peptide is GAD 555 -567 (NFFRM VIS NP AAT; SEQ ID NO: 12).
- peptide encompasses native peptides (either degradation products, synthetically synthesized peptides or recombinant peptides) and peptidomimetics (typically, synthetically synthesized peptides), as well as peptoids and semipeptoids which are peptide analogs, which may have, for example, modifications rendering the peptides more stable while in a body or more capable of penetrating into cells.
- Methods for preparing peptidomimetic compounds are well known in the art and are specified, for example, in Quantitative Drug Design, C.A. Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press (1992), which is incorporated by reference as if fully set forth herein. Further details in this respect are provided hereinunder.
- Natural aromatic amino acids, Trp, Tyr and Phe, may be substituted for synthetic non-natural acid such as TIC, naphthylelanine (Nol), ring-methylated derivatives of
- the peptides of the invention may also include one or more modified amino acids or one or more non-amino acid monomers (e.g. fatty acids, complex carbohydrates etc).
- amino acid or “amino acids” is understood to include the 20 naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine and phosphothreonine; and other unusual amino acids including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine and ornithine.
- amino acid includes both D- and L-amino acids.
- the peptides of the invention are preferably utilized in a linear form, although it will be appreciated that in cases where cyclicization does not severely interfere with peptide characteristics, cyclic forms of the peptide can also be utilized.
- the peptides of the invention may include one or more non-natural or natural polar amino acids, including but not limited to serine and threonine which are capable of increasing peptide solubility due to their hydroxyl-containing side chain.
- the peptides of the invention may be synthesized by any techniques that are known to those skilled in the art of peptide synthesis.
- solid phase peptide synthesis a summary of the many techniques may be found in J. M. Stewart and J. D. Young, Solid Phase Peptide Synthesis, W. H. Freeman Co. (San Francisco), 1963 and J. Meienhofer, Hormonal Proteins and Peptides, vol. 2, p. 46, Academic Press (New York), 1973.
- For classical solution synthesis see G. Schroder and K. Lupke, The Peptides, vol. 1, Academic Press (New York), 1965. Large scale peptide synthesis is described by Andersson Biopolymers 2000;55(3):227-50.
- the isolated complex which comprises the MHC class II and the type I diabetes-associated autoantigenic peptide has a structural conformation which enables isolation of a high affinity entity which comprises an antigen binding domain capable of specifically binding to a native conformation of a complex composed of the MHC class II and the type I diabetes-associated autoantigenic peptide.
- the high affinity entity does not bind to the MHC class II in an absence of the diabetes-associated autoantigenic peptide, wherein the isolated high affinity entity does not bind to the diabetes-associated autoantigenic peptide in an absence of the MHC class II.
- MHC class II in the absence of the diabetes-associated autoantigenic peptide encompasses an empty MHC class II complex (i.e., devoid of any antigenic peptide) as well as an MHC class II complex which is bound to another antigen peptide which is not the diabetes-associated autoantigenic peptide of some embodiments of the invention, e.g., a different MHC class II-restricted antigenic peptide.
- diabetes-associated autoantigenic peptide in an absence of the MHC class II encompasses the diabetes-associated autoantigenic peptide of some embodiments of the invention when not bound to the MHC class II complex as well as to the diabetes-associated autoantigenic peptide of some embodiments of the invention when bound to another MHC class II complex, e.g., a different allele of an MHC class II beta or alpha chain than the chain(s) used for forming the complex of some embodiments of the invention.
- the isolated complex which comprises the MHC class II and the diabetes-associated autoantigenic peptide does not include an heterologous immunoglobulin (e.g., an Fc, Fab and/or a single chain Fv antibody) attached thereto (either a covalent or a non-covalent attachment to the MHC class II molecules, e.g., via the C'-terminus of the MHC class II molecules).
- an heterologous immunoglobulin e.g., an Fc, Fab and/or a single chain Fv antibody
- the isolated MHC/peptide complexes should be generated such that a correct folding of the MHC class II alpha and beta chains with the antigenic peptide occurs. It should be noted that for preparation of a recombinant complex of MHC class II and a restricted antigen peptide the extracellular domains of the alpha and beta chains are required.
- the signal peptide of the MHC class II molecules When expressed in eukaryotic cells, the signal peptide of the MHC class II molecules is cleaved post translationally, thus obtaining a mature protein. To enable correct folding of the antigenic peptide within the MHC class II molecules, the antigenic peptide should be covalently attached close to the N-terminus of the extracellular domain of the mature MHC class II beta chain.
- the structural conformation is obtainable when the diabetes-associated autoantigenic peptide is covalently conjugated or bound to the extracellular domain of the mature beta chain of the MHC class II.
- the structural conformation is obtained when the diabetes-associated autoantigenic peptide is covalently conjugated or bound to the extracellular domain of the mature beta chain of the MHC class II.
- the diabetes-associated autoantigenic peptide is covalently bound at a C terminus thereof to an N-terminus of an extracellular domain of the MHC class II.
- covalently bound refers to being part of the polypeptide chain of the mature beta chain.
- Such a covalent conjugation can be achieved by translationally fusing the coding sequence of the diabetes-associated autoantigenic peptide to the coding sequence of the extracellular domain of the beta chain MHC class II molecule.
- the diabetes-associated autoantigenic peptide is covalently embedded between amino acids 1-6 of an extracellular domain of the beta chain of the MHC class II.
- covalently embedded between refers to being covalently bound within an amino acid sequence (a polypeptide).
- the diabetes-associated autoantigenic peptide is covalently embedded between amino acids 1-2, 2-3, 3-4, 4-5, or 5-6 of the extracellular domain of the beta chain of the MHC class II.
- the diabetes-associated autoantigenic peptide can be embedded after the first, second, third, forth or fifth amino acid position of the mature extracellular domain of the beta chain of the MHC class II.
- the diabetes-associated autoantigenic peptide is covalently attached after the third amino acid of the mature MHC class II beta chain (i.e., between the third and forth amino acids of the mature MHC class II beta chain).
- the diabetes-associated autoantigenic peptide is flanked at a C-terminus thereof by a linker peptide.
- the linker peptide can be selected according to the expression system used for preparing the recombinant MHC class II-antigenic peptide.
- the linker peptide confers flexibility to the mature beta chain and enables the folding of the conjugated antigenic peptide within the peptide-binding grooves within the MHC class II molecules.
- the linker peptide comprises a site for an enzymatic cleavage of the recombinant protein. Cleavage can be done in vivo (i.e., within a living organism), ex vivo (when cell of an organism are cultured) or in vitro.
- the linker peptide may include a thrombin cleavage site.
- a linker peptide may comprise a thrombin cleavage site (e.g., the sequence LVPRGS) flanked by two sequences which increase flexibility of the recombinant protein such as GGGGS.
- a linker peptide which can be covalently conjugated to the diabetes-associated autoantigenic peptide complexes:
- the linker peptide can be translationally fused to the diabetes-associated autoantigenic peptide and to the extracellular domain of the mature beta chain MHC class II.
- the C-terminus of the diabetes-associated autoantigenic peptide is fused directly to the N-terminus of the linker peptide; and the C-terminus of the linker peptide is fused directly to the N-terminus or to an amino acid position between 1-6 of the N-terminal end of the mature beta chain extracellular domain.
- each of the extracellular domains of the alpha and beta chains comprises a member of a binding pair, which upon interaction with the other member forms a binding pair.
- Non-limiting examples of such binding pairs include the leucine-zipper dimerization domains of Jun-Fos binding pairs and the acidic (AZ) and basic (BZ) leucin zipper motives which form a stable protein complex.
- the beta chain of the MHC class II comprises a first member of a binding pair which upon expression in eukaryotic cells binds to a second member of the binding pair, wherein the second member is comprised in an alpha chain of the MHC class II, wherein the beta chain and the alpha chain form the MHC class II.
- the MHC class II complex of some embodiments of the invention was generated by expressing in a host cell (e.g., S2 cells) a polynucleotide which comprises a nucleic acid sequence encoding a diabetes-associated autoantigenic peptide (e.g., GAD peptide) which is translationally fused to a nucleic acid sequence encoding an MHC class II beta chain (e.g., DR- Bl*0401; SEQ ID NO:212) such that the encoded antigenic peptide is fused between the third and forth amino acid positions of the beta chain (of the mature extracellular domain of the beta chain).
- a host cell e.g., S2 cells
- a polynucleotide which comprises a nucleic acid sequence encoding a diabetes-associated autoantigenic peptide (e.g., GAD peptide) which is translationally fused to a nucleic acid sequence encoding an MHC class II beta chain (e.g., DR-
- translationally fused and "in frame” are interchangeably used herein to refer to polynucleotides which are covalently linked to form a single continuous open reading frame spanning the length of the coding sequences of the linked polynucleotides.
- Such polynucleotides can be covalently linked directly or preferably indirectly through a spacer or linker region.
- an isolated polynucleotide comprising a first nucleic acid sequence encoding an extracellular domain of an MHC class II beta chain [e.g., DR-B1*0401; (SEQ ID NO:264 for the amino acid sequence) and ; (SEQ ID NO:265 for the nucleic acid sequence)] and a second nucleic acid construct encoding a diabetes-associated autoantigenic peptide [e.g., GAD-peptide NFFRMVISNPAAT (SEQ ID NO: 12), AACTTCTTTCGTATGGTTATCAGCAATCCAGCTGCGACT (SEQ ID NO:266) for the nucleic acid sequence encoding the GAD-peptide], wherein the second nucleic acid construct being translationally fused upstream of the first nucleic acid construct or between the nucleic acid sequence encoding amino acids 1-6 of the extracellular domain.
- an MHC class II beta chain e.g., DR-B1*0401; (SEQ ID NO:264 for the amino
- the isolated polynucleotide further comprises a nucleic acid sequence encoding a linker peptide being translationally fused downstream of the second nucleic acid sequence.
- the first nucleic acid sequence and the second nucleic acid sequence are connected via a nucleic acid sequence encoding a linker peptide (GGGSLVPRGSGGGGS; SEQ ID NO:262).
- the isolated polynucleotide further comprises a third nucleic acid sequence encoding a first member of a binding pair [(e.g., Jun, the amino acid sequence set forth in SEQ ID NO:195 (RIARLEEKVKTLKAQNSELASTANMLREQVAQLKQKVMNH)] which upon expression in eukaryotic cells binds to a second member of the binding pair.
- the third nucleic acid sequence encoding a first member of a binding pair is translationally fused downstream of the first nucleic acid sequence encoding an MHC class II beta chain.
- the first member of binding pair (e.g., Jun amino acid sequence) is connected via a short peptide linker to the MHC class II beta chain.
- a short peptide linker is set forth in SEQ ID NO:170 (VDGGGGG).
- nucleic acid system comprising:
- MHC class II beta chain and a second nucleic acid construct encoding a diabetes- associated autoantigenic peptide, wherein the second nucleic acid construct being translationally fused upstream of the first nucleic acid construct; and a third nucleic acid sequence encoding a first member of a binding pair which upon expression in eukaryotic cells binds to a second member of the binding pair;
- a second polynucleotide which comprises a forth nucleic acid sequence encoding an MHC class II alpha chain [e.g., DR-A1*0101; amino acids 1-217 of SEQ ID NO:167 (of the recombinant molecule); and nucleic acids 1-651 of SEQ ID NO:169].
- the second polynucleotide further comprises a fifth nucleic acid sequence encoding the second member of the binding pair [e.g., Fos, the amino acid sequence set forth in SEQ ID NO: 196 (LTDTLQAETDQLEDEKSALQTEIANLLKEKEKLEFILAAH)].
- a fifth nucleic acid sequence encoding the second member of the binding pair [e.g., Fos, the amino acid sequence set forth in SEQ ID NO: 196 (LTDTLQAETDQLEDEKSALQTEIANLLKEKEKLEFILAAH)].
- the fifth nucleic acid sequence encoding the second member of the binding pair is translationally fused downstream of the forth nucleic acid sequence encoding the MHC class II alpha chain.
- the Fos amino acid sequence is connected via a short peptide linker to the MHC class II alpha chain.
- a short peptide linker is set forth in SEQ ID NO: 170 (VDGGGGG).
- the fifth nucleic acid sequence encoding the second member of the binding pair and the forth nucleic acid sequence encoding an MHC class II alpha chain are connected via a nucleic acid sequence encoding a linker peptide (e.g., VDGGGGG; SEQ ID NO:170).
- a linker peptide e.g., VDGGGGG; SEQ ID NO:170.
- Non-limiting examples of recombinant beta chain and alpha chain molecules are illustrated in Figures 8A-B and 9A-B, and exemplary sequences thereof are provided in SEQ ID NOs: 166-167 and 168-169, respectively.
- At least one molecule of the MHC class II complex (i.e., an alpha or beta chain) further comprises an in-frame tag, i.e., a nucleic acid sequence which encodes a peptide capable of being enzymatically modified to include a binding entity.
- an in-frame tag i.e., a nucleic acid sequence which encodes a peptide capable of being enzymatically modified to include a binding entity.
- a peptide can be used for site specific biotinylation using e.g., a biotin protein ligase- Bir A enzyme (AVIDITY).
- AVIDITY biotin protein ligase- Bir A enzyme
- Non-limiting examples of such tags includes the Bir A recognition sequence is set forth by SEQ ID NO: 197 (Leu Gly Gly lie Phe Glu Ala Met Lys Met Glu Leu Arg Asp).
- the Bir A recognition sequence for biotinylation is covalently conjugated at the carboxy terminal (C l ) of the recombinant alpha chain.
- an in-frame tag can be used for isolation of antibodies which specifically bind to the specific MHC-peptide complex, such as using streptavidin.
- the MHC class Il-peptide complexes forms multimers which are bound by a common binding entity.
- multimers e.g., tetramers
- MHC class Il-peptide complexes can be formed using a streptavidin which binds to the biotinylated complexes.
- an isolated high affinity entity comprising an antigen binding domain capable of specifically binding a complex composed of a major histocompatibility complex (MHC) class II and a type I diabetes-associated autoantigenic peptide, wherein the isolated high affinity entity does not bind to the MHC class II in an absence of the diabetes-associated autoantigenic peptide, wherein the isolated high affinity entity does not bind to the diabetes-associated autoantigenic peptide in an absence of the MHC class II.
- MHC major histocompatibility complex
- the antigen binding domain is capable of specifically binding to a native conformation of the complex composed of the MHC class II and the type I diabetes-associated autoantigenic peptide.
- native conformation refers to the conformation of the complex when naturally presented on cells, e.g., cells of a mammal, e.g., human cells.
- the native conformation comprises the structural conformation of the complex of the type I diabetes-associated autoantigenic peptide and the MHC class II when presented on an antigen presenting cell (APC).
- APC antigen presenting cell
- Non-limiting examples of antigen presenting cells which display or present the complex of the MHC class II and the diabetes-associated autoantigenic peptide include macrophages, dendritic cells (DCs) and B-cells.
- an isolated high affinity entity comprising an antigen binding domain, the high affinity entity being isolatable by the isolated complex of some embodiments of the invention.
- an isolated high affinity entity comprising an antigen binding domain capable of specifically binding to the isolated complex of some embodiments of the invention.
- the antigen binding domain of the isolated high affinity entity is capable of specifically binding to a native conformation of a complex composed of the MHC class II and the type I diabetes- associated autoantigenic peptide.
- the antigen binding domain of the isolated high affinity entity is further capable of specifically binding to the isolated complex of some embodiments of the invention.
- an isolated high affinity entity comprising an antigen binding domain, the antigen binding domain being capable of specifically binding:
- a complex composed of a major histocompatibility complex (MHC) class II and a type I diabetes-associated autoantigenic peptide wherein the isolated high affinity entity does not bind to the MHC class II in an absence of the diabetes-associated autoantigenic peptide, wherein the isolated high affinity entity does not bind to the diabetes-associated autoantigenic peptide in an absence of the MHC class II; and (ii) a native conformation of a complex composed of an MHC class II and a type I diabetes-associated autoantigenic peptide.
- MHC major histocompatibility complex
- an isolated high affinity entity comprising an antigen binding domain capable of specifically binding to an isolated complex comprising an MHC class II and a type I diabetes-associated autoantigenic peptide, wherein the diabetes-associated autoantigenic peptide being covalently conjugated to the amino terminal (N l ) end of a recombinant beta chain of the MHC class II.
- an isolated high affinity entity being isolatable by an isolated complex which comprises an MHC class II and a type I diabetes-associated autoantigenic peptide, wherein the diabetes-associated autoantigenic peptide being covalently conjugated at the amino terminal (N l ) end of a recombinant beta chain of the MHC class II, wherein an antigen binding domain of the isolated high affinity entity is capable of specifically binding to a native conformation of a complex composed of the MHC class II and the type I diabetes- associated autoantigenic peptide.
- an isolated high affinity entity being isolatable by an isolated complex which comprises an MHC class II and a type I diabetes-associated autoantigenic peptide, wherein the diabetes-associated autoantigenic peptide being covalently conjugated at the amino terminal ( ⁇ ') end of a recombinant beta chain of the MHC class II, wherein an antigen binding domain of the isolated high affinity entity is capable of specifically binding to:
- an isolated high affinity entity comprising a complementarity determining regions (CDRs) set forth by SEQ ID NOs: 171-173 CDRs 1-3 for light chain; SEQ ID NOs:177- 179 CDRs 1-3 for heavy chain (CDRs 1-3 of heavy chain and light chain of G3H8).
- an isolated high affinity entity comprising a complementarity determining regions (CDRs) set forth by SEQ ID NOs:183-185 CDRs 1-3 for light chain and SEQ ID NOs.189-191 CDRs 1-3 for heavy chain.
- high affinity entity refers to any naturally occurring or artificially produced molecule, composition, or organism which binds to a specific antigen with a higher affinity than to a non-specific antigen.
- the affinity can be quantified using known methods such as, Surface Plasmon Resonance (SPR) (described in Scarano S, Mascini M, Turner AP, Minunni M. Surface plasmon resonance imaging for affinity-based biosensors. Biosens Bioelectron. 2010, 25: 957-66), and can be calculated using, e.g., a dissociation constant, Kd, such that a lower Kd reflects a higher affinity.
- SPR Surface Plasmon Resonance
- Kd dissociation constant
- the high affinity entity binds to a complex comprising an MHC class II and an MHC class Il-restricted autoantigen (a diabetes-associated autoantigenic peptide).
- the high affinity entity binds to a certain specific complex with a higher affinity as compared to the affinity of the same entity to a similar complex in which at least one of the complex components, i.e., the MHC class II alpha chain, the MHC class II beta chain, and/or the MHC class II- restricted autoantigen being replaced with a component having at least one mutation (substitution, deletion or insertion) with respect to the component of the specific complex.
- the complex components i.e., the MHC class II alpha chain, the MHC class II beta chain, and/or the MHC class II- restricted autoantigen being replaced with a component having at least one mutation (substitution, deletion or insertion) with respect to the component of the specific complex.
- the mutation is in an amino acid position which is conserved between restricted antigens of various MHC class II alleles.
- the high affinity entity exhibits an affinity to a specific antigen which is higher in at least about one order of magnitude as compared to the affinity of the same entity to a non-specific antigen, e.g., at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10 orders of magnitudes higher.
- the dissociation constant of the high affinity entity to the specific antigen is about 10 "4 M or less, e.g., about 10 "5 M or less, e.g., about 10 ⁇ 6 M or less, e.g., about 10 "7 or less, e.g., about 10 ⁇ 8 or less, e.g., about 10 "9 M or less, e.g., about 10 "10 M or less.
- Non-limiting examples of high affinity entities include an antibody, an antibody fragment, a phage displaying an antibody, a peptibody, a cell-based display entity (e.g., a bacterium or yeast displaying an antibody), and cell-free displaying entity (e.g., a ribosome displaying a peptide or antibody).
- a cell-based display entity e.g., a bacterium or yeast displaying an antibody
- cell-free displaying entity e.g., a ribosome displaying a peptide or antibody
- Bacteriophages which display antibodies and which can be used according to some embodiments of the invention include M13 and fd filamentous phage, T4, T7, and ⁇ phages.
- bacteria e.g., E. Coli
- yeast for displaying antibodies are well (See e.g., Daugherty PS., et al., 1998. Antibody affinity maturation using bacterial surface display. Protein Engineering 11:825-832; Johan Rockberg et al., Epitope mapping of antibodies using bacterial surface display. Nature Methods 5, 1039 - 1045 (2008); Sachdev S Sidhu, Full-length antibodies on display, Nature Biotechnology 25, 537 - 538 (2007); each of which is fully incorporated herein by reference).
- Cell-free displaying entities include a ribosome displaying a protein (described in Mingyue He and Michael J. Taussig, 2002. Ribosome display: Cell-free protein display technology. Briefings in functional genomics and proteomics. Vol 1: 204-212; Patrick Dufner et al., 2006. Harnessing phage and ribosome display for antibody optimization. Trends in Biotechnology, Vol. 24: 523-529; each of which is fully incorporated herein by reference).
- Peptibodies are isolated polypeptide comprising at least one peptide capable of binding to an antigen (e.g., a CDR) attached to an Fc domain of an antibody (e.g., IgG, IgA, IgD, IgE, IgM antibodies) or a fragment of an Fc domain.
- an antigen e.g., a CDR
- a peptibody can include more than one peptide capable of binding an antigen (e.g., 2, 3, 4 or 5 peptides) which may be the same as one another or may be different from one another.
- antibody as used in this invention includes intact molecules as well as functional fragments thereof, such as Fab, F(ab')2, and Fv that are capable of binding to macrophages.
- These functional antibody fragments are defined as follows: (1) Fab, the fragment which contains a monovalent antigen-binding fragment of an antibody molecule, can be produced by digestion of whole antibody with the enzyme papain to yield an intact light chain and a portion of one heavy chain; (2) Fab', the fragment of an antibody molecule that can be obtained by treating whole antibody with pepsin, followed by reduction, to yield an intact light chain and a portion of the heavy chain; two Fab' fragments are obtained per antibody molecule; (3) (Fab")2, the fragment of the antibody that can be obtained by treating whole antibody with the enzyme pepsin without subsequent reduction; F(ab')2 is a dimer of two Fab' fragments held together by two disulfide bonds; (4) Fv, defined as a genetically engineered fragment containing the variable region of the light chain and the variable region of the
- the antigen binding domain comprises complementarity determining region (CDR) selected from the group of the CDRs set forth by SEQ ID NOs: 171-173 CDRs 1-3 for light chain; SEQ ID NOs: 177- 179 CDRs 1-3 for heavy chain, and 183-185 CDRs 1-3 for light chain; SEQ ID NOs: 189-191 CDRs 1-3 for heavy chain.
- CDR complementarity determining region
- Antibody fragments according to the present invention can be prepared by proteolytic hydrolysis of the antibody or by expression in E. coli or mammalian cells (e.g. Chinese hamster ovary cell culture or other protein expression systems) of DNA encoding the fragment.
- Antibody fragments can be obtained by pepsin or papain digestion of whole antibodies by conventional methods.
- antibody fragments can be produced by enzymatic cleavage of antibodies with pepsin to provide a 5S fragment denoted F(ab')2.
- This fragment can be further cleaved using a thiol reducing agent, and optionally a blocking group for the sulfhydryl groups resulting from cleavage of disulfide linkages, to produce 3.5S Fab' monovalent fragments.
- a thiol reducing agent optionally a blocking group for the sulfhydryl groups resulting from cleavage of disulfide linkages
- an enzymatic cleavage using pepsin produces two monovalent Fab' fragments and an Fc fragment directly.
- cleaving antibodies such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic, chemical, or genetic techniques may also be used, so long as the fragments bind to the antigen that is recognized by the intact antibody.
- Fv fragments comprise an association of VH and VL chains. This association may be noncovalent, as described in Inbar et al. [Proc. Natl Acad. Sci. USA 69:2659-62 (19720]. Alternatively, the variable chains can be linked by an intermolecular disulfide bond or cross-linked by chemicals such as glutaraldehyde. Preferably, the Fv fragments comprise VH and VL chains connected by a peptide linker.
- sFv single-chain antigen binding proteins
- the structural gene is inserted into an expression vector, which is subsequently introduced into a host cell such as E. coli.
- the recombinant host cells synthesize a single polypeptide chain with a linker peptide bridging the two V domains.
- Methods for producing sFvs are described, for example, by [Whitlow and Filpula, Methods 2: 97- 105 (1991); Bird et al., Science 242:423-426 (1988); Pack et al., Bio/Technology 11:1271-77 (1993); and U.S. Pat. No. 4,946,778, which is hereby incorporated by reference in its entirety.
- CDR peptides (“minimal recognition units") can be obtained by constructing genes encoding the CDR of an antibody of interest. Such genes are prepared, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells. See, for example, Larrick and Fry [Methods, 2: 106- 10 (1991)].
- the antibodies are multivalent forms such as tetrameric Fabs, IgM or IgGl antibodies, thus forming a multivalent composition with higher avidity to the target.
- Humanized forms of non-human (e.g., murine) antibodies are chimeric molecules of immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab').sub.2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
- Humanized antibodies include human immunoglobulins (recipient antibody) in which residues form a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
- CDR complementary determining region
- donor antibody such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
- Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
- Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
- the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
- the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2:593-596 (1992)].
- Fc immunoglobulin constant region
- a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody.
- humanized antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
- humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
- Human antibodies can also be produced using various techniques known in the art, including screening of phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al., J. Mol. Biol., 222:581 (1991)].
- the techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 147(l):86-95 (1991)].
- human antibodies can be made by introduction of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Pat. Nos.
- the human or humanized antibody will generally tend to be better tolerated immunologically than one of non human origin since non variable portions of non human antibodies will tend to trigger xenogeneic immune responses more potent than the allogeneic immune responses triggered by human antibodies which will typically be allogeneic with the individual. It will be preferable to minimize such immune responses since these will tend to shorten the half-life, and hence the effectiveness, of the antibody in the individual. Furthermore, such immune responses may be pathogenic to the individual, for example by triggering harmful inflammatory reactions.
- an antibody of a human origin or a humanized antibody, will also be advantageous for applications (such as targeted cell killing) in which a functional physiological effect, for example an immune response against a target cell, activated by a constant region of the antibody in the individual is desired.
- a functional physiological effect for example an immune response against a target cell, activated by a constant region of the antibody in the individual is desired.
- an optimal functional interaction occurs when the functional portion of the antibody, such as the Fc region, and the molecule interacting therewith such as the Fc receptor or the Fc-binding complement component are of a similar origin (e.g., human origin).
- the antibody of the invention which includes a constant region, or a portion thereof of any of various isotypes, may be employed.
- the isotype is selected so as to enable or inhibit a desired physiological effect, or to inhibit an undesired specific binding of the antibody via the constant region or portion thereof.
- ADCC antibody-dependent cell mediated cytotoxicity
- NK natural killer
- the isotype can be IgG
- the isotype can be IgE
- the isotype can be IgE or IgA.
- the antibody may comprise a constant region or portion thereof capable of initiating the cascade.
- the antibody may advantageously comprise a Cgamma2 domain of IgG or Cmu3 domain of IgM to trigger a Clq-mediated complement cascade.
- the antibody of the invention may not comprise a constant region (be devoid of a constant region), a portion thereof or specific glycosylation moieties (required for complement activation) of the relevant isotype.
- an isolated antibody comprising an antigen binding domain capable of specifically binding the isolated complex of MHC class II-GAD antigenic peptide of some embodiments of the invention.
- the isolated antibody does not bind to the MHC class II in an absence of the antigenic peptide, wherein the isolated antibody does not bind the antigenic peptide in an absence of the MHC class II.
- the antibody of some embodiments of the invention binds to the target complex (MHC class II-GAD autoantigen) with an affinity characterized by a dissociation constant which is lower than about 100 nanomolar, e.g., lower than about 50 nanomolar, e.g., lower than about 20 nanomolar, e.g., about 10 nanomolar or lower.
- an isolated polynucleotide sequence [e.g., SEQ ID NOs:174 (CDR1 of the G3H8 Ab light chain), 175 (CDR2 of the G3H8 Ab light chain), 176 (CDR3 of the G3H8 Ab light chain), 180 (CDR1 of the G3H8 Ab heavy chain), 181 (CDR2 of the G3H8 Ab heavy chain), 182 (CDR3 of the G3H8 Ab heavy chain), 159 (nucleic acid sequence encoding the G3H8 Ab light chain) or 161 (nucleic acid sequence encoding the G3H8 Ab heavy chain] encoding the amino acid sequence of the antibody of the invention [e.g., SEQ ID NOs:171 (CDR1 of the G3H8 Ab light chain), 172 (CDR2 of the G3H8 Ab light chain), 173 (CDR3 of the G3H8 Ab light chain
- the nucleic acid construct of the invention may also include an enhancer, a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal, a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof; a signal sequence for secretion of the antibody polypeptide from a host cell; additional polynucleotide sequences that allow, for example, the translation of several proteins from a single mRNA such as an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter-chimeric polypeptide; sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed peptide.
- an enhancer a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal, a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or
- mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+/-), pGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogea, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
- Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used.
- SV40 vectors include pSVT7 and pMT2.
- Vectors derived from bovine papilloma virus include pBV-lMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p205.
- exemplary vectors include pMSG, pAV009/A + , pMTO10/A + , pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
- Recombinant viral vectors are useful for in vivo expression since they offer advantages such as lateral infection and targeting specificity.
- Introduction of nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses.
- nucleic acid transfer techniques include transfection with viral or non-viral constructs, such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems.
- viral or non-viral constructs such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems.
- Useful lipids for lipid- mediated transfer of the gene are, for example, DOTMA, DOPE, and DC-Choi [Tonkinson et al., Cancer Investigation, 14(1): 54-65 (1996)].
- the most preferred constructs for use in gene therapy are viruses, most preferably adenoviruses, AAV, lentiviruses, or retroviruses.
- prokaryotic or eukaryotic cells can be used as host-expression systems to express the antibody of the invention.
- host-expression systems include, but are not limited to, microorganisms, such as bacteria transformed with a recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vector containing the coding sequence; yeast transformed with recombinant yeast expression vectors containing the coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors, such as Ti plasmid, containing the coding sequence.
- Mammalian expression systems can also be used to express the antibody of the invention.
- antibody polypeptides of the invention can be purified using a variety of standard protein purification techniques, such as, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, chromatofocusing and differential solubilization.
- a molecule comprising the high affinity entity (e.g., the antibody) of the invention being conjugated to a functional moiety (also referred to as an "immunoconjugate") such as a detectable or a therapeutic moiety.
- a functional moiety also referred to as an "immunoconjugate”
- the immunoconjugate molecule can be an isolated molecule such as a soluble or synthetic molecule.
- detectable or reporter moieties may be conjugated to the high affinity entity of the invention (e.g., the antibody of the invention).
- a radioactive isotope such as ⁇ 12 3 ⁇ 4dine
- a phosphorescent chemical such as ⁇ 12 3 ⁇ 4dine
- a chemiluminescent chemical such as a fluorescent chemical (fluorophore)
- fluorophores examples include, but are not limited to, phycoerythrin (PE), fluorescein isothiocyanate (FITC), Cy-chrome, rhodamine, green fluorescent protein (GFP), blue fluorescent protein (BFP), Texas red, PE-Cy5, and the like.
- PE phycoerythrin
- FITC fluorescein isothiocyanate
- Cy-chrome Cy-chrome
- rhodamine green fluorescent protein
- GFP green fluorescent protein
- BFP blue fluorescent protein
- Texas red PE-Cy5, and the like.
- fluorophore selection methods of linking fluorophores to various types of molecules see Richard P. Haugland, "Molecular Probes: Handbook of Fluorescent Probes and Research Chemicals 1992-1994", 5th ed., Molecular Probes, Inc. (1994); U.S. Pat. No. 6,037,137 to Oncoimmunin Inc.; Hermanson, "Bioconjugate Techniques", Academic Press New York, N
- Fluorescence detection methods which can be used to detect the high affinity entity (e.g., antibody) when conjugated to a fluorescent detectable moiety include, for example, fluorescence activated flow cytometry (FACS), immunofluorescence confocal microscopy, fluorescence in-situ hybridization (FISH) and fluorescence resonance energy transfer (FRET).
- FACS fluorescence activated flow cytometry
- FISH fluorescence in-situ hybridization
- FRET fluorescence resonance energy transfer
- enzymes may be attached to the high affinity entity (e.g., the antibody) of some embodiments of the invention [e.g., horseradish peroxidase (HPR), beta-galactosidase, and alkaline phosphatase (AP)] and detection of enzyme-conjugated antibodies can be performed using ELISA (e.g., in solution), enzyme-linked immunohistochemical assay (e.g., in a fixed tissue), enzyme-linked chemiluminescence assay (e.g., in an electrophoretically separated protein mixture) or other methods known in the art [see e.g., Khatkhatay MI. and Desai M., 1999.
- HPR horseradish peroxidase
- AP alkaline phosphatase
- the affinity tag (or a member of a binding pair) can be an antigen identifiable by a corresponding antibody [e.g., digoxigenin (DIG) which is identified by an anti-DIG antibody) or a molecule having a high affinity towards the tag [e.g., streptavidin and biotin].
- DIG digoxigenin
- the antibody or the molecule which binds the affinity tag can be fluorescently labeled or conjugated to enzyme as described above.
- a streptavidin or biotin molecule may be attached to the antibody of the invention via the recognition sequence of a biotin protein ligase (e.g., BirA) as described in the Examples section which follows and in Denkberg, G. et al, 2000. Eur. J. Immunol. 30:3522-3532.
- a biotin protein ligase e.g., BirA
- a streptavidin molecule may be attached to an antibody fragment, such as a single chain Fv, essentially as described in Cloutier SM. et al, 2000. Molecular Immunology 37:1067-1077; Dubel S. et al, 1995. J Immunol Methods 178:201; Huston
- Functional moieties such as fluorophores, conjugated to streptavidin are commercially available from essentially all major suppliers of immunofluorescence flow cytometry reagents (for example, Pharmingen or Becton-Dickinson).
- biotin conjugated antibodies are bound to a streptavidin molecule to form a multivalent composition (e.g., a dimer or tetramer form of the antibody).
- Table 1 provides non-limiting examples of identifiable moieties which can be conjugated to the antibody of the invention.
- the high affinity entity e.g., the antibody
- the high affinity entity may be conjugated to a therapeutic moiety.
- the therapeutic moiety can be, for example, a cytotoxic moiety, a toxic moiety, a cytokine moiety and a second antibody moiety comprising a different specificity to the antibodies of the invention.
- Non-limiting examples of therapeutic moieties which can be conjugated to the high affinity entity (e.g., the antibody) of the invention are provided in Table 2, hereinbelow.
- the toxic moiety is PE38KDEL [(SEQ ID NO:233 for protein) and SEQ ID NO:234 for nucleic acid).
- the functional moiety (the detectable or therapeutic rrjoiety of the invention) may be attached or conjugated to the high affinity entity (e.g., the antibody) of the invention in various ways, depending on the context, application and purpose.
- the immunoconjugate may be produced by recombinant means.
- the nucleic acid sequence encoding a toxin e.g., PE38KDEL
- a fluorescent protein e.g., green fluorescent protein (GFP), red fluorescent protein (RFP) or yellow fluorescent protein (YFP)
- GFP green fluorescent protein
- RFP red fluorescent protein
- YFP yellow fluorescent protein
- the functional moiety may be chemically synthesized by, for example, the stepwise addition of one or more amino acid residues in defined order such as solid phase peptide synthetic techniques.
- a functional moiety may also be attached to the high affinity entity (e.g., the antibody) of the invention using standard chemical synthesis techniques widely practiced in the art [see e.g., hypertexttransferprotocol://worIdwideweb (dot) chemistry (dot) org/portal/Chemistry)], such as using any suitable chemical linkage, direct or indirect, as via a peptide bond (when the functional moiety is a polypeptide), or via covalent bonding to an intervening linker element, such as a linker peptide or other chemical moiety, such as an organic polymer.
- Chimeric peptides may be linked via bonding at the carboxy (C) or amino (N) termini of the peptides, or via bonding to internal chemical groups such as straight, branched or cyclic side chains, internal carbon or nitrogen atoms, and the like.
- Description of fluorescent labeling of antibodies is provided in details in U.S. Pat. Nos. 3,940,475, 4,289,747, and 4,376,110.
- Exemplary methods for conjugating peptide moieties (therapeutic or detectable moieties) to the high affinity entity (e.g., the antibody) of the invention are described herein below:
- SPDP conjugation A non-limiting example of a method of SPDP conjugation is described in Cumber et al. (1985, Methods of Enzymology 112: 207-224). Briefly, a peptide, such as a detectable or therapeutic moiety (e.g., 1.7 mg/ml) is mixed with a 10- fold excess of SPDP (50 mM in ethanol); the antibody is mixed with a 25-fold excess of SPDP in 20 mM sodium phosphate, 0.10 M NaCl pH 7.2 and each of the reactions is incubated for about 3 hours at room temperature. The reactions are then dialyzed against PBS. The peptide is reduced, e.g., with 50 mM DTT for 1 hour at room temperature.
- a detectable or therapeutic moiety e.g., 1.7 mg/ml
- the reduced peptide is desalted by equilibration on G-25 column (up to 5 % sample/column volume) with 50 mM KH 2 P0 4 pH 6.5.
- the reduced peptide is combined with the SPDP-antibody in a molar ratio of 1:10 antibody:peptide and incubated at 4 °C overnight to form a peptide-antibody conjugate.
- Glutaraldehyde conjugation A non-limiting example of a method of glutaraldehyde conjugation is described in G.T. Hermanson (1996, “Antibody Modification and Conjugation, in Bioconjugate Techniques, Academic Press, San Diego). Briefly, the antibody and the peptide (1.1 mg/ml) are mixed at a 10-fold excess with 0.05 % glutaraldehyde in 0.1 M phosphate, 0.15 M NaCl pH 6.8, and allowed to react for 2 hours at room temperature. 0.01 M lysine can be added to block excess sites. After-the reaction, the excess glutaraldehyde is removed using a G-25 column equilibrated with PBS (10 % v/v sample/column volumes)
- Carbodumide conjugation - Conjugation of a peptide with an antibody can be accomplished using a dehydrating agent such as a carbodiimide, e.g., in the presence of 4-dimethyl aminopyridine.
- Carbodiimide conjugation can be used to form a covalent bond between a carboxyl group of peptide and an hydroxy! group of an antibody (resulting in the formation of an ester bond), or an amino group of an antibody (resulting in the formation of an amide bond) or a sulfhydryl group of an antibody (resulting in the formation of a thioester bond).
- carbodiimide coupling can be used to form analogous covalent bonds between a carbon group of an antibody and an hydroxyl, amino or sulfhydryl group of the peptide [see, J. March, Advanced Organic Chemistry: Reaction's, Mechanism, and Structure, pp. 349-50 & 372-74 (3d ed.), 1985].
- the peptide can be conjugated to an antibody via a covalent bond using a carbodiimide, such as dicyclohexylcarbodiimide [B. Neises et al. (1978), Angew Chem., Int. Ed. Engl. 17:522; A. Hassner et al. (1978, Tetrahedron Lett. 4475); E.P. Boden et al. (1986, J. Org. Chem. 50:2394) and L.J. Mathias (1979, Synthesis 561)].
- the isolated high affinity entity e.g., the antibody
- the isolated high affinity entity can be used to detect the complex of MHC class II and a diabetes associate autoantigen (e.g., the GAD autoantigenic peptide) on the surface antigen Presenting Cells (APC) such as dendritic cells, macrophages and B-cells.
- APC surface antigen Presenting Cells
- a method of detecting presentation of a type I diabetes-associated autoantigenic peptide on a cell is effected by contacting the cell with the high affinity entity of some embodiments of the invention, the molecule of some embodiments of the invention, or the antibody of some embodiments of the invention, under conditions which allow immunocomplex formation, wherein a presence or a level above a predetermined threshold of the immunocomplex is indicative of presentation of the diabetes-associated autoantigenic peptide on the cell.
- the cell presenting the diabetes-associated autoantigenic peptide can be any nucleated cell such as an antigen presenting cell (APC) in the blood, pancreas and lymphoid organs such as thymus, bone marrow, lymph node and lymphoid follicles.
- APC antigen presenting cell
- Contacting the cell with the high affinity entity (e.g., the antibody)/molecule or multivalent composition of the invention may be effected in vitro (e.g., in a cell line), ex vivo or in vivo.
- the method of the invention is effected under conditions sufficient to form an immunocomplex; such conditions (e.»., appropriate concentrations, buffers, temperatures, reaction times) as well as methods to optimize such conditions are known to those skilled in the art, and examples are disclosed herein.
- immunocomplex refers to a complex which comprises the high affinity entity of some embodiments of the invention (e.g., the antibody) and the MHC-class Il-diabetes-associated autoantigenic peptide (e.g., GAD peptide). Determining a presence or level of the immunocomplex of the invention is performed using the detectable moiety to which the high affinity entity (e.g., antibody) is attached, and can be performed using various methods are known in the art and described hereinabove.
- the high affinity entity e.g., antibody
- the level of the immunocomplex in the tested cell is compared to a predetermined threshold.
- the threshold may be determined based on a known reference level and/or a level in a control cell.
- the control cell can be obtained from a control, healthy subject (e.g., a subject not diagnosed with diabetes or not being at-risk for diabetes, or from a subject devoid of the specific MHC molecule forming the MHC-peptide complex (e.g., DR4).
- the control subject is of the same species e.g. human, preferably matched with the same age, weight, sex etc. as the subject in need thereof.
- the teachings of the invention can be used to detect cells which present diabetes-associated autoantigenic peptideic peptides (e.g., GAD presenting cell(s)) in a biological sample of the subject.
- diabetes-associated autoantigenic peptideic peptides e.g., GAD presenting cell(s)
- cells which present diabetes-associated autoantigenic peptides refers to any cell or a portion thereof of the subject which displays the complex of MHC class II and MHC-restricted diabetes-associated autoantigenic peptide.
- the biological sample can be any sample which contains cells or a portion thereof (e.g., cell debris, membrane vesicles) which putatively present the MHC class II-diabetes-associated autoantigenic peptide complex.
- cells or a portion thereof e.g., cell debris, membrane vesicles
- the subject is at risk of developing type 1 diabetes.
- subjects who are at risk to develop type 1 diabetes include subjects carrying the HLA DRB1*03,*04; DQB1*0302 genotype and the DR3-DQ2 and DR4-DQ8 haplotypes.
- Type 1 diabetes results from autoimmune destruction of insulin-producing beta cells of the pancreas, which lead to lack of insulin and subsequently increased blood and urine glucose.
- Classical symptoms include polyuria (frequent urination), polydipsia (increased thirst), polyphagia (increased hunger), and weight loss.
- type 1 diabetes is made by demonstrating any one of the following: Fasting plasma glucose level at or above 7.0 mmol/L (126 mg/dL); Plasma glucose at or above 11.1 mmol/L (200 mg dL) two hours after a 75 g oral glucose load as in a glucose tolerance test; Symptoms of hyperglycemia and casual plasma glucose at or above 11.1 mmol/L (200 mg/dL); Glycated hemoglobin (hemoglobin AIC) at or above 6.5.
- hemoglobin AIC Glycated hemoglobin
- islets autoantibodies Early signs of type 1 diabetes include the development of islets autoantibodies. Autoantibodies to four islet antigen groups have so far been identified: insulin or proinsulin, GAD65 or GAD67, IA-2 (PHOGRIN), and ZnT8. The number of islets autoantibodies, greater titer, affinity, and broadness of epitope reactivity are features of-autoantibodies that affect the risk for T1D. Combination of family history information, genetic factors, autoantibodies, age and beta cells function markers provides a disease risk determination that can be calculated empirically.
- the isolated antibodies of some embodiments of the invention were shown capable of detecting APC (which present the MHC class II-GAD antigenic peptide) in the infiltrated islets of diabetic B7/DR4 mice. Moreover, the isolated antibodies of some embodiments of the invention were shown capable of detecting APC in the infiltrated islets of pre-diabetic young B7/DR4 mice, thus diagnosing early signs of beta cell destruction leading to type 1 diabetes.
- type 1 diabetes at the early stages of the disease is of significant importance since not all of the beta cells in the pancreas are destroyed. Thus, early detection of type 1 diabetes, before a complete diagnosis is made, is of great significance, since it enables clinical intervention and treatment which will prevent the complete destruction of beta cells.
- Antigen-specific tolerance approaches are desirable treatment of T1D.
- the focus of these developing treatment strategies is to safely inactivate pathogenic autoreactive T cells in an autoantigen-specific manner while leaving the remainder of immune system unperturbed. Identification of the antigen-specificity nature of the immune response prior to antigen-specific intervention will allow the adjustment of the suitable treatment for the current auto-immune response of the subject.
- the isolated antibodies of some embodiments of the invention were shown capable of detecting specific auto-antigens presentation, and therefore identifying the specific-antigenic nature of the auto-immune process.
- teachings of the invention can be used to select an accurate and most suitable antigen-specific intervention strategy.
- a method of diagnosing type 1 diabetes (T1D) in a subject is effected by contacting a cell of the subject with the high affinity entity (e.g., antibody) of some embodiments of the invention, the molecule of some embodiments of the invention, or the multivalent antibody of some embodiments of the invention under conditions which allow immunocomplex formation, wherein a presence or a level above a pre-determined threshold of the immunocomplex in the cell is indicative of the type 1 diabetes in the subject.
- the high affinity entity e.g., antibody
- diagnosis refers to determining presence or absence of a pathology, classifying a pathology or a symptom, determining a severity of the pathology, monitoring pathology progression, forecasting an outcome of a pathology and/or prospects of recovery.
- diagnosis of type 1 diabetes relates to detecting early signs of the disease, even before the destruction of beta cells has began and the beta cells are still functional (i.e., produce insulin in response to elevation in glucose levels).
- a method of treating type 1 diabetes comprising administering to a subject in need thereof a therapeutically effective amount of the isolated high affinity entity (e.g., antibody) of some embodiments of the invention, the molecule of some embodiments of the invention (e.g., which includes the high affinity entity conjugated to a therapeutic moiety such as toxin), the multivalent composition comprising same of some embodiments of the invention, the isolated polynucleotide or the nucleic acid construct encoding same, thereby treating the treating type 1 diabetes (T1D).
- the isolated high affinity entity e.g., antibody
- the molecule of some embodiments of the invention e.g., which includes the high affinity entity conjugated to a therapeutic moiety such as toxin
- the multivalent composition comprising same of some embodiments of the invention, the isolated polynucleotide or the nucleic acid construct encoding same, thereby treating the treating type 1 diabetes (T1D).
- treating refers to inhibiting or arresting the development of a disease, disorder or condition and/or causing the reduction, remission, or regression of a disease, disorder or condition.
- Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a disease, disorder or condition, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a disease, disorder or condition.
- treatment of type 1 diabetes is achieved by blocking presentation of the MHC class II/diabetes-associated autoantigenic peptide on APCs, and thus preventing or avoiding recognition of the antigen presenting cells by the specific T cells.
- treatment with the isolated antibodies of the invention is performed at an early stage of disease, before the onset of diabetic symptoms.
- treatment with the isolated high affinity entity e.g., the antibody
- treatment with the isolated high affinity entity prevents the symptoms of glucose blood level increase and the subsequent need for insulin administration (e.g., by injections) because the beta cell own insulin production is spared.
- the effector functions of the high affinity entity are manipulated such that the high affinity entity (e.g., antibody) is devoid of an Antibody-Dependent Cell-Mediated Cytotoxicity (ADCC) activity or devoid of a Complement-Dependent Cytotoxicity (CDC) activity.
- ADCC Antibody-Dependent Cell-Mediated Cytotoxicity
- CDC Complement-Dependent Cytotoxicity
- the antibody of some embodiments of the invention is devoid of a constant region, a portion thereof or specific glycosylation moieties (required for complement activation) of the relevant isotype.
- the high affinity entity (e.g., antibody) of the invention can be used to directly kill the APCs which display the diabetes-associated autoantigenic peptide (e.g., GAD antigenic peptide) in a complex with the MHC class II.
- the diabetes-associated autoantigenic peptide e.g., GAD antigenic peptide
- the isolated high affinity entity e.g., antibody
- the isolated high affinity entity is a naked high affinity entity that is capable of mediating ADCC or CDC.
- naked refers to being devoid of a conjugated moiety such as a detectable or a therapeutic moiety.
- the naked antibody comprises the constant region, a portion thereof or specific glycosylation moieties which mediate ADCC or CDC.
- the isolated high affinity entity e.g., the antibody
- a therapeutic moiety e.g., drug, toxic moiety
- the drug is an antiinflammatory drugs or a cytokine that will reduce or inhibit the local inflammation in the islets and thus will rescue and inhibit the damage to the insulin producing beta cells.
- the isolated high affinity entity e.g., the antibody
- molecule comprising same, multivalent antibody composition, polynucleotide, and/or nucleic acid construct of the invention is capable of killing MHC class Il-diabetes-associated autoantigenic peptides (e.g., GAD) presenting cells in the subject in need thereof.
- MHC class Il-diabetes-associated autoantigenic peptides e.g., GAD
- the high affinity entity e.g., the antibody
- the molecule of the invention which comprise the high affinity entity, e.g., antibody, conjugated to a therapeutic or detectable moiety
- the multivalent composition of the invention, the isolated polynucleotide or the nucleic acid construct of the invention may be provided per se or may be administered as a pharmaceutical composition.
- a "pharmaceutical composition” refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients.
- the purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
- active ingredient refers to the high affinity entity (e.g., the antibody) of the invention, the molecule of the invention (which comprise the high affinity entity, e.g., an antibody, conjugated to a therapeutic or detectable moiety, or a polynucleotide encoding same), the multivalent composition of the invention, the isolated polynucleotide or the nucleic acid construct of the invention accountable for the biological effect.
- the high affinity entity e.g., the antibody
- the molecule of the invention which comprise the high affinity entity, e.g., an antibody, conjugated to a therapeutic or detectable moiety, or a polynucleotide encoding same
- the multivalent composition of the invention the isolated polynucleotide or the nucleic acid construct of the invention accountable for the biological effect.
- pharmaceutically acceptable carrier refers to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
- An adjuvant is included under these phrases.
- excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient.
- excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
- Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intravenous, inrtaperitoneal, intranasal, or intraocular injections.
- compositions of the invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
- compositions for use in accordance with the invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
- the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
- physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
- penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
- the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art.
- Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient.
- Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores.
- Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP).
- disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
- Dragee cores are provided with suitable coatings.
- suitable coatings For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures.
- Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
- compositions which can be used orally include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
- the push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers.
- the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
- stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
- compositions may take the form of tablets or lozenges formulated in conventional manner.
- the active ingredients for use according to the invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide.
- the dosage unit may be determined by providing a valve to deliver a metered amount.
- Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
- compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion.
- Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative.
- the compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
- the active ingredient may be in powder form for constitution with, a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.
- a suitable vehicle e.g., sterile, pyrogen-free water based solution
- compositions of the invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
- compositions suitable for use in context of the invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients [e.g., the high affinity entity of the invention, e.g., the antibody of the invention, the molecule of the invention (e.g., which comprise the antibody conjugated to a therapeutic or detectable moiety), the multivalent composition of the invention, the isolated polynucleotide or the nucleic acid construct of the invention] effective to prevent, alleviate or ameliorate symptoms of a disorder (type 1 diabetes) or prolong the survival of the subject being treated.
- active ingredients e.g., the high affinity entity of the invention, e.g., the antibody of the invention, the molecule of the invention (e.g., which comprise the antibody conjugated to a therapeutic or detectable moiety), the multivalent composition of the invention, the isolated polynucleotide or the nucleic acid construct of the invention
- the effect of the active ingredients e.g., the high affinity entity, e.g., the antibody of the invention, or the polynucleotide encoding same
- type 1 diabetes treatment can be evaluated by monitoring the level of glucose in the blood of the treated subject, and/or measuring the level of hemoglobin Ale using well known methods.
- the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays.
- a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
- Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals.
- the data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
- the dosage may vary depending upon the dosage form employed and the route of administration utilized.
- the exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.l).
- Dosage amount and interval may be adjusted individually to provide plasma or brain levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC).
- MEC minimum effective concentration
- the MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
- dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
- compositions to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
- the therapeutic agent of the invention e.g., the high affinity entity of the invention, e.g., the antibody, molecule and/or multivalent composition of the invention
- other drug(s) designed for treating type 1 diabetes include insulin (e.g., a recombinant human insulin, pig derived insulin) and Anti-CD3 mAb.
- Methods of administering insulin include injection, insulin pumps and inhaled insulin have been available at various times. Pancreas transplants have been also used to treat type 1 diabetes.
- the combination therapy may increase the therapeutic effect of the agent of the invention in the treated subject.
- compositions of the invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient.
- the pack may, for example, comprise metal or plastic foil, such as a blister pack.
- the pack or dispenser device may be accompanied by instructions for administration.
- the pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
- Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as if further detailed above.
- agents of some embodiments of the invention which are described hereinabove for detecting the complexes of MHC class II/diabetes-associated autoantigenic peptides (e.g., GAD antigenic peptide) (either in an isolated form or when displayed on cells) may be included in a diagnostic kit/article of manufacture preferably along with appropriate instructions for use and labels indicating FDA approval for use in diagnosing, determining predisposition to, and/or assessing type 1 diabetes.
- kit can include, for example, at least one container including at least one of the above described diagnostic agents (e.g., the high affinity entity, e.g., the antibody) and an imaging reagent packed in another container (e.g., enzymes, secondary antibodies, buffers, chromogenic substrates, fluorogenic material).
- diagnostic agents e.g., the high affinity entity, e.g., the antibody
- imaging reagent packed in another container (e.g., enzymes, secondary antibodies, buffers, chromogenic substrates, fluorogenic material).
- the kit may also include appropriate buffers and preservatives for improving the shelf-life of the kit.
- a method of isolating a high affinity entity which specifically binds to a complex composed of a major histocompatibility complex (MHC) class II and a type I diabetes- associated autoantigenic peptide comprising:
- the high affinity entity further specifically binds to a native conformation of the complex of the MHC class II and the type I diabetes-associated autoantigenic peptide.
- composition of matter comprising the isolated MHC class II and diabetes-associated autoantigenic peptide complex of some embodiments of the invention and a conjugated functional moiety.
- the conjugated functional moiety can be a therapeutic or a detectable moiety as described above. Conjugation of the functional moiety can be performed as described above and/or in U.S. Patent Application No. 20030166277 which is fully incorporated herein by reference.
- the functional moiety comprises an antibody or a fragment specific for a cell surface marker.
- the cell surface marker can be expressed on an antigen presenting cell.
- cell surface markers include, but are not limited to cell surface markers of tumor cells, epithelial cells, fibroblast, and T cells (e.g., CD28, CTLA-4 and CD25).
- the functional moiety comprises a therapeutic moiety such as a cytokine or lymphokine.
- a therapeutic moiety such as a cytokine or lymphokine.
- the cytokine or lymphokine may be linked to the MHC class II and diabetes-associated autoantigenic peptide complex either directly or via, e.g., formation of a multivalent compound (using streptavidin or avidin for example, and a biotinylated cytokine or lymphokine.
- Non-limiting examples of cytokines or lymphokines include interleukins (e.g.,
- IL-2, IL-3, IL-4, IL-5, IL-6, IL-10, IL-12, IL-15, and IL-18 alpha interferons (e.g., IFN.alpha.), beta interferons (e.g., IFN.beta.), gamma, interferons (e.g., IFN.gamma.), granulocyte-macrophage colony stimulating factor (GM-CSF), and transforming growth factor (TGF, e.g., TGF-alpha. and TGF-beta).
- alpha interferons e.g., IFN.alpha.
- beta interferons e.g., IFN.beta.
- gamma interferons
- interferons e.g., IFN.gamma.
- GM-CSF granulocyte-macrophage colony stimulating factor
- TGF transforming growth factor
- compositions of matter of some embodiments of the invention comprising the composition of matter of some embodiments of the invention and a therapeutically acceptable carrier as described above.
- composition of matter of some embodiments of the invention is useful for modulating, i.e., either inhibiting or stimulating, an immune response; for stimulating desirable immune responses, for example, immune responses against infectious agents or cancer; for inhibiting undesirable immune responses, such as allergic responses, allograft rejections, and autoimmune diseases; by directing the MHC class II/diabetes-associated autoantigenic peptide complex to professional antigen presenting cells, such as dendritic cells, B cells, or macrophages; tumor cells; epithelial cells; fibroblasts; T cells; or other cells. Depending on the targeted cell type, this will lead to either very efficient stimulation or inhibition of antigen specific T cell activity.
- compositions, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
- a compound or “at least one compound” may include a plurality of compounds, including mixtures thereof.
- range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
- method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
- treating includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
- Bl*0401(HA-307-319) plasmids for inducible expression in Schneider S2 cell were used for cloning of DR-Bl*0401(GAD 555- 5 67 ) construct, transfection and expression of recombinant four-domain MHC class II as previously reported (Svendsen, P., et al., 2004). Briefly, in these constructs the intracellular domains of the DR-A and DR-B chains were replaced by leucine-zipper dimerization domains of Fos and Jun transcription factors, respectively, for heterodimer assembly. The antigenic peptide was introduced to the N-terminus of the DR-B chain through a flexible linker.
- Bir A recognition sequence for biotinylation was introduced to the C-terminus of the DR-A chain.
- DR-A and DR-B plasmids were co-transfected with pCoBlast selection vector to S2 cells using cellfectin reagent (invitrogen). Stable single-cell line clones were verified for protein expression.
- Upon induction with CuS0 4i cells supernatant were collected and DR4 complexes were affinity purified by anti-DR LB3.1 (ATCC number HB-298) monoclonal antibody (mAb).
- the purified DR4 complexes were biotinylated by Bir-A ligase (Avidity) and characterized by SDS-PAGE. The right folding of the complexes was verified by recognition of anti-DR conformation sensitive mAb (L243) in ELISA binding assay.
- the streptavidin-depleted library was incubated in solution with soluble biotinylated DR4/GAD (500 nM for the first round, and 100 nM for the following rounds) for 30 minutes at room temperature.
- Streptavidin-coated magnetic beads 200 ⁇ for the first round of selection and 100 ⁇ for the following rounds) were added to the mixture and incubated for 10-15 minutes at room temperature. The beads were washed extensively 12 times with PBS/0.1% Tween 20 and an additional two washes were with PBS.
- the diversity of the selected Abs was determined by DNA fingerprinting using a restriction endonuclease (BstNl), which is a frequent cutter of Ab V gene sequences.
- ELISA with purified Fab antibodies - Binding specificity of individual soluble Fab fragments were determined by ELISA using biotinylated MHC/peptide complexes.
- ELISA plates (Falcon) were coated overnight with BSA-biotin (1 ⁇ g/well). After being washed, the plates were incubated (1 hour at room temperature) with streptavidin (10 ⁇ g/ml), washed extensively, and further incubated (1 hour at room temperature) with 5 g/ml of MHC/peptide complexes. The plates were blocked for 30 minutes at room temperature with PBS/2% skim milk and subsequently were incubated for 1 hour at room temperature with 5 ⁇ / ⁇ soluble purified Fab. After washing, plates were incubated with horseradish peroxidase-conjugated/anti-human-Fab antibody. Detection was performed using TMB reagent (Sigma).
- GAD65 Altered Peptide Ligand (APL) that were loaded into Preiss were: M559Z (NFFRZVISNPAAT; SEQ ID NO.207), I561M (NFFRMVMSNPAAT; SEQ ID NO:208), N563Q (NFFRM VIS QP AAT; SEQ ID NO:209), I561M-N563Q (NFFRMVMSQPAAT; SEQ ID NO:210).
- Cells (10 6 ) were incubated with 1-5 ⁇ g of specific Fab for 1 hour at 4°C, followed by incubation with mouse-anti-myc Ab and FITC-labeled anti-mouse Ab for 45 minutes at 4°C. Cells were finally washed and analyzed by a FACSCalibur flow cytometer (BD).
- JL-2 bioassay for T cell hybridoma - Hybridoma cells (10 5 /well in a 96-well plate) in 50 ⁇ of 10% FBS-containing medium were combined with 50 ⁇ 10 5 irradiated (3000 rad) splenocytes of HLA-DRB1*0401-Tg mice and with 50 ⁇ of 25 pg/ml individual peptides and various Fabs concentrations.
- the cells were incubated at 37 °C and 7% C0 2 for 24 hours. Supernatants were collected from the top of the culture for IL-2 capture ELISA.
- Finetek, Torrance, CA 9050 for immunofluorescence on frozen sections. Frozen sections (8 ⁇ ) were dried and blocked with 0.1% BSA/PBS for 30 minutes. G3H8 was added at 50 ⁇ 3 ⁇ 4 / ⁇ for 1 hour at room temperature. Alexa-488-anti-human (A11013, Molecule probes, Eugene, OR, USA) was used as secondary Ab at 1:200 dilution. Fluorescence images were taken on Cell Observer - Zeiss Microscope.
- TCRLs For the isolation of TCRLs directed to the native MHC/peptide complexes the present inventors generated a recombinant DR4/GAD55 5- 5 67 complex which was used for screening of a phage display antibody library.
- Recombinant DR4 complexes - Four-domain DR4 molecules were generated from a DR4 construct previously reported for expression in insect cells (Svendsen, P., et al., 2004) in which the intracellular domains of the DR-A1*0101 and DR-B1*0401 chains were replaced by leucine-zipper dimerization domains for heterodimer assembly (Svendsen, P., et al., 2004).
- the antigenic peptide was introduced to the N-terminus of the DR-B chain through a flexible linker.
- the Bir A recognition sequence for biotinylation was introduced to the C-terminus of the DR-A chain ( Figure 1A).
- TCR-Uke Fabs toward DR4/GAD555.S67 complexes The present inventors used E. coli cells to produce a soluble Fab form of a representative clone of each DNA restriction pattern. The specificity of the selected clones was characterized in ELISA binding assay ( Figure 2A).
- TCRL Fab Abs (G1A1, G1H12, G3H8, G1A2) were isolated and found to bind solely to recombinant full length DR4/GAD 555-567 complexes and not to DR4 complexes with control peptides (i.e., the DR4 molecule without the GAD 555 _5 67 peptide), or to the GAD55 5-5 67 peptide alone. Additionally, these TCRLs successfully detect native DR4/GADs 55 _5 67 complexes presented by EBV transformed DR4+ Priess B cell ( Figure 2B for representative G3H8 Fab).
- the Fabs do not bind Preiss cells loaded with control DR4-associated peptides such as HA 307-31 9, InsAi.is, CII 26 i -273 ( Figure 2B).
- GAD 555 .5 67 is the minimal stimulating peptide within the GAD5 52 . 572 naturally processed T cell epitope of the hGAD65 in the context of DR4 (Nepom GT, et al., 2001). Therefore, the present inventors tested the ability of the isolated TCRLs to recognize this naturally T1D- associated epitope.
- G3H8 binds Preiss cells loaded with GAD 552 .
- TcR contact P5 position has been shown to be important for TcRs interactions with this hGAD65 epitope (John A. et al., 2004), emphasizing the TCR-like nature of G3H8 Fab.
- Preiss cells loaded with GAD555-567 containing the single amino acid substitutions M559Z ( Figure 3B) and N563Q ( Figure 3D) obtained similar binding intensity of G3H8 Fab as for Preiss cells loaded with the wild-type sequence of the GAD555-567 peptide ( Figure 3A).
- Preiss cells loaded with GAD555-567 containing the single amino acid substitution I561M ( Figure 3C) and the double amino acids substitution I561M, N563Q ( Figure 3E) obtained significant decrease in the binding intensity of Fab G3H8 compared to the wild-type peptide.
- the present inventors further tested the ability of G3H8 Fab to compete with the cognate TcR interaction with DR4/GAD complexes presented by APCs and by that to block this activating signal leading to T cells autoreactivity.
- G3H8 Fab found to inhibit -80% response of G2.1.36.1 T cell hybridoma specific to GAD-555-567 restricted by HLA-DR*0401 ( Figure 4A).
- G3H8 do not inhibit HI.13.2 hybridoma response to HA307-319 peptide restricted by HLA-DR*0401 ( Figures 4B).
- antigen-specific immunologic tolerance to the autoreactive GAD-epitope was in-vitro demonstrated by G3H8 Fab.
- the present inventors used the G3H8 Fab to test whether APC in the infiltrated islets of diabetic B7/DR0401 mice present the GAD 555-567 peptide on their MHC molecules.
- Positive staining of the G3H8 identified such complexes in islets of B7/DR4 diabetic mice ( Figures 5A-C) and in infiltrated islets of B7/DR4 pre-diabetic mice (data not shown) as compared to islets from C57B6 control mice ( Figures 5D-E).
- G3H8 Fab found to bind in a peptide-specific manner APC presenting GAD-autoantigen at the islets of langerhans of the pancreas.
- the demonstrated accessibility of G3H8 antibody to the islets infiltrating APC is essential for its therapeutic goal by blocking the down-stream activation of autoreactive T cells by these APC.
- Table 3 Provided are the diabetes-associated autoantigenic peptides (with their sequence identifiers, SEQ ID NO:) and the MHC class II molecules which bind thereto.
- GSLQPLALE 140 LVLNRLKVGLQWAVKA
- Table 4 Provided are the diabetes-associated autoantigenic peptides (with their sequence identifiers, SEQ ID NO:) and the MHC class II molecules which bind thereto.
- Table 5 Provided are the diabetes-associated autoanti genie peptides (with their sequence identifiers, SEQ ID NO:) and the MHC class II molecules which bind thereto.
- the G3H8 Fab was cloned into a fully human whole IgG molecule.
- the H and L Fab genes were cloned for expression as human IgGl ⁇ Ab into the eukaryotic expression vector pCMV/myc/ER.
- the multiple cloning site, the myc epitope tag, and the endoplasmic reticulum (ER) retention signal of pCMV/myc/ER were replaced by a cloning site containing recognition sites for #ssHI and Nhel followed by the human IgGl constant H chain region cDNA isolated by RT-PCR from human lymphocyte total RNA.
- a similar construct was generated for the L chain.
- Each shuttle expression vector carries a different antibiotic resistance gene. Expression was facilitated by co-transfection of the two constructs into the human embryonic kidney HEK293 cell by using the FuGENE 6 Transfection Reagent (Roche). After co-transfection, cells were grown on selective medium. Clones that reacted specifically with Preiss cells pulsed with GAD-555-567 peptide were adapted to growth in 0.5% serum and were further purified using protein A affinity chromatography. SDS-PAGE analysis of the purified protein revealed homogenous, pure IgG with the expected molecular mass of 150 kDa.
- mice were immunized with 100 ⁇ g peptide in 100 ⁇ 50% CFA/PBS subcutaneously at the base of the tail. Tissues were harvested on day 5 and single cell suspensions were analyzed by flow cytometry. LN cells were washed and incubated with 0.125 ⁇ g/ml G3H8 IgG for 1 hour at 4°C followed by incubation with anti-human- PE as a secondary Ab (2.5 ⁇ 3 ⁇ 41 ⁇ 21).
- the G3H8 TCRL Ab specifically stained APCs in LNs derived from GAD immunized mice which included 6.5% positive cells ⁇ i.e., cells presenting the HLA-DR4-GAD-555-567 complexes) but not APCs presenting the HLA-DR4-HA-307-319 complex from mice immunized with the control HA-307-319 peptide.
- G3H8 IgG exhibits enhanced binding and potency as compared to the Fab -
- the G3H8 IgG form was found to exhibit enhanced binding as compared to the Fab fragment ( Figure 11 A).
- the whole IgG TCRL molecule which has increased avidity, inhibited GAD-specific T cell activation/function with >10-fold higher potency compared to the Fab ( Figure 11B) while maintaining its unique TCR-like specificity (Figure 11C).
- Nepom GT Lippolis JD, White FM, Masewicz S, Marto JA, Herman A, Luckey CJ, Falk B, Shabanowitz J, Hunt DF, Engelhard VH, Nepom BS. Identification and modulation of a naturally processed T cell epitope from the diabetes-associated autoantigen human glutamic acid decarboxylase 65 (hGAD65). Proc Natl Acad Sci U S A. 2001 Feb 13;98(4): 1763-8;
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Diabetes (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Pathology (AREA)
- General Engineering & Computer Science (AREA)
- General Physics & Mathematics (AREA)
- Endocrinology (AREA)
- Emergency Medicine (AREA)
- Public Health (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Obesity (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13/810,248 US20130189284A1 (en) | 2010-07-15 | 2011-07-14 | Antibodies with t-cell receptor like specificity towards native complexes of mhc class ii and diabetes-associated autoantigenic peptides |
| JP2013519215A JP2013535963A (ja) | 2010-07-15 | 2011-07-14 | Mhcクラスiiと糖尿病関連自己抗原性ペプチドとの天然型複合体に対するt細胞受容体様特異性を有する単離された高親和性実体 |
| EP11746669.8A EP2593480A2 (en) | 2010-07-15 | 2011-07-14 | Antibodies with t-cell receptor like specificity towards native complexes of mhc class ii and diabetes-associated autoantigenic peptides |
| CA2805478A CA2805478A1 (en) | 2010-07-15 | 2011-07-14 | Isolated high affinity entities with t-cell receptor like specificity towards native complexes of mhc class ii and diabetes-associated autoantigenic peptides |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US36443710P | 2010-07-15 | 2010-07-15 | |
| US61/364,437 | 2010-07-15 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2012007950A2 true WO2012007950A2 (en) | 2012-01-19 |
| WO2012007950A3 WO2012007950A3 (en) | 2012-04-12 |
Family
ID=44504047
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IL2011/000563 Ceased WO2012007950A2 (en) | 2010-07-15 | 2011-07-14 | Isolated high affinity entities with t-cell receptor like specificity towards native complexes of mhc class ii and diabetes-associated autoantigenic peptides |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US20130189284A1 (enExample) |
| EP (1) | EP2593480A2 (enExample) |
| JP (1) | JP2013535963A (enExample) |
| CA (1) | CA2805478A1 (enExample) |
| WO (1) | WO2012007950A2 (enExample) |
Cited By (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016162495A1 (en) * | 2015-04-10 | 2016-10-13 | Midatech Limited | Nanoparticle-based antigen specific immunotherapy |
| WO2016174652A1 (en) | 2015-04-30 | 2016-11-03 | Technion Research & Development Foundation Limited | Chimeric antigen receptors and methods of their use |
| WO2017009853A1 (en) | 2015-07-16 | 2017-01-19 | Yeda Research And Development Co. Ltd. | Genetically modified anti-third party central memory t cells and use of same in immunotherapy |
| WO2017089769A1 (en) * | 2015-11-23 | 2017-06-01 | Immunocore Limited | Peptides |
| US9695410B2 (en) | 2010-07-15 | 2017-07-04 | Technion Research & Development Foundation Limited | Isolated high affinity entities with T-cell receptor like specificity towards native complexes of MHC class II and glutamic acid decarboxylase (GAD) autoantigenic peptides |
| EP3221344A2 (en) * | 2014-11-21 | 2017-09-27 | Immusant Inc. | Peptides for use in treatment and diagnosis of type 1 diabetes |
| EP3197466A4 (en) * | 2014-09-26 | 2018-05-30 | The University Of British Columbia | A combination of kynurenine and antigen presenting cells (apc) as therapeutics and methods for their use in immune modulation |
| WO2018134824A1 (en) | 2017-01-18 | 2018-07-26 | Yeda Research And Development Co. Ltd. | Genetically modified veto cells and use of same in immunotherapy |
| US10792333B2 (en) | 2015-11-23 | 2020-10-06 | Immunocore Limited | Peptides derived from actin-like protein 8 (ACTL8) |
| US10980893B2 (en) | 2015-11-23 | 2021-04-20 | Immunocore Limited | Peptides derived from transient receptor potential cation channel subfamily M member 1 (TRPM1), complexes comprising such peptides bound to MHC molecules |
| WO2023018621A1 (en) | 2021-08-10 | 2023-02-16 | Gamida-Cell Ltd. | Engineered nk cells, methods of their production and uses thereof |
| WO2024026452A1 (en) * | 2022-07-29 | 2024-02-01 | Repertoire Immune Medicines, Inc. | T cell epitopes associated with type 1 diabetes |
| WO2024023521A1 (en) * | 2022-07-27 | 2024-02-01 | The University Of Birmingham | Tolerogenic peptides |
| US12153056B2 (en) | 2019-07-15 | 2024-11-26 | Washington University | Compositions for and methods of diagnosing, prognosing, and treating diabetes |
Citations (40)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3791932A (en) | 1971-02-10 | 1974-02-12 | Akzona Inc | Process for the demonstration and determination of reaction components having specific binding affinity for each other |
| US3839153A (en) | 1970-12-28 | 1974-10-01 | Akzona Inc | Process for the detection and determination of specific binding proteins and their corresponding bindable substances |
| US3850752A (en) | 1970-11-10 | 1974-11-26 | Akzona Inc | Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically |
| US3850578A (en) | 1973-03-12 | 1974-11-26 | H Mcconnell | Process for assaying for biologically active molecules |
| US3853987A (en) | 1971-09-01 | 1974-12-10 | W Dreyer | Immunological reagent and radioimmuno assay |
| US3867517A (en) | 1971-12-21 | 1975-02-18 | Abbott Lab | Direct radioimmunoassay for antigens and their antibodies |
| US3879262A (en) | 1972-05-11 | 1975-04-22 | Akzona Inc | Detection and determination of haptens |
| US3901654A (en) | 1971-06-21 | 1975-08-26 | Biological Developments | Receptor assays of biologically active compounds employing biologically specific receptors |
| US3935074A (en) | 1973-12-17 | 1976-01-27 | Syva Company | Antibody steric hindrance immunoassay with two antibodies |
| US3940475A (en) | 1970-06-11 | 1976-02-24 | Biological Developments, Inc. | Radioimmune method of assaying quantitatively for a hapten |
| US3984533A (en) | 1975-11-13 | 1976-10-05 | General Electric Company | Electrophoretic method of detecting antigen-antibody reaction |
| US3996345A (en) | 1974-08-12 | 1976-12-07 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
| US4034074A (en) | 1974-09-19 | 1977-07-05 | The Board Of Trustees Of Leland Stanford Junior University | Universal reagent 2-site immunoradiometric assay using labelled anti (IgG) |
| US4036945A (en) | 1976-05-03 | 1977-07-19 | The Massachusetts General Hospital | Composition and method for determining the size and location of myocardial infarcts |
| US4098876A (en) | 1976-10-26 | 1978-07-04 | Corning Glass Works | Reverse sandwich immunoassay |
| US4289747A (en) | 1978-12-26 | 1981-09-15 | E-Y Laboratories, Inc. | Immunological determination using lectin |
| US4331647A (en) | 1980-03-03 | 1982-05-25 | Goldenberg Milton David | Tumor localization and therapy with labeled antibody fragments specific to tumor-associated markers |
| US4376110A (en) | 1980-08-04 | 1983-03-08 | Hybritech, Incorporated | Immunometric assays using monoclonal antibodies |
| US4666828A (en) | 1984-08-15 | 1987-05-19 | The General Hospital Corporation | Test for Huntington's disease |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4801531A (en) | 1985-04-17 | 1989-01-31 | Biotechnology Research Partners, Ltd. | Apo AI/CIII genomic polymorphisms predictive of atherosclerosis |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US4879219A (en) | 1980-09-19 | 1989-11-07 | General Hospital Corporation | Immunoassay utilizing monoclonal high affinity IgM antibodies |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| US5011771A (en) | 1984-04-12 | 1991-04-30 | The General Hospital Corporation | Multiepitopic immunometric assay |
| US5192659A (en) | 1989-08-25 | 1993-03-09 | Genetype Ag | Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes |
| US5272057A (en) | 1988-10-14 | 1993-12-21 | Georgetown University | Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase |
| US5281521A (en) | 1992-07-20 | 1994-01-25 | The Trustees Of The University Of Pennsylvania | Modified avidin-biotin technique |
| US5464764A (en) | 1989-08-22 | 1995-11-07 | University Of Utah Research Foundation | Positive-negative selection methods and vectors |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5545807A (en) | 1988-10-12 | 1996-08-13 | The Babraham Institute | Production of antibodies from transgenic animals |
| US5569825A (en) | 1990-08-29 | 1996-10-29 | Genpharm International | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5625126A (en) | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5633425A (en) | 1990-08-29 | 1997-05-27 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5661016A (en) | 1990-08-29 | 1997-08-26 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US6037137A (en) | 1997-02-20 | 2000-03-14 | Oncoimmunin, Inc. | Fluorogenic peptides for the detection of protease activity |
| US6350466B1 (en) | 1994-08-05 | 2002-02-26 | Targesome, Inc. | Targeted polymerized liposome diagnostic and treatment agents |
| US20020114816A1 (en) | 1995-07-14 | 2002-08-22 | Josef Endl | Autoreactive peptides from human glutamic acid-decarboxylase (gad) |
| US20030166277A1 (en) | 2000-04-12 | 2003-09-04 | University Of Rochester | Targeted vaccine delivery systems |
| US20090155292A1 (en) | 2007-03-07 | 2009-06-18 | Pedro Santamaria | Compositions and methods for the prevention and treatment of autoimmune conditions |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2232834A1 (en) * | 1995-09-21 | 1997-03-27 | University Of Utah | Targeting of conjugates of poly(ethylene glycol) and antibodies against glutamic acid decarboxylase to islet cells |
| CA2302779C (en) * | 1997-09-16 | 2010-02-02 | Oregon Health Sciences University | Recombinant mhc molecules useful for manipulation of antigen-specific t-cells |
| EP1319184B1 (en) * | 2000-08-14 | 2007-07-25 | N.V. Organon | Use of antibodies against specific mhc-peptide complexes |
| EP1578775A4 (en) * | 2002-07-12 | 2009-02-11 | Dana Farber Cancer Inst Inc | NEW COMPOSITIONS AND METHOD FOR GENERATING MHC CLASS II COMPOUNDS BY PEPTIDE EXCHANGE |
| CN101039953B (zh) * | 2004-07-23 | 2012-08-15 | 沃尔特及伊莱萨霍尔医学研究院 | 治疗和诊断剂 |
| CA2638892A1 (en) * | 2005-03-18 | 2006-09-28 | Oregon Health & Science University | Recombinant mhc molecules useful for manipulation of antigen-specific t cells |
-
2011
- 2011-07-14 CA CA2805478A patent/CA2805478A1/en not_active Abandoned
- 2011-07-14 US US13/810,248 patent/US20130189284A1/en not_active Abandoned
- 2011-07-14 JP JP2013519215A patent/JP2013535963A/ja active Pending
- 2011-07-14 WO PCT/IL2011/000563 patent/WO2012007950A2/en not_active Ceased
- 2011-07-14 EP EP11746669.8A patent/EP2593480A2/en not_active Withdrawn
Patent Citations (42)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3940475A (en) | 1970-06-11 | 1976-02-24 | Biological Developments, Inc. | Radioimmune method of assaying quantitatively for a hapten |
| US3850752A (en) | 1970-11-10 | 1974-11-26 | Akzona Inc | Process for the demonstration and determination of low molecular compounds and of proteins capable of binding these compounds specifically |
| US3839153A (en) | 1970-12-28 | 1974-10-01 | Akzona Inc | Process for the detection and determination of specific binding proteins and their corresponding bindable substances |
| US3791932A (en) | 1971-02-10 | 1974-02-12 | Akzona Inc | Process for the demonstration and determination of reaction components having specific binding affinity for each other |
| US3901654A (en) | 1971-06-21 | 1975-08-26 | Biological Developments | Receptor assays of biologically active compounds employing biologically specific receptors |
| US3853987A (en) | 1971-09-01 | 1974-12-10 | W Dreyer | Immunological reagent and radioimmuno assay |
| US3867517A (en) | 1971-12-21 | 1975-02-18 | Abbott Lab | Direct radioimmunoassay for antigens and their antibodies |
| US3879262A (en) | 1972-05-11 | 1975-04-22 | Akzona Inc | Detection and determination of haptens |
| US3850578A (en) | 1973-03-12 | 1974-11-26 | H Mcconnell | Process for assaying for biologically active molecules |
| US3935074A (en) | 1973-12-17 | 1976-01-27 | Syva Company | Antibody steric hindrance immunoassay with two antibodies |
| US3996345A (en) | 1974-08-12 | 1976-12-07 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
| US4034074A (en) | 1974-09-19 | 1977-07-05 | The Board Of Trustees Of Leland Stanford Junior University | Universal reagent 2-site immunoradiometric assay using labelled anti (IgG) |
| US3984533A (en) | 1975-11-13 | 1976-10-05 | General Electric Company | Electrophoretic method of detecting antigen-antibody reaction |
| US4036945A (en) | 1976-05-03 | 1977-07-19 | The Massachusetts General Hospital | Composition and method for determining the size and location of myocardial infarcts |
| US4098876A (en) | 1976-10-26 | 1978-07-04 | Corning Glass Works | Reverse sandwich immunoassay |
| US4289747A (en) | 1978-12-26 | 1981-09-15 | E-Y Laboratories, Inc. | Immunological determination using lectin |
| US4331647A (en) | 1980-03-03 | 1982-05-25 | Goldenberg Milton David | Tumor localization and therapy with labeled antibody fragments specific to tumor-associated markers |
| US4376110A (en) | 1980-08-04 | 1983-03-08 | Hybritech, Incorporated | Immunometric assays using monoclonal antibodies |
| US4879219A (en) | 1980-09-19 | 1989-11-07 | General Hospital Corporation | Immunoassay utilizing monoclonal high affinity IgM antibodies |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US5011771A (en) | 1984-04-12 | 1991-04-30 | The General Hospital Corporation | Multiepitopic immunometric assay |
| US4666828A (en) | 1984-08-15 | 1987-05-19 | The General Hospital Corporation | Test for Huntington's disease |
| US4683202B1 (enExample) | 1985-03-28 | 1990-11-27 | Cetus Corp | |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4801531A (en) | 1985-04-17 | 1989-01-31 | Biotechnology Research Partners, Ltd. | Apo AI/CIII genomic polymorphisms predictive of atherosclerosis |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| US5545807A (en) | 1988-10-12 | 1996-08-13 | The Babraham Institute | Production of antibodies from transgenic animals |
| US5272057A (en) | 1988-10-14 | 1993-12-21 | Georgetown University | Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase |
| US5464764A (en) | 1989-08-22 | 1995-11-07 | University Of Utah Research Foundation | Positive-negative selection methods and vectors |
| US5487992A (en) | 1989-08-22 | 1996-01-30 | University Of Utah Research Foundation | Cells and non-human organisms containing predetermined genomic modifications and positive-negative selection methods and vectors for making same |
| US5192659A (en) | 1989-08-25 | 1993-03-09 | Genetype Ag | Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes |
| US5569825A (en) | 1990-08-29 | 1996-10-29 | Genpharm International | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5625126A (en) | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5633425A (en) | 1990-08-29 | 1997-05-27 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5661016A (en) | 1990-08-29 | 1997-08-26 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5281521A (en) | 1992-07-20 | 1994-01-25 | The Trustees Of The University Of Pennsylvania | Modified avidin-biotin technique |
| US6350466B1 (en) | 1994-08-05 | 2002-02-26 | Targesome, Inc. | Targeted polymerized liposome diagnostic and treatment agents |
| US20020114816A1 (en) | 1995-07-14 | 2002-08-22 | Josef Endl | Autoreactive peptides from human glutamic acid-decarboxylase (gad) |
| US6037137A (en) | 1997-02-20 | 2000-03-14 | Oncoimmunin, Inc. | Fluorogenic peptides for the detection of protease activity |
| US20030166277A1 (en) | 2000-04-12 | 2003-09-04 | University Of Rochester | Targeted vaccine delivery systems |
| US20090155292A1 (en) | 2007-03-07 | 2009-06-18 | Pedro Santamaria | Compositions and methods for the prevention and treatment of autoimmune conditions |
Non-Patent Citations (108)
| Title |
|---|
| "Immobilized Cells and Enzymes", 1986, IRL PRESS |
| "Methods in Enzymology", vol. 1-317, ACADEMIC PRESS |
| "PCR Protocols: A Guide To Methods And Applications", 1990, ACADEMIC PRESS |
| "Remington's Pharmaceutical Sciences", MACK PUBLISHING CO. |
| "Vectors: A Survey of Molecular Cloning Vectors and Their Uses", 1988, BUTTERWORTHS |
| A. HASSNER ET AL., TETRAHEDRON LETT., 1978, pages 4475 |
| ANDERSSON, BIOPOLYMERS, vol. 55, no. 3, 2000, pages 227 - 50 |
| AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1989, JOHN WILEY AND SONS |
| AUSUBEL, R. M.,: "Current Protocols in Molecular Biology", vol. I-III, 1994 |
| B. D., AND HIGGINS S. J.,: "Nucleic Acid Hybridization", 1985 |
| B. NEISES ET AL., ANGEW CHEM., INT. ED. ENGL., vol. 17, 1978, pages 522 |
| BACH, J. M., OTTO, H., NEPOM, G. T., JUNG, G., COHEN, H., TIMSIT, J., BOITARD, C., VAN ENDERT, P. M.: "High Affinity Presentation of an Autoantigenic Peptide in Type I Diabetes by an HLA Class II Protein Encoded in a Haplotype Protecting From Disease", JOURNAL OF AUTOIMMUNITY, vol. 10, 1997, pages 375 - 386 |
| BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423 - 426 |
| BIRREN ET AL.: "Genome Analysis: A Laboratory Manual Series", vol. 1-4, 1998, COLD SPRING HARBOR LABORATORY PRESS |
| BOERNER ET AL., J. IMMUNOL., vol. 147, no. 1, 1991, pages 86 - 95 |
| CELLIS, J. E.: "Cell Biology: A Laboratory Handbook", vol. I-III, 1994 |
| CHANG ET AL.: "Somatic Gene Therapy", 1995, CRC PRESS |
| CLOUTIER SM. ET AL., MOLECULAR IMMUNOLOGY, vol. 37, 2000, pages 1067 - 1077 |
| COHEN CJ ET AL., J MOL RECOGNIT., vol. 16, 2003, pages 324 - 32 |
| COHEN CJ, DENKBERG G, LEV A, EPEL M, REITER Y.: "Recombinant antibodies with MHC-restricted, peptide-specific, T-cell receptor-like specificity: new tools to study antigen presentation and TCR-peptide-MHC interactions", JOURNAL OF MOLECULAR RECOGNITION, vol. 16, 2003, pages 324 - 332 |
| COLE ET AL.: "Monoclonal Antibodies and Cancer Therapy", 1985, ALAN R. LISS, pages: 77 |
| COLIGAN J. E.: "Current Protocols in Immunology", 1994 |
| CUMBER ET AL., METHODS OF ENZYMOLOGY, vol. 112, 1985, pages 207 - 224 |
| DAUGHERTY PS. ET AL.: "Antibody affinity maturation using bacterial surface display", PROTEIN ENGINEERING, vol. 11, 1998, pages 825 - 832, XP000941079, DOI: doi:10.1093/protein/11.9.825 |
| DE HAARD H. J., VAN NEER N., REURS A., HUFTON S. E., ROOVERS R. C., HENDERIKX P., DE BRUINE A. P., ARENDS J. W., HOOGENBOOM H. R.: "A large non- immunized human Fab fragment phage library that permits rapid isolation and kinetic analysis of high affinity antibodies", J. BIOL. CHEM., vol. 274, 1999, pages 18218 - 18230, XP002128301, DOI: doi:10.1074/jbc.274.26.18218 |
| DENKBERG, G. ET AL., EUR. J. IMMUNOL., vol. 30, 2000, pages 3522 - 3532 |
| DI LORENZO TP, PEAKMAN M, ROEP BO.: "Translational mini-review series on type 1 diabetes: Systematic analysis of T cell epitopes in autoimmune diabetes", CLIN EXP IMMUNOL., vol. 148, 2007, pages 1 - 16 |
| DUBEL S. ET AL., J IMMUNOL METHODS, vol. 178, 1995, pages 201 |
| E.P. BODEN ET AL., J. ORG. CHEM., vol. 50, 1986, pages 2394 |
| FINGL ET AL.: "The Pharmacological Basis of Therapeutics", 1975, pages: L |
| FISHWILD ET AL., NATURE BIOTECHNOLOGY, vol. 14, 1996, pages 845 - 51 |
| FRESHNEY, R. I.,: "Animal Cell Culture", 1986 |
| G. SCHRODER, K. LUPKE: "The Peptides", vol. 1, 1965, ACADEMIC PRESS |
| G.T. HERMANSON: "Antibody Modification and Conjugation, in Bioconjugate Techniques", 1996, ACADEMIC PRESS |
| GAIT, M. J.,: "Oligonucleotide Synthesis", 1984 |
| GEBE JA, UNRATH KA, FALK BA, ITO K, WEN L, DANIELS TL, LERNMARK A, NEPOM GT: "Clin Immunol. Age-dependent loss of tolerance to an immunodominant epitope of glutamic acid decarboxylase in diabetic-prone RIP-B7/DR4 mice", CLIN IMMUNOL., vol. 121, no. 3, December 2006 (2006-12-01), pages 294 - 304 |
| GEPTS W.: "Pathologic anatomy of pancreas in juvenile diabetes mellitus", DIABETES, vol. 14, 1965, pages 619 - 633 |
| GILBOA, BIOTECHNIQUES, vol. 4, no. 6, 1986, pages 504 - 512 |
| HAMES, B. D., AND HIGGINS S. J.,: "Transcription and Translation", 1984 |
| HAMMER ET AL., CELL, vol. 74, 1993, pages 197 - 203 |
| HARLOW, LANE: "Antibodies: A Laboratory Manual", 1988, COLD SPRING HARBOR LABORATORY |
| HERMANSON: "Bioconjugate Techniques", 1995, ACADEMIC PRESS |
| HOOGENBOOM, WINTER, J. MOL. BIOL., vol. 227, 1991, pages 381 |
| HUSTON JS., METHODS IN ENZYMOLOGY, vol. 203, 1991, pages 46 |
| INBAR ET AL., PROC. NAT1 ACAD. SCI. USA, vol. 69, 1972, pages 2659 - 62 |
| ISHIKAWA E. ET AL., J IMMUNOASSAY, vol. 4, 1983, pages 209 - 327 |
| J. M. STEWART, J. D. YOUNG: "Solid Phase Peptide Synthesis", 1963, W. H. FREEMAN CO. |
| J. MARCH: "Advanced Organic Chemistry: Reaction's, Mechanism, and Structure", 1985, pages: 349 - 50,372-7 |
| J. MEIENHOFER: "Hormonal Proteins and Peptides", vol. 2, 1973, ACADEMIC PRESS, pages: 46 |
| JOHAN ROCKBERG ET AL.: "Epitope mapping of antibodies using bacterial surface display", NATURE METHODS, vol. 5, 2008, pages 1039 - 1045, XP002516298, DOI: doi:10.1038/nmeth.1272 |
| JOHN A. GEBE, SUSAN A. MASEWICZ, SHARON A. KOCHIK, HELENA REIJONEN, GERALD T. NEPOM.: "Inhibition of altered peptide ligand-mediated antagonism of human GAD65-responsive CD4 T cells by non-antagonizable T cells", EUR. J. IMMUNOL., vol. 34, 2004, pages 3337 - 3345 |
| JONES ET AL., NATURE, vol. 321, 1986, pages 522 - 525 |
| KAY M. ET AL., BIOCHEMISTRY, vol. 34, 1995, pages 293 |
| KHATKHATAY MI., DESAI M., J IMMUNOASSAY, vol. 20, 1999, pages 151 - 83 |
| KIPRIYANOV SM. ET AL., HUM ANTIBODIES HYBRIDOMAS, vol. 6, 1995, pages 93 |
| KIPRIYANOV SM. ET AL., PROTEIN ENGINEERING, vol. 9, 1996, pages 203 |
| KROGSGAARD M. ET AL., JOURNAL PF EXPERIMENTAL MEDICINE, 2000, pages 1395 - 1412 |
| KROGSGAARD M., WUCHERPFENNIG KW., CANNELLA B. ET AL.: "Visualization of Myelin Basic Protein (MBP) T Cell Epitopes in Multiple Sclerosis Lesions using a Monoclonal Antibody Specific for the Human Histocompatibility Leukocyte Antigen (HLA)-DR2-MBP 85-99 Complex", JOURNAL OF EXPERIMENTAL MEDICINE, vol. 191, 2000, pages 1395 - 1412 |
| L.J. MATHIAS, SYNTHESIS, 1979, pages 561 |
| LARRICK, FRY, METHODS, vol. 2, 1991, pages 106 - 10 |
| LIEBERMAN SM, DILORENZO TP: "A comprehensive guide to antibody and T-cell responses in type 1 diabetes", TISSUE ANTIGENS, vol. 62, 2003, pages 359 - 77, XP002323391, DOI: doi:10.1034/j.1399-0039.2003.00152.x |
| LIU J, PURDY LE, RABINOVITCH S, JEVNIKAR AM, ELLIOTT JF.: "Major DQ8-restricted T-cell epitopes for human GAD65 mapped using human CD4, DQA1*0301, DQB1*0302 transgenic IA(null) NOD mice", DIABETES, vol. 48, 1999, pages 469 - 77, XP002384579, DOI: doi:10.2337/diabetes.48.3.469 |
| LOHMANN, T., LESLIE, R. D., LONDEI, M: "T cell Clones to Epitopes of Glutamic Acid Decarboxylase 65 Raised from Normal Subjects and Patients with Insulin-dependent Diabetes", JOURNAL OF AUTOIMMUNITY, vol. 9, 1996, pages 385 - 389 |
| LONBERG ET AL., NATURE, vol. 368, 1994, pages 856 - 859 |
| LONBERG, HUSZAR, INTERN. REV. IMMUNOL., vol. 13, 1995, pages 65 - 93 |
| MARKS ET AL., BIO/TECHNOLOGY, vol. 10, 1992, pages 779 - 783 |
| MARKS ET AL., J. MOL. BIOL., vol. 222, 1991, pages 581 |
| MARSHAK ET AL.: "Strategies for Protein Purification and Characterization - A Laboratory Course Manual", 1996, CSHL PRESS |
| MASEWICZ, S. A., PAPADOPOULOS, G. K., SWANSON, E., MORIARITY, L., MOUSTAKAS, A. K., NEPOM, G. T.: "Modulation of T cell response to hGAD65 peptide epitopes", TISSUE ANTIGENS, vol. 59, 2002, pages 101 - 112 |
| MINGYUE HE, MICHAEL J. TAUSSIG: "Ribosome display: Cell-free protein display technology", BRIEFINGS IN FUNCTIONAL GENOMICS AND PROTEOMICS, vol. 1, 2002, pages 204 - 212 |
| MISHELL AND SHIIGI: "Selected Methods in Cellular Immunology", 1980, W. H. FREEMAN AND CO. |
| MORRISON, NATURE, vol. 368, 1994, pages 812 - 13 |
| NEPOM GT, LIPPOLIS JD, WHITE FM, MASEWICZ S, MARTO JA, HERMAN A, LUCKEY CJ, FALK B, SHABANOWITZ J, HUNT DF: "Identification and modulation of a naturally processed T cell epitope from the diabetes-associated autoantigen human glutamic acid decarboxylase 65 (hGAD65", PROC NATL ACAD SCI U S A., vol. 98, no. 4, 13 February 2001 (2001-02-13), pages 1763 - 8, XP055008762, DOI: doi:10.1073/pnas.98.4.1763 |
| NEUBERGER, NATURE BIOTECHNOLOGY, vol. 14, 1996, pages 826 |
| OELLERICH M., J CLIN CHEM CLIN BIOCHEM., vol. 18, 1980, pages 197 - 208 |
| OLING, V., MARTTILA, J., ILONEN, J., KWOK, W. W., NEPOM, G., KNIP, M., SIMELL, O., REIJONEN, H.: "GAD65- and proinsulin-specific CD4+ T-cells detected by MHC class II tetramers in peripheral blood of type 1 diabetes patients and at-risk subjects", JOURNAL OF AUTOIMMUNITY, vol. 25, 2005, pages 235 - 243 |
| OU, D., JONSEN, L. A., METZGER, D. L., TINGLE, A. J.: "CD4+ and CD8+ T-cell clones from congenital rubella syndrome patients with IDDM recognize overlapping GAD65 protein epitopes: Implications for HLA class I and II allelic linkage to disease susceptibility", HUMAN IMMUNOLOGY, vol. 60, 1999, pages 652 - 664 |
| PACK ET AL., BIO/TECHNOLOGY, vol. 11, 1993, pages 1271 - 77 |
| PATEL, S. D., COPE, A. P., CONGIA, M., CHEN, T. T., KIM, E., FUGGER, L., WHERRETT, D., SONDERSTRUP-MCDEVITT, G.: "Identification of immunodominant T cell epitopes of human glutamic acid decarboxylase 65_by using HLA-DR(alpha 1*0101,beta 1*0401) transgenic_mice", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 94, 1997, pages 8082 - 8087 |
| PATRICK DUFNER ET AL.: "Harnessing phage and ribosome display for antibody optimization", TRENDS IN BIOTECHNOLOGY, vol. 24, 2006, pages 523 - 529 |
| PEARCE LA. ET AL., BIOCHEM MOLEC BIOL INTL, vol. 42, 1997, pages 1179 - 1188 |
| PERBAL, B.: "A Practical Guide to Molecular Cloning", 1984 |
| PERBAL: "A Practical Guide to Molecular Cloning", 1988, JOHN WILEY & SONS |
| PORTER, R. R., BIOCHEM. J., vol. 73, 1959, pages 119 - 126 |
| PRESTA, CURR. OP. STRUCT. BIOL., vol. 2, 1992, pages 593 - 596 |
| REIJONEN, H., NOVAK, E. J., KOCHIK, S., HENINGER, A., LIU, A. W., KWOK, W. W., NEPOM, G. T.: "Detection of GAD65-Specific T-Cells by Major Histocompatibility Complex Class II Tetramers in Type 1 Diabetic Patients and At-Risk Subjects", DIABETES, vol. 51, 2002, pages 1375 - 1382, XP003010701, DOI: doi:10.2337/diabetes.51.5.1375 |
| RHARBAOUI, MAYER, GRANIER, BOUANANI, THIVOLET, PAU, ORGIAZZI, MADEC: "T cell response pattern to glutamic acid decarboxylase 65 (GAD65) peptides of newly diagnosed type 1 diabetic patients sharing susceptible HLA haplotypes", CLINICAL & EXPERIMENTAL IMMUNOLOGY, vol. 117, 1999, pages 30 - 37 |
| RICHARD P. HAUGLAND: "Molecular Probes: Handbook of Fluorescent Probes and Research Chemicals, 5th ed.,", 1992, MOLECULAR PROBES, INC. |
| RIECHMANN ET AL., NATURE, vol. 332, 1988, pages 323 - 327 |
| RIECHMANN ET AL., NATURE, vol. 332, 1988, pages 323 - 329 |
| ROEP, B. O., ATKINSON, M. A., VAN ENDERT, P. M., GOTTLIEB, P. A., WILSON, S. B., SACHS, J. A.: "Autoreactive T cell Responses in Insulin-dependent (Type 1) Diabetes Mellitus. Report of the First International Workshop for Standardization of T cell assays", JOURNAL OF AUTOIMMUNITY, vol. 13, 1999, pages 267 - 282 |
| SACHDEV S SIDHU: "Full-length antibodies on display", NATURE BIOTECHNOLOGY, vol. 25, 2007, pages 537 - 538 |
| SAMBROOK ET AL.: "Molecular Cloning: A laboratory Manual", 1989 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRINGS HARBOR LABORATORY |
| SCARANO S, MASCINI M, TURNER AP, MINUNNI M.: "Surface plasmon resonance imaging for affinity-based biosensors", BIOSENS BIOELECTRON, vol. 25, 2010, pages 957 - 66, XP026808881 |
| SCHUURS AH., VAN WEEMEN BK., J IMMUNOASSAY, vol. 1, 1980, pages 229 - 49 |
| See also references of EP2593480A2 |
| STADINSKI ET AL., IMMUNITY, vol. 32, 2010, pages 446 |
| STANFORD C. AND HORTON R.: "Receptors: A Practical Approach," 2nd ed.,", 2001, OXFORD UNIVERSITY PRESS, article GAKAMSKY D. ET AL.: "Evaluating Receptor Stoichiometry by Fluorescence Resonance Energy Transfer" |
| STITES ET AL.: "Basic and Clinical Immunology(8th Edition),", 1994, APPLETON & LANGE |
| STUBBS ET AL., BIOCHEMISTRY, vol. 35, 1996, pages 937 |
| SVENDSEN, P., C. B. ANDERSEN, N. WILLCOX, A. J. COYLE, R. HOLMDAHL, T. KAMRADT, L. FUGGER: "Tracking of Proinflammatory Collagen-Specific T Cells in Early and Late Collagen Induced Arthritis in Humanized Mice", J IMMUNOL, vol. 173, 2004, pages 7037 - 7045, XP002661381 |
| TONKINSON ET AL., CANCER INVESTIGATION, vol. 14, no. 1, 1996, pages 54 - 65 |
| VEGA ET AL.: "Gene Targeting", 1995, CRC PRESS |
| VERHOEYEN ET AL., SCIENCE, vol. 239, 1988, pages 1534 - 1536 |
| WATSON ET AL.: "Recombinant DNA", SCIENTIFIC AMERICAN BOOKS |
| WHITLOW, FILPULA, METHODS, vol. 2, 1991, pages 97 - 105 |
| WISDOM GB., METHODS MOL BIOL., vol. 32, 1994, pages 433 - 40 |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9695410B2 (en) | 2010-07-15 | 2017-07-04 | Technion Research & Development Foundation Limited | Isolated high affinity entities with T-cell receptor like specificity towards native complexes of MHC class II and glutamic acid decarboxylase (GAD) autoantigenic peptides |
| US12551459B2 (en) | 2014-09-26 | 2026-02-17 | The University Of British Columbia | Combination of kynurenine and antigen presenting cells (APC) as therapeutics and methods for their use in immune modulation |
| EP3197466A4 (en) * | 2014-09-26 | 2018-05-30 | The University Of British Columbia | A combination of kynurenine and antigen presenting cells (apc) as therapeutics and methods for their use in immune modulation |
| US10473647B1 (en) | 2014-11-21 | 2019-11-12 | Immusant, Inc. | Peptides for use in treatment and diagnosis of type 1 diabetes |
| EP3221344A2 (en) * | 2014-11-21 | 2017-09-27 | Immusant Inc. | Peptides for use in treatment and diagnosis of type 1 diabetes |
| WO2016162495A1 (en) * | 2015-04-10 | 2016-10-13 | Midatech Limited | Nanoparticle-based antigen specific immunotherapy |
| WO2016174652A1 (en) | 2015-04-30 | 2016-11-03 | Technion Research & Development Foundation Limited | Chimeric antigen receptors and methods of their use |
| WO2017009853A1 (en) | 2015-07-16 | 2017-01-19 | Yeda Research And Development Co. Ltd. | Genetically modified anti-third party central memory t cells and use of same in immunotherapy |
| WO2017089769A1 (en) * | 2015-11-23 | 2017-06-01 | Immunocore Limited | Peptides |
| US10792333B2 (en) | 2015-11-23 | 2020-10-06 | Immunocore Limited | Peptides derived from actin-like protein 8 (ACTL8) |
| US10980893B2 (en) | 2015-11-23 | 2021-04-20 | Immunocore Limited | Peptides derived from transient receptor potential cation channel subfamily M member 1 (TRPM1), complexes comprising such peptides bound to MHC molecules |
| WO2018134824A1 (en) | 2017-01-18 | 2018-07-26 | Yeda Research And Development Co. Ltd. | Genetically modified veto cells and use of same in immunotherapy |
| US12153056B2 (en) | 2019-07-15 | 2024-11-26 | Washington University | Compositions for and methods of diagnosing, prognosing, and treating diabetes |
| WO2023018621A1 (en) | 2021-08-10 | 2023-02-16 | Gamida-Cell Ltd. | Engineered nk cells, methods of their production and uses thereof |
| WO2024023521A1 (en) * | 2022-07-27 | 2024-02-01 | The University Of Birmingham | Tolerogenic peptides |
| WO2024026452A1 (en) * | 2022-07-29 | 2024-02-01 | Repertoire Immune Medicines, Inc. | T cell epitopes associated with type 1 diabetes |
Also Published As
| Publication number | Publication date |
|---|---|
| US20130189284A1 (en) | 2013-07-25 |
| CA2805478A1 (en) | 2012-01-19 |
| JP2013535963A (ja) | 2013-09-19 |
| EP2593480A2 (en) | 2013-05-22 |
| WO2012007950A3 (en) | 2012-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2593551B1 (en) | Isolated high affinity entities with t-cell receptor like specificity towards native complexes of mhc class ii and glutamic acid decarboxylase (gad) autoantigenic peptides | |
| US20130189284A1 (en) | Antibodies with t-cell receptor like specificity towards native complexes of mhc class ii and diabetes-associated autoantigenic peptides | |
| US20140170168A1 (en) | Antibodies which bind soluble t-cell receptor ligands | |
| JP7062640B2 (ja) | 抗cd19抗体に対する抗イディオタイプ抗体 | |
| US9995733B2 (en) | Agents for treating disease | |
| EA030777B1 (ru) | Анти-альфа-синуклеинсвязывающие молекулы | |
| JP2021090454A (ja) | 抗原結合分子及びその使用方法 | |
| JP2022522404A (ja) | T細胞調節抗原提示ポリペプチド及びその使用方法 | |
| KR20110090985A (ko) | 인간 cxcl1 단백질의 면역학적 측정 방법 | |
| US20240150750A1 (en) | Antigen binding molecules and methods of use thereof | |
| JP2004506901A (ja) | 特異的なmhc−ペプチド複合体に対する抗体の使用 | |
| CN115917317A (zh) | 用于测定表达嵌合抗原的免疫细胞的体外肿瘤杀伤活性的基于细胞的测定法 | |
| JP7797469B2 (ja) | 抗klk2抗体に対する抗イディオタイプ抗体 | |
| Marshall et al. | Engineering and characterization of a novel fusion protein incorporating B7. 2 and an anti–ErbB-2 single-chain antibody fragment for the activation of Jurkat T cells | |
| US20040248257A1 (en) | SPEX compositions and methods of use | |
| CN120035444A (zh) | 针对psma的亲和结合实体及其使用方法 | |
| JP2002503094A (ja) | 活性化レセプタに会合される新しいポリペプチド及びその生物学的応用 | |
| CA3241395A1 (en) | Antibodies and uses thereof | |
| EP2957571B1 (en) | Monoclonal anti-pvhl antibodies and uses thereof | |
| RU2845938C1 (ru) | Клеточный анализ для определения активности киллинга опухолевых клеток, экспрессирующих химерные антигены иммунных клеток in vitro | |
| US20250122302A1 (en) | Antigen binding proteins specifically binding ct45 | |
| CN121978342A (en) | Cell-based assays for determining in vitro tumor killing activity of immune cells expressing chimeric antigens | |
| CN117529501A (zh) | 针对抗cd79b抗体的抗独特型抗体 | |
| WO2025125234A1 (en) | High affinity antibodies specifically binding to pepsinogen c | |
| EA052990B1 (ru) | Химерный антигенный рецептор антител к hk2 (car) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11746669 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2805478 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2013519215 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13810248 Country of ref document: US Ref document number: 224251 Country of ref document: IL |
|
| REEP | Request for entry into the european phase |
Ref document number: 2011746669 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011746669 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 224251 Country of ref document: IL |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112013000988 Country of ref document: BR |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: 112013000988 Country of ref document: BR |
|
| ENPW | Started to enter national phase and was withdrawn or failed for other reasons |
Ref document number: 112013000988 Country of ref document: BR |