WO2011146985A1 - Méthode de détermination de la réponse à un traitement par une composition immunomodulatrice - Google Patents

Méthode de détermination de la réponse à un traitement par une composition immunomodulatrice Download PDF

Info

Publication number
WO2011146985A1
WO2011146985A1 PCT/AU2011/000627 AU2011000627W WO2011146985A1 WO 2011146985 A1 WO2011146985 A1 WO 2011146985A1 AU 2011000627 W AU2011000627 W AU 2011000627W WO 2011146985 A1 WO2011146985 A1 WO 2011146985A1
Authority
WO
WIPO (PCT)
Prior art keywords
allele
hla
response
subject
treatment
Prior art date
Application number
PCT/AU2011/000627
Other languages
English (en)
Inventor
Vijayaprakash Suppiah
David Booth
Graeme Stewart
Jacob George
Silvana Gaudieri
Simon Mallal
Original Assignee
The University Of Sydney
Western Sydney Local Health Network
Murdoch University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2010902565A external-priority patent/AU2010902565A0/en
Application filed by The University Of Sydney, Western Sydney Local Health Network, Murdoch University filed Critical The University Of Sydney
Publication of WO2011146985A1 publication Critical patent/WO2011146985A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C12Q1/706—Specific hybridization probes for hepatitis
    • C12Q1/707—Specific hybridization probes for hepatitis non-A, non-B Hepatitis, excluding hepatitis D
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the present invention is in the field of diagnostic and prognostic assays for medical conditions that are treated using an immunomodulatory composition, and improved therapeutic methods based on the diagnostic and prognostic assays of the invention.
  • Immunomodulatory compositions comprise drug compounds that act by modulating certain key aspects of the immune system in the treatment of viral diseases, neoplasias, Thl -mediated diseases, Th2 -mediated diseases, or Thl7-mediated diseases, substantially by modulating expression or secretion of one or more cytokines involved in autoimmunity and/or immune responses to infectious agents, or by modulating one of more components of a cytokine signalling pathway.
  • Cytokines may be interferons (IFNs, e.g., Type I IFNs such as IFN-a, IFN- ⁇ , or IFN-co; or Type II IFNs such as IFN- ⁇ ; or Type III IFNs such as IFN- ⁇ , WN- 2, or IFN- 3), interleukins (e.g., IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL- 12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-21, or IL-35), a tumor necrosis factor (e.g., TNF-a or TNF- ⁇ ), or colony-stimulating factor (CSF).
  • IFNs interferons
  • Type IFNs such as IFN-a, IFN- ⁇ , or IFN-co
  • Type II IFNs such as IFN- ⁇
  • the IFNs generally assist immune responses by inhibiting viral replication within host cells, activating cytotoxic T cells and macrophages, increasing antigen presentation to lymphocytes, inducing resistance to viral and intracellular bacterial infections, and controlling tumors. Additionally, the Type III IFNs exert a regulatory effect on Th2 cells. Interleukins promote development and differentiation of T cells, B cells and hematopoietic cells. Tumor necrosis factors regulate cells of the immune systems to stimulate acute phase inflammatory responses, induce apoptotic cell death, inhibit tumorigenesis and inhibit viral replication. Although IFNs may be produced by a number of different cells, IFN- ⁇ is produced predominantly by Thl cells, and interleukins and TNF-a are produced by Thl cells and/or Th2 cells.
  • Thl cells and Th2 cells are effector T cells defined by their cytokine secretion profiles. Thl cells mediate cellular immunity to protect against intracellular pathogens and immunogens via the actions of cytotoxic T lymphocytes and activated macrophages and complement-fixing and complement-opsonizing antibodies. Thl cells produce IL- 2, which stimulates growth and differentiation of T cell responses mediated by Thl cells, as well as producing IFN- ⁇ and TNF- ⁇ . On the other hand, Th2 cells mediate humoral immunity and allergic responses to protect against extracellular pathogens and antigens via the actions of B cells, mast cells and eosinophils. Th2 cells produce IL-3, IL-4, IL-5, and IL-10, which stimulate production of IgE antibodies, and also recruitment, proliferation, differentiation, maintenance and survival of eosinophils.
  • Thl -mediated and Th2 -mediated diseases are driven by disruption of the balance between Thl cells and Th2 cells.
  • the finely-tuned balance of Thl and Th2 cells is regulated by cytokine secretion and, under normal circumstances, Th2 cells secrete IL-4 and IL-10 which down-regulate Thl cells thereby regulating production of IFN- ⁇ , TNF- ⁇ and IL-2.
  • IL-10 is a potent inhibitor of Thl cells.
  • IFNs such as IFN- ⁇ also drive Thl cell production.
  • IL-4 drives Th2 cell production and IFN- ⁇ inhibits Th2 cells.
  • Thl -mediated diseases e.g., multiple sclerosis (MS), rheumatoid arthritis (RA), Type I diabetes (IDDM) and scleroderma
  • DTH delayed type hypersensitivity
  • MS a Thl/Th2 imbalance in the central nervous system leads to proliferation of pro-inflammatory CD4 + Thl cells, IFN- ⁇ secretion, macrophage activation and consequential immune-mediated injury to myelin and oligodendrocytes, wherein the IFN- ⁇ release in this case may also drive Thl cell overproduction.
  • Thl/Th2 imbalance occurs in the thymus and periphery leading to progressive elimination of functional Th2 cells as autoreactive Thl cells become activated and mediate pancreatic islet ⁇ -cell destruction.
  • the administration of IL-12 may restore Thl/Th2 immune balance.
  • Th2 -mediated diseases e.g., Con A hepatitis, atopic dermatitis, asthma and allergy, are generally characterized by over-production of IgE antibodies and/or eosinophilia as a consequence of a Thl/Th2 imbalance.
  • Con A hepatitis
  • repeated injections of Con A shift an initial Thl response to a Th2 and profibrogenic response, with over-production and secretion of IL-4, IL-10 and TGF- ⁇ in the liver activating natural killer T cells as part of an innate immune response thereby causing liver damage.
  • Thl 7 cells provide an effector arm distinct from Thl and Th2 cells and, like Treg (iTreg), are regulated by TGF- ⁇ . Thl 7 cellular differentiation is important for host defense e.g., against bacteria and fungi, and poor regulation of Thl 7 cellular function is implicated in immune pathogenesis of autoimmune and inflammatory diseases.
  • Infections by a number of different viruses are treated using immunomodulatory compositions, including infections by human papillomaviruses such as HP VI 6, HPV6, HPV11 ; infections by herpesviruses such as HSV-1, HSV-2, VZV, HHV-6, HHV-7, HHV-8 (KSHV), HCMV and EBV; infections by picornaviruses such as the Coxsackie B viruses and encephalomyocarditis virus (EMCV); infections by flaviviruses such as the encephalitis viruses and hepatitis viruses e.g., hepatitis A virus, hepatitis B virus (HBV) and hepatitis C virus (HCV); arenaviruses such as those associated with a viral haemorrhagic fever; infections by togaviruses such as equine encephalitis viruses; infections by bunyaviruses such as Rift Valley fever virus, Crimean-Congo haemorrhagi
  • Neoplasias are also treated using immunomodulatory compositions e.g., HPV-associated cancer such as cervical intrapepithelial neoplasia, cervical carcinoma, vulvar intraepithelial neoplasia, penile intraepithelial neoplasia, perianal intraepithelial neoplasia; hepatocellular carcinoma; basal cell carcinoma, squamous cell carcinoma, actinic keratosis, and melanoma.
  • Certain Th2-mediated diseases e.g., asthma, allergic rhinitis, atopic dermatitis, are also treated using immunomodulatory compositions.
  • cytokines per se as immunodulatory compositions.
  • IFNs are known to be used for treatment of infections by several positive-sense single- stranded RNA viruses i.e., (+) ssRNA viruses, including e.g., SARS-associated coronavirus, HBV, HCV, coxsackie B virus, EMCV, and for treatment of infections by several negative-sense single-stranded RNA viruses i.e., (-) ssRNA viruses, including e.g., Ebola virus, VSV, IAV, HTNV and APEUV (see e.g., De Clerq Nature Reviews 2, 704-720 (2004); Li et al, J. Leukocyte Biol, online publication DOI: 10.1189/jlb.1208761 (Apr 30, 2009).
  • (+) ssRNA viruses including e.g., SARS-associated coronavirus, HBV, HCV, coxsackie B virus, EMCV
  • EMCV negative-sense single-stranded RNA viruses
  • the IFN especially IFN-a may be pegylated.
  • Pegylated IFN- ⁇ is currently in clinical trial for treatment of chronic HCV infection, and has been shown to be useful for protecting isolated cells against VSV, EMCV, HTNV, APEUV, IAV, HSV-1, HSV-2 and HBV, (see e.g., Li et al, J. Leukocyte Biol, online publication DOI: 10.1189/jlb.1208761, Apr 30, 2009).
  • IFN-a is also known to be used in the treatment of certain lesions and neoplasias e.g., condylomata acuminata, hairy cell leukemia, Kaposi's sarcoma, melanoma, non- Hodgkin's lymphoma, however IFN- ⁇ has been shown to have potent anti-tumor activity against human astrocytoma/glioblastoma cells, whereas IFN- ⁇ has been shown to have activity against glioblastoma cells, thymoma cells and fibrosarcoma cells, and IFN- 2 has been shown to have activity against melanoma and fibrosarcoma cells ⁇ see e.g., Li et al, J.
  • Leukocyte Biol. online publication DOI: 10.1189/jlb.1208761, Apr 30, 2009). It is also known to use IFN- ⁇ for treatment of relapsing forms of Thl- mediated diseases such as MS. ⁇ - ⁇ 2 has also been shown to protect against certain Th2-mediated diseases e.g., asthma and Con A-induced hepatitis (see e.g., Li et al, J. Leukocyte Biol., online publication DOI: 10.1189/jlb.l 208761, Apr 30, 2009).
  • immunomodulatory compositions comprising IFN- ⁇ / ⁇ may act, at least in part, to induce IFN- ⁇ proteins as effector molecules.
  • the receptor complex for Type I IFNs consists of a heterodimeric IFNAR1/IFNAR2 complex, whereas Type III IFNs signal through a heterodimeric IL-28Ra/IL-10R2 receptor e.g., Li et al, J. Leukocyte Biol, online publication DOI: 10.1189/jlb.l 208761 (Apr 30, 2009).
  • IL-28Ra/IL-10R2 is expressed in far fewer contexts than IFNAR1/IFNAR2. This suggests that therapy using immunomodulatory compositions comprising IFN- ⁇ / ⁇ may be less specific than therapy using immunomodulatory compositions comprising IFN- ⁇ .
  • IFN- ⁇ / ⁇ may activate both receptor types i.e., directly via action of IFN- ⁇ / ⁇ on IFNAR1/IFNAR2 receptors and indirectly via induction of IFN- ⁇ and subsequent action of IFN- ⁇ on IL-28Ra/IL-10R2 receptors.
  • administration of IFN- ⁇ is likely to activate selectively IL-28Ra/IL-10R2 receptors.
  • all IFNs activate the Jak/STAT pathways and generally induce common interferon-stimulated genes (ISGs) that mediate the biological effects of IFNs e.g., Siren et al, J. Immunol 174, 1932-1937 (2005), Ank et al, J.
  • immunomodulatory compositions that induce IFN production e.g., poly(I)- poly(C), poly(I)-poly(C) 2 -U) or ampligen, and deazaneplanocin A, are also used in the treatment of infections by e.g., coxsackie B virus, Ebola virus and for certain flaviviruses and bunyaviruses that are amenable to treatment with IFNs (De Clerq Nature Reviews 2, 704-720 (2004).
  • Immunomodulatory compounds may also exert their activity by activating Toll-like receptors (TLRs) to induce selected cytokine biosynthesis.
  • TLRs Toll-like receptors
  • Immunomodulatory guanosine analogs such as those having substituents at the 7- position and/or 8-position, e.g., Reitz et al., J. Med. Chem. 37, 3561-3578 (1994) Michael et al., J. Med. Chem. 36, 3431-3436 (1993) have been shown to stimulate the immune system, whilst 5'-0-proprionyl and 5'-0-butyryl esters of 2-amino-6-methoxy- 9-(p-D-arabinofuranosyl)-9H-purine inhibit varicella zoster virus (VZV) e.g., U.S. Pat. No. 5,539,098 to Krenitsky.
  • VZV varicella zoster virus
  • guanosine analogs in particular 6-alkoxy derivatives of arabinofuranosyl purine, are useful for anti-tumor therapy e.g., U.S. Pat. No. 5,821,236 to Krenitsky.
  • the 7-deazaguanosine analogs have been shown to exhibit antiviral activity in mice against a variety of RNA viruses, whereas 3-deazaguanine analogs have significant broad spectrum antiviral activity against certain DNA and RNA viruses e.g., Revankar et al., J. Med. Chem.
  • Guanosine analogs e.g., ribavirin and derivatives thereof e.g., acetate salts or ribavirin 5'-monophosphate or ribavirin 5'- diphosphate or ribavirin 5'-triphosphate or ribavirin 3',5'-cyclic phosphate or the 3- carboxamidine derivative taribavirin (viramidine), 7-benzyl-8-bromoguanine, 9-benzyl- 8-bromoguanine, and CpG-containing oligonucleotides, that shift the Thl/Th2 balance and are useful for the treatment of Thl -mediate or Th2 -mediated disease depending upon their cytokine profiles.
  • acetate salts e.g., acetate salts or ribavirin 5'-monophosphate or ribavirin 5'- diphosphate or ribavirin 5'-triphosphate or ribavirin 3',5'-cyclic
  • lymphokines IL-1, IL-6, IFN-a and TNF-a have been shown to elicit various effects on lymphokines IL-1, IL-6, IFN-a and TNF-a e.g., Goodman, Int. J. Immunopharmacol, 10, 579-588 (1988); U.S. Pat. No. 4,746,651; Smee et al, Antiviral Res. 15, 229 (1991); Smee et al., Antimicrobial Agents and Chemotherapy 33, 1487- 1492 (1989).
  • 7-benzyl-8-bromoguanine and 9-benzyl-8-bromoguanine selectively inhibit Thl cytokine production, specifically IL-2 and IFN- ⁇ and therefore may be useful in the treatment of Thl -related autoimmune disease, which manifests activated T cells and overproduction of IFN- ⁇ , and target leukemia and lymphoma cells, e.g., Poluektova et al., Int. J. Immunopharmacol.21, 777-792 (1999).
  • ribavirin shifts an immune response from Th2 toward a Thl cytokine profile, and is useful for treatment of Th2 -mediated diseases.
  • Ribavirin is useful in post-exposure prophylaxis of exposure to e.g., arenaviruses causing Lassa fever or Crimean-Congo hemorrhagic fever, HTNV, West Nile Virus, chronic HCV infection, AIV and RSV.
  • cidofovir [(S) ⁇ -(3- hydroxy-2-phosphonylmethoxypropyl)cytosine, (HPMPC] e.g., Abdulkarin et al, Oncogene 21, 2334-2346, (2002).
  • Cidofovir is used in the treatment of a number of viral conditions including HCMV-retinitis in AIDS patients and other HCMV infections and poxvirus infections.
  • immunomodulatory compositions include small organic molecule imidazoquinoline amine derivatives e.g., U.S. Pat. Nos. 4,689,338 and 6,069,149; purine derivatives e.g., U.S. Pat. Nos. 6,028,076 and 6,376,501; imidazopyridine derivatives; e.g., U.S. Pat. No. 6,518,265; benzimidazole derivatives e.g., U.S. Pat. No. 6,387,938); adenine derivatives e.g., U.S. Pat. No.
  • the immunosuppressive agent mycophenolate mofetil inhibits coxsackie B3 virus-induced myocarditis (see, e.g., Padalko et al, BMC Microbiol. 3, 25 et seq. (2003).
  • immunomodulatory compositions produce adverse side-effects, suggesting a benefit in limiting their application to contexts where therapeutic benefit outweighs detrimental effects.
  • the IFNs may cause, inter alia, psychiatric disorders, depression, anaphylxis, thrombocytopenia, seizure, cardiomyopathy, hepatotoxicity, flu-like symptoms, fever, fatigue, headache, muscle pain, convulsions, dizziness, erythema and immunosuppression through neutropenia, and interleukins e.g., IL-1, may cause dose- related fever and flu-like symptoms.
  • guanosine analogs may be teratogenic with prolonged use.
  • the efficacy of immunomodulatory compositions for particular indications may be highly variable, and therapeutic outcome is likely to be influenced by host factors e.g., genotype.
  • host factors e.g., genotype.
  • racial differences may affect suitability of subjects for therapy with immunomodulators.
  • HLA haplotype effects governing both innate and adaptive immune responses of subjects, are also known to affect viral clearance.
  • MHC class I proteins are a diverse class of heterodimeric receptors that present antigen fragments to cytotoxic T-cells via the CD8 receptor on the cytotoxic T-cells, and also bind to a diverse class of inhibitory and activating receptors on natural killer (NK) cells, interaction e.g., an additive interaction or epistatic interaction between expressed HLA Class I alleles can produce variations in immune responses.
  • HLA gene dosage effects can also be significant in determining innate immune responses of subjects.
  • means for identifying and selecting those patients who are likely to respond to treatment with an immunomodulatory composition may provide a substantial therapeutic benefit to those patients that are either non-responders, low- responders or relapsers, by avoiding inappropriate prescriptions to those patient classes and reducing the anxiety caused by subsequent treatment failure. More accurate prescription of drugs to responders also provides for reduced subsidies by health agencies. Moreover, for those conditions in which alternative therapies are available, such means may also provide for selection of the most appropriate therapy for a particular patient.
  • the HLA-C gene locus encodes ligands for the natural killer (NK) cell immunoglobulin-like receptor-2 isoforms (KIR2DL), wherein a functional dimorphism determines KIR2DL specificity such that HLA-C group 1 (HLA-Cl) alleles encoding HLA-C comprising Asn80 bind to the inhibitory receptors KIR2DL2 and KIR2DL3 and to the activating KIR2DS2 receptor, and HLA-C group 2 (HLA-C2) alleles encoding HLA-C comprising Lys80 bind to the inhibitory receptor KIR2DL1 and to the activating receptor KIR2DS.
  • HLA-C group 1 HLA-Cl
  • HLA-C molecules that permit their classification into HLA-Cl or HLA- C2 genotypes are provided by the IMGT/HLA database of the European Bioinformatics Institute (EBI), Wellcome Trust, Genome Campus, Hinxton, Cambridge CB10 1SD, United Kingdom. See e.g., Robinson et al, Nucleic Acids Res. 31, 311-314 (2003).
  • HLA-Cl molecules Based on primary amino acid sequence data available in the IMGT/HLA database as at 7 February, 2011, exemplary HLA-Cl molecules include most HLA-Cwl , HLA-Cw3, HLA-Cw7, HLA-Cw8, HLA-Cwl2, HLA-Cwl3, HLA-Cwl4 and HLA-Cwl6 genotypes, in addition to HLA-Cw*0227 and HLA-Cw*041 1, HLA-Cw*0429, HLA- Cw*0436, HLA-Cw*0455, HLA-Cw*0611, HLA-Cw*1507, HLA-Cw*1525, and HLA-Cw*1543.
  • exemplary HLA-C2 molecules include most HLA-Cw2, HLA-Cw4, HLA-Cw5, HLA-Cw6, HLA-Cwl 5, HLA-Cwl 7 and HLA-Cwl 8 genotypes, in addition to HLA-Cw*0114, HLA-Cw*0307, HLA- Cw*0315, HLA-Cw*0345, HLA-Cw*0707, HLA-Cw*0709, HLA-Cw*0776, HLA- Cw*0810, HLA-Cw*1204, HLA-Cw*1205, HLA-Cw*1209, HLA-Cw* 1221 , HLA- Cw*l233, HLA-Cw*1241, HLA-Cw*1412, HLA-Cw*1602, HLA-Cw* 1609, HLA- Cw*1612, HLA-Cw*1619, and HLA-Cw*1625.
  • Knapp et al, Heptol. 51, 1168-1175, 2009 sought to determine whether or not the KIRD2L3 /HLA-Cl gene combination provides an advantage in HCV-exposed injection drug user having apparent resistance to HCV infection i.e., because they remain seronegative and aviremic, and in chronically-infected subjects who successfully clear HCV with treatment.
  • Knapp et al. found a stronger association between homozygosity for KIR2DL3 in combination with a HLA-C 1 allotype in exposed seronegative aviremic subjects than for subjects with chronic HCV infection.
  • Knapp et al. also concluded that homozygosity for KIR2DL3 in combination with a HLA-C 1 allotype was indicative of an improved response to antiviral therapy as determined by sustained virological response (SVR).
  • SVR sustained virological response
  • the inventors sought to develop improved tests for determining a response of individuals with chronic HCV infection to treatment with immunomodulatory compositions such as comprising IFNs, specifically pegylated IFN- a, in combination with ribavirin.
  • immunomodulatory compositions such as comprising IFNs, specifically pegylated IFN- a, in combination with ribavirin.
  • the inventors sought to ascertain epistatic interactions between such IL28B alleles and alleles at other loci that are associated with viral clearance in response to treatment. More particularly, the inventors sought to ascertain additive and/or epistatic interactions between HLA Class I alleles and IL28B alleles that provide a basis for improved tests for determining a response e.g., a low response (LR) or high response (HR), to antiviral therapy.
  • LR low response
  • HR high response
  • the inventors were particularly interested in determining combinations of IL28B alleles with HLA-C alleles, that provide an improved predictor of the
  • the inventors sought to determine whether or not HLA-C2 homozygosity, or a combination of one or more HLA-C2 alleles and one or more IL28B alleles in a subject's genome, is predictive of a response e.g., a low response (LR) or high response (HR) to antiviral therapy.
  • a response e.g., a low response (LR) or high response (HR) to antiviral therapy.
  • the present inventors sought to determine whether or not one or more HLA-C 1 alleles, or a combination of one or more HLA-C 1 alleles and one or more IL28B alleles, is predictive of a response e.g., a low response (LR) or high response (HR) to antiviral therapy.
  • the inventors performed HLA-C genotyping and serotyping and IL28B genotyping on a cohort of about 910 HCV-infected subjects, and determined associations between HLA-C alleles and/or IL28B alleles and responsiveness to therapy.
  • HLA-C2 alleles are more prevalent in the genome of subjects having poor responses to therapy.
  • Data in Table 9 hereof demonstrate that HLA-C2 alleles as a class are also represented more frequently in the genomes of subjects that do not respond to antiviral therapy, or respond less-well to therapy.
  • the positive predictive value of homozygosity of HLA-C2 for a poor response to therapy is about 73%, compared to only about 62% for the carriage of HLA-C2 allele, and this association is highly significant (Table 10).
  • HLA-C2 homozygosity when combined with one or more copies of a low response (LR) allele linked to IL28B e.g., the G allele (LR allele) of rs8099917 (Tables 1 1-13) and/or the G allele (LR allele) of rs4803221 (Table 13) and/or the T allele (LR allele) of rsl2979860 (Table 13), in a subject's genome is more highly predictive of a low response or poor response or non- response to antiviral therapy with immunomodulatory agent(s) than the corresponding IL28B marker solus or HLA-C2 marker solus, and preferably better than another previously-identified IL28B marker solus.
  • LR low response
  • HLA-C2/IL28B- LR allele combinations are especially evident from a comparison of the treatment responses of HLA-C2 homozygotes carrying one IL28B-LR allele in his/her genome to the treatment responses of subjects carrying at least one HLA-C 1 allele and at least one IL28B-LR allele and/or to the treatment responses of subjects two copies of the corresponding high response (HR) allele.
  • data presented herein demonstrate a positive predictive value of greater than 80% for the association between subjects not having a sustained viral response to therapy and a genotype comprising HLA-C2 homozygosity combined with either at least one LR allele of rs4803221 or at least one LR allele of rs8099917, whereas the positive predictive value of at least one HLA-C 1 allele and at least one of those LR alleles is only 60-69%, and the positive predictive value of two copies of the corresponding high response (HR) allele is only about 60% (Table 13).
  • HLA-C2 allele shall be taken to mean an allele of the HLA-C gene of humans that encodes an HLA-C polypeptide comprising a lysine (K) residue at a position corresponding to position 80 of a full-length HLA-C polypeptide.
  • Particularly preferred HLA-C2 molecules will also comprise an asparagine (N) residue at a position corresponding to position 77 of a full-length HLA-C polypeptide.
  • an HLA-C2 allele is associated with a weak or poor patient response in the population to antiviral therapy with an immunomodulatory agent such as pegylated IFN-oc or a combination comprising pegylated IFN-oc and ribavirin.
  • HLA-C2 molecules include HLA-Cw2, HLA-Cw4, HLA-Cw5, HLA-Cw6, HLA-Cwl5, HLA-Cwl7 and HLA-Cwl 8 genotypes other than HLA-Cw*0227 and HLA-Cw*0411, HLA-Cw*0429, HLA-Cw*0436, HLA-Cw*0455, HLA-Cw*0611, HLA-Cw*1507, HLA-Cw* 1525, or HLA-Cw* 1543.
  • HLA-C2 homozygosity refers to two copies of any HLA-C2 allele at the same locus in the genome of a subject.
  • HLA-C 1 allele shall be taken to mean an allele of the HLA-C gene of humans that encodes an HLA-C polypeptide comprising an asparagine (N) residue at a position corresponding to position 80 of a full-length HLA-C polypeptide.
  • Particularly preferred HLA-Cl molecules will also comprise a serine (S) residue at a position corresponding to position 77 of a full-length HLA-C polypeptide.
  • an HLA-Cl allele is associated with a better patient response in the population to antiviral therapy with an immunomodulatory agent such as pegylated IFN-a or a combination comprising pegylated IFN-a and ribavirin, and preferably a sustained virological response (SVR) to said therapy.
  • an immunomodulatory agent such as pegylated IFN-a or a combination comprising pegylated IFN-a and ribavirin, and preferably a sustained virological response (SVR) to said therapy.
  • HLA-Cl molecules include HLA-Cwl, HLA-Cw3, HLA-Cw7, HLA-Cw8, HLA-Cwl2, HLA-Cwl3, HLA-Cwl4, HLA-Cwl6, HLA-Cw*0227, HLA-Cw*0411, HLA-Cw*0429, HLA-Cw*0436, HLA-Cw*0455, HLA-Cw*0611, HLA-Cw* 1507, HLA-Cw* 1525, and HLA-Cw* 1543, and being other than HLA-Cw*0114, HLA-Cw*0307, HLA-Cw*0315, HLA-Cw*0345, HLA- Cw*0707, HLA-Cw*0709, HLA-Cw*0776, HLA-Cw*0810, HLA-Cw*1204, HLA- Cw* 1205, HLA-Cw*1209, HLA-Cw*1221, H
  • allele linked to IL28B shall be taken to include any allele positioned within in the 5'-upstream region or 3'-downstream region of the IL28B gene including the IL28A/IL28B intergenic region, or any allele positioned in a promoter region, 3 '-untranslated region, exon or intron of the IL28B gene.
  • the allele may be in genomic DNA, and/or in transcribed mRNA where applicable.
  • Tables 1-7 hereof provide alleles linked to IL28B that are useful in combination with HLA-C2 homozygosity for determining the likelihood that a subject will respond to treatment with an immunomodulatory composition, especially the likelihood that a subject having a chronic HCV infection will respond to treatment with an immunomodulatory composition comprising IFN-a, such as a composition comprising IFN-a and ribavirin.
  • Preferred alleles linked to IL28B that may be combined with HLA-C2 homozygosity are positioned in the 5 '-upstream region or intergenic IL28A/IL28B region of the human genome.
  • rs4803221 shall be taken to mean the polymorphic region that is positioned within the 5 '-upstream flanking region of the IL28B gene of humans, wherein said polymorphic region comprises the sequence set forth in SEQ ID NO: 41 or a complementary nucleotide sequence thereto.
  • the term “rs4803221” shall also be taken to refer to the single nucleotide polymorphism contained within SEQ ID NO: 41 e., at position 31 thereof.
  • the term “rs4803221” shall be taken to refer to the HR allele and/or the LR allele of rs4803221.
  • HR allele of rs4803221 or “C allele of rs4803221” or “rs4803221 -HR” shall be taken to refer to an allele of rs4803221 comprising cytosine at a position corresponding to position 31 of SEQ ID NO: 159 in the context of a sequence comprising SEQ ID NO: 159, or within the context of a shorter sequence comprising at least about 5 or 6 or 7 or 8 or 9 or 10 or 1 1 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 contiguous nucleotides of SEQ ID NO: 159 including the cytosine at position 31 of SEQ ID NO: 159.
  • the HR allele of rs4803221 is associated with a better patient response in the population to antiviral therapy with an immunomodulatory agent such as pegylated IFN-a or a combination comprising pegylated IFN-a and ribavirin, and preferably a sustained virological response (SVR) to said therapy.
  • an immunomodulatory agent such as pegylated IFN-a or a combination comprising pegylated IFN-a and ribavirin, and preferably a sustained virological response (SVR) to said therapy.
  • LR allele of rs4803221 or “G allele of rs4803221” or “rs4803221-LR” shall be taken to refer to an allele of rs4803221 comprising guanine or guanosine at a position corresponding to position 31 of SEQ ID NO: 160 in the context of a sequence comprising SEQ ID NO: 160, or within the context of a shorter sequence comprising at least about 5 or 6 or 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 contiguous nucleotides of SEQ ID NO: 160 including the guanine or guanosine at position 31 of SEQ ID NO: 160.
  • the LR allele of rs4803221 is associated with a weak or poor patient response in the population to antiviral therapy with an immunomodulatory agent such as pegylated IFN-a, or a combination comprising pegylated IFN-a and ribavirin.
  • an immunomodulatory agent such as pegylated IFN-a, or a combination comprising pegylated IFN-a and ribavirin.
  • rs8099917 shall be taken to mean the polymorphic region that is positioned within the 5 '-upstream flanking region of the IL28B gene of humans, wherein said polymorphic region comprises the sequence set forth in SEQ ID NO: 4 or a complementary nucleotide sequence thereto.
  • rs8099917 shall also be taken to refer to the single nucleotide polymorphism contained within SEQ ID NO: 4 i.e., at position 31 thereof. Unless the context requires otherwise, the term “rs8099917” shall be taken to refer to the HR allele and/or the LR allele of rs8099917.
  • HR allele of rs8099917 or “T allele of rs8099917” or “rs8099917-HR” shall be taken to refer to an allele of rs8099917 comprising thymidine or uracil at a position corresponding to position 31 of SEQ ID NO: 5 in the context of a sequence comprising SEQ ID NO: 5, or within the context of a shorter sequence comprising at least about 5 or 6 or 7 or 8 or 9 or 10 or 1 1 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 contiguous nucleotides of SEQ ID NO: 5 including the thymidine (or a uracil) at position 31 of SEQ ID NO: 5.
  • the HR allele of rs8099917 is associated with a better patient response in the population to antiviral therapy with an immunomodulatory agent such as pegylated IFN-a or a combination comprising pegylated IFN-a and ribavirin, and preferably a sustained virological response (SVR) to said therapy.
  • an immunomodulatory agent such as pegylated IFN-a or a combination comprising pegylated IFN-a and ribavirin, and preferably a sustained virological response (SVR) to said therapy.
  • LR allele of rs8099917 or "G allele of rs8099917” or “rs8099917-LR” shall be taken to refer to an allele of rs8099917 comprising guanine or guanosine at a position corresponding to position 31 of SEQ ID NO: 6 in the context of a sequence comprising SEQ ID NO: 6, or within the context of a shorter sequence comprising at least about 5 or 6 or 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 contiguous nucleotides of SEQ ID NO: 6 including the guanine or guanosine at position 31 of SEQ ID NO: 6.
  • the LR allele of rs8099917 is associated with a weak or poor patient response in the population to antiviral therapy with an immunomodulatory agent such as pegylated IFN-a, or a combination comprising pegylated IFN-a and ribavirin.
  • an immunomodulatory agent such as pegylated IFN-a, or a combination comprising pegylated IFN-a and ribavirin.
  • the term "rs 12979860” shall be taken to mean the polymorphic region that is positioned within the 5 '-upstream flanking region of the IL28B gene of humans, wherein said polymorphic region comprises the sequence set forth in SEQ ID NO: 42 or a complementary nucleotide sequence thereto.
  • rs 12979860 shall also be taken to refer to the single nucleotide polymorphism contained within SEQ ID NO: 42 i.e., at position 31 thereof. Unless the context requires otherwise, the term “rs 12979860” shall be taken to refer to the HR allele and/or the LR allele of rsl 2979860.
  • HR allele of rsl 2979860 or “C allele of rsl 2979860” or “rsl 2979860-HR” shall be taken to refer to an allele of rsl 2979860 comprising cytosine at a position corresponding to position 31 of SEQ ID NO: 161 in the context of a sequence comprising SEQ ID NO: 161, or within the context of a shorter sequence comprising at least about 5 or 6 or 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 contiguous nucleotides of SEQ ID NO: 161 including the cytosine at position 31 of SEQ ID NO: 161.
  • the HR allele of rsl2979860 is associated with a better patient response in the population to antiviral therapy with an immunomodulatory agent such as pegylated IFN-a or a combination comprising pegylated IFN-a and ribavirin, and preferably a sustained virological response (SVR) to said therapy.
  • an immunomodulatory agent such as pegylated IFN-a or a combination comprising pegylated IFN-a and ribavirin, and preferably a sustained virological response (SVR) to said therapy.
  • LR allele of rsl2979860 or “T” allele of rsl2979860” or “rsl2979860-LR” shall be taken to refer to an allele of rsl 2979860 comprising thymidine or uracil at a position corresponding to position 31 of SEQ ID NO: 162 in the context of a sequence comprising SEQ ID NO: 162, or within the context of a shorter sequence comprising at least about 5 or 6 or 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 contiguous nucleotides of SEQ ID NO: 162 including the thymidine or uracil at position 31 of SEQ ID NO: 162.
  • the LR allele of rsl2979860 is associated with a weak or poor patient response in the population to antiviral therapy with an immunomodulatory agent such as pegylated IFN-a, or a combination comprising pegylated IFN-a and ribavirin.
  • an immunomodulatory agent such as pegylated IFN-a, or a combination comprising pegylated IFN-a and ribavirin.
  • the predictive value of the foregoing allele combinations employing HLA-C and IL28B genotyping may be enhanced by genotyping for a plurality of alleles linked to IL28B e.g., to thereby determine HLA-C2 homozygosity and at least two different LR alleles linked to IL28B.
  • genotyping for a plurality of alleles linked to IL28B e.g., to thereby determine HLA-C2 homozygosity and at least two different LR alleles linked to IL28B.
  • an effect of combining at least one other IL28B-LR allele with HLA-C2 homozygosity is determined to demonstrate that the combination will not adversely affect the predictive capacity of the test.
  • associations between the sustained viral response (SVR) of subjects and a genotype comprising HLA-C2 homozygosity and at least one specific IL28B-LR allele selected from rs4803221-LR, rs8099917-LR and rsl2979860-LR e.g., the LR allele of rs4803221 and the LR allele of rs8099917, or the LR allele of rs4803221 and the LR allele of rs 12979860, or the LR allele of rs8099917 and the LR allele of rs 12979860, or the LR allele of rs4803221 and the LR allele of rs8099917 and the LR allele of rsl 2979860) are provided herein.
  • SVR sustained viral response
  • genotype combinations may provide for greater population coverage and sensitivity of the assay, preferably without compromizing positive predictive value and/or assay specificity. Such combinations that provide enhanced predictive value are even more desired.
  • Other combinations of alleles of IL28B selected from those set forth in Tables 1 and 3-7 hereof may also have predictive value in combination with HLA-C2 homozygosity, e.g., for any IL28B allele that is in linkage disequilibrium at least with rs4803221 and/or rs8099917 and/or rsl 2979860.
  • the inventors have also provided a test for determining the likelihood that a subject will or will not respond to therapy with an immunomodulatory composition that provides both a high positive predictive value and improved population coverage, e.g., at least about 10% or 11% or 12% or 13% or 14% or 15% or 16% or 17% or 18% or 19% or 20% or 21% or 22% or 23% or 24% or 25% or 26% or 27% or 28% or 29% or 30% or 31% or 32% or 33% or 34% or 35% or 36% or 37% or 38% or 39% or 40% or 41% or 42% or 43% or 44% or 45% or 46% or 47% or 48% or 49% or 50% or 55% or 60% or 65% or 70% or 75% or 80% or 85% or 90% or 95% or 96% or 97% or 98% or 99% of cases.
  • an immunomodulatory composition that provides both a high positive predictive value and improved population coverage, e.g., at least about 10% or 11% or 12% or 13% or 14% or 15% or
  • the data herein provide the basis for prognostic tests to determine the likelihood that a subject will or will not respond to therapy with one or more immunomodulatory agents, and in particular, the likelihood that a subject suffering from a chronic HCV infection will or will not respond to therapy comprising immunomodulatory agents such as IFN-a and ribavirin.
  • the tests herein based on homozygosity of HLA-C2 alleles have improved accuracy compared to tests based on a single HLA-C2 allele in determining the likelihood of a subject's response to therapy, and multi-analyte prognostic tests for homozygosity of HLA-C2 alleles in combination with at least one LR allele linked to IL28B have improved accuracy compared to tests based on a single HLA-C1 allele or single HLA-C2 allele or homozygosity of the corresponding HR allele linked to IL28B, have even greater accuracy in determining the likelihood of a subject's response to therapy.
  • such tests combining homozygosity at HLA-C2 with at least one LR allele linked to IL28B at the polymorphic rs8099917 locus have much improved accuracy in detecting non-responder or low-responder phenotypes for anti-HCV therapy e.g., odds ratio of 4.02, compared to tests based on homozygosity at HLA-C2 alone e.g., odds ratio of 1.57, or tests for a LR allele at rs8099917 e.g., odds ratio of 2.16 (Tables 12 and 13).
  • the HLA-C2 alleles optionally with one or more IL28B alleles, serotypes, haplotypes and genotypes provided herein, provide the means for accurately determining the likelihood that a subject will or will not respond to therapy comprising an immunomodulatory composition.
  • the terms “accurately determining” or “accurate prognosis” shall be taken to mean an association of a particular allele, genotype, genotype combination, serotype, genotype, or haplotype, with a high response (HR) or low response (LR) to therapy, or an association of a particular allele, genotype, genotype combination, serotype, genotype, or haplotype, with a non-response to therapy, or an association of a particular allele, genotype, genotype combination, serotype, genotype, or haplotype, with relapse.
  • HR high response
  • LR low response
  • Accurate determination or prognosis may be statistically significant, e.g., at p ⁇ 10 ⁇ 3 ' or preferably p ⁇ 10 "4 , or more preferably p ⁇ 10 "5 or p ⁇ 10 "6 or p ⁇ 10 "7 .
  • the term "accurately determining” means that an allele, genotype, serotype, or genotype at a single locus provides a positive predictive value (PPV) with respect to treatment outcome e.g., a high response (HR) or low response (LR) to therapy, of more than about 70% for patients in a population.
  • PSV positive predictive value
  • the predictive test may determine the likelihood that a subject will or will not respond to therapy with an immunomodulatory composition, wherein the test provides a high positive predictive value e.g., at least about 70% or 85% or 80% or 81% or 82% or 83% or 84% or 85% or 86% or 87% or 88% or 89% or 90% or 91% or 92% or 93% or 94% or 95% or 96% or 97% or 98% or 99% 100%.
  • a high positive predictive value e.g., at least about 70% or 85% or 80% or 81% or 82% or 83% or 84% or 85% or 86% or 87% or 88% or 89% or 90% or 91% or 92% or 93% or 94% or 95% or 96% or 97% or 98% or 99% 100%.
  • the term "accurately determining” means that a plurality of alleles, genotypes, serotypes, or a genotype combination or a haplotype, e.g., HLA-C2 in combination with at least one IL28B-LR allele, provides a positive predictive value (PPV) with respect to treatment outcome of more than about 75% for patients in a population.
  • the PPV may increase proportionately with the number of markers assayed.
  • an association at any single locus is stronger than for rs8099917 solus in a population.
  • population means a test population of greater than 100 matched individuals or greater than 200 matched individuals or greater than 300 matched individuals or greater than 400 matched individuals or greater than 500 matched individuals.
  • matched is meant that the individuals of the test population have similar or near- identical age, BMI, viral titer, and treatment regime.
  • the present invention also provides for accurate prognosis in a "real world" population of individuals suffering from the same medical condition e.g., individuals suffering from the same condition that are at least matched with respect to ethnicity.
  • one example of the invention provides for accurate prognosis of treatment for primary or chronic HCV infection in a population of Caucasian patients.
  • the term "immunomodulatory composition” shall be taken in its broadest context to mean a composition comprising one or more compounds capable of modulating expression or secretion of one or more cytokines involved in autoimmunity and/or immune responses to infectious agents, or by modulating one or more components of a cytokine signalling pathway.
  • the term "compound” in this context includes a protein, small molecule, antibody molecule, or nucleic acid e.g., RNAi, antisense RNA, ribozyme or siRNA.
  • HLA-C2 homozygosity optionally with one or more IL28B alleles, serotypes, haplotypes and genotypes provided herein, has clear application for the accurate prognosis of a response to any therapy comprising administration of an "immunomodulatory composition" that is known to be used and/or known to be useful in the treatment of a viral infection and/or neoplasia and/or Thl -mediated disease and/or Th2 -mediated disease.
  • the invention is suitable for accurate prognosis of a response to therapy comprising administration of an "immunomodulatory composition" for treatment of Thl -mediated disease and/or Th2-mediated disease e.g., one or more conditions selected individually or collectively from the group consisting of multiple sclerosis (MS), rheumatoid arthritis (RA), Type I diabetes (IDDM), scleroderma, Con A hepatitis, atopic dermatitis, asthma, allergic rhinitis and allergy.
  • MS multiple sclerosis
  • RA rheumatoid arthritis
  • IDDM Type I diabetes
  • scleroderma Con A hepatitis
  • Con A hepatitis atopic dermatitis
  • asthma allergic rhinitis and allergy.
  • the invention is suitable for accurate prognosis of a response to therapy comprising administration of an "immunomodulatory composition" for treatment of one or more infections by viruses selected individually or collectively from the group consisting of human papillomaviruses (e.g., papillomavirus(es) selected from HPV16, HPV6 and HP VI 1), herpes viruses (e.g., herpes virus(es) selected from HSV-1, HSV-2, VZV, HHV-6, HHV-7, HHV-8 (KSHV), HCMV and EBV), picornaviruses (e.g., picornavirus(es) selected from Coxsackie B virus(es) and EMCV), flaviviruses (e.g., flavivirus(es) selected from encephalitis virus(es) and hepatitis virus(es) such as HAV and/or HBV and/or HCV), arenaviruses (a) of human papill
  • the invention provides means for prognosis of a response to therapy comprising administration of an "immunomodulatory composition" for treatment of one or more infections by hepatitis virus(es), such as HAV and/or HBV and/or HCV, and especially HCV.
  • an "immunomodulatory composition” for treatment of one or more infections by hepatitis virus(es), such as HAV and/or HBV and/or HCV, and especially HCV.
  • the invention is suitable for accurate prognosis of a response to therapy comprising administration of an "immunomodulatory composition" for treatment of one or more neoplasias or precancerous conditions, such as neoplasia(s) and pre-cancerous condition(s) selected individually or collectively from the group consisting of HPV-associated cancer (e.g., cervical intrapepithelial neoplasia and/or cervical carcinoma and/or vulvar intraepithelial neoplasia and/or penile intraepithelial neoplasia and/or perianal intraepithelial neoplasia), hepatocellular carcinoma, basal cell carcinoma, squamous cell carcinoma, actinic keratosis, melanoma, hairy cell leukemia, Kaposi's sarcoma, non-Hodgkin's lymphoma, astrocytoma, glioblastoma,
  • HLA-C2 homozygosity optionally with one or more IL28B alleles, serotypes, haplotypes and genotypes provided herein, provides the means for accurately determining the likelihood that a subject will respond to therapy comprising of an immunomodulatory composition comprising IFN.
  • IFN interferon molecule
  • IFN-a, IFN- ⁇ , IFN-oo, IFN- ⁇ , IFN- ⁇ , IFN- ⁇ 2, or IFN- 3 a composition comprising a plurality of any interferon molecules e.g., two or more molecules selected from IFN-a, IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , IFN- 2 and ⁇ - ⁇ 3, a composition comprising one or more derivatives of an interferon molecule e.g., a pegylated interferon, and mixtures of said one or more derivatives with one or more non-derivative interferon molecules.
  • the present invention has clear application for the prognosis of a response to any therapy comprising administration of "IFN" that is known to be used and/or known to be useful in the treatment of a viral infection and/or neoplasia and/or Thl- mediated disease and/or Th2 -mediated disease.
  • the invention is useful for prognosis of a response to an infection treatable by "IFN", wherein the infection is by one or more ssRNA viruses, i.e., an infection by one or more (+) ssRNA viruses and/or an infection by one or more (-)ssRNA viruses, such as SARS-associated coronavirus (SARS-CoV), HBV, HCV, coxsackie B virus, EMCV, Ebola virus, VSV, IAV, HTNV, or APEUV, and/or one or more double-stranded DNA viruses such as HSV-1 or HSV- 2.
  • SARS-CoV SARS-associated coronavirus
  • HBV HBV
  • HCV coxsackie B virus
  • EMCV Ebola virus
  • VSV SV
  • IAV IAV
  • HTNV HTNV
  • APEUV APEUV
  • double-stranded DNA viruses such as HSV-1 or HSV- 2.
  • the invention is useful for prognosis of a pre-cancerous lesion or neoplasia treatable by "IFN” e.g., a pre-cancerous lesion or neoplasia selected from the group consisting of condylomata acuminata, hairy cell leukemia, Kaposi's sarcoma, melanoma, non-Hodgkin's lymphoma, astrocytoma, glioblastoma, thymoma and fibrosarcoma.
  • IFN e.g., a pre-cancerous lesion or neoplasia selected from the group consisting of condylomata acuminata, hairy cell leukemia, Kaposi's sarcoma, melanoma, non-Hodgkin's lymphoma, astrocytoma, glioblastoma, thymoma and fibrosarcoma.
  • the invention is useful for prognosis of a Thl -mediated disease or Th2-mediated disease treatable by "IFN” e.g., a disease selected from the group consisting of MS, asthma and Con A-induced hepatitis.
  • IFN a disease selected from the group consisting of MS, asthma and Con A-induced hepatitis.
  • HLA-C2 homozygosity provides the means for accurately determining the likelihood that a subject will respond to therapy comprising an immunomodulatory composition comprising guanosine analog(s).
  • guanosine analog shall be taken to include any known guanosine analog, a composition comprising a plurality of guanosine analogs, a composition comprising one or more derivatives of one or more guanosine analogs and mixtures of said one or more derivatives with one or more non-derivative guanosine analogs.
  • Preferred guanosine analogs in this context are those compounds that are capable of modulating levels of Thl and/or Th2 cells, or that have antiviral and/or anti-cancer activity.
  • Exemplary guanosine analogs are selected from ribavirin, viramidine, 7-benzyl-8-bromoguanine, 9-benzyl-8-bromoguanine, and CpG-containing oligonucleotide(s), and derivative(s), salt(s), solvate(s) and hydrate(s) thereof e.g., ribavirin 5'-monophosphate, ribavirin 5'-diphosphate, ribavirin 5'- triphosphate, and ribavirin 3',5'-cyclic phosphate.
  • HLA-C and/or IL28B alleles, serotypes, haplotypes and genotypes disclosed herein provide the means for accurately determining the likelihood that a subject will respond to therapy comprising an immunomodulatory composition comprising IFN and guanosine analog(s).
  • the inventors found that homozygosity for the HLA-C2 allele is predictive of a poor response to antiviral therapy.
  • the present inventors have found that a combination of at least one HLA-C2 allele and one or two copies of a low response (LR) allele linked to IL28B is predictive of a poor response to antiviral therapy.
  • the present invention thus provides the first disclosure of an association between a genotype comprising two HLA-C2 alleles and at least one LR allele linked to IL28B, and poor treatment outcome.
  • any gene or gene fragment may be employed in performing the present invention by virtue of the gene or gene fragment being capable of detecting an allele of HLA-C disclosed herein, and optionally any an allele of IL28B disclosed herein.
  • An allele of HLA-C not specifically disclosed herein may also provide a surrogate means of detecting an HLA-C allele disclosed herein by virtue of being in linkage disequilibrium with it.
  • An allele of IL28B not specifically disclosed herein may also provide a surrogate means of detecting an IL28B allele disclosed herein by virtue of being in linkage disequilibrium with it.
  • a gene or gene fragment will be capable of detecting an allele of HLA-C or IL28B if it hybridizes to an allele represented by a SNP, microsatellite or INDEL in linkage disequilibrium with an HLA-C or IL28B allele disclosed herein.
  • a gene or gene fragment hybridising to one allele of a haplotype block may provide a surrogate for detection of the haplotype block by virtue of the alleles of the haplotype block being in linkage disequilibrium.
  • Preferred markers that may provide surrogates for an exemplified allele hereof are generally positioned within 5kb of the 5 '-end or 3 'end of the gene, the intergenic IL28A/IL28B region, or with the protein-encoding region or an intron region of the structural HLA-C or IL28B gene, or within the protein-encoding region of the HLA-C gene.
  • the haplotype block identified and characterized by the inventors for the IFN- 3 gene (Table 6), and expression data ( Figure 1) demonstrating that expression of IFN- 2 and IFN- 3 is reduced in carriers of the LR allele i.e., the G allele, of rs 8099917 relative to carriers of the corresponding HR allele i.e., the T allele, indicate that all of the chromosome 19 SNPs presented in Table 1 are definitely linked to the IFN- 3 gene, with the possible exception of rs4803224, rsl2980602 and rsl 0853728.
  • the excluded SNPs under these criteria are more distal than rs8099917 from the structural gene region i.e., encoding IFN- 3.
  • the present invention may be employed by identifying any marker linked to HLA-C2 or IL28B and associated with treatment outcome e.g., in the 5 '-upstream region or an intron or an exon or the 3'- downstream region.
  • the present invention encompasses, but is not limited to, the use of HLA- C2 homozygosity, optionally combined with at least one IL28B allele, preferably at least one IL28B-LR allele, set forth in any one or more of Tables 1 and 3-7, and any combination thereof e.g., a specific haplotype set forth in any one of Tables 3-6, for determining the likelihood that a subject will or will not respond to therapy comprising an immunomodulatory composition as described herein.
  • a marker linked to the HLA-C2 gene or a fragment thereof optionally in combination with a marker linked to an allelic variant of the IL28B gene or a fragment thereof, may be employed for accurate prognosis.
  • fragment in this context, is meant a portion of a gene of sufficient length to be useful for detection of gene expression associated with the polymorphism and/or of sufficient length to directly identify the polymorphism e.g., in a platform suitable for identifying SNPs as described herein.
  • the present invention provides for the use of homozygosity in an HLA-C2 allele for determining the likelihood that a subject will respond poorly to therapy comprising an immunomodulatory composition as described herein.
  • data presented in Table 12 for two separate patient cohorts demonstrate that that homozygosity in HLA-C2, and the data presented in Table 13, indicate that HLA-C2 homozygosity is highly predictive that a subject will respond poorly to therapy comprising an immunomodulatory composition.
  • the exemplified correlation between the presence of at least one HLA-C2 allele and at least one LR allele at rs4803221 or rs8099917 (e.g., in the rs8099917 IL28B haplotype block) or rs 12979860, and a low response to antiviral therapy, demonstrates functional significance of the associations described herein, and especially with respect to IFN therapy.
  • determinations of homozygosity for HLA-C2 alleles may be employed.
  • determinations of homozygosity for HLA-C2 alleles and at least one LR allele of a polymorphic locus set forth in Table 1 may be employed.
  • determinations of homozygosity for both HLA-C2 alleles and LR alleles of a polymorphic locus set forth in Table 1 are employed.
  • heterozygosity or homozygosity for HLA- C2 alleles in combination with a determination of heterozygosis or homozygosity for any number or combination of L alleles set forth in Table 1 e.g., an IL28B haplotype.
  • at least one LR allele is an LR allele of the rs8099917 locus set forth in Table 1 , or even more preferably, an LR allele of rs4803221.
  • the present invention provides a method for accurately determining the likelihood that a subject will or will not respond to treatment with an immunomodulatory composition, said method comprising detecting homozygosity of HLA-C2 alleles in a sample from the subject, wherein detection of said homozygosity is indicative of a low response of the subject to treatment with said composition.
  • the present invention provides a method for accurately determining the likelihood that a subject will or will not respond to treatment with an immunomodulatory composition, said method comprising detecting homozygosity of HLA-C2 alleles and detecting one or more alleles linked to a IL28B (IFN- 3) gene in a sample from the subject, wherein detection of said homozygosity and said one or more alleles is indicative of a low response of the subject to treatment with said composition.
  • IFN- 3 IL28B
  • the present invention provides a method for accurately determining the likelihood that a subject will or will not respond to treatment with an immunomodulatory composition, said method comprising detecting homozygosity of HLA-C2 and IL28B ( ⁇ - ⁇ 3) alleles in a sample from the subject, wherein detection of said homozygosity is indicative of a low response of the subject to treatment with said composition.
  • the present invention provides a method for accurately determining the likelihood that a subject will or will not respond to treatment with an immunomodulatory composition, said method comprising detecting two or more markers in a sample from the subject, wherein at least one marker is linked to an HLA- C allele e.g., an HLA-C1 or HLA-C2 allelic variant, and at least one marker is linked to a IL28B ( ⁇ - ⁇ 3) gene e.g., an IL28B-HR allelic variant or IL28B-LR allelic variant, and wherein detection of said one or more markers is indicative of the likely response of the subject to treatment with said composition.
  • an HLA- C allele e.g., an HLA-C1 or HLA-C2 allelic variant
  • IL28B ⁇ - ⁇ 3 gene
  • the present invention provides a method for accurately determining the likelihood that a subject will or will not respond to treatment with an immunomodulatory composition, said method comprising detecting two or more markers in a sample from the subject, wherein at least one marker is linked to an HLA- C2 allele and at least one marker is linked to a low response (LR) allele of IL28B, and wherein said detection is indicative of HLA-C2 homozygosity and at least one LR allele of IL28B in the genome of the subject, said indication being further indicative of a low response of the subject to treatment with said composition.
  • LR low response
  • HLA-C2 alleles are selected from HLA-Cw2, HLA-Cw4, HLA-Cw5, HLA- Cw6, HLA-Cwl5, HLA-Cwl7, HLA-Cwl 8, HLA-Cw*0114, HLA-Cw*0307, HLA- Cw*0315, HLA-Cw*0345, HLA-Cw*0707, HLA-Cw*0709, HLA-Cw*0776, HLA- Cw*0810, HLA-Cw*1204, HLA-Cw*1205, HLA-Cw*1209, HLA-Cw*1221, HLA- Cw*1233, HLA-Cw*1241, HLA-Cw*1412, HLA-Cw*1602, HLA-Cw*1609, HLA- Cw*1612, HLA-Cw*1619, and HLA-Cw*1625, and being other than HLA-Cw*0227, HLA-Cw*0411,
  • Exemplary low response (LR) alleles of IL28B are selected from the group of single nuclear polymorphisms (SNPs) set forth in any one of Table 1 or comprise a SNP set forth in Table 1 or are encoded by nucleic acid comprising a SNP set forth in Table 1 or linked to a SNP set forth in Table 1.
  • SNPs single nuclear polymorphisms
  • an IL28B-LR allele may consist of a SNP set forth in Table 3 or comprise a SNP set forth in Table 3 or be encoded by nucleic acid comprising a SNP set forth in Table 3 or be linked to a SNP set forth in Table 3.
  • an IL28B-LR allele may consist of a SNP set forth in Table 4 or 5 or comprise a SNP set forth in Table 4 or 5 or be encoded by nucleic acid comprising a SNP set forth in Table 4 or 5 or be linked to a SNP set forth in Table 4 or 5.
  • an IL28B-LR allele may comprise a sequence selected from the group consisting of:
  • an IL28B-LR allele is the rs4803221-LR allele e.g., SEQ ID NO: 160 or at least about 5 or 6 or 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 contiguous nucleotides thereof including the nucleotide at position 31 thereof, or a complementary sequence thereto.
  • an IL28B-LR allele is the rs8099917-LR allele e.g., SEQ ID NO: 6 or at least about 5 or 6 or 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 contiguous nucleotides thereof including the nucleotide at position 31 thereof, or a complementary sequence thereto.
  • an IL28B-LR allele is the rsl2979860-LR allele e.g., SEQ ID NO: 162 or at least about 5 or 6 or 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 contiguous nucleotides thereof including the nucleotide at position 31 thereof, or a complementary sequence thereto.
  • IL28B-LR alleles at different loci of IL28B, such as a haplotype comprising two or more IL28B alleles e.g., wherein the haplotype comprises at least one or two or three alleles of rs4803221 , rs 12979860, or rs8099917, such as a haplotype comprising alleles of rs 12980275, rs8105790, rs8103142, rsl0853727, rs8109886 and rs8099917.
  • one or two LR alleles at any locus of IL28B set forth in Tables 1 and 3-7 may be detected.
  • heterozygosity or homozygosity at any additional locus may be employed in combination with the HLA-C2 homozygosity of the invention.
  • IL28B genotypes or IL28B markers e.g., two or three or four of five or six or seven or more IL28B genotypes or markers in combination with the HLA-C2 homozygosity of the invention.
  • the present invention provides a method for accurately determining the likelihood that a subject will have a low response or non-response to treatment with an immunomodulatory composition, said method comprising detecting two or more markers in a sample from the subject, wherein at least one marker is linked to an HLA- C2 allele and at least one marker is linked to a single nuclear polymorphism (SNP) set forth in Table 1 or comprises a SNP set forth in Table 1 or is encoded by nucleic acid comprising a SNP set forth in Table 1 or linked to a SNP set forth in Table 1, and wherein detection of said one or more markers is indicative of the low response or non- response of the subject to treatment with said composition.
  • SNP single nuclear polymorphism
  • a marker linked to HLA-C2 may determine that the subject has a genotype indicative of the presence of at least one HLA-C2 allele which, when present with at least one marker linked to or comprising or encoded by nucleic acid comprising a SNP set forth in Table 1 is indicative of the low response or non-response of the subject to treatment with said composition.
  • the subject is heterozygous at the HLA-C2 locus i.e., has the genotype HLA-C1/HLA-C2, which, when said genotype is present with at least one marker linked to or comprising or encoded by nucleic acid comprising a SNP set forth in Table 1 is indicative of the low response or non-response of the subject to treatment with said composition.
  • the subject is homozygous at the HLA-C2 locus i.e., has the genotype HLA-C2/HLA- C2, which, when said genotype is present with at least one marker linked to or comprising or encoded by nucleic acid comprising a SNP set forth in Table 1 is indicative of the low response or non-response of the subject to treatment with said composition.
  • At least one marker linked to or comprising or encoded by nucleic acid comprising a SNP set forth in Table 1 also comprises at least one LR allele of a polymorphic locus set forth in Table 1.
  • one or two HLA-C2 alleles may be detected in combination with one or two LR alleles at one or more loci set forth in Table 1.
  • the present invention clearly provides for detection of a single HLA-C2 allele and a single LR allele of a polymorphic locus set forth in Table 1 as being indicative of the low response or non-response of the subject to treatment with said composition.
  • detection of two HLA-C2 alleles and a single LR allele of a polymorphic locus set forth in Table 1 is indicative of the low response or non- response of the subject to treatment with said composition.
  • detection of one HLA-C2 allele and two LR alleles of a polymorphic locus set forth in Table 1 is indicative of the low response or non-response of the subject to treatment with said composition.
  • detection of two HLA-C2 alleles and two LR alleles of a polymorphic locus set forth in Table 1 is indicative of the low response or non-response of the subject to treatment with said composition.
  • detection of two HLA- C2 alleles and a single LR allele at each of a plurality of polymorphic loci set forth in Table 1 is indicative of the low response or non-response of the subject to treatment with said composition.
  • detection of one HLA-C2 allele and two LR alleles at each of a plurality of polymorphic loci set forth in Table 1 is indicative of the low response or non-response of the subject to treatment with said composition.
  • detection of two HLA-C2 alleles and two LR alleles at each of a plurality of polymorphic loci set forth in Table 1 is indicative of the low response or non- response of the subject to treatment with said composition.
  • At least one polymorphic locus is the rs8099917 locus set forth in Table 1.
  • an allele comprising a C or G nucleotide at rs8099917 is indicative of a low response or non-response to treatment of the subject to treatment with said composition.
  • a genotype combination comprising at least one HLA-C2 allele and at least one LR allele at rs8099917
  • the genotype combination comprises at least one HLA- C2 allele and at least one LR allele at rs8099917 and at least one allele at each of rs 12980275, rs8105790, rs8103142, rs 10853727 and rs8109886, and wherein detection of a genotype combination comprising said alleles is indicative of a low response or non-response to treatment of the subject with said composition.
  • At least one polymorphic locus is the rs4803221 locus set forth in Table 1.
  • an allele comprising a G nucleotide on the sense strand at rs4803221, or a C nucleotide on the antisense strand at rs4803221 is indicative of a low response or non-response to treatment of the subject to treatment with said composition.
  • a genotype combination comprising at least one HLA-C2 allele and at least one LR allele at rs4803221 such as wherein the genotype combination comprises at least one HLA- C2 allele and at least one LR allele in linkage disequilibrium with rs4803221, and wherein detection of a genotype combination comprising said alleles is indicative of a low response or non-response to treatment of the subject with said composition.
  • This invention also encompasses detection of at least one polymorphic locus at the rsl2979860 locus set forth in Table 1.
  • an allele comprising a T nucleotide on the sense strand at rs 12979860, or an A nucleotide on the antisense strand at rs 12979860, is indicative of a low response or non-response to treatment of the subject to treatment with said composition.
  • a genotype combination comprising at least one HLA-C2 allele and at least one LR allele at rs 12979860 such as wherein the genotype combination comprises at least one HLA-C2 allele and at least one LR allele in linkage disequilibrium with rs 12979860, and wherein detection of a genotype combination comprising said alleles is indicative of a low response or non-response to treatment of the subject with said composition.
  • Preferred IL28B marker(s) associated with a low response or non-response to treatment with the immunomodulatory composition are contained within a sequence selected from the group consisting of:
  • detection of said at least one marker is indicative of a low response or non- response to treatment of the subject to treatment with said composition.
  • At least one marker associated with the ⁇ - ⁇ 3 gene may comprise an allele associated with a low response or non-response to treatment with the immunomodulatory composition, wherein said allele is contained within a sequence selected from the group consisting of: (i) a sequence set forth in any one of SEQ ID NOs: 6, 11, 69, 86, 89, 160, or 162; and (ii) a sequence complementary to a sequence at (i), wherein detection of said at least one marker is indicative of a low response or non-response to treatment of the subject to treatment with said composition.
  • the present invention provides a method for accurately determining the likelihood that a subject will have a response or high response to treatment with an immunomodulatory composition, said method comprising detecting two or more markers in a sample from the subject, wherein at least one marker is linked to an HLA- Cl allele and at least one marker is linked to a single nuclear polymorphism (SNP) set forth in Table 1 or comprises a SNP set forth in Table 1 or is encoded by nucleic acid comprising a SNP set forth in Table 1 or linked to a SNP set forth in Table 1, and wherein detection of said one or more markers is indicative of the response or high- response of the subject to treatment with said composition.
  • SNP single nuclear polymorphism
  • a marker linked to HLA-C1 may determine that the subject has a genotype indicative of the presence of at least one HLA-C1 allele which, when present with at least one marker linked to or comprising or encoded by nucleic acid comprising a SNP set forth in Table 1 is indicative of the response or high-response of the subject to treatment with said composition.
  • the subject is heterozygous at the HLA-C locus i.e., has the genotype HLA-C1/HLA-C2, which, when said genotype is present with at least one marker linked to or comprising or encoded by nucleic acid comprising a SNP set forth in Table 1 is indicative of the response or high-response of the subject to treatment with said composition.
  • the subject is homozygous at the HLA-C locus e.g., has the genotype HLA-C 1 /HLA-C 1, which, when said genotype is present with at least one marker linked to or comprising or encoded by nucleic acid comprising a SNP set forth in Table 1 is indicative of the response or high-response of the subject to treatment with said composition.
  • At least one marker linked to or comprising or encoded by nucleic acid comprising a SNP set forth in Table 1 also comprises at least one HR allele of a polymorphic locus set forth in Table 1.
  • one or two HLA-C 1 alleles may be detected in combination with one or two HR alleles at one or more loci set forth in Table 1.
  • the present invention clearly provides for detection of a single HLA-C 1 allele and a single HR allele of a polymorphic locus set forth in Table 1 as being indicative of the response or high-response of the subject to treatment with said composition.
  • detection of two HLA-C 1 alleles and a single HR allele of a polymorphic locus set forth in Table 1 is indicative of the response or high-response response of the subject to treatment with said composition.
  • detection of one HLA-C 1 allele and two HR alleles of a polymorphic locus set forth in Table 1 is indicative of the response or high-response of the subject to treatment with said composition.
  • detection of two HLA-Cl alleles and two HR alleles of a polymorphic locus set forth in Table 1 is indicative of the response or high-response of the subject to treatment with said composition.
  • detection of two HLA-Cl alleles and a single HR allele at each of a plurality of polymorphic loci set forth in Table 1 is indicative of the response or high-response of the subject to treatment with said composition.
  • detection of one HLA-Cl allele and two HR alleles at each of a plurality of polymorphic loci set forth in Table 1 is indicative of the response or high-response of the subject to treatment with said composition.
  • detection of two HLA-Cl alleles and two HR alleles at each of a plurality of polymorphic loci set forth in Table 1 is indicative of the response or high-response of the subject to treatment with said composition.
  • At least one polymorphic locus is the rs8099917 locus set forth in Table 1.
  • an allele comprising A or T nucleotide at rs8099917 is indicative of a response or high response to treatment of the subject to treatment with said composition.
  • a genotype combination comprising at least one HLA-Cl allele and at least one HR allele at rs8099917 such as wherein the genotype combination comprises at least one HLA-Cl allele and at least one HR allele at rs8099917 and at least one allele at each of rsl2980275, rs8105790, rs8103142, rsl0853727 and rs8109886, and wherein detection of a genotype combination comprising said alleles is indicative of a response to treatment or a high response to treatment of the subject with said composition.
  • At least one polymorphic locus is the rs4803221 locus set forth in Table 1.
  • an allele comprising a C nucleotide in the sense strand at rs4803221, or comprising a G nucleotide in the antisense strand at rs4803221 is indicative of a response or high response to treatment of the subject to treatment with said composition.
  • a genotype combination comprising at least one HLA-Cl allele and at least one HR allele at rs4803221 such as wherein the genotype combination comprises at least one HLA- CI allele and at least one HR allele at rs4803221 and at least one allele in linkage disequilibrium with rs4803221, and wherein detection of a genotype combination comprising said alleles is indicative of a response to treatment or a high response to treatment of the subject with said composition.
  • At least one polymorphic locus is the rsl 2979860 locus set forth in Table 1.
  • an allele comprising a C nucleotide in the sense strand at rsl 2979860, or comprising a G nucleotide in the antisense strand at rsl 2979860 is indicative of a response or high response to treatment of the subject to treatment with said composition.
  • a genotype combination comprising at least one HLA-C1 allele and at least one HR allele at rsl 2979860 such as wherein the genotype combination comprises at least one HLA- Cl allele and at least one HR allele at rsl 2979860 and at least one allele in linkage disequilibrium with rsl 2979860, and wherein detection of a genotype combination comprising said alleles is indicative of a response to treatment or a high response to treatment of the subject with said composition.
  • Preferred IL28B marker(s) associated with a positive response or a high response or a strong response to treatment with the immunomodulatory composition wherein said allele is contained within a sequence selected from the group consisting of:
  • detection of said at least one marker is indicative of a response of the subject to treatment with said composition.
  • At least one marker may comprise an allele associated with a response to treatment with the immunomodulatory composition, wherein said allele is contained within a sequence selected from the group consisting of: (i) a sequence set forth in any one of SEQ ID NOs: 5, 10, 67, 85, 88, 159 or 161 ; and (ii) a sequence complementary to a sequence at (i), wherein detection of said at least one marker is indicative of a response of the subject to treatment with said composition.
  • the present invention also encompasses the detection of a modified level of expression e.g., increased or reduced expression of one or more HLA-C and/or IL28B allelic markers in a sample from the subject, wherein said modified expression is indicative of a response of the subject to treatment with said composition.
  • Modified expression may be determined by e.g., increased or reduced expression of one or more of the genes or proteins carrying a diagnostic polymorphism.
  • a modified level of at least one expression product of the gene(s) is detected e.g., by nucleic acid-based assay or antigen-based assay.
  • an amplification reaction e.g., isothermal amplification or PCR reaction such as RT-PCR
  • a protein-containing sample derived from a subject is contacted with an antibody or ligand capable of specifically binding to an allelic variant of a protein encoded by the gene(s) said marker for a time and under conditions sufficient for complex to form and the complex is detected.
  • Any standard immunoassay may be employed e.g., ELISA, including sandwich ELISA performed in a microtiter well or in a lateral flow or flow-through assay format.
  • control samples are selected from the group consisting of: (i) sample(s) from one or more subjects not being treated with the immunomodulatory composition; and (ii) a data set comprising measurements of expression determined previously for the sample(s) at (i).
  • the sample will generally comprise genomic DNA, mRNA, protein or a derivative thereof. Amplified DNA or cDNA derived from genomic DNA or mRNA is also useful.
  • a nucleated cell and/or an extract thereof comprising protein or nucleic acid is particularly useful if the assay is nucleic acid-based or protein-based.
  • the sample should comprise cell extract expected to comprise the marker protein e.g., a cell expressing ⁇ - ⁇ 3.
  • the present invention encompasses the use of any sample selected from the group consisting of whole blood, serum, plasma, peripheral blood mononuclear cells (PBMC), a buffy coat fraction, saliva, urine, a buccal cell, liver biopsy and a skin cell or combinations thereof.
  • PBMC peripheral blood mononuclear cells
  • the invention may be performed ex vivo i.e., wherein the sample has been derived or isolated or obtained previously from the subject.
  • the sample may comprise genomic DNA, mRNA, protein or a derived thereof.
  • a positive response may be selected from the group consisting of: (i) a response comprising enhanced clearance of a virus or a reduction in virus titer or a change in other health characteristic of the subject related to reduced virus titer or enhanced clearance; (ii) a response comprising recovery or remission from cancer or reduced growth of a tumor or pre-cancerous lesion; (iii) a change in Thl cell number, Th2 cell number or Thl/Th2 cell balance or a change in other health characteristic of the subject indicative of recovery from a Thl -mediated or Th2-mediated disease; and (iv) a combination of two or all of (i) to (iii).
  • a low response or non- response may be selected from the group consisting of: (i) a failure to clear of a virus or to reduce virus titer or change in other health characteristic of the subject related to said failure; (ii) a failure to recover or enter remission from cancer or to reduce growth of a tumor or pre-cancerous lesion; (iii) no significant change in Thl cell number, Th2 cell number or Thl/Th2 cell balance or health characteristic of the subject that may indicate recovery from a Thl -mediated or Th2-mediated disease; and (iv) a combination of two or all of (i) to (iii).
  • the subject belongs to that racial background or has a matching genetic background.
  • the subject is Caucasian e.g., northern European.
  • the subject may be African e.g., Zulu, or Asian e.g., Chinese.
  • the immunomodulatory composition may also comprise one or more IFNs and/or one or more derivatives of said one or more of said IFNs e.g., one or more IFNs selected from IFN-a, IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , ⁇ - ⁇ 2 and ⁇ - ⁇ 3 and/or one or more derivatives of any one or more of said IFNs.
  • the immunomodulatory composition may comprise one or more guanosine analogs and/or one or more derivatives of said one or more of said guanosine analogs e.g., one or more of ribavirin, viramidine, 7-benzyl-8-bromoguanine, 9-benzyl-8-bromoguanine, and CpG-containing oligonucleotide(s), and derivative(s), salt(s), solvate(s) and hydrate(s) thereof.
  • the immunomodulatory composition comprises IFN-a and ribavirin. Testing of responses to pegylated IFNs are clearly encompassed.
  • the present invention provides a process for accurately determining the likelihood that a subject will or will not respond to treatment of Thl -mediated disease and/or Th2-mediated disease with an immunomodulatory composition, said process comprising performing a method according to any example hereof for accurately determining a likely response of a subject to treatment with an immunomodulatory composition or the likelihood that a subject will have a response or high response to treatment with an immunomodulatory composition, and determining a response for the subject selected from the group consisting of:
  • the disease may be selected from the group consisting of multiple sclerosis (MS), rheumatoid arthritis (RA), Type I diabetes (IDDM), scleroderma, Con A hepatitis, atopic dermatitis, asthma, allergic rhinitis and allergy.
  • MS multiple sclerosis
  • RA rheumatoid arthritis
  • IDDM Type I diabetes
  • scleroderma Con A hepatitis
  • Con A hepatitis atopic dermatitis
  • asthma allergic rhinitis and allergy.
  • another example of the present invention provides a process for accurately determining the likelihood that a subject will or will not respond to treatment of one or more bacterial or viral infections with an immunomodulatory composition, said process comprising performing a method according to any example hereof for accurately determining a likely response of a subject to treatment with an immunomodulatory composition or the likelihood that a subject will have a response or high response to treatment with an immunomodulatory composition, and determining a response for the subject selected from the group consisting of:
  • a response comprising enhanced clearance of a virus or bacterium or a reduction in virus titer or bacterial count or a change in other health characteristic of the subject related to reduced virus titer or bacterial count or enhanced clearance, wherein said response is indicative of a response to treatment;
  • the bacterium is a gram negative bacterium and/or the virus is a single-stranded RNA virus e.g., a virus is selected from the group consisting of a human papillomavirus, a picornavirus, a flavivirus such as a hepatitis virus, an arenavirus, a togavirus, a bunyavirus, a filovirus, a paramyxovirus, a rhabdovirus, an orthomyxovirus, and a coronavirus.
  • the virus is a DNA virus e.g., a herpes virus.
  • Yet another example of the invention provides a process for accurately determining the likelihood that a subject will or will not respond to treatment of HCV infection with an immunomodulatory composition, said process comprising performing a method according to any example hereof for accurately determining a likely response of a subject to treatment with an immunomodulatory composition or the likelihood that a subject will have a response or high response to treatment with an immunomodulatory composition, and determining a response for the subject selected from the group consisting of:
  • the present invention provides a process for accurately determining the likelihood that a subject will or will not respond to treatment of HCV infection with an immunomodulatory composition comprising an IFN or a derivative thereof and ribavirin or a derivative thereof, said process comprising performing a method according to any example hereof for accurately determining a likely response of a subject to treatment with an immunomodulatory composition or the likelihood that a subject will have a response or high response to treatment with an immunomodulatory composition, and determining a response for the subject selected from the group consisting of:
  • a response comprising enhanced clearance of HCV or a reduction in HCV titer or a change in other health characteristic of the subject related to reduced virus titer or enhanced clearance, wherein said response is indicative of a response to treatment; and (ii) a failure to clear HCV or to reduce HCV titer or a change in a health characteristic of the subject related to said failure, wherein said response is indicative of a low response or no response to treatment.
  • the immunomodulatory composition may comprise one or more IFNs and/or one or more derivatives of said one or more of said IFNs as described according to any other example hereof.
  • the immunomodulatory composition may comprise one or more guanosine analogs and/or one or more derivatives of said one or more of said guanosine analogs according to any other example hereof.
  • the present invention provides a process for selecting a subject in need of treatment with an immunomodulatory composition, said process comprising:
  • the present invention provides a process for selecting a subject in need of treatment with an immunomodulatory composition, said process comprising:
  • the immunomodulatory composition may comprise one or more IFNs and/or one or more derivatives of said one or more of said IFNs as described according to any other example hereof.
  • the immunomodulatory composition may comprise one or more guanosine analogs and/or one or more derivatives of said one or more of said guanosine analogs according to any other example hereof.
  • Exemplary samples comprise peripheral blood mononuclear cells.
  • the present invention provides a process for treating an HCV- infected subject, comprising: (i) performing the ex vivo selection process on a sample from a subject; and (ii) either (a) administering or recommending a therapeutically effective amount of an immunomodulatory composition comprising an IFN to the subject or shortening the length of treatment with said immunomodulatory composition if the subject is likely to respond to treatment, or (b) administering or recommending an alternative therapy or extending the length of treatment with said immunomodulatory composition if the subject is not likely to respond to treatment or likely to produce a low response to treatment.
  • the present invention provides a process for determining a predisposition in a subject to a chronic HCV infection, said process comprising performing a prognostic method as described herein to thereby identify a subject likely to not respond to treatment with an immunomodulatory composition or likely to provide a low response to treatment, and determining that the subject has a predisposition to chronic HCV infection.
  • the present invention provides methods of treatment employing the prognostic test described herein.
  • the invention provides a process comprising: (i) performing a prognostic method or process as described according to any example hereof; and (ii) administering or recommending an immunomodulatory composition to a subject.
  • such a process comprises: (i) obtaining results of a prognostic method or process as described according to any example hereof; and (ii) administering or recommending an immunomodulatory composition to a subject.
  • a further example of the present invention provides a kit comprising a plurality of isolated nucleic acids and/or a plurality of antibodies and/or a plurality of peptides for performing a prognostic method or process according to any example hereof.
  • the nucleic acids each comprise a fragment of an HLA-C1 allele and/or a fragment of a HLA-C2 allele, in combination with an allele of a SNP listed in Table 1 and are capable of distinguishing between the other allele at the same locus e.g., by virtue of comprising nucleotide sequences set forth herein or complementary thereto, or by virtue of being contained within said nucleotide sequences.
  • the kit comprises antibodies bind selectively to HLA-C1 and/or antibodies that bind selectively to HLA-C2 in combination with antibodies a peptide comprising an allelic variant of an amino acid in the IFN- 3 polypeptide as set forth in Table 1 and are capable of distinguishing between the other allelic variant at the same locus.
  • the kit comprises peptides that bind selectively to HLA-C1 and/or peptides that bind selectively to HLA-C2 in combination with one or more peptides that each comprise an allelic variant of an amino acid in the IFN- 3 polypeptide as set forth in Table 1 and are capable of distinguishing between the other allelic variant at the same locus e.g., by virtue of comprising amino acid sequences set forth herein, or by virtue of being contained within said amino acid sequences.
  • the plurality of nucleic acids, peptides or antibodies may be arrayed e.g., on a solid substrate.
  • the kit at least comprises a plurality of nucleic acids comprising sequences derived from a HLA- Cl and/or HLA-C2 genotype in combination with at least one IFN- 3 -derived nucleic acid.
  • a further example provides for the use of a plurality of isolated nucleic acid or peptides or antibodies as described according to any example hereof in the manufacture of a kit or solid substrate for performing a prognostic method or process according to any example hereof.
  • nucleotide residues referred to herein are those recommended by the IUPAC-IUB Biochemical Nomenclature Commission, wherein A represents Adenine, C represents Cytosine, G represents Guanine, T represents Thymine, Y represents a pyrimidine residue, R represents a purine residue, M represents Adenine or Cytosine, K represents Guanine or Thymine, S represents Guanine or Cytosine, W represents Adenine or Thymine, H represents a nucleotide other than Guanine, B represents a nucleotide other than Adenine, V represents a nucleotide other than Thymine, D represents a nucleotide other than Cytosine and N represents any nucleotide residue.
  • derived from shall be taken to indicate that a specified integer may be obtained from a particular source albeit not necessarily directly from that source.
  • the present invention is performed without undue experimentation using, unless otherwise indicated, conventional techniques of molecular biology, developmental biology, mammalian cell culture, recombinant DNA technology, histochemistry and immunohistochemistry and immunology. Such procedures are described, for example, in the following texts that are incorporated by reference:
  • Figure 1 provides a graphical representation showing combined expression of ⁇ - ⁇ 2 and ⁇ - ⁇ 3 (y-axis) as determined by RT-PCR for healthy controls having different genotypes at rs8099917 (x-axis).
  • Data show that expression of ⁇ - ⁇ 2 and ⁇ - ⁇ 3 is reduced in patients that are homozygous for the low response (LR) G allele at this locus compared to those patients that are homozygous for the high response (HR) T allele at this locus, and for G/T heterozygotes.
  • the data further suggest functional significance of the rs8099917 SNP in therapeutic response.
  • Figure 2 provides a graphical representation showing the percentage of individuals who have a low response (LR) or high response (HR) to antiviral therapy in a cohort of about 300 e.g., 301, HCV-infected subjects.
  • Subjects genotyped for IL28B alleles alone were either homozygous for a HR allele linked to IL28B at rs8099917 (TT on the x-axis) or had at least one LR allele linked to IL28B at rs8099917 (G* on the x-axis).
  • Subjects genotyped for HLA-C alleles alone were either homozygous for HLA-C2 (C2C2 on the x-axis) or had at least one HLA-C 1 allele (not C2C2 on the x-axis).
  • Subjects genotyped for HLA-C alleles and at least one IL28B allele were either homozygous for HLA-C2 and at least one LR allele linked to IL28B at rs8099917 (C2C2G* on the x-axis), or they had at least one HLA-C 1 allele and no LR allele linked to IL28B at rs8099917 (Not C2C2G* on the x-axis).
  • Figure 3 provides a graphical representation showing the percentage non-SVR rates of the three HLA-C/rs8099917 genotype combinations in stage 1, replication stage and combined cohort as described in Example 4.
  • Figure 4 provides a graphical representation showing the percentage non-SVR rates of HLA-C, IL28B and combined HLA-C/IL28B genotypes in the combined cohort as described in Example 4.
  • Figure 5 provides a graphical representation showing association of HLA-C genotype with viral clearance with and without therapy. Odds ratio is plotted against viral clearance for ea3ch comparison, plus or minus 95% confidence interval. Vertical height of plotted points is in proportion to log (1/p) where 'p' is the probability of observed association being by chance. Odds ratios are shown for each comparison. CHC - chronic hepatitis C, SC - spontaneous clearer, SVR - sustained viral response, NSVR - no sustained viral response.
  • Figure 6 provides graphical representations of Receiver Operator Curves for prediction of failure to clear virus on therapy based on (blue line) clinical data only (age/sex/bmi/log(viralload)): AUC 69.5% ; (red line) Clinical + rs8099917: AUC 73.4% , (green line) Clinical + rs8099917*HLA.C: AUC 73.9% . Note analysis was done on the 540 patients with no missing clinical data.
  • Figure 7 provides a graphical representation showing the proportion of each cohort with the HLA-C2C2 and IL28B G* genotype, which predicts treatment failure.
  • HC healthy controls; SVR - sustained viral responders; SC - spontaneous clearers; Non- SVR - non-sustained viral responders.
  • Two-way arrows only show the significant 2x2 chi squared comparisons with associated p values and odds ratios.
  • HC numbers obtained from Williams et al, Hum Immunol 63, 602-613 (2002) and Dunne et al., Int J Immunogenet 35, 295-302 (2008).
  • Figure 8 provides a graphical representation showing the proportion of each ethnic group with the HLA-C genotype which predicts treatment failure (blue).
  • a marker is at least one HLA-C allele e.g., at least one HLA-Cl allele or at least one HLA-C2 allele.
  • a marker of the present invention is at least one IL28B allele e.g. , at least one HR allele linked to IL28B or at least one LR allele linked to IL28B or a IL28B haplotype block.
  • HLA-Cl alleles or HLA-C2 alleles Protein markers for HLA-Cl alleles or HLA-C2 alleles are described by Alper et al, J. Exp. Med. 144, pi 1 1 1 et seq. (1976) or Hobart et al, J. Immunol. 116, pi 736 et seq. (1976) incorporated herein by reference.
  • markers comprising or consisting of nucleic acid are employed e.g., DNA or RNA or a combination of RNA or DNA or modified RNA comprising one or more non-nucleic acid components or modified DNA comprising one or more non-nucleic acid components.
  • HLA-C markers may comprise amplified nucleic acid comprising a polymorphism such as a SNP, microsatellite or INDEL. Standard means are employed to determine HLA-C alleles.
  • the Class I SSP ARMS-PCR method is employed essentially as described by Tonks et al, Tissue Antigens 53, 175-183, 1999 which is incorporated herein by reference.
  • HLA-C alleles are amplified using amplification primers comprising one or more hypervariable regions of HLA-Cl or HLA-C2 genes, such as the hypervariable region of exon 2 and/or exon 3.
  • primers specific for exon 2, codon 45 and/or exon 3, codon 182 may be employed.
  • amplification primers specific for nucleic acid encoding the HLA-Cw al domain e.g., comprising polymorphisms for codon 77 and/or codon 80 are employed to distinguish HLA-Cl from HLA-C2.
  • sequence-specific oligonucleotide probes SSOPs is confirmed by using B lymphoblastoid cell lines as positive controls for the HLA-C alleles.
  • HLA-C alleles Specific microsatellite markers for HLA-C alleles are described e.g., by Tamiya et al, Tissue Antigens 51, 337-346, (1998); Tamiya et al, Tissue Antigens 52, (1999); Jenisch et al., Am. J. Hum. Genet. 63, 191-199 (1998); Marshall et al, Hum. Immunol. 38, 24- 29 (1993); or Krishnan et al, Genomics 30, 53-58 (1995), each of which is incorporated by reference.
  • Exemplary SNP markers for HLA-C alleles are from the region containing HLA-B and HLA-C i.e., the so-called beta-block as described e.g., by Gaudieri et al, Genome Res. 10, 1579-1586 (2000) and the references cited therein, each of which is incorporated herein by reference.
  • Preferred IL28B SNP markers will comprise a sequence set forth in the Sequence Listing or complementary thereto.
  • a nucleic acid marker comprises, for example, a polymorphism, an insertion into an IL28B gene or transcript thereof, a deletion from an IL28B gene or transcript thereof, a transcript of an IL28B gene or a fragment thereof or an alternatively spliced transcript of an IL28B or a fragment thereof, and includes copy number variants or inversions.
  • the nucleotide substitution or deletion or insertion may be in the 5 '-end of a gene, the 3 '-end of a gene, in an exon of a gene or an intron of a gene.
  • nucleotide substitution or deletion or insertion may be in an intergenic region i.e., between genes.
  • a nucleotide substitution or deletion or insertion may modify gene expression and, without being bound by any theory or mode of action this modified expression may be associated with the development of a therapeutic response, or a non-response or low response.
  • the method of the invention comprises detecting or determining the presence of a plurality of markers associated with a therapeutic response.
  • a probe or primer capable of specifically detecting a marker that is associated with or causative of a therapeutic response is any probe or primer that is capable of specifically hybridizing to the region of the genome that comprises said marker, or an expression product thereof.
  • a nucleic acid marker is preferably at least about 8 nucleotides in length (for example, for detection using a locked nucleic acid (LNA) probe).
  • LNA locked nucleic acid
  • a marker is preferably at least about 15 nucleotides in length or more preferably at least 20 to 30 nucleotides in length.
  • Such markers are particularly amenable to detection by nucleic acid hybridization-based detection means assays, such as, for example any known format of PCR or ligase chain reaction.
  • a method for detecting a nucleic acid marker comprises hybridizing an oligonucleotide to the marker linked to nucleic acid in a sample from a subject under moderate to high stringency conditions and detecting hybridization of the oligonucleotide using a detection means, such as for example, an amplification reaction or a hybridization reaction.
  • a low stringency is defined herein as being a hybridization and/or a wash carried out in 6 x SSC buffer, 0.1% (w/v) SDS at 28°C, or equivalent conditions.
  • a moderate stringency is defined herein as being a hybridization and/or washing carried out in 2 x SSC buffer, 0.1% (w/v) SDS at a temperature in the range 45°C to 65°C, or equivalent conditions.
  • a high stringency is defined herein as being a hybridization and/or wash carried out in 0.1 x SSC buffer, 0.1% (w/v) SDS, or lower salt concentration, and at a temperature of at least 65°C, or equivalent conditions. Reference herein to a particular level of stringency encompasses equivalent conditions using wash/hybridization solutions other than SSC known to those skilled in the art.
  • the stringency is increased by reducing the concentration of SSC buffer, and/or increasing the concentration of SDS and/or increasing the temperature of the hybridization and/or wash.
  • the conditions for hybridization and/or wash may vary depending upon the nature of the hybridization matrix used to support the sample DNA, and/or the type of hybridization probe used.
  • stringency is determined based upon the temperature at which a probe or primer dissociates from a target sequence (i.e., the probe or primers melting temperature or Tm). Such a temperature may be determined using, for example, an equation or by empirical means. Several methods for the determination of the Tm of a nucleic acid are known in the art.
  • the Wallace Rule determines the G + C and the T + A concentrations in the oligonucleotide and uses this information to calculate a theoretical Tm (Wallace et al, Nucleic Acids Res. 6, 3543, 1979).
  • Alternative methods such as, for example, the nearest neighbour method are known in the art, and described, for example, in Howley, et al, J. Biol. Chem. 254, 4876, Santa Lucia, Proc. Natl. Acad. Sci. USA, 95: 1460-1465, 1995 or Bresslauer et al, Proc. Natl. Acad. Sci. USA, 83: 3746-3750, 1986.
  • a temperature that is similar to (e.g., within 5°C or within 10°C) or equal to the proposed denaturing temperature of a probe or primer is considered to be high stringency.
  • Medium stringency is to be considered to be within 10°C to 20°C or 10°C to 15°C of the calculated Tm of the probe or primer.
  • probe or primer used in an assay of the present invention will depend upon the assay format used. Clearly, a probe or primer that is capable of preferentially or specifically hybridizing or annealing to or detecting the marker of interest is preferred.
  • Methods for designing probes and/or primers for, for example, PCR or hybridization are known in the art and described, for example, in Dieffenbach and Dveksler (Eds) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratories, NY, 1995).
  • Eds Dieffenbach and Dveksler
  • several software packages are publicly available that design optimal probes and/or primers for a variety of assays, e.g. Primer 3 available from the Center for Genome Research, Cambridge, MA, USA.
  • Probes and/or primers useful for detection of a marker associated with a therapeutic response are assessed to determine those that do not form hairpins, self-prime or form primer dimers (e.g. with another probe or primer used in a detection assay). Furthermore, a probe or primer (or the sequence thereof) is assessed to determine the temperature at which it denatures from a target nucleic acid (i.e. the melting temperature of the probe or primer, or Tm). Methods of determining Tm are known in the art and described, for example, in Santa Lucia, Proc. Natl. Acad. Sci. USA, 95: 1460-1465, 1995 or Bresslauer et al, Proc. Natl. Acad. Sci. USA, 83: 3746-3750, 1986.
  • a primer or probe useful for detecting a SNP or mutation in an allele specific PCR assay or a ligase chain reaction assay is designed such that the 3' terminal nucleotide hybridizes to the site of the SNP or mutation.
  • the 3' terminal nucleotide may be any of the nucleotides known to be present at the site of the SNP or mutation.
  • complementary nucleotides occur in the probe or primer and at the site of the polymorphism the 3' end of the probe or primer hybridizes completely to the marker of interest and facilitates amplification, for example, PCR amplification or ligation to another nucleic acid. Accordingly, a probe or primer that completely hybridizes to the target nucleic acid produces a positive result in an assay.
  • a primer useful for a primer extension reaction is designed such that it preferentially or specifically hybridizes to a region adjacent to a specific nucleotide of interest, e.g. a SNP or mutation.
  • the specific hybridization of a probe or primer may be estimated by determining the degree of homology of the probe or primer to any nucleic acid using software, such as, for example, BLAST, the specificity of a probe or primer can only be determined empirically using methods known in the art.
  • a locked nucleic acid (LNA) or protein-nucleic acid (PNA) probe or a molecular beacon useful, for example, for detection of a SNP or mutation or microsatellite by hybridization is at least about 8 to 12 nucleotides in length.
  • the nucleic acid, or derivative thereof, that hybridizes to the site of the SNP or mutation or microsatellite is positioned at approximately the centre of the probe, thereby facilitating selective hybridization and accurate detection.
  • oligonucleotide synthesis is described, in Gait (Ed) (In: Oligonucleotide Synthesis: A Practical Approach, IRL Press, Oxford, 1984).
  • a probe or primer may be obtained by biological synthesis (eg. by digestion of a nucleic acid with a restriction endonuclease) or by chemical synthesis.
  • biological synthesis eg. by digestion of a nucleic acid with a restriction endonuclease
  • chemical synthesis is preferable.
  • oligonucleotide synthesis include, for example, phosphotriester and phosphodiester methods (Narang, et al. Meth. Enzymol 68: 90, 1979) and synthesis on a support (Beaucage, et al Tetrahedron Letters 22: 1859-1862, 1981) as well as phosphoramidate technique, Caruthers, M. H., et al, "Methods in Enzymology," Vol. 154, pp. 287-314 (1988), and others described in “Synthesis and Applications of DNA and PvNA,” S. A. Narang, editor, Academic Press, New York, 1987, and the references contained therein.
  • LNA synthesis is described, for example, in Nielsen et al, J. Chem. Soc. Perkin Trans., 1: 3423, 1997; Singh and Wengel, Chem. Commun. 1247, 1998. While, PNA synthesis is described, for example, in Egholm et al, Am. Chem. Soc., 114: 1895, 1992; Egholm et al, Nature, 365: 566, 1993; and Oram et al, Nucl. Acids Res., 21: 5332, 1993.
  • the probe or primer comprises one or more detectable markers.
  • the probe or primer comprises a fluorescent label such as, for example, fluorescein (FITC), 5,6-carboxymethyl fluorescein, Texas red, nitrobenz-2-oxa-l,3- diazol-4-yl (NBD), coumarin, dansyl chloride, rhodamine, 4'-6-diamidino-2- phenylinodole (DAPI), and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7, fluorescein (5-carboxyfluorescein-N-hydroxysuccinimide ester), rhodamine (5,6- tetramethyl rhodamine).
  • FITC fluorescein
  • NBD nitrobenz-2-oxa-l,3- diazol-4-yl
  • DAPI nitrobenz-2-oxa-l,3- diazol-4-yl
  • DAPI nitrobenz-2-ox
  • the absorption and emission maxima, respectively, for these fluors are: FITC (490 nm; 520 nm), Cy3 (554 nm; 568 nm), Cy3.5 (581 nm; 588 nm), Cy5 (652 nm: 672 nm), Cy5.5 (682 nm; 703 nm) and Cy7 (755 nm; 778 nm).
  • the probe or primer is labeled with, for example, a fluorescent semiconductor nanocrystal (as described, for example, in US 6,306,610), a radiolabel or an enzyme (e.g. horseradish peroxidase (HRP), alkaline phosphatase (AP) or ⁇ - galactosidase).
  • a fluorescent semiconductor nanocrystal as described, for example, in US 6,306,610
  • a radiolabel or an enzyme e.g. horseradish peroxidase (HRP), alkaline phosphatase (AP) or ⁇ - galactosidase.
  • Such detectable labels facilitate the detection of a probe or primer, for example, the hybridization of the probe or primer or an amplification product produced using the probe or primer.
  • Methods for producing such a labeled probe or primer are known in the art.
  • commercial sources for the production of a labeled probe or primer will be known to the skilled artisan, e.g., Sigma-Genosys, Sydney, Australia.
  • the present invention additionally contemplates the use a probe or primer as described herein in the manufacture of a diagnostic reagent for diagnosing or determining a predisposition to a therapeutic response. b) Detection methods
  • Methods for detecting nucleic acids include for example, hybridization based assays, amplification based assays and restriction endonuclease based assays.
  • a change in the sequence of a region of the genome or an expression product thereof such as, for example, an insertion, a deletion, a transversion, a transition, alternative splicing or a change in the preference of or occurrence of a splice form of a gene is detected using a method, such as, polymerase chain reaction (PCR) strand displacement amplification, ligase chain reaction, cycling probe technology or a DNA microarray chip amongst others.
  • PCR polymerase chain reaction
  • PCR Methods of PCR are known in the art and described, for example, in Dieffenbach (Ed) and Dveksler (Ed) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratories, NY, 1995).
  • two non-complementary nucleic acid primer molecules comprising at least about 20 nucleotides in length, and more preferably at least 30 nucleotides in length are hybridized to different strands of a nucleic acid template molecule, and specific nucleic acid molecule copies of the template are amplified enzymatically.
  • PCR products may be detected using electrophoresis and detection with a detectable marker that binds nucleic acids.
  • one or more of the oligonucleotides are labeled with a detectable marker (e.g. a fluorophore) and the amplification product detected using, for example, a lightcycler (Perkin Elmer, Wellesley, MA, USA).
  • a detectable marker e.g. a fluorophore
  • the present invention also encompasses quantitative forms of PCR, such as, for example, Taqman assays.
  • Strand displacement amplification utilizes oligonucleotides, a DNA polymerase and a restriction endonuclease to amplify a target sequence.
  • the oligonucleotides are hybridized to a target nucleic acid and the polymerase used to produce a copy of this region.
  • the duplexes of copied nucleic acid and target nucleic acid are then nicked with an endonuclease that specifically recognizes a sequence at the beginning of the copied nucleic acid.
  • the DNA polymerase recognizes the nicked DNA and produces another copy of the target region at the same time displacing the previously generated nucleic acid.
  • SDA Strand displacement amplification
  • Ligase chain reaction uses at least two oligonucleotides that bind to a target nucleic acid in such a way that they are adjacent. A ligase enzyme is then used to link the oligonucleotides. Using thermocycling the ligated oligonucleotides then become a target for further oligonucleotides. The ligated fragments are then detected, for example, using electrophoresis, or MALDI-TOF. Alternatively, or in addition, one or more of the probes is labeled with a detectable marker, thereby facilitating rapid detection.
  • Cycling Probe Technology uses chimeric synthetic probe that comprises DNA-RNA- DNA that is capable of hybridizing to a target sequence. Upon hybridization to a target sequence the RNA-DNA duplex formed is a target for RNase H thereby cleaving the probe. The cleaved probe is then detected using, for example, electrophoresis or ALDI-TOF.
  • a marker that is associated with or causative of a therapeutic response occurs within a protein coding region of a genomic gene (e.g. an IFN-A3 gene) and is detectable in mRNA encoded by that gene.
  • a marker may be an alternate splice-form of a mRNA encoded by a genomic gene (e.g. a splice form not observed in a normal and/or healthy subject, or, alternatively, an increase or decrease in the level of a splice form in a subject that carries the marker).
  • Such a marker may be detected using, for example, reverse-transcriptase PCR (RT-PCR), transcription mediated amplification (TMA) or nucleic acid sequence based amplification (NASBA), although any mRNA or cDNA based hybridization and/or amplification protocol is clearly amenable to the instant invention.
  • RT-PCR reverse-transcriptase PCR
  • TMA transcription mediated amplification
  • NASBA nucleic acid sequence based amplification
  • RT-PCR Methods of RT-PCR are known in the art and described, for example, in Dieffenbach (Ed) and Dveksler (Ed) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratories, NY, 1995).
  • Methods of TMA or self-sustained sequence replication use two or more oligonucleotides that flank a target sequence, a RNA polymerase, RNase H and a reverse transcriptase.
  • One oligonucleotide (that also comprises a RNA polymerase binding site) hybridizes to an RNA molecule that comprises the target sequence and the reverse transcriptase produces cDNA copy of this region.
  • RNase H is used to digest the RNA in the RNA-DNA complex, and the second oligonucleotide used to produce a copy of the cDNA.
  • the RNA polymerase is then used to produce a RNA copy of the cDNA, and the process repeated.
  • NASBA systems rely on the simultaneous activity of three enzymes (a reverse transcriptase, RNase H and RNA polymerase) to selectively amplify target mRNA sequences.
  • the mRNA template is transcribed to cDNA by reverse transcription using an oligonucleotide that hybridizes to the target sequence and comprises a RNA polymerase binding site at its 5' end.
  • the template RNA is digested with RNase H and double stranded DNA is synthesized.
  • the RNA polymerase then produces multiple RNA copies of the cDNA and the process is repeated.
  • the hybridization to and/or amplification of a marker associated with a therapeutic response is detectable using, for example, electrophoresis and/or mass spectrometry.
  • one or more of the probes/primers and/or one or more of the nucleotides used in an amplification reactions may be labeled with a detectable marker to facilitate rapid detection of a marker, for example, marker as described supra, e.g., a fluorescent label ⁇ e.g. Cy5 or Cy3) or a radioisotope (e.g. 32 P).
  • amplification of a nucleic acid may be continuously monitored using a melting curve analysis method, such as that described in, for example, US 6,174,670.
  • a marker associated with a therapeutic response comprises a single nucleotide change.
  • Methods of detecting single nucleotide changes are known in the art, and reviewed, for example, in Landegren et al, Genome Research 8: 769-776, 1998.
  • a single nucleotide changes that introduces or alters a sequence that is a recognition sequence for a restriction endonuclease is detected by digesting DNA with the endonuclease and detecting the fragment of interest using, for example, Southern blotting (described in Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987) and Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001)).
  • a nucleic acid amplification method described supra is used to amplify the region surrounding the single nucleotide changes.
  • the amplification product is then incubated with the endonuclease and any resulting fragments detected, for example, by electrophoresis, MALDI-TOF or PCR.
  • the direct analysis of the sequence of polymorphisms of the present invention can be accomplished using either the dideoxy chain termination method or the Maxam-Gilbert method (see Sambrook et ai, Molecular Cloning, A Laboratory Manual (2nd Ed., CSHP, New York 1989); Zyskind et ai, Recombinant DNA Laboratory Manual, (Acad. Press, 1988)).
  • a single nucleotide change is detected using single stranded conformational polymorphism (SSCP) analysis.
  • SSCP analysis relies upon the formation of secondary structures in nucleic acids and the sequence dependent nature of these secondary structures.
  • an amplification method such as, for example, a method described supra, is used to amplify a nucleic acid that comprises a single nucleotide change.
  • the amplified nucleic acids are then denatured, cooled and analyzed using, for example, non-denaturing polyacrylamide gel electrophoresis, mass spectrometry, or liquid chromatography (e.g. HPLC or dHPLC).
  • Regions that comprise different sequences form different secondary structures, and as a consequence migrate at different rates through, for example, a gel and/or a charged field.
  • a detectable marker may be incorporated into a probe/primer useful in SSCP analysis to facilitate rapid marker detection.
  • any nucleotide changes are detected using, for example, mass spectrometry or capillary electrophoresis.
  • amplified products of a region of DNA comprising a single nucleotide change from a test sample are mixed with amplified products from a normal healthy individual. The products are denatured and allowed to re-anneal.
  • samples that comprise a different nucleotide at the position of the single nucleotide change will not completely anneal to a nucleic acid molecule from a normal/healthy individual thereby changing the charge and/or conformation of the nucleic acid, when compared to a completely annealed nucleic acid.
  • Such incorrect base pairing is detectable using, for example, mass spectrometry.
  • Mass spectrometry is also useful for detecting the molecular weight of a short amplified product, wherein a nucleotide change causes a change in molecular weight of the nucleic acid molecule (such a method is described, for example, in US 6,574,700).
  • Allele specific PCR (as described, for example, In Liu et al, Genome Research, 7: 389- 398, 1997) is also useful for determining the presence of one or other allele of a single nucleotide change.
  • An oligonucleotide is designed, in which the most 3' base of the oligonucleotide hybridizes with the single nucleotide change.
  • PCR reaction if the 3' end of the oligonucleotide does not hybridize to a target sequence, little or no PCR product is produced, indicating that a base other than that present in the oligonucleotide is present at the site of single nucleotide change in the sample.
  • PCR products are then detected using, for example, gel or capillary electrophoresis or mass spectrometry.
  • Primer extension methods are also useful for the detection of a single nucleotide change.
  • This oligonucleotide is then used in a primer extension protocol with a polymerase and a free nucleotide diphosphate that corresponds to either or any of the possible bases that occur at the single nucleotide change.
  • the nucleotide-diphosphate is labeled with a detectable marker (e.g.
  • primer extension products are detected using mass spectrometry (e.g. MALDI-TOF).
  • the present invention extends to high-throughput forms primer extension analysis, such as, for example, minisequencing (Sy Vamen et al, Genomics 9: 341- 342, 1995).
  • a probe or primer or multiple probes or primers
  • a solid support e.g. a glass slide
  • a biological sample comprising nucleic acid is then brought into direct contact with the probe/s or primer/s, and a primer extension protocol performed with each of the free nucleotide bases labeled with a different detectable marker.
  • the nucleotide present at a single nucleotide change or a number of single nucleotide changes is then determined by determining the detectable marker bound to each probe and/or primer.
  • LNA and PNA molecules Fluorescently labeled locked nucleic acid (LNA) molecules or fluorescently labeled protein-nucleic acid (PNA) molecules are useful for the detection of SNPs (as described in Simeonov and Nikiforov, Nucleic Acids Research, 30(17): 1-5, 2002).
  • LNA and PNA molecules bind, with high affinity, to nucleic acid, in particular, DNA.
  • Fluorophores in particular, rhodamine or hexachlorofluorescein conjugated to the LNA or PNA probe fluoresce at a significantly greater level upon hybridization of the probe to target nucleic acid. However, the level of increase of fluorescence is not enhanced to the same level when even a single nucleotide mismatch occurs.
  • the degree of fluorescence detected in a sample is indicative of the presence of a mismatch between the LNA or PNA probe and the target nucleic acid, such as, in the presence of a SNP.
  • fluorescently labeled LNA or PNA technology is used to detect a single base change in a nucleic acid that has been previously amplified using, for example, an amplification method described supra.
  • LNA or PNA detection technology is amenable to a high-throughput detection of one or more markers immobilizing an LNA or PNA probe to a solid support, as described in Orum et al, Clin. Chem. 45: 1898- 1905, 1999.
  • Molecular Beacons are useful for detecting single nucleotide changes directly in a sample or in an amplified product (see, for example, Mhlang and Malmberg, Methods 25: 463-471, 2001).
  • Molecular beacons are single stranded nucleic acid molecules with a stem-and-loop structure.
  • the loop structure is complementary to the region surrounding the single nucleotide change of interest.
  • the stem structure is formed by annealing two "arms,” complementary to each other, that are on either side of the probe (loop).
  • a fluorescent moiety is bound to one arm and a quenching moiety to the other arm that suppresses any detectable fluorescence when the molecular beacon is not bound to a target sequence.
  • the arms Upon binding of the loop region to its target nucleic acid the arms are separated and fluorescence is detectable.
  • a single base mismatch significantly alters the level of fluorescence detected in a sample. Accordingly, the presence or absence of a particular base at the site of a single nucleotide change is determined by the level of fluorescence detected.
  • a single nucleotide change can also be identified by hybridization to nucleic acid arrays, an example of which is described in WO 95/1 1995.
  • WO 95/11995 also describes subarrays that are optimized for detection of a variant form of a pre- characterized polymorphism.
  • Such a sub-array contains probes designed to be complementary to a second reference sequence, which is an allelic variant of the first reference sequence.
  • the second group of probes is designed by the same principles, except that the probes exhibit complementarity to the second reference sequence.
  • a second group (or further groups) can be particularly useful for analyzing short sub-sequences of the primary reference sequence in which multiple mutations are expected to occur within a short distance commensurate with the length of the probes (e.g., two or more mutations within 9 to 21 bases).
  • the present invention encompasses other methods of detecting a single nucleotide change that is associated with a therapeutic response, such as, for example, SNP microarrays (available from Affymetrix, or described, for example, in US 6,468,743 or Hacia et al, Nature Genetics, 14: 441, 1996), Taqman assays (as described in Livak et al, Nature Genetics, 9: 341-342, 1995), solid phase minisequencing (as described in Syvamen et al, Genomics, 13: 1008-1017, 1992), minisequencing with FRET (as described in Chen and Kwok , Nucleic Acids Res.
  • SNP microarrays available from Affymetrix, or described, for example, in US 6,468,743 or Hacia et al, Nature Genetics, 14: 441, 1996)
  • Taqman assays as described in Livak et al, Nature Genetics, 9: 341-342, 1995
  • a single nucleotide change associated with a therapeutic response is detected using a Taqman assay essentially as described by Corder et al., Science, 261: 921-923.
  • Serological markers may be employed conveniently to determine HLA-C serotypes arising by expression of HLA-C 1 alleles or HLA-C2 alleles e.g., by isoelectric focussing (IEF) of sera and C2-specific hemolytic agarose overlay as described by Alper et al, J. Exp. Med. 144, pi 111 et seq. (1976) or Hobart et al, J. Immunol 116, pl736 et seq. (1976) incorporated herein by reference.
  • IEF isoelectric focussing
  • ligand shall be taken in its broadest context to include any chemical compound, polynucleotide, peptide, protein, lipid, carbohydrate, small molecule, natural product, polymer, etc. that is capable of selectively binding, whether covalently or not, to one or more specific sites on a polypeptide encoded by a gene linked to a SNP of Table 1.
  • the ligand may bind to its target via any means including hydrophobic interactions, hydrogen bonding, electrostatic interactions, van der Waals interactions, pi stacking, covalent bonding, or magnetic interactions amongst others. It is particularly preferred that a ligand is able to specifically bind to a specific form of a polypeptide marker.
  • antibody refers to intact monoclonal or polyclonal antibodies, immunoglobulin (IgA, IgD, IgG, IgM, IgE) fractions, humanized antibodies, or recombinant single chain antibodies, as well as fragments thereof, such as, for example Fab, F(ab)2, and Fv fragments.
  • Antibodies are prepared by any of a variety of techniques known to those of ordinary skill in the art, and described, for example in, Harlow and Lane (In: Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988).
  • an immunogen comprising the antigenic polypeptide is initially injected into any one of a wide variety of animals (e.g., mice, rats, rabbits, sheep, humans, dogs, pigs, chickens and goats).
  • the immunogen is derived from a natural source, produced by recombinant expression means, or artificially generated, such as by chemical synthesis (e.g., BOC chemistry or FMOC chemistry).
  • a peptide comprising any variant amino acid listed in Table 1 may be employed as an antigen for antibody production.
  • a peptide, polypeptide or protein is joined to a carrier protein, such as bovine serum albumin or keyhole limpet hemocyanin.
  • the immunogen and optionally a carrier for the protein is injected into the animal host, preferably according to a predetermined schedule incorporating one or more booster immunizations, and blood collected from said the animals periodically.
  • the immunogen is injected in the presence of an adjuvant, such as, for example Freund's complete or incomplete adjuvant, lysolecithin and dinitrophenol to enhance the subject's immune response to the immunogen.
  • Monoclonal or polyclonal antibodies specific for the polypeptide are then purified from blood isolated from an animal by, for example, affinity chromatography using the polypeptide coupled to a suitable solid support.
  • Monoclonal antibodies specific for the antigenic polypeptide of interest are prepared, for example, using the technique of Kohler and Milstein, Eur. J. Immunol. 5:511-519, 1976, and improvements thereto. Briefly, these methods involve the preparation of immortal cell lines capable of producing antibodies having the desired specificity (i.e., reactivity with the polypeptide of interest). Such cell lines are produced, for example, from spleen cells obtained from an animal immunized as described supra. The spleen cells are immortalized by, for example, fusion with a myeloma cell fusion partner, preferably one that is syngeneic with the immunized animal.
  • fusion techniques are known in the art, for example, the spleen cells and myeloma cells are combined with a nonionic detergent or electrofused and then grown in a selective medium that supports the growth of hybrid cells, but not myeloma cells.
  • a preferred selection technique uses HAT (hypoxanthine, aminopterin, and thymine) selection. After a sufficient time, usually about 1 to 2 weeks, colonies of hybrids are observed. Single colonies are selected and growth media in which the cells have been grown is tested for the presence of an antibody having binding activity against the polypeptide (immunogen). Hybridomas having high reactivity and specificity are preferred.
  • Monoclonal antibodies are isolated from the supernatants of growing hybridoma colonies using methods such as, for example, affinity purification as described supra.
  • Various techniques are also known for enhancing antibody yield, such as injection of the hybridoma cell line into the peritoneal cavity of a suitable vertebrate host, such as a mouse. Monoclonal antibodies are then harvested from the ascites fluid or the blood of such an animal subject. Contaminants are removed from the antibodies by conventional techniques, such as chromatography, gel filtration, precipitation, and/or extraction.
  • the marker associated with neurodegeneration of this invention may be used in the purification process in, for example, an affinity chromatography step.
  • an immunogen used in the production of an antibody is one which is sufficiently antigenic to stimulate the production of antibodies that will bind to the immunogen and is preferably, a high titer antibody.
  • an immunogen is an entire protein.
  • an immunogen consists of a peptide representing a fragment of a polypeptide.
  • an antibody raised to such an immunogen also recognizes the full-length protein from which the immunogen was derived, such as, for example, in its native state or having native conformation.
  • an antibody raised against a peptide immunogen recognizes the full-length protein from which the immunogen was derived when the protein is denatured.
  • denatured is meant that conformational epitopes of the protein are disrupted under conditions that retain linear B cell epitopes of the protein. As will be known to a skilled artisan linear epitopes and conformational epitopes may overlap.
  • a monoclonal antibody is produced using a method such as, for example, a human B-cell hybridoma technique (Kozbar et al, Immunol. Today 4:12, 1983), a EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al. Monoclonal Antibodies in Cancer Therapy, 1985 Allen R. Bliss, Inc., pages 77-96), or screening of combinatorial antibody libraries (Huse et al, Science 246:1275, 1989).
  • the method of the invention detects the presence of a marker in a polypeptide, said marker being associated or causative of with a therapeutic response.
  • An amount, level or presence of a polypeptide is determined using any of a variety of techniques known to the skilled artisan such as, for example, a technique selected from the group consisting of, immunohistochemistry, immunofluorescence, an immunoblot, a Western blot, a dot blot, an enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), enzyme immunoassay, isoelectric focussing (IEF), fluorescence resonance energy transfer (FRET), matrix-assisted laser desorption/ionization time of flight (MALDI-TOF), electrospray ionization (ESI), mass spectrometry (including tandem mass spectrometry, e.g.
  • an assay used to determine the amount or level of a protein is a semiquantitative assay. In another example, an assay used to determine the amount or level of a protein in a quantitative assay.
  • an amount of antibody or ligand bound to a marker of a therapeutic response is determined using an immunoassay.
  • an assay selected from the group consisting of immunohistochemistry, immunofluorescence, enzyme linked immunosorbent assay (ELISA), fluorescence linked immunosorbent assay (FLISA) Western blotting, RIA, a biosensor assay, a protein chip assay, a mass spectrometry assay, a fluorescence resonance energy transfer assay and an immunostaining assay (e.g. immunofluorescence).
  • Standard solid-phase ELISA or FLISA formats are particularly useful in determining the concentration of a protein from a variety of samples.
  • such an assay involves immobilizing a biological sample onto a solid matrix, such as, for example a polystyrene or polycarbonate microwell or dipstick, a membrane, or a glass support (e.g. a glass slide).
  • a solid matrix such as, for example a polystyrene or polycarbonate microwell or dipstick, a membrane, or a glass support (e.g. a glass slide).
  • An antibody that specifically binds to a marker of a therapeutic response is brought into direct contact with the immobilized biological sample, and forms a direct bond with any of its target protein present in said sample.
  • This antibody is generally labeled with a detectable reporter molecule, such as for example, a fluorescent label (e.g. FITC or Texas Red) or a fluorescent semiconductor nanocrystal (as described in US 6,306,610) in the case of a FLISA or an enzyme (e.g.
  • HRP horseradish peroxidase
  • AP alkaline phosphatase
  • ⁇ - galactosidase a suitably labeled secondary antibody that binds to the first antibody.
  • the label is detected either directly, in the case of a fluorescent label, or through the addition of a substrate, such as for example hydrogen peroxide, TMB, or toluidine, or 5-bromo-4-chloro-3-indol-beta-D-galaotopyranoside (x-gal) in the case of an enzymatic label.
  • a substrate such as for example hydrogen peroxide, TMB, or toluidine, or 5-bromo-4-chloro-3-indol-beta-D-galaotopyranoside (x-gal) in the case of an enzymatic label.
  • a substrate such as for example hydrogen peroxide, TMB, or toluidine, or 5-bromo-4-chloro-3-indol-
  • an ELISA comprises immobilizing an antibody or ligand that specifically binds a marker employed in the prognostic assay of the invention on a solid matrix, such as, for example, a membrane, a polystyrene or polycarbonate microwell, a polystyrene or polycarbonate dipstick or a glass support.
  • a sample is then brought into physical relation with said antibody, and a marker within the polypeptide is bound or 'captured'.
  • the bound protein is then detected using a labeled antibody.
  • a labeled anti-human antibody that binds to an epitope that is distinct from the first (capture) antibody is used to detect the captured protein.
  • a third labeled antibody can be used that binds the second (detecting) antibody.
  • a marker is detected using a radioimmunoassay (RIA).
  • RIA radioimmunoassay
  • the basic principle of the assay is the use of a radiolabeled antibody or antigen to detect antibody-antigen interactions.
  • An antibody or ligand that specifically binds to the marker is bound to a solid support and a sample brought into direct contact with said antibody.
  • an isolated and/or recombinant form of the antigen is radiolabeled and brought into contact with the same antibody. Following washing, the level of bound radioactivity is detected.
  • any antigen in the biological sample inhibits binding of the radiolabeled antigen the level of radioactivity detected is inversely proportional to the level of antigen in the sample.
  • Such an assay may be quantitated by using a standard curve using increasing known concentrations of the isolated antigen.
  • such an assay may be modified to use any reporter molecule, such as, for example, an enzyme or a fluorescent molecule, in place of a radioactive label.
  • any reporter molecule such as, for example, an enzyme or a fluorescent molecule, in place of a radioactive label.
  • Western blotting is used to determine the level of a marker employed in the prognostic assay of the invention.
  • protein from a sample is separated using sodium doedecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) using techniques known in the art and described in, for example, Scopes (In: Protein Purification: Principles and Practice, Third Edition, Springer Verlag, 1994). Separated proteins are then transferred to a solid support, such as, for example, a membrane ⁇ e.g., a PVDF membrane), using methods known in the art, for example, electrotransfer.
  • a solid support such as, for example, a membrane ⁇ e.g., a PVDF membrane
  • This membrane is then blocked and probed with a labeled antibody or ligand that specifically binds to a marker of a therapeutic response.
  • a labeled secondary, or even tertiary, antibody or ligand is used to detect the binding of a specific primary antibody.
  • the level of label is then determined using an assay appropriate for the label used. An appropriate assay will be apparent to the skilled artisan.
  • the level or presence a protein marker is determined using methods known in the art, such as, for example, densitometry.
  • the intensity of a protein band or spot is normalized against the total amount of protein loaded on a SDS- PAGE gel using methods known in the art.
  • the level of the marker detected is normalized against the level of a control/reference protein.
  • control proteins include, for example, actin, glyceraldehyde 3- phosphate dehydrogenase (GAPDH), ⁇ 2 microglobulin, hydroxy-methylbilane synthase, hypoxanthine phosphoribosyl-transferase 1 (HPRT), ribosomal protein LI 3c, succinate dehydrogenase complex subunit A and TATA box binding protein (TBP).
  • GPDH glyceraldehyde 3- phosphate dehydrogenase
  • HPRT hypoxanthine phosphoribosyl-transferase 1
  • TBP TATA box binding protein
  • a polypeptide marker of a therapeutic response is detected within a cell, using methods known in the art, such as, for example, immunohistochemistry or immunofluorescence.
  • a cell or tissue section that is to be analyzed to determine the presence of the marker is fixed, to stabilize and protect both the cell and the proteins contained within the cell.
  • the method of fixation does not disrupt or destroy the antigenicity of the marker, thus rendering it undetectable.
  • Methods of fixing a cell include for example, treatment with paraformaldehyde, treatment with alcohol, treatment with acetone, treatment with methanol, treatment with Bouin's fixative and treatment with glutaraldehyde.
  • a cell is incubated with a ligand or antibody capable of binding the marker.
  • the ligand or antibody is, for example, labeled with a detectable marker, such as, for example, a fluorescent label (e.g.
  • FITC fluorescent semiconductor nanocrystal
  • an enzyme e.g. horseradish peroxidase (HRP)
  • HRP horseradish peroxidase
  • AP alkaline phosphatase
  • ⁇ -galactosidase e.g. horseradish peroxidase (HRP)
  • HRP horseradish peroxidase
  • AP alkaline phosphatase
  • ⁇ -galactosidase e.g. horseradish peroxidase (HRP)
  • AP alkaline phosphatase
  • ⁇ -galactosidase e.g. horseradish peroxidase (HRP)
  • AP alkaline phosphatase
  • ⁇ -galactosidase e.g. horseradish peroxidase (HRP)
  • AP alkaline phosphatase
  • ⁇ -galactosidase e.g. horseradish peroxidas
  • immunofluorescence or immunohistochemistry will comprise additional steps such as, for example, cell permeabilization (using, for example, n-octyl-BD- glucopyranoside, deoxycholate, a non-ionic detergent such as Triton X-100 NP-40, low concentrations of ionic detergents, such as, for example SDS or saponin) and/or antigen retrieval (using, for example, heat).
  • cell permeabilization using, for example, n-octyl-BD- glucopyranoside, deoxycholate, a non-ionic detergent such as Triton X-100 NP-40, low concentrations of ionic detergents, such as, for example SDS or saponin
  • ionic detergents such as, for example SDS or saponin
  • antigen retrieval using, for example, heat).
  • Biosensor devices generally employ an electrode surface in combination with current or impedance measuring elements to be integrated into a device in combination with the assay substrate (such as that described in U.S. Patent No. 5,567,301).
  • An antibody/ligand that specifically binds to a marker of a therapeutic response is preferably incorporated onto the surface of a biosensor device and a biological sample contacted to said device.
  • a change in the detected current or impedance by the biosensor device indicates protein binding to said antibody.
  • Some forms of biosensors known in the art also rely on surface plasmon resonance to detect protein interactions, whereby a change in the surface plasmon resonance surface of reflection is indicative of a protein binding to a ligand or antibody (U.S. Patent No. 5,485,277 and 5,492,840).
  • Biosensors are of particular use in high throughput analysis due to the ease of adapting such systems to micro- or nano-scales. Furthermore, such systems are conveniently adapted to incorporate several detection reagents, allowing for multiplexing of diagnostic reagents in a single biosensor unit. This permits the simultaneous detection of several proteins or peptides in a small amount of body fluids.
  • Evanescent biosensors are also preferred as they do not require the pre-treatment of a biological sample prior to detection of a protein of interest.
  • An evanescent biosensor generally relies upon light of a predetermined wavelength interacting with a fluorescent molecule, such as for example, a fluorescent antibody attached near the probe's surface, to emit fluorescence at a different wavelength upon binding of the target polypeptide to the antibody or ligand.
  • Micro- or nano-cantilever biosensors are also preferred as they do not require the use of a detectable label.
  • a cantilever biosensor utilizes a ligand and/or antibody capable of specifically detecting the analyte of interest that is bound to the surface of a deflectable arm of a micro- or nano-cantilever.
  • the deflectable arm of the cantilever Upon binding of the analyte of interest (e.g. a marker employed in the prognostic assay of the invention) the deflectable arm of the cantilever is deflected in a vertical direction (i.e. upwards or downwards).
  • the change in the deflection of the deflectable arm is then detected by any of a variety of methods, such as, for example, atomic force microscopy, a change in oscillation of the deflectable arm or a change in pizoresistivity.
  • exemplary micro-cantilever sensors are described in USSN 20030010097.
  • the proteins, peptides, polypeptides, antibodies or ligands that are able to bind specific antibodies or proteins of interest are bound to a solid support such as for example glass, polycarbonate, polytetrafluoroethylene, polystyrene, silicon oxide, metal or silicon nitride.
  • a solid support such as for example glass, polycarbonate, polytetrafluoroethylene, polystyrene, silicon oxide, metal or silicon nitride.
  • This immobilization is either direct (e.g. by covalent linkage, such as, for example, Schiff s base formation, disulfide linkage, or amide or urea bond formation) or indirect.
  • Methods of generating a protein chip are known in the art and are described in for example U.S. Patent Application No. 20020136821, 20020192654, 20020102617 and U.S. Patent No. 6,391,625.
  • an antibody or ligand may be captured on a microfabricated polyacrylamide gel pad and accelerated into the gel using microelectrophoresis as described in, Arenkov et al. Anal. Biochem. 275:123-131, 2000.
  • a protein chip may comprise only one protein, ligand or antibody, and be used to screen one or more patient samples for the presence of one polypeptide of interest. Such a chip may also be used to simultaneously screen an array of patient samples for a polypeptide of interest.
  • a protein sample to be analyzed using a protein chip is attached to a reporter molecule, such as, for example, a fluorescent molecule, a radioactive molecule, an enzyme, or an antibody that is detectable using methods known in the art.
  • a reporter molecule such as, for example, a fluorescent molecule, a radioactive molecule, an enzyme, or an antibody that is detectable using methods known in the art.
  • a protein chip by contacting a protein chip with a labeled sample and subsequent washing to remove any unbound proteins the presence of a bound protein is detected using methods known in the art, such as, for example, using a DNA microarray reader.
  • biomolecular interaction analysis-mass spectrometry (BIA-MS) is used to rapidly detect and characterize a protein present in complex biological samples at the low- to sub-fmole level (Nelson et al. Electrophoresis 21: 1 155-1 163, 2000).
  • One technique useful in the analysis of a protein chip is surface enhanced laser desorption/ionization-time of flight-mass spectrometry (SELDI-TOF-MS) technology to characterize a protein bound to the protein chip.
  • the protein chip is analyzed using ESI as described in U.S. Patent Application 20020139751.
  • any cell or sample that comprises genomic DNA is useful for determining a disease or disorder and/or a predisposition to a disease or disorder.
  • the cell or sample is derived from a human.
  • the cell or sample comprises a nucleated cell.
  • Preferred biological samples include, for example, whole blood, serum, plasma, peripheral blood mononuclear cells (PBMC), a buffy coat fraction, saliva, urine, a buccal cell, fecal material, sweat, liver biopsy or a skin cell.
  • PBMC peripheral blood mononuclear cells
  • a biological sample comprises a white blood cell, more preferably, a lymphocyte cell.
  • the biological sample is a cell isolated using a method selected from the group consisting of amniocentesis, chorionic villus sampling, fetal blood sampling ⁇ e.g. cordocentesis or percutaneous umbilical blood sampling) and other fetal tissue sampling ⁇ e.g. fetal skin biopsy).
  • a biological sample will depend upon the detection means used. For example, an assay, such as, for example, PCR or single nucleotide primer extension may be performed on a sample comprising a single cell, although greater numbers of cells are preferred. Alternative forms of nucleic acid detection may require significantly more cells than a single cell.
  • protein- based assays require sufficient cells to provide sufficient protein for an antigen based assay.
  • the biological sample has been derived or isolated or obtained previously from the subject. Accordingly, the present invention also provides an ex vivo method. In one example, the method of the invention additionally comprises isolating, obtaining or providing the biological sample.
  • the method is performed using an extract from a biological sample, such as, for example, genomic DNA, mRNA, cDNA or protein.
  • biological sample also includes samples that comprise a cell or a plurality of cells, whether processed for analysis or not.
  • such an assay may require the use of a suitable control, e.g. a normal individual or a typical population, e.g., for quantification.
  • a suitable control e.g. a normal individual or a typical population, e.g., for quantification.
  • the term "normal individual” shall be taken to mean that the subject is selected on the basis that they are not undergoing treatment with an immunomodulatory composition.
  • the normal subject has not been diagnosed with any form of medical condition for which therapy may be recommended using, for example, clinical analysis.
  • a suitable control sample is a control data set comprising measurements of the marker being assayed for a typical population of subjects known not to suffer from a medical condition for which therapy may be recommended.
  • the subject is not at risk of developing such a medical condition and e.g., the subject does not have a history of the disease.
  • the term "typical population" with respect to subjects known not to suffer from a disease or disorder and/or comprise or express a marker of a therapeutic response shall be taken to refer to a population or sample of subjects tested using, for example, known methods for diagnosing the therapeutic response, and determined not to suffer from the disease and/or tested to determine the presence or absence of a marker of the disease, wherein said subjects are representative of the spectrum of normal and/or healthy subjects or subjects known not to suffer from the disease.
  • a reference sample is not included in an assay. Instead, a suitable reference sample is derived from an established data set previously generated from a typical population. Data derived from processing, analyzing and/or assaying a test sample is then compared to data obtained for the sample population.
  • Data obtained from a sufficiently large number of reference samples so as to be representative of a population allows the generation of a data set for determining the average level of a particular parameter. Accordingly, the amount of an expression product that is diagnostic of a therapeutic response can be determined for any population of individuals, and for any sample derived from said individual, for subsequent comparison to levels of the expression product determined for a sample being assayed. Where such normalized data sets are relied upon, internal controls are preferably included in each assay conducted to control for variation. Methods for determining a marker associated with therapeutic response
  • the invention additionally comprises determining a marker for a therapeutic response to any form of medical condition for which therapy with an immunomodulator would be recommended.
  • the present invention further provides methods for identifying new markers for a therapeutic response.
  • the present invention additionally provides a method for identifying a plurality of markers that is associated with a therapeutic response, said method comprising:
  • determining an association between a marker ⁇ e.g. a polymorphism and/or allele and/or a splice form and/or a mutation) and an event e.g., a response involves comparing the frequency of a polymorphism, allele, splice form or mutation at a specific locus between a sample of unrelated individuals undergoing treatment (i.e., and an appropriate control that is representative of the allelic distribution in the normal population.
  • Population stratification occurs when there are multiple subgroups with different allele frequencies present within a population.
  • the different underlying allele frequencies in the sampled subgroups may be independent of the disease, disorder and/or phenotype within each group, and, as a consequence, may produce erroneous conclusions of linkage disequilibrium or association.
  • case-comparison based design may be used in which a comparison between a group of unrelated probands with the disease, disorder and/or phenotype and a group of control (comparison) individuals who are unrelated to each other or to the probands, but who have been matched to the proband group on relevant variable (other than infection status) that may influence genotype (e.g. sex, ethnicity and/or age).
  • relevant variable other than infection status
  • controls are screened to exclude those subjects that have a personal history of a disease or treatment.
  • Such a "supernormal" control group is representative of the allele distribution of individuals unaffected by a disease or treatment.
  • an analysis of association is used to detect non-random distribution of one or more alleles and/or polymorphisms and/or splice variants within subjects affected by a disease/disorder and/or phenotype of interest.
  • the comparison between the test population and a suitable control population is made under the null hypothesis assumption that the locus to which the alleles and/or polymorphisms are linked has no influence on phenotype, and from this a nominal p-value is produced.
  • a biallelic polymorphism or mutation e.g.
  • a SNP using a case control study, a chi- square analysis (or equivalent test) of a 2 x 2 contingency table (for analysis of alleles) or a 3 x 2 contingency table (for analysis of genotypes) is used.
  • marker data from members of the family of each proband are used to estimate the expected null distributions and an appropriate statistical test performed that compares observed data with that expected under the null hypothesis.
  • Another method useful in the analysis of association of a marker with a disease, disorder and/or phenotype is the genomic control method (Devlin and Roeder, Biometrics, 55: 997-1004, 1999).
  • the genetic control method computes chi-square test statistics for both null and candidate loci. The variability and/or magnitude of the test statistics observed for the null loci are increased if population stratification and/or unmeasured genetic relationships among the subjects exist. This data is then used to derive a multiplier that is used to adjust the critical value for significance test for candidate loci. In this manner, genetic control permits analysis of stratified case-control data without an increased rate of false positives.
  • a structured association approach (Pritchard et al, Am. J. Hum. Genet., 67: 170-181, 2000) uses marker loci unlinked to a candidate marker to infer subpopulation membership. Latent class analysis is used to control for the effect of population substructure. Essentially, null loci are used to estimate the number of subpopulations and the probability of a subject's membership to each subpopulation. This method is then capable of accounting for a change in allele/polymorphism frequency as a result of population substructure. Alternatively, or in addition, a Bayesian statistical approach may be used to determine the significance of an association between an allele and/or polymorphism in a gene and a response to treatment. Such an approach takes account of the prior probability that the locus under examination is involved in the therapeutic response of interest (e.g., Morris et al, Am. J. Hum. Genet, 67: 155-169, 2001).
  • Publicly available software may be employed to determine associations.
  • This example demonstrates SNPs and alleles of the present invention that are associated with a response to therapy for hepatitis C virus infection using a composition comprising IFN.
  • the disclosed associations between variations in the IL28B gene are sufficiently-strong to indicate that genotypes in 19ql3.13 between position 44,423,000 and position 44,436,000, especially IFN- 3 (IL-28B) genotypes, can be used to predict drug responses.
  • the data also support the use of IFN- ⁇ e.g., IFN- ⁇ and/or IFN- 2 and/or ⁇ - ⁇ 3, for treatment of HCV infection and other diseases currently treated using other IFNs such as IFN-a or IFN- ⁇ or combinations thereof.
  • the data herein provide high response (HR) alleles associated with a rapid or strong or sustained virus response (SVR) of subjects to hepatitis C therapy comprising IFN-a and ribavirin, as determined by virus clearance, in addition to providing low response (LR) alleles associated with a poor or low response or no response to such therapy.
  • HR high response
  • SVR sustained virus response
  • LR low response
  • Tables 1 and 3 provide listings of SNPs linked to the IL28B gene on chromosome 19 which form part of the applicants' invention, including specific examples of HR alleles and LR alleles that are predictive of the response to treatment.
  • Table 4 provides data on the effects of different genotypes comprising exemplary HR alleles and/or LR alleles linked to IL28B including, for example, HR alleles and/or LR alleles having approximate p value less than about 10 "9 for rs8099917, rs8109886, rsl 0853727, rs8103142 and rs 12980275, in addition to several weak alleles of rs4803224, rsl2980602 and rsl0853728.
  • Table 5 provides data on the effects of different genotype combinations comprising exemplary HR alleles and/or LR alleles linked to IL28B, including, for example, rs8099917, rs8103142, and rsl2980275.
  • double-homozygotes for the HR alleles of rsl2980275 and rs8099917 and double-homozygotes for the HR alleles of rs8103142 and rs8099917 and triple homozygotes for the HR alleles of rsl2980275, rs8103142 and rs8099917 show strong responses to therapy (p ⁇ 6 x 10- 4 ), whereas the corresponding homozygotes for LR alleles at these loci demonstrate consistently low responses to therapy (p>0.04), as shown in Table 5.
  • Table 6 provides data on haplotype effects for haplotypes comprising exemplary HR alleles and/or LR alleles linked to IL28B including, for example, the haplotype comprising rsl2980275, rs8105790, rs8103142, rsl0853727, rs8109886 and rs8099917.
  • Table 7 provides data on the sensitivity, specificity, and positive predictive value (PPV) of different genotypes comprising exemplary HR alleles and/or LR alleles linked to IL28B. These data demonstrate that two doses of a LR allele i.e., homozygosity of the LR allele, is highly predictive of a poor, weak or non-response to therapy, especially with respect to LR alleles of rs4803221, rs8099917 and rsl2979860.
  • stage one genotyping a well-characterised Australian population of 302 patients of European ancestry, matched for age, BMI, viral titre, and treatment regime was employed (Table 2). Patients were excluded from the study if they had been co- infected with either HB V or HIV or if they were not of European descent. All patients included in this study had been diagnosed as infected with genotype 1 HCV based on serology and viral DNA tests, had received a standard course of pegylated interferon- alpha (IFN-a) and ribavirin, and their six-month post-treatment responses to therapy as determined by virus clearance had been determined.
  • IFN-a pegylated interferon- alpha
  • ribavirin six-month post-treatment responses to therapy as determined by virus clearance had been determined.
  • non- SVR non-sustained viral response
  • Hardy-Weinberg equilibrium and allelic distributions in subjects having high response(s) or low response(s) were compared using a chi-squared test in Haploview version 3.31 of the Broad Institute, USA e.g., as described by Barrett et al. Bioinformatics 21, 263-265 (2005).
  • the threshold for genome-wide significant association was set at p ⁇ 1.6 x 10 "7 i.e., 0.05/312,000. SNPs having 1.6xl0 "7 ⁇ p ⁇ l .OxlO "4 were considered to show a highly suggestive association with response to therapy.
  • SNPs having l.OxlO "4 ⁇ p ⁇ l.OxlO "3 were considered to show a moderately suggestive association with response to therapy.
  • the Cochran- Armitage trend test was used to assess association of all SNPs tested in Stage one and Stage two, and merged p values were determined.
  • the 302 patient samples were genotyped using the Infinium HumanHap300 or CNV370 genotyping BeadChip (Illumina, Inc., San Diego, USA). Samples having a very low call rate using the Illumina cluster (i.e., genotyping efficiency less than 95%) was deleted. A minor allele frequency (MAF) check was performed for data handling accuracy, and those SNPs occurring in less than 0.05% of samples were deleted. Samples providing a Hardy- Weinberg equilibrium p value > 10 "4 were retained. Two individuals were excluded due to genotyping call rates less than 90%, and IBS/IBD analysis revealed that those two individuals were related. The 99% confidence interval (CI) for genotyping error was estimated to be between 1.7% and 1.8%.
  • CI confidence interval
  • a Manhattan plot of signal intensity relative to genome position and a Quantile- Quantile plot of allelic associations for the stage one SNPs (not shown), identified SNPs that were more associated than may be expected by mere chance.
  • a genomic inflation factor lambda of 1.005 in that analysis indicated a low possibility of false positive associations e.g., due to population stratification.
  • a total of 312,000 SNPs passed the first stage quality filters and were analysed further.
  • SNPs were classified as highly or suggestively associated with the therapeutic response, as described under “statistical analysis” supra.
  • stage one three chromosome 19 SNPs were identified having a high or suggestive association with therapeutic response that were linked to the interferon lambda-3 (IFN- ⁇ 3) gene. No other SNPs mapping to chromosome 19 satisfied the threshold for genome- wide associations.
  • SNPs on other chromosomes were also identified having at least moderately suggestive positive associations with therapeutic response that mapped to the following chromosomal locations:
  • rs6806020 between about 3p21.2 and about 3p21.31, within an intron of the CACNA2D3 gene; and rs 12486361 between about 3p24.3 and about 3p25.1, within an intron of the RTFN-1 gene;
  • rs7750468 at about 6q22.31, between C6orf68 and SLC35F1 ; rs2746200 at about 6ql3, within an intron of the RIMS-1 gene; rs927188 between about 6pl2.2 and about 6pl2.3, within an intron of PHKD-1; rs2517861 between about 6p21.33 and about 6p22 and between HLA pseudogenes HCP5P10 and MICF; and rs2025503 and rs2066911 between about 6p22.1 and about 6p22.2, and between ALDH5A1 and PRL genes;
  • rsl0283103 and rs2114487 between about 8ql2.2 to about 8ql3.1 e.g., between CRH and MGC33510 such as between ADHFE1 and MGC33510 or between RRS1 and CRH;
  • rs 1002960 between about 9q22.1 and about 9q22.2, in an intergenic region
  • rsl931704 between about 10q26.2 and about 10q26.3 and between NPS and DOCK1;
  • rsl939565 at about l lq21, between KIAA1731 and FN5 genes; rs568910 and rs557905 within introns of the CASP-1 gene, wherein rs568910 is in intron 2 and rs557905 is in intron 6;
  • rsl931704 between about 14q22.1 and 14q22.2, between DACT1 and LOC729646;
  • rs3093390 between about 16pl 1.2 and about 16pl2.1 and between IL21R and GFT3 C 1 ; and rs7196702 between about 16q23.1 and about 16q23.2, in an intron of the WWOX gene;
  • the SNPs, rs7750468, rs2066911, rsrs6806020, rs2114487 and rsl931704 were considered highly suggestive of an association, and the remaining considered to be moderately suggestive of an association based on stage one screening data.
  • a total of 512 highly and moderately associated SNPs were selected from stage one.
  • SNPs having a significance level of p ⁇ l.OxlO "4 irrespective of their genome location, and 206 SNPs linked to genes classified as immune regulatory or anti-viral by gene ontology and having a significance level of 1.0xl0 ⁇ 4 ⁇ p ⁇ l.OxlO "3 were included.
  • the SNPs were genotyped using Golden Gate technology (Illumina, Inc., San Diego, USA). Two (2) cases having call rates of less than 0.90, 8 samples with no treatment outcome were excluded. Cluster plots of the remaining samples were checked by visual inspection and 38 ambiguous calls and SNPs with MAF less than 0.05 were also excluded from further analysis. A further 8 SNPs were excluded as having poor significance in their Hardy- Weinberg equilibrium
  • DASH dynamic allele-specific hybridization
  • PCR or other amplification means employing e.g., ARMS primers of different length or differentially labelled and comprising sequences that overlap at the SNP site to thereby amplify the alleles;
  • Invader assay employing e.g., a flap endonuclease (FEN) such as cleavase to digest a tripartite structure comprising genomic DNA and two specific oligonucleotide probes wherein a first probe (the Invader oligonucleotide) is complementary to the 3 ' end of the genomic DNA and comprises a mismatched 3 '-terminal nucleotide that overlaps the SNP in the target genomic DNA and wherein a second probe (allele- specific oligonucleotide) is complementary to the 5' end of the target genomic DNA and extends past the 3' side of the SNP nucleotide and comprises a nucleotide complementary to a SNP allele, such that the tripartit
  • thermostable DNA polymerase having 5'- nuclease activity to degrade genomic DNA hybridizing to matched primers but not mismatched primers e.g., performed in real time such as in a Taqman assay format (Applied Biosystems, Carlsbad, USA) and/or in a multiplex assay format;
  • ligase assay employing matched and mismatched oligonucleotides to interrogate a SNP by hybridizing the probes over the SNP site such that ligation to an upstream or downstream constant oligonucleotide can occur if the probes are identical to the target genomic DNA;
  • xiv by analyzing single strand conformation polymorphisms e.g., as determined by mobility of single-stranded genomic DNA or amplicons produced therefrom;
  • xv by temperature gradient gel electrophoresis (TGGE) or temperature gradient capillary electrophoresis (TGCE) employing target DNA comprising denaturing target DNA comprising the SNP site in the presence of an allele-specific probe comprising a mismatched allele to the target DNA, re- annealing the nucleic acids and resolving the products in the presence of a temperature gradient;
  • TGGE temperature gradient gel electrophoresis
  • TGCE temperature gradient capillary electrophoresis
  • the rs8099917 SNP was typed by PCR-RFLP using Tsp45I restriction enzyme (New England Biolabs, Beverley, MA). Digestions were performed in 10 ⁇ reactions in XI buffer, 0.4U enzyme, 5 ⁇ PCR product and Milli Q water at 65°C for 2h. Digested products were electrophoresed at 120V for 1/2 h on a 2% (w/v) TBE gel. Genotype was determined as a 325 bp fragment for the T allele, and as fragments of 286 bp and 39 bp for the G allele. Release of a further 214bp fragment arising from digestion at an internal control Tsp451 site was used to assess completeness of digestion.
  • Haplotypes of SNPs linked to the IFN- 3 (IL28B) gene were selected using Haplotype Tagger software of the Center for Human Genetic Research of Massachusetts General Hospital and Harvard Medical School, USA, and the Broad Institute, USA, e.g., as described by de Bakker et al, Nature Genetics 37, 1217-1223 (2005).
  • Haplotype Tagger is a tool for the selection and evaluation of SNPs from genotype data, that combines a pairwise tagging method with a multimarker haplotype approach. Genotype data and/or a chromosomal location within which SNPs are mapped are provided as a source for calculation of linkage disequilibrium patterns based on sequence data for the chromosomal region of interest.
  • Haplotype Tagger provides a list of the SNPs and corresponding statistical tests that capture variants of interest.
  • Haplotype Tagger may be implemented in the stand-alone program, Haploview (e.g., version 3.31) of the Broad Institute, USA (e.g., Barrett et al. Bioinformatics 21, 263- 265, 2005).
  • Haplotype Tagger was employed to fine-map SNPs in the IFN- ⁇ gene cluster and to tag the common haplotypes in the chromosomal region comprising the IFN gene cluster. That analysis identified IFN- 3 as having a distinct haplotype block for alleles at loci identified herein as being associated with therapeutic response (data not shown).
  • Pairwise correlation coefficients were determined for ⁇ - ⁇ 3 SNPs and haplotype distributions within the study population were determined.
  • Table 6 shows haplotypes for combinations of the following SNPs:
  • the data presented in Table 6 also show that the HR allele for rs 12980275 is linked to HR alleles at rs8105790, rs8103142, rs8109886 and rs8099917 in 45.2% of the test population, and that the LR allele for rs8099917 is associated with LR alleles for rsl2980275, rs8105790, rs8103142, and rs8109886 in 25.6% of the test population, suggesting linkage disequilibrium between these alleles. Accordingly, the occurrence of specific alleles linked to IFN- 3 may predict haplotypes associated with high or low responses to therapy.
  • BWA1 Burrows- Wheeler Alignment
  • Non-parametric measures of the statistical dependencies between known SNPs linked to the IL28B region of the genome according to HapMap and the genetic variations obtained by massively parallel sequencing were determined as Spearman Correlation Coefficients. This confirms that the genetic variability is correlated to HR and LR alleles of SNPs linked to IL28B.
  • genotypes of about 460 individuals infected with HCV and having known treatment responses were also determined, and the sensitivities, specificities, and positive predictive values (PPVs), and negative predictive values (NPVs) were calculated based on the frequencies of those genotypes, for several SNPs linked to IL28B, as follows: a) For LR alleles:
  • Sensitivity was determined as the number of individuals that are homozygous for a test LR allele of a SNP linked to IL28B and do not respond significantly to treatment and/or do not have a sustained viral response to treatment (i.e., low- responders and non-responders), as a proportion of the number of all low- responders and non-responders in the same cohort;
  • PPV was determined as the number of low-responders and non-responders that are homozygous for a test LR allele of a SNP linked to IL28B as a proportion of the number of all subjects in the same cohort that are also homozygous for the same test LR allele; and 4. NPV was determined as the number of responders and high-responders that are not homozygous for a test LR allele of a SNP linked to IL28B as a proportion of the number of all subjects in the same cohort that are also not homozygous for the same test LR allele. b) For HR alleles:
  • Sensitivity was determined as the number of responders and high-responders that are homozygous for a test HR allele of a SNP linked to IL28B as a proportion of the number of all responders and high-responders in the same cohort;
  • PPV was determined as the number of responders and high-responders that are homozygous for a test HR allele of a SNP linked to IL28B as a proportion of the number of all subjects in the same cohort that are also homozygous for the same test HR allele;
  • NPV was determined as the number of low-responders and non-responders that are not homozygous for a test HR allele of a SNP linked to IL28B and do not respond significantly to treatment as a proportion of the number of subjects in the same cohort that are also not homozygous for the same test HR allele.
  • the positive predictive value was determined to measure the proportion of subjects who are correctly diagnosed by determining homozygosity at HR and LR alleles linked to IL28B.
  • SNPs identified by GWAS herein, including rs8099917, rs4803221 and rs 12979860.
  • the SNPs identified by GWAS including rs4803221, rs8099917 and rsl2979860, are in linkage disequilibrium e.g., a correlation coefficient (r 2 ) of 0.96 for responders and high-responders (HR) and a correlation coefficient (r 2 ) of 0.97 for poor-responders and non-responders (LR).
  • LR alleles of the SNPs designated rs4803221 and rs8099917 and rsl 2979860 provide accurate predictions of low-response or non- response to anti-HCV therapy, as shown by a PPV of greater than 70% in each case for two copies of the LR allele.
  • This provides the first statistical ranking of LR alleles, and demonstrates for the first time the improved prognostic value of the LR allele at rs4803221 relative to rs8099917.
  • the test may be expected to provide 88.5% accuracy for homozygotes as each locus, as determined by the PPV (Table 7).
  • the minor (LR) allele of rs8099917 may provide only 81.8% accuracy for homozygotes as this locus
  • the minor (LR) allele of rsl 2979860 may provide only 74.4% accuracy for homozygotes as this locus, as determined by the PPV (Table 7).
  • RT-PCR was performed employing primers and probes for IFN- ⁇ (IL29), ⁇ - ⁇ 2 (IL28A) and ⁇ - ⁇ 3 (IL28B), essentially as described by Mihm et al, C. Lab. Invest. 84, 1148-1159 (2004).
  • the expression levels of the mRNAs were normalized to median expression of glyceraldehyde 3 -phosphate dehydrogenase (GAPDH).
  • GPDH glyceraldehyde 3 -phosphate dehydrogenase
  • Data in Figure 1 indicate that expression levels for both IFN- 2 and ⁇ - ⁇ 3 are higher in carriers of a genotype having the HR allele for rs8099917 (P O.04).
  • the genotype may alter expression in different contexts and with different stimulation e.g., as indicated in Table 1, such as by altering one or more of mRNA splicing, mRNA turnover, mRNA half-life, mRNA stability, affinity of the encoded cytokine for its cognate receptor. Any one or more of these factors may contribute to improved viral clearance for subject having the high response (HR) haplotype.
  • the data indicate functional significance in the correlation between haplotype and therapeutic efficacy of pegylated interferon-alpha (IFN-a) and ribavirin against HCV.
  • IFN-a pegylated interferon-alpha
  • SNPs and associations between specific allelic variants at the loci identified in this study, have clear clinical relevance to the diagnosis and treatment using immune response modulators such as interferons, ribavirin and combinations thereof.
  • immune response modulators such as interferons, ribavirin and combinations thereof.
  • the identification of a subject carrying a low response (LR) allele at a SNP position identified in this study indicates a reduced likelihood of clearing a virus such as HCV compared to a subject that is a non-carrier of the same allele.
  • LR low response
  • HR high response
  • GG homozygotes at the rs8099917 locus fail to clear HCV
  • 44% of TT homozygotes at this locus fail to clear HCV.
  • Standard genotyping and haplotyping methods as described herein may be employed to determine the likelihood of a response to therapy in a subject.
  • the data provided herein provide the means to identify those subjects, including 50% of Europeans, who may clear virus on therapy, and those who do not.
  • SNPs identified herein, including the HR haplotype and LR haplotype associations nearly 90% of subjects capable of having high response(s) to conventional therapy can be identified by their genotype.
  • IFN- 3 is up-regulated by viral infection and by other interferons in hepatocytes and other cells e.g., Siren et al, J. Immunol. 174, 1932-1937 (2005), Ank et al, J. Virol. 80, 4501-4509 (2006), and Doyle et al, Hepatol 44, 896-906 (2006), and protects against HCV in an in vitro system e.g., Robek et al, J. Virol. 79, 3851- 3854 (2005) and Marcello et al, Gastroenterol.
  • ⁇ - ⁇ 3 also regulates similar genes to IFN-oc via JAK/STAT signalling, however is more specific in its tissue targets. Proceeding on this basis, it is reasonable to conclude that ⁇ - ⁇ 3 provides the basis for diagnosis for those medical indications currently treated using IFNs. It is also reasonable to conclude that ⁇ - ⁇ 3 provides the basis for alternative therapies to those employing other IFNs such as IFN-a or IFN- ⁇ , e.g., for those medical indications compatible with IFN- 3 expression and activity.
  • IL-21R on chromosome 16
  • caspase-1 on chromosome 11
  • HLA pseudogene cluster on chromosome 6
  • IL-21 promotes T cell proliferation and viral clearance, and is structurally similar to IFN- ⁇ in terms of exon structure, wherein the alpha helices are encoded by separate exons.
  • CASP1 activates IL-1 which then promotes the inflammatory cascade, and inhibits HCV replication in vitro e.g., Zhu et al, J. Virol. 77, 5493-5498 (2003).
  • an immunomodulatory composition comprising an interferon (IFN)
  • a cohort of about 300 e.g., 301, Australian Caucasians infected with HCV were genotyped for HLA-C alleles and associations between specific HLA-C alleles with response to therapy comprising interferon and ribavirin were determined using statistical procedures described herein.
  • Interactions between IL28B alleles and HLA-C alleles in response to therapy of chronic hepatitis C using an immunomodulatory composition comprising an interferon (IFN)
  • Example 2 The cohort of subjects referred to in Example 2 were also genotyped for the IL28B rs8099917 polymorphism, essentially as described in Example 1, to determine whether or not there is any interaction e.g., additive interaction or epistatic interaction, between HLA-C genotype and rs8099917 genotype in determining the response to antiviral therapy.
  • any interaction e.g., additive interaction or epistatic interaction
  • subjects who are carriers for at least one HLA-Cl allele and are homozygous for the HR allele of rs8099917 have about 60% likelihood of responding to therapy.
  • a second cohort of 483 Australian Caucasians infected with HCV were genotyped for HLA-C and rs8099917 alleles and associations between specific HLA-C alleles with response to therapy and interactions e.g., additive interaction or epistatic interaction between rs8099917 and HLA-C2 in modulating the response to therapy were determined as before.
  • Data presented in Table 12 and Figures 3 and 4 confirm the associations between HLA-C2 alleles and response to therapy for the second cohort and the combined cohorts, and strengthen the conclusion that subjects who are homozygous for HLA-C2 alleles exhibit a low response to therapy compared to subjects who carry at least one HLA-Cl allele.
  • These data also confirm the interactions e.g., additive interaction or epistatic interaction between the rs8099917 polymorphism and HLA-C2 in response to antiviral therapy.
  • the presence of at least one HLA-Cl allele in combination with at least one LR allele at rs8099917 does not have such a high predictive value. This most likely reflects an interaction between HLA-C2 and the LR allele of rs8099917.
  • the cohort of subjects referred to in Example 2 were also genotyped for the IL28B rs4803221 polymorphism and HLA-C alleles, to determine whether or not there is any interaction e.g., additive interaction or epistatic interaction between the IL28B marker and HLA-C 1 and/or HLA-C2 in response to antiviral therapy.
  • any interaction e.g., additive interaction or epistatic interaction between the IL28B marker and HLA-C 1 and/or HLA-C2 in response to antiviral therapy.
  • tests for homozygosity of LR alleles at rs4803221 have greatly-improved prognostic accuracy when combined with HLA-C2 homozygosity than do tests for homozygosity of LR alleles at rs8099917 when combined with HLA-C2.
  • the predictive value of this test also appears to be improved substantially by further stratifying the population by testing for homozygosity of the LR allele of rs4803221.
  • the cohort of subjects referred to in Example 2 were also genotyped for the IL28B rsl 2979860 polymorphism and HLA-C alleles, to determine whether or not there is any interaction e.g., additive interaction or epistatic interaction between the IL28B marker and HLA-C 1 and/or HLA-C2 in response to antiviral therapy.
  • any interaction e.g., additive interaction or epistatic interaction between the IL28B marker and HLA-C 1 and/or HLA-C2 in response to antiviral therapy.
  • tests for homozygosity of LR alleles at rsl 2979860 have greatly-improved prognostic accuracy when combined with HLA-C2 homozygosity than do tests for homozygosity of LR alleles at rs8099917 when combined with HLA- C2.
  • the predictive value of this test also appears to be improved substantially by further stratifying the population by testing for homozygosity of the LR allele of rs 12979860.
  • the presence of at least one HLA-Cl allele in combination with at least one LR allele at rs 12979860 does not have a high predictive value. This most likely reflects an interaction between HLA-C2 and the LR allele of rs 12979860.
  • a combined test for homozygosity of HLA-C2 alleles and at least one LR allele at rs 12979860 and at least one LR allele at rs8099917 may provide population coverage of about 33%, a specificity of about 95% and a positive predictive value of about 80%.
  • the population coverage may near 50%, with still higher levels of specificity and accuracy.
  • HLA-C2 homozygotes are less likely to respond to pegylated interferon/ribavirin therapy than those with HLA-Cl genotypes (Odds Ratio 1.57);
  • Carriers of one or more LR alleles of IL28B SNPs are less likely to respond to pegylated interferon/ribavirin therapy than the corresponding HR genotypes, including the corresponding IL28B-HR homozygotes;
  • HLA-C2 homozygotes who are also carriers of one or more LR alleles of IL28B SNPs are much less likely to respond to drug therapy than other genotype combinations e.g., see Figs 3 and 4, Tables 7 and 13; and 4.
  • the positive predictive values of exemplary LR genotypes when combined with HLA-C2 homozygosity may be ranked as follows:
  • rs4803221 >rs8099917>rs 12979860.
  • Interactions between IL28B alleles and HLA-C alleles in response to therapy of chronic hepatitis C using an immunomodulatory composition comprising an interferon (IFN)
  • CHC chronic hepatitis C
  • HLA-C CI vs C2 individuals with spontaneous clearance, for HLA-C CI vs C2, presence of inhibitory and activating KIR genes, and two IL28B SNPs, rs8099917 and rs 12979860.
  • HLA-C samples were genotyped by multiplex PCR(18) to 2-digit resolution. For samples from Turin and spontaneous clearers, HLA-C genotyping was by PCR and sequencing. All Australian samples were genotyped by multiplex PCR for KIR2DL2 and KIR2DL3(19). K1R2DL2 and KIR2DL3 in the remainder and in spontaneous clearers, and KIR2DS1 and KIR2DS2 in all samples were genotyped by PCR using the protocol of Ashouri et. al., Tissue Antigens 74, 62-67 (2009). 2DL1 was not included due to the fact that it is very common (>90%), so that we would have insufficient power to detect an association with its absence.
  • the rs8099917 SNP was genotyped as previously reported by Suppiah et al, Nat Genet 41, 1100-1104 (2009).
  • the IL28B rs 12979860 SNP was genotyped using custom made taqman genotyping kit. For HLA- C, all samples (except Turin and spontaneous clearers) were genotyped by multiplex PCR to 2-digit resolution (1) with some modifications.
  • exon 2 and 3 of the HLA-C locus was amplified using the primers HLAC.M13F + HLAC15M13R (5' TGT AAA ACG ACG GCC AGT ARC GAG GKG CCC KCC CGG CGA 3' - 5' CAG GAA ACA GCT ATG ACC GGA GAT RGG GAA GGC TCC CCA CT 3*) respectively.
  • the resultant amplicon was sequenced using the primers M13F and M13R as well as the primers CIN2R (5' GGA GRC GTG ACC TGC GCC CCR GG 3'), CF1C( 5' CGG GGG CGG GGC CAG 3'), CX2RB (5' GCC CAG GAT CCG CAG GC 3'), CX2FG (5' GAG TGA ACC TGC GGA AA 3'), CX2FA (5' CAA CCA GAG CGA GGA CG 3') and CX2FD (5' ACC GGG AGA CAC AGA AG 3') to resolve likely ambiguities. Allele assignments were obtained using the program Assign (Conexio Genomics).
  • HLA-C genotyping was by PCR and sequencing using the following primer set: HLA-C forward primer: 5'-GGA GCC GCG CAG GGA-3', HLA- C reverse primer: 5'-AGG GGT CGT GAC CTG CG-3' and HLA-C sequencing primer: 5'-TAT TGG GAC CGG GAG ACA CAG-3'.
  • the inventors had previously shown that the IL28B rs8099917 G allele predicts failure to clear HCV on PeglFN/R therapy in the CHC cohort assessed herein for HLA-C and KIR genotypes.
  • SNP rs8099917 G carriers were 19.7% of SC, 27.5% of healthy controls (HapMap CEU data), 37.9% of SVR and 57.3% of NSVR (Table 16).
  • HLA-C2C2 predicts poor viral clearance on therapy
  • HLA-C 1 and C2 variants are associated with a number of aspects of viral clearance.
  • HLA-C2 homozygosity was not different between spontaneous clearers and healthy controls (see Table 17). This important observation suggests that the difference in association of HLA-C genotype with viral clearance is due to therapy response alone, not immune response in the absence of therapy.
  • KIR2DS2 for HLA- Cl The KIR ligands on NK cells activated on ligation to HLA-C are KIR2DS2 for HLA- Cl, and KIR2DS1 for HLA-C2. Increased activation could occur in HLA-C 1 carriers who are also carriers of KIR2DS2, and for HLA-C2 carriers who are also carriers of KIR2DS1.
  • KIR2DS genotypes affected viral clearance either singly or in combination with HLA-C genotypes (Table 22 and Table 23), although from a logistic regression model, it appears KIR2DS1 may mitigate the effect of HLA-C2C2.
  • This genetic evidence supports an underlying physiological mechanism for HCV viral control involving an interaction between IL28B, HLA-C and KIRs. Because of the very high linkage disequilibrium in the MHC Class I region around HLA-C, the association observed may be due to HLA-C variants tagging other Class I genes. However, the KIR interactions, which are HLA-C specific, support the signal being due to HLA-C itself, as does the strong body of evidence pointing to the importance of NK cells in killing virally infected cells in response to interferon and TRAIL.
  • activated NK cells recognize and lyse HCV replicon-containing hepatoma cells in vitro and should therefore be able to kill virus-infected hepatocytes in vivo.
  • Cells that lack or have down regulated MHC class I molecules, such as virally infected cells or tumour cells, are susceptible to NK cell mediated killing.
  • ⁇ 3 the protein encoded by IL28B augments the anti -tumor activity of NK cells.
  • HLA-C NK killing of hepatocytes
  • HLA-C 1 carriers compared to C2 homozygotes.
  • HLA-C genotypes could affect NK cell activity in the context of IFNa treatment.
  • IFNa could affect NK killing of HCV-infected hepatocytes.
  • IFNa is known to increase NK sensitivity to activation, but also to directly activate NK cells in patients with HCV infection and induced a strongly cytotoxic phenotype.
  • This NK cell activation and killing of hepatocytes is affected by the HLA-C genotype: the CI allele allowing activation more rapidly and aggressively.
  • HLA-C may be even more upregulated in response to IFNa, making it more difficult for C2 homozygotes to activate NK cells.
  • IFN 3 affects viral clearance.
  • IFN 3 is likely to enhance antiviral mechanisms through up-regulation of interferon-stimulated genes (ISGs) in acute disease, but its effect may be more complicated in chronic infection, where up-regulation of ISGs in liver is associated with reduced treatment response.
  • ISGs interferon-stimulated genes
  • HLA-C and IL28B genotypes with treatment-induced clearance, but not spontaneous clearance, suggests IL28B may be enhancing NK killing on PeglFN/R therapy.
  • HLA-C is one of the most up-regulated genes following treatment of a cell line with ⁇ 3. The degree of this up-regulation may depend on HLA-C genotype.
  • the larger predictive value for HLA-C2C2 and IL28B rs8099917 G* than SNP rsl 2979860 T* may indicate different haplotype effects.
  • the rs8099917 minor allele tags the haplotype with the highest association with therapeutic response, whilst rsl 2978960 minor alleles are on this haplotype and one other. There is evidence of independent effects of the two haplotypes. Therefore the additive effect of HLA-C with IL28B may be only with the rs8099917 tagged haplotype.
  • HLA-C2C2/IL28B G* The overall differences in frequency of HLA-C2C2/IL28B G* in healthy controls, spontaneous clearers, SVR and NSVR groups suggests a role in pathogenesis for this gene combination. It is also striking that HLA-C2C2 frequency is highly variable between ethnic groups, roughly in proportion to their treatment responsiveness (Figure 8). Much of the variation between African Americans and European Americans has been explained by the IL28B rsl 2979860 SNP, but it seems likely that their higher proportion of the HLA-C2C2 genotype may also contribute to their reduced viral clearance.
  • IL28B genotype alone allows prediction of failure of PeglFN/R in only 66% (Table 25). We have shown that with HLA-C genotyping this can be improved to a clinically meaningful 80%. Genotyping of IL28B and HLA-C to C1/C2 is rapid and inexpensive. Table 1
  • Chromosome positions are derived from Hapmap project data release 27.
  • Chromosome positions are derived from Hapmap project data release 27.
  • SNP Chromosome Position 1 Location SNP effect Sequence comprising SNP rs 1549928 19 44431549 5'-end of IL28B expression level gaagcaaagaaagaggaaacagacagtaga[A/G]acagggacagagacaatttggaaaccgagt rs34347451 19 44431529 5'-end of IL28B expression level gggatggctgcctccaacactcggtttccf */ A] aaattgtctctgtccctgtttctactgtct rs35814928 19 44431477 5'-end of IL28B expression level tctgggatcccagtcgggtgtgaggacttc[*/A]aacccgaggttggcctgtgccgggatggc rs4803222 19 44431193 5'-end of IL28B expression
  • Chromosome positions are derived from Hapmap project data release 27.
  • SNP Chromosome Position 1 Location SNP effect Sequence comprising SNP rs 1 1882871 19 44429451 5'-end of IL28B expression level tccctgtagaaggacccgctcctctt[A/G]tatctgagacagtggatccaagtcag rs56215543 19 44429428 5'-end of IL28B expression level gatataagaggagcgggtccttctac[A G]gggaagagaccacagttctccaggaa rs 12979731 19 44429353 5'-end of IL28B expression level tccagagctcaagttttttcctgcca[C/T]agcaaccgttggagggtcgtacaatg rs2020358 19 44428927 5'-end of IL28B expression level cgagccagggactcaggtggc
  • Chromosome positions are derived from Hapmap project data release 27.
  • IL28B-Arg32 allele tggagcagttcctgtcgccaggctccGcggggctctcccggatgcaaggggct 19 44427130 intron 2 of IL28B mRNA cttcaggaaaacatgagtcagtccct[A/G]cagtaggagcatgagatagcccactg stability/turnover/
  • Chromosome positions are derived from Hapmap project data release 27.
  • SNP Chromosome Position' Location SNP effect Sequence comprising SNP
  • rs8102358 19 44426852 intron 3 of IL28B mRNA gtgaaggggccactacagagccaggt[A/G]agcagggctgggagggcaggggtggg stability/turnover/
  • Chromosome positions are derived from Hapmap project data release 27.
  • SNP Chromosome Position 1 Location SNP effect Sequence comprising SNP SEQ ID NO:
  • rs4803217 19 44426060 3'-end of IL28B stabi lity/turno ver tagcgactgggtgacaataaattaag[A/C]caagtggctaatttataaataaaat 83
  • Chromosome positions are derived from Hapmap project data release 27.
  • Chromosome positions are derived from Hapmap project data release 27.
  • Chromosome positions are derived from Hapmap project data release 27.
  • Stage one and stage two p-values are based on allelic comparisons obtained from Haploview.
  • Odds ratio (OR) and 95% confidence interval (95% C.I.) are based on allelic distributions of SNPs for the combined cohort.
  • Stage one and stage two -values are based on allelic comparisons obtained from Haploview.
  • Odds ratio (OR) and 95% confidence interval (95% C.I.) are based on allelic distributions of SNPs for the combined cohort.
  • SNP p value 1 p value 1 p value 2 (95% C.I.) Possible genotypes Tested genotype Genotype P value OR (95% C.I.) rs56215543 A/A A/G G/G
  • Stage one and stage two p-values are based on allelic comparisons obtained from Haploview.
  • Merged p- values are based on cochrane-armitage trend test results.
  • Odds ratio (OR) and 95% confidence interval (95% C.I.) are based on allelic distributions of SNPs for the combined cohort.
  • Stage one and stage two -values are based on allelic comparisons obtained from Haploview.
  • Odds ratio (OR) and 95% confidence interval (95% C.I.) are based on allelic distributions of SNPs for the combined cohort.
  • Stage one and stage two p- values are based on allelic comparisons obtained from Haploview.
  • Odds ratio (OR) and 95% confidence interval (95% C.I.) are based on allelic distributions of SNPs for the combined cohort.
  • HR genotype homozygous for HR alleles at designated locus associated with higher response to therapy.
  • LR genotype homozygous for LR alleles at designated locus associated with lower response to therapy.
  • Odds ratios of each haplotype were calculated as carriage vs non-carriage of the haplotype.
  • CI * represents CI carriers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Communicable Diseases (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • Virology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne un procédé permettant de déterminer de façon précise la probabilité qu'un patient répondra à un traitement par une composition immunomodulatrice consistant à détecter l'homozygotie des allèles HLA-C2 ou au moins deux marqueurs, l'un étant un marqueur d'un allèle HLA-C et l'autre étant un marqueur d'un allèle IL28B, et des procédés permettant de sélectionner les patients appropriés pour le traitement ou la poursuite du traitement, et d'offrir un traitement approprié à des patients, sur la base des résultats du dosage.
PCT/AU2011/000627 2010-05-28 2011-05-25 Méthode de détermination de la réponse à un traitement par une composition immunomodulatrice WO2011146985A1 (fr)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US34979310P 2010-05-28 2010-05-28
US61/349,793 2010-05-28
AU2010902565 2010-06-10
AU2010902565A AU2010902565A0 (en) 2010-06-10 Method of determining response to treatment with immunomodulatory composition
AU2011901568A AU2011901568A0 (en) 2011-04-28 Method of determining response to treatment with immunomodulatory composition
AU2011901568 2011-04-28

Publications (1)

Publication Number Publication Date
WO2011146985A1 true WO2011146985A1 (fr) 2011-12-01

Family

ID=45003139

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2011/000627 WO2011146985A1 (fr) 2010-05-28 2011-05-25 Méthode de détermination de la réponse à un traitement par une composition immunomodulatrice

Country Status (1)

Country Link
WO (1) WO2011146985A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012145794A1 (fr) * 2011-04-29 2012-11-01 The University Of Sydney Procédé de détermination de la réponse à un traitement avec une composition immunomodulatrice
WO2013001504A1 (fr) * 2011-06-30 2013-01-03 Centre Hospitalier Universitaire Vaudois (C.H.U.V.) Polymorphismes associés à une absence de réponse à un traitement de l'hépatite c ou à une prédisposition à une clairance non spontanée de l'hépatite c
WO2013155346A1 (fr) * 2012-04-11 2013-10-17 The Regents Of The University Of California Outils diagnostiques pour la réponse au traitement par 6-thiopurines
EP2669296A4 (fr) * 2011-01-27 2015-06-03 Fujirebio Kk Anticorps anti-il28b et procédé de dosage d'il28b l'utilisant
CN105002294A (zh) * 2015-08-21 2015-10-28 北京鑫诺美迪基因检测技术有限公司 Il28b基因位点多态性检测引物组合物和试剂盒
CN111118150A (zh) * 2020-03-02 2020-05-08 上海百傲科技股份有限公司 用于检测il28b基因的方法、试剂盒、引物对及探针

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
VIDAL-CASTIÑEIRA, J. R. ET AL.: "Effect of Killer Immunoglobulin-Like Receptors in the Response to Combined Treatment in Patients with Chronic Hepatitis C Virus Infection", JOURNAL OF VIROLOGY, vol. 84, no. 1, January 2010 (2010-01-01), pages 475 - 481 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2669296A4 (fr) * 2011-01-27 2015-06-03 Fujirebio Kk Anticorps anti-il28b et procédé de dosage d'il28b l'utilisant
WO2012145794A1 (fr) * 2011-04-29 2012-11-01 The University Of Sydney Procédé de détermination de la réponse à un traitement avec une composition immunomodulatrice
WO2013001504A1 (fr) * 2011-06-30 2013-01-03 Centre Hospitalier Universitaire Vaudois (C.H.U.V.) Polymorphismes associés à une absence de réponse à un traitement de l'hépatite c ou à une prédisposition à une clairance non spontanée de l'hépatite c
WO2013155346A1 (fr) * 2012-04-11 2013-10-17 The Regents Of The University Of California Outils diagnostiques pour la réponse au traitement par 6-thiopurines
US10385395B2 (en) 2012-04-11 2019-08-20 The Regents Of The University Of California Diagnostic tools for response to 6-thiopurine therapy
CN105002294A (zh) * 2015-08-21 2015-10-28 北京鑫诺美迪基因检测技术有限公司 Il28b基因位点多态性检测引物组合物和试剂盒
CN111118150A (zh) * 2020-03-02 2020-05-08 上海百傲科技股份有限公司 用于检测il28b基因的方法、试剂盒、引物对及探针
CN111118150B (zh) * 2020-03-02 2023-10-20 上海百傲科技股份有限公司 用于检测il28b基因的方法、试剂盒、引物对及探针

Similar Documents

Publication Publication Date Title
US20100316608A1 (en) Method of Determining A Response To Treatment With Immunomodulatory Composition
Naggie et al. Dysregulation of innate immunity in hepatitis C virus genotype 1 IL28B‐unfavorable genotype patients: Impaired viral kinetics and therapeutic response
KR20120040725A (ko) Ｈｃｖ 감염 환자에서 ｃ형 간염 결과를 진단 또는 예측하기 위한 방법
US7858319B2 (en) Method of screening for drug hypersensitivity reaction
WO2011146985A1 (fr) Méthode de détermination de la réponse à un traitement par une composition immunomodulatrice
US10927414B2 (en) Methods and kits for determining predisposition to develop kidney diseases
JP2012187082A (ja) 第６染色体短腕２１．３３領域の一塩基多型に基づく抗てんかん薬による薬疹リスクの検査方法
US20080020383A1 (en) Haplotype Markers And Methods Of Using The Same To Determine Response To Treatment
JP2023552199A (ja) コロナウイルス感染症を発症するリスクが高い対象を特定する方法及びその治療法
EP1499356A1 (fr) Methodes de traitement et de diagnostic pour des patients atteints de l'hepatite c
WO2012145794A1 (fr) Procédé de détermination de la réponse à un traitement avec une composition immunomodulatrice
EP1427849B1 (fr) Procede de depistage des reactions d'hypersensibilite a des medicaments
WO2013001504A1 (fr) Polymorphismes associés à une absence de réponse à un traitement de l'hépatite c ou à une prédisposition à une clairance non spontanée de l'hépatite c
JP2023513171A (ja) 慢性ｂ型肝炎感染症の治療におけるバイオマーカー及びその使用
EP2566978A1 (fr) Gène de susceptibilité à un traitement antiviral et ses utilisations
JP2010124801A (ja) インターフェロン療法の効果予測用マーカーおよびインターフェロン作用増強剤のスクリーニング方法
US20130064819A1 (en) Biomarkers
TW202214873A (zh) 生物標記及其於治療慢性hbv感染之用途
WO2009034661A1 (fr) Procédé de diagnostic et induction d'une résistance à un virus
JP5111763B2 (ja) 気管支喘息の遺伝的素因検査方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11785912

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11785912

Country of ref document: EP

Kind code of ref document: A1

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 28/11/2013)

122 Ep: pct application non-entry in european phase

Ref document number: 11785912

Country of ref document: EP

Kind code of ref document: A1