WO2011132939A2 - Rtk-bpb se liant spécifiquement à rtk - Google Patents

Rtk-bpb se liant spécifiquement à rtk Download PDF

Info

Publication number
WO2011132939A2
WO2011132939A2 PCT/KR2011/002839 KR2011002839W WO2011132939A2 WO 2011132939 A2 WO2011132939 A2 WO 2011132939A2 KR 2011002839 W KR2011002839 W KR 2011002839W WO 2011132939 A2 WO2011132939 A2 WO 2011132939A2
Authority
WO
WIPO (PCT)
Prior art keywords
type
cytokine
trp
thr
glu
Prior art date
Application number
PCT/KR2011/002839
Other languages
English (en)
Korean (ko)
Other versions
WO2011132939A8 (fr
WO2011132939A3 (fr
Inventor
전상용
김성현
박세호
김대진
이상헌
Original Assignee
광주과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 광주과학기술원 filed Critical 광주과학기술원
Priority to KR1020127023553A priority Critical patent/KR20130103302A/ko
Publication of WO2011132939A2 publication Critical patent/WO2011132939A2/fr
Publication of WO2011132939A3 publication Critical patent/WO2011132939A3/fr
Publication of WO2011132939A8 publication Critical patent/WO2011132939A8/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/107—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B30/00—Methods of screening libraries
    • C40B30/04—Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C40B40/10—Libraries containing peptides or polypeptides, or derivatives thereof
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants

Definitions

  • Cytokine_BPB that specifically binds to cytokine
  • the present invention relates to Cytokine_BPB which specifically binds to Cytokine.
  • Antibodies are immunoglobulin proteins, a type of plasma protein produced by B cells, that specifically inactivate and inactivate antigens by specifically recognizing and binding to specific sites of antigens.
  • the specificity and high affinity of these antigen-antibody reactions and the diversity of antibodies that can distinguish tens of millions of antigens have led to the emergence of many types of antibody products, including diagnostics and therapeutics.
  • the FDA has approved 21 monoclonal antibodies, and antibodies such as Rituximab and Herceptin have been effective in more than 50% of patients who have not responded to other treatments. Has demonstrated successful clinical treatment of lymphoma, colon cancer or breast cancer using monoclonal antibodies.
  • the total market size of therapeutic antibodies is estimated to grow at an annual average of 203 ⁇ 4, from $ 10 billion in 2004 to $ 30 billion in 2010, and the market is expected to grow exponentially.
  • the development of new drugs using antibodies is active because the drug development period is short, investment costs are low, and side effects can be easily predicted.
  • the antibody is a herbal medicine, the human body is hardly affected, and the half-life in the body is overwhelmingly long compared to low molecular weight drugs, so the patient is friendly.
  • monoclonal antibodies in humans are recognized as foreign antigens and can cause severe allergic reactions or hypersensitivity.
  • the anti-cancer monoclonal antibody is used clinically, the production cost is high, and thus the price of the therapeutic agent increases rapidly.
  • Antibody-replacement protein is a recombinant protein made to have constant and variable regions like an antibody.
  • a small and stable protein is replaced with a random sequence of amino acids to make a library, which is then screened for the target material, thereby providing high affinity and good Substances with specificity can be found.
  • avimers and affibodies among antibody replacement proteins have been reported to have a picomol affinity for a target substance.
  • These antibodies alternative protein can penetrate deep in the tumor size by a small, stable and has high-beam "and is generally less cause an immune banung.
  • antibody replacement proteins that are being commercialized by venture companies or multinational pharmaceutical companies are fibronectin type ⁇ domain, lipocalin, LDLR-A domain, crystallin, protein A and ankyrin. It uses a protein called repeat (Ankyrin repeat), BPTI, and has a high affinity of several nanomolar to picomolar to target. Adnectin, Avimer, and Kunitz domains are currently undergoing FDA clinical trials.
  • the present invention focused on peptide-based antibody replacement proteins that are different from antibody replacement proteins using proteins up to now.
  • Peptides have been widely used in place of antibody therapeutics due to proper pharmacokinetics, mass productivity, low toxicity, antigenic inhibition and low production cost compared to antibodies.
  • the advantages of peptides as therapeutic drugs are low production costs, high safety and responsiveness, relatively low patent royalties, and less exposure to unwanted immune systems, which can inhibit the production of antibodies to the peptides themselves. Deformation through is easy and accurate.
  • most peptides exhibit low affinity and specificity for specific protein targets compared to antibodies, they cannot be used for various applications. therefore, There is a need in the art for the development of new peptide-based antibody replacement proteins that can overcome the disadvantages of peptides.
  • the present inventors have tried to develop a peptide material capable of specific binding with high affinity to a biological target molecule. This is expected to be a technology that can produce new drug candidates with high affinity and specificity in a short time using peptides having low affinity reported for a large number of targets.
  • Cytokines are secreted by certain immune cells that carry signals between cells. Cytokines stimulate immune cells to activate immune response or inhibit black.
  • Cytokines are involved in various biological and pathological phenomena (eg, autoimmune diseases), and many studies have been conducted on medicines targeting them.
  • the inventors have sought to develop a system capable of delivering various substances intracellularly or to the cell surface based on Cytokine binding and specificity.
  • the peptides are randomly bound to both ends of the structural stabilization site having a relatively rigid peptide backbone, and when the two peptides are jointly bound to the cytokine molecule, the binding ability and specificity are greatly increased.
  • a bipodal peptide binder (BPB) having a compound was completed.
  • an object of the present invention is to provide a Cytokine-bipodal peptide binder (Cytokine-BPB).
  • Another object of the present invention is to provide a Cytokine-bipodal peptide binder (Cytokine-BPB).
  • Cytokine-BPB Cytokine-bipodal peptide binder
  • Cytokine-target binding region I and Cytokine-target binding region ⁇ (Cytokine) bound to both ends of the structural stabilization site and each comprising n and m amino acids selected at random; Cytokine—bipodal peptide binders that specifically bind to Cytokine, including -target binding region ⁇ ).
  • the inventors have sought to develop a system capable of delivering various substances intracellularly or to the cell surface based on Cytokine binding and specificity.
  • the peptides are randomly bound to both ends of the structural stabilization site having a relatively rigid peptide backbone, and when the two peptides are jointly bound to the cytokine molecule, the binding ability and specificity are greatly increased. It was confirmed that a bipodal peptide binder (BPB) having a was obtained.
  • BPB bipodal peptide binder
  • the basic strategy of the present invention is to connect peptides that are bound to the target at both ends of the rigid peptad backbone.
  • the rigid peptide backbone acts to stabilize the overall structure of the bipodal peptide provider and enhances the binding of the target binding site I and the target binding site ⁇ to the target molecule.
  • Structural stabilization sites usable in the present invention include parallel, antiparallel or parallel and antiparallel amino acid strands, interstrand hydrogen bonds, electrostatic interactions, hydrophobic interactions, van der Waals interactions, pi-pi Protein structure motifs in which non-covalent bonds are formed by interaction, cation-pi interaction, or a combination thereof. Hydrogen bonds between the strands, electrostatic interactions, hydrophobic interactions, van der Waals interactions, pi-pi interactions, cation-pi interactions, or their Non-covalent bonds formed by combination contribute to the rigidity of the structure stabilization site.
  • interstrand non-covalent bonds at the structure stabilization site include hydrogen bonds, hydrophobic interactions, van der Waals interactions, pi-pi interactions or combinations thereof.
  • covalent bond there may be a covalent bond to the structured stabilization site.
  • disulfide bonds may be formed at the structured stabilization site to further increase the robustness of the structure stabilized site.
  • the increase in firmness by such covalent bonds is given in consideration of the specificity and affinity of the bipodal peptide binder for the target.
  • the amino acid strands of the structure stabilization site are linked by a linker.
  • linker as used to refer to the strands refers to the material that connects the strands.
  • the turn sequence in ⁇ -hairpin acts as a linker
  • a substance connecting two c-terminus of leucine zipper eg , Peptide linkers
  • the linker connects the parallel, antiparallel or parallel and antiparallel amino acid strands. For example, at least two strands (preferably two strands) arranged in parallel fashion, at least two strands (preferably two strands) arranged in antiparallel fashion, and at least three strands arranged in parallel and antiparallel fashion.
  • the linker (preferably three strands) is connected by the linker.
  • the linker is a turn sequence or peptide linker.
  • the turn sequence is ⁇ -turn, ⁇ -turn, ⁇ -turn, ⁇ -turn or ⁇ -loop (Venkatachalam CM (1968), Biopolymers, 6, 1425-1436; Nemethy G and Printz MP. (1972), Macro / no 1 ecu les, 5, 755-758; Lewis PN et al,, (1973), Biochi. Biophys. Acta, 303, 211-229; Toniolo C. (1980) CRC Crit. Rev. Biochem., 9, 1-44; Richardson JS. (1981), Adv.
  • the turn sequence used in the present invention is ⁇ -turn.
  • ⁇ -turn When ⁇ -turn is used as the turn sequence, it is preferably a type I, type ⁇ , type ⁇ , type ⁇ ', type m or type m' turn sequence, more preferably type I, type I ' ⁇ type ⁇ , A type ⁇ 'turn sequence, even more preferably a type j' or type ⁇ 'turn sequence, and most preferably a type ⁇ turn sequence ( ⁇ , L. Sibanda et al., /. Mol. Biol., 1989, 206, 4, 759-777; BL Sibanda et al., Methods Enzymol., 1991, 202, 59-82).
  • the turn sequence in the present invention is H. Jane Dyson et al. , Eur. J. Biochem. 255: 462-471 (1998), which is incorporated herein by reference.
  • Available for the turn sequence include the following amino acid sequences: X-Pro-Gly-Glu-Val; Ala— X-Gly—Glu-Val (X is selected from 20 amino acids).
  • X is selected from 20 amino acids.
  • the peptide linker connects two strands arranged in a parallel manner or two strands arranged in an antiparallel manner. Desirable
  • Peptide linkers can be used in any known in the art.
  • the sequence of a suitable peptide linker may be selected in consideration of the following factors: (a) the ability to be applied to flexible extended conformation; (b) the ability not to create secondary structures that interact with biological target molecules; And (C) absence of hydrophobic residues or residues with charges that interact with the biological target molecule.
  • Preferred peptide linkers include Gly, Asn and Ser residues. Other neutral amino acids such as Thr and Ala can also be included in the linker sequence. Suitable amino acid sequences for linkers are Marat ea et al., Gene 40: 39-46 (1985); Murphy et al., Proc. Natl. Acad Sci. USA 83: 8258-8562 (1986); US Pat. Nos. 4,935,233, 4,751,180 and 5,990,275.
  • the peptide linker sequence may consist of 1-50 amino acid residues.
  • the structural stabilization site is a ⁇ -hairpin, a linker linked ⁇ -sheet or a linker leucine zipper, more preferably the structural stabilization site is a ⁇ -hairpin or linker linked ⁇ -sheet And most preferably ⁇ -hairspray.
  • ⁇ -hairpin refers to the simplest protein motif comprising two ⁇ strands, the two ⁇ strands representing an antiparallel alignment with each other. In this ⁇ -hairpin the two ⁇ strands are generally linked by turn sequences.
  • the turn sequence applied to the ⁇ -hairpin is a type I, type ⁇ , type ⁇ , type ⁇ ', type m or type ⁇ ' turn sequence, more preferably type I, type 1 ', type n, It is a type ⁇ 'turn sequence, even more preferably a type ⁇ or type ⁇ ' turn sequence, and most preferably a type ⁇ turn sequence.
  • turn sequences represented by X-Pro-Gly-Glu-Val; or Ala-X-Gly-Glii-Val (X is selected from 20 amino acids) can also be used for ⁇ -hairpins.
  • the type I turn sequence is Asp-Asp-Ala-Thr-Lys-Thr
  • the type ⁇ turn sequence is Glu-Asn-Gly-Lys
  • the type ⁇ turn sequence is X-Pro -Gly-Glu-Val
  • Ala-X—Gly—Glu-Val X is selected from 20 amino acids
  • the type ⁇ ′ turn sequence is Glu-Gly-Asn-Lys or Glu-D-Pro—Asn -Lys.
  • Peptides with ⁇ -hairpin formulations are well known in the art. See, for example, US Pat. No. 6,914,123 and Andrea G. Cochran et al. , PNAS, tryptophan zipper disclosed in 98 (10): 5578-5583, template-fixed ⁇ -hairpin mimetic disclosed in WO 2005/047503, disclosed in US Pat. No. 5,077,979. ⁇ -hairpin variants are well known. In addition, — peptides with hairpin conformation are described by Smith & Regan (1995) Science 270: 980-982; Chou & Fassman (1978) Annu. Rev. Biochem.
  • a tryptophan zipper is used.
  • the tryptophan zipper used in the present invention is represented by the following general formula (I):
  • 3 ⁇ 4 is Ser or Gly-Glu
  • X 2 and X ' 2 are independently of each other Thr, His, Val, lie, Phe or Tyr
  • X 3 is Trp or Tyr
  • X4 is Type I , Type ⁇ ′, Type ⁇ , type ⁇ 'or type m or type ⁇ turn sequence
  • 3 ⁇ 4 is Trp or Phe
  • 3 ⁇ 4 is Trp or Val
  • X 7 is Lys or Thr-Glu.
  • 3 ⁇ 4 is Ser or Gly-Glu, and ⁇ '2 is independently of each other Thr, His or Val, 3 ⁇ 4 is Trp or Tyr, is Type I, Type ⁇ , Type ⁇ Or type ⁇ 'turn sequence, 3 ⁇ 4 is Trp or Phe, 3 ⁇ 4 is Trp or Val, and X? Is Lys or Thr-Glu. Even more preferably, 3 ⁇ 4 in Formula I is Ser or Gly— Glu,
  • X 2 and X ' 2 are independently of each other Thr, His or Val, 3 ⁇ 4 is Trp, is type I, type ⁇ , type ⁇ or type ⁇ ' turn sequence, 3 ⁇ 4 is Trp, 3 ⁇ 4 is Trp, X 7 is Lys or Thr-Glu.
  • 3 ⁇ 4 is ser, 3 ⁇ 4 and X ' 2 are Thr, 3 ⁇ 4 is Trp, is a type ⁇ or type ⁇ ' turn sequence, 3 ⁇ 4 is Trp, 3 ⁇ 4 is Trp 3 ⁇ 4 is Lys.
  • Xl is Ser, 3 ⁇ 4 and X'2 are Thr, 3 ⁇ 4 is Trp, X4 is type ⁇ turn sequence (ENGK) or type ⁇ 'turn sequence (EGNK), 3 ⁇ 4 is Trp, 3 ⁇ 4 is Trp, and X 7 is Lys.
  • amino acid sequences of tryptophan zippers suitable for the present invention are described in SEQ ID NOs: 1 to 3 and 5 to 10.
  • ⁇ -hairpin peptides usable as structural stabilization sites in the present invention are peptides derived from B1 domaine of protein G, ie GB1 peptides.
  • the structural stabilization site is preferably represented by the following general formula ⁇ :
  • 3 ⁇ 4 is Arg, Gly-Glu or Lys-Lys
  • X 2 is Gin or Thr
  • 3 ⁇ 4 is type I, type ⁇ , type ⁇ , type ⁇ or type m or type ⁇ turn sequence
  • X4 is Gin, Thr- Glu or Gln-Glu.
  • the structural stabilization site of the general formula ⁇ is
  • 3 ⁇ 4 is Gly-Glu or Lys-Lys
  • X 2 is type I, type ⁇ , type ⁇ , type ⁇ 'or type m or type ⁇ turn sequence
  • 3 ⁇ 4 is Thr-Glu or Gln-Glu.
  • Exemplary amino acid sequences of GB1 ⁇ -hairpins suitable for the present invention are described in SEQ ID NO: 4 and 14 to 15 sequences.
  • the structural stabilization site is preferably represented by the following general formula m:
  • 3 ⁇ 4 is Lys or Lys— Lys, 3 ⁇ 4 is Trp or Tyr, 3 ⁇ 4 is Val or
  • Thr is, type I , type ⁇ , type ⁇ , type ⁇ or type m or Type ⁇ turn sequence, 3 ⁇ 4 is Trp or Ala, 3 ⁇ 4 is Trp or Val, and X 7 is Glu or Gln-Glu.
  • ⁇ -hairpin peptide that can be used as a structural stabilization site in the present invention is represented by the following general formula IV:
  • 3 ⁇ 4 is Lys-Thr or Gly
  • 3 ⁇ 4 is Trp or Tyr
  • 3 ⁇ 4 is type I, type ⁇ , type II, type ⁇ 'or type m or type ⁇ turn sequence, and is Thr-Glu or Gly.
  • Exemplary amino acid sequences of ⁇ -hairpins of Formulas III and IV are described in SEQ ID NOs: 11-12, 15, and 16-19.
  • a -sheet connected by a linker can be used as the structural stabilization site.
  • two or more amino acid strands, which are parallel or antiparallel, preferably antiparallel, are in an extended form, and hydrogen bonds are formed between the amino acid strands.
  • ⁇ -sheet structure two adjacent ends of two amino acid strands are connected by a linker.
  • linker various turn-sequences or peptide linkers described above may be used. If the turn-sequence is used as a linker, the ⁇ -turn sequence is most preferred.
  • leucine zippers or leucine zippers linked by linkers may be used as structural stabilization sites.
  • Leucine zippers are conserved peptide domains that cause parallel dimerization of two ⁇ -chains and are generally dimerized domains found in proteins involved in gene expression (“Leucine scissors”. Glossary of Biochemistry and Molecular Biology ( (1997) .Ed. David M. Glick.London: Portland Press; Lands chulz WH, et al. (1988) Science 240: 1759-1764).
  • Leucine zippers generally comprise a heptad repeat sequence, with the leucine residues located at the fourth or fifth.
  • leucine zippers that may be used in the present invention include the amino acid sequence of LEALKEK, LKALEKE, LKKLVGE, LEDKVEE, LENEVAR or LLSKNYH.
  • Leucine used in the present invention Specific examples of zippers are described in SEQ ID NO: 39.
  • Each half of the leucine zipper consists of short ⁇ -hexens with direct leucine contact between the ⁇ -chains.
  • the leucine zipper in the transcription factor generally consists of a hydrophobic leucine zipper site and a basic site (site that interacts with the main groove of the DNA molecule). When the leucine zipper is used in the present invention, the basic site is not necessarily required.
  • two adjacent ends of two amino acid strands may be linked by a linker.
  • a linker various turn-sequences or peptide linkers described above may be used, and preferably, a peptide linker that does not affect the structure of the leucine zipper is used.
  • Random amino acid sequences are joined to both ends of the structure stabilization site described above.
  • the random amino acid sequence forms Cytokine-target binding site I and Cytokine-target binding site ⁇ .
  • One of the biggest features of the present invention is to prepare a peptide binder in a bipodal manner by connecting Cytokine-target binding site I and Cytokine-target binding site ⁇ to both ends of the structure stabilization site. Cytokine-target binding site I and Cytokine-target binding site ⁇ cooperatively bind to the target, thereby greatly increasing affinity for Cytokine.
  • the amino acid number n of the cytokine-target binding site I is not particularly limited, preferably an integer of 2-100, more preferably an integer of 2-50, even more preferably an integer of 2-20, most preferred Preferably an integer of 3-10.
  • the number of amino acids m of the cytokine-target binding site ⁇ is not particularly limited, and is preferably 2-100 and an integer, more preferably an integer of 2-50, even more preferably an integer of 2-20, most preferably Preferably an integer of 3-10.
  • Cytokine-target binding site I and Cytokine-target binding site ⁇ may each contain different or identical numbers of amino acid residues. Cytokine-target binding site I and Cytokine-target binding site ⁇ may include different or identical amino acid sequences, and preferably include different amino acid sequences. The amino acid sequence contained in Cytokine-target binding site I and / or Cytokine-target binding site ⁇ is a linear amino acid sequence or a cyclic amino acid sequence.
  • At least one amino acid residue among the amino acid sequences included in the Cytokine-target binding site I and / or the Cytokine-target binding site ⁇ is an acetyl group, a fluorenyl methoxy carbonyl group, Formyl, palmitoyl, myristyl, stearyl or polyethylene glycol (PEG).
  • Cytokine-BPB of the present invention which is bound to a biological target molecule, can be used for the regulation of physiological responses in vivo, detection of substances in vivo, imaging of in vivo molecules, and targeting for drug delivery, and also as an escort molecule.
  • a cargo is added to the structure stabilization site, the Cytokine-target binding site I or the Cytokine-target binding site ⁇ (more preferably, the structure stabilization site, even more preferably the linker of the structure stabilization site).
  • the cargo include, but are not limited to, labels, chemicals, biopharmaceuticals or nanoparticles that generate detectable signals.
  • Labels that generate the detectable signal include T1 contrast (eg Gd chelate compounds), T2 contrast (eg superparamagnetics (eg magnetite, Fe 3 0 4 , Y-Fe 2 0 3 , manganese ferrite, cobalt) Ferrites and nickel ferrites)), radioisotopes (e.g., 15 0, 13 N, P 32 , S 35 , 44 Sc, 45 Ti, 118 1, 136 La, 198 T1, 200 ⁇ 1, 205 Bi and 206 Bi) , Including but not limited to fluorescent materials (fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5), chemilumines, magnetic particles, mass labels or electron-dense particles It doesn't happen.
  • T1 contrast eg Gd chelate compounds
  • T2 contrast eg superparamagnetics (eg magnetite, Fe 3 0 4 , Y-Fe 2 0 3 , manganese
  • Cytokine—target binding site I and / or Cytokine-target binding site ⁇ comprises an amino acid sequence that binds to Cytokine.
  • Cytokine to which the BPB molecule of the present invention binds includes various Cytokines known in the art, preferably TNF (tumor necrosis factor) alpha, TNF beta, inter leukin-lO (IL-lO), interferon beta (IFN
  • Cytokine-BPB of the present invention binds to cytokine and acts to inhibit the action of cytokine.
  • the bipodal peptide binder of the present invention is typically referred to as "one strand of the N-Cytokine-target binding site 1_structural stabilization site-linker-the other strand of the structural stabilization site-Cytokine-target binding site ⁇ -C" Has a construct of
  • between the Cytokine-target binding site I and one strand of the structure stabilization site and / or between the other strand of the structure stabilization site -Cytokine-target binding site ⁇ in the Cytokine-bipodal peptide binder of the present invention Includes a structure influence inhibiting region that blocks the cross-structural effects between the cytokine-target binding site and the structure stabilization site.
  • At the site of rotation are amino acids that are relatively free of rotation of ⁇ and ⁇ in the peptide molecule.
  • the amino acids having relatively free rotation of and ⁇ are glycine, alanine and serine. 1-10, preferably 1-8, more preferably 1-3 amino acid residues may be located in the structure influence inhibitory site.
  • the library of Cytokine-bipodal peptide binders of the present invention having the constructs described above can be obtained by various methods known in the art.
  • the Cytokine-bipodal peptide binder will have a random sequence, which has no sequence preference or designation (or immobilization) at any position of Cytokine-target binding site I and / or Cytokine-target binding site ⁇ . It means no amino acid residues.
  • a library of Cytokine-bipodal peptide binders may be prepared on solid phase supports (eg, polystyrene or polyacrylamide resins). It can be constructed according to the split-synthesis method carried out (Lam et al. (1991) Nature 354: 82; WO 92/00091).
  • a library of bi Cytokine- podal peptide binder is constructed by a cell surface display (display surface ce ll) scheme (e.g., phage display, bacteria display or yeast display).
  • the library of Cytokine-bipodal peptide binder may be prepared through a display method based on plasmid, bacteriophage, phagemid, yeast, bacteria, mRNA or ribosomes.
  • Phage display is a technique for displaying various polypeptides in the form of proteins fused to coat proteins on the surface of the phage (Scott, JK and Smith, GP (1990) Science 249: 386; Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001); Clackson and Lowman, Phage Display, Oxford University Press (2004). Random peptides are displayed by fusing the gene to be expressed in gene ⁇ or gene uptake of filamentous phage (eg, M13).
  • Phageimide may be used for the fiji display.
  • Phageimide is a plasmid vector with one copy of the bacterial origin of replication (eg, ColEl) and the intergenic site of the bacteriophage. DNA fragments cloned in this phagemid are propagated like plasmids.
  • a preferred embodiment of the present invention comprises the following steps: (i) phage coat protein (eg, gene m of filamentous phage such as M13 or A fusion gene in which a gene encoding a gene free coat protein) and a gene encoding a bipodal tempide binder are fused; And constructing a library of expression vectors comprising transcriptional regulatory sequences (eg, lac promoters) operably linked to the fusion gene; (ii) introducing said expression vector library into a suitable host cell; (Hi) culturing the host cell to form a recombinant phage or phagemid virus particle so that the fusion protein is displayed on the surface; (iv) Contacting the cytokine molecule with the viral particle to bind the particle to the target molecule; And (V) separating particles not bound to the Cytokine molecule.
  • phage coat protein eg, gene m of filamentous phage such as M13 or A fusion gene in which a gene encoding
  • the method of producing an expression vector comprising a bipodal peptide binder gene may be carried out according to methods known in the art.
  • known phagemid or phage vector e.g. pIGT2, fUSE5, fAFFl, fd-CATl, m663, fdtetDOG, pHENl, pComb3, pComb8, pCANTAB 5E (Pharmacia) LamdaSurfZap, pIF4, PM48, PM52, PM54, fdH) And p8V5
  • an expression vector can be prepared.
  • phage display methods are performed using filamentous phage, lambda phage display (W0 95/34683; US Pat. No. 5,627,024), T4 phage display (Ren et al. (1998) Gene 215: 439; Zhu (1997) ) CAN 33: 534) and T7 phage display (US Pat. No. 5,766,905) can also be used to build a library of bipodal peptide binders.
  • the method of introducing the vector library into a suitable host cell can be carried out according to a variety of transformation methods, most preferably according to the electroporation method (see US Pat. Nos. 5,186,800, 5,422,272, 5,750,373), suitable hosts are gram negative bacterial cells such as E. coli, and suitable E. coli hosts are JM101, E. coli K12 strain 294, E. coli strain W3110 and E. coli XL-lBlue. (Stratagene), including but not limited to. Host cells are preferably prepared as competent cells prior to transformation (Sambn ik, J. et al., Molecular Cloning. A Laboratory Manual 3rd ed.
  • helper phage phages include, but are not limited to, Ex helper phage, M13-K07, M13-VCS, and R408.
  • the selection of virus particles binding to the biological target molecule can typically be carried out via a biopanning process (Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001); Clackson and Lowman, Phage Display, Oxford University Press (2004).
  • the present invention provides a nucleic acid molecule encoding the above-described Cytokine-bipodal peptide binder.
  • the present invention provides a vector for expression of a Cytokine-bipodal peptide binder comprising a nucleic acid molecule encoding a Cytokine-bipodal peptide binder.
  • the present invention provides a transformant comprising a vector for expression of a Cytokine-bipodal peptide binder.
  • nucleic acid molecule is meant to encompass DNA (gDNA and cDNA) and RNA molecules inclusively, and the nucleotides, which are the basic structural units in nucleic acid molecules, are naturally modified nucleotides, as well as modified sugar or base sites.
  • Analogues Schott al.
  • the vector of the present invention is a powerful promoter capable of transferring transcription to the nucleic acid molecule in addition to the nucleic acid molecule encoding the Cytokine-bipodal peptide binder (e.g., tac promoter, lac promoter, 7adJV5 promoter , Ipp promoter, 3 ⁇ 4 ⁇ promoter, p R x promoter, rad promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.), ribosomal binding site and transcription / detox termination sequence for initiation of translation Include.
  • the Cytokine-bipodal peptide binder e.g., tac promoter, lac promoter, 7adJV5 promoter , Ipp promoter, 3 ⁇ 4 ⁇ promoter, p R x promoter, rad promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.
  • the vector of the invention is a signal on the 5'-direction of the nucleic acid molecule encoding the Cytokine-bipodal peptide binder. Sequences (eg, pelB) may be further included.
  • the vector of the present invention further comprises a tagging sequence (eg, myc tag) for confirming that the bipodal peptide binder is well expressed on the surface of the phage.
  • the vector of the invention comprises a gene encoding a phage coat protein, preferably a gene of filamentous phage such as M13 or a gene VI coat protein.
  • the vector of the invention is the origin of replication of bacteria (e.g.
  • the vector of the present invention may include antibiotic resistance genes commonly used in the art as a selection marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neo Resistance genes for mycin and tetracycline.
  • the transformants of the present invention are preferably Gram-negative bacterial cells such as E. coli, and suitable E. coli hosts include JM101, E. coli K12 strain 294 ; E. coli strain W3110 and E. coli XL-lBlue (Stratagene), including but not limited to:
  • the method of carrying the vector of the present invention into a host cell includes the CaCl 2 method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9: 2110-2114 (1973)), one method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9: 2110-2114 (1973); and Hanahan, D., J. Mol. Biol., 166: 557-580 (1983)) and electroporation methods (US Pat. Nos. 5,186,800, 5,422,272, 5,750,373) and the like.
  • Cytokine-bipodal peptide binders of the present invention exhibit very low levels (e.g., nM levels) of 3 ⁇ 4 values (dissociation constants), providing peptides that exhibit very high affinity to Cytokine molecules.
  • bipodal peptide binders exhibit about 10 2 -10 5 times (preferably about 10 3 -10 4 times) high affinity compared to binders made in a monopodal manner.
  • the Cytokine-bipodal peptide binder of the present invention not only has a use as a medicament, but also detects substances in vivo, in vivo molecular imaging, phosphorus It can be used to target cell imaging and drug delivery in vitro, and can also be used as an escort molecule.
  • the present invention provides Cytokine-BPB that specifically binds to Cytokine.
  • the Cytokine-bipodal peptide binders of the present invention thus exhibit very low levels (eg, nM levels) of K D values (dissociation constants), resulting in very high affinity to the target.
  • Cytokine-BPB of the present invention can transport various substances into cell surface or cells based on Cytokine binding and specificity.
  • La shows a schematic diagram of a bipodal-peptide binder and Cytokine—BPB including ⁇ -hairpin as a structural stabilization site.
  • Lb shows a schematic diagram of Cytokine-BPB containing ⁇ -sheets linked by linkers as structural stabilization sites.
  • Figure lc shows a schematic of Cytokine-BPB containing leucine zippers linked by linkers as structural stabilization sites.
  • FIG. ID shows a schematic of Cytokine-BPB comprising leucine-rich motifs linked by linkers as structural stabilization sites
  • FIG. 2 shows a strategy for cloning Cytokine-BPB libraries.
  • the pelB signal sequence, myc tag is a tagging sequence to confirm that the target gene is well expressed on the surface of the phage.
  • the lac promoter was used as a promoter.
  • Figure 3 shows the results of TNF- a cytotoxic inhibition assay of TNFa-BPB.
  • Figure 4a is a result of measuring the affinity of a specific bipodal peptide binder that binds to the pyronectin ED-B protein.
  • Figure 4b is the result of measuring the affinity for the demonstration of the synergistic effect of the bipodal peptide binder BPB.
  • FIG. 7 shows biopanning results for VEGF proteins performed to select bipodal peptide binders specific for VEGF.
  • BPBIVEGF BPB2 VEGF
  • BPB3 VEG F BPB4vE GF
  • Figure 9 shows in cells of specific bipodal peptide binders that bind VEGF.
  • Beta-Fl (5'-TTCTATGCGGCCCAGCTGGCC
  • Beta-Bl (5'- AACAGTTTCTGCGGCCGCTCCTCC ⁇ 00 ( ⁇ ) 6 ⁇ 000 ⁇ 00 ⁇ 6 ⁇ 00 ⁇ 000 ⁇ -3 ') (N is A, T, G or C; K is G or T; M is C or A).
  • E. coli XL1-BLUE cells (American Type Culture Collection, Manassas, USA) were plated on LB agar-plates. After the inoculating colonies grown in an agar plate medium in LB medium with 5 heunhap at 37 ° C at a rate of 200 rpm and incubated for one day. Cultured 10 cells were inoculated in 2 LB medium and incubated in the same manner until the absorbance was 0.3-0.4 at a wavelength of 600 nm. The incubated flask was left on ice for 30 minutes, then centrifuged at 4.000 ⁇ g for 20 minutes at 4 ° C. to remove all supernatants except the sunk cells and suspended in 1 sterile sterile distilled water.
  • Electroporation was performed by dispensing 25 // 100 of phagemid vector 12 and 100 / ⁇ reacted with insert 2.9 fig of insert DNA on a bipodal peptide binder.
  • the competent cells were dissolved on ice, mixed with 200 ⁇ of competent cells and mixed with a solution 4 ⁇ , and then placed in a cooled 0.2 cm cuvette and placed on ice for 1 minute.
  • An electroporator (BioRad, Hercules, CA) was programmed at 200 ⁇ at 25 uF and 2.5 kV, drained the prepared cuvettes, placed in the electroporator and pulsed (time constant is 4.5-5 msec). Thereafter immediately placed in 1 LB medium containing 20 mM glucose prepared at 37 ° C.
  • a total of 25 cells obtained were transferred to a 100 ml test tube. After incubation at 200 rpm at 37 ° C. for one hour, the cells were incubated with 10 ⁇ dilution to measure the number of libraries and plated in ampicillin agar medium. The remaining cells in 1 LB of 20 mM glucose and 50 / / ⁇ Ampicillin was added and incubated for one day at 30 ° C. After centrifugation at 4 ° C. at 4,000 ⁇ g for 20 minutes, the supernatant except for the precipitated cells was removed, resuspended in LB of 40 1 and glycerol was added at a final concentration of 20% or higher and stored at -80 ° C. . Recombinant Phage Production and PEG Precipitation in Libraries
  • Recombinant phage was produced in a bipodal peptide binder library stored at -80 ° C. Ampicillin (50 ⁇ / ⁇ ) and 20 mM glucose were added to a 100 1 LB medium in 500 flasks, and then library 1 stored at -80 ° C was added at a rate of 150 rpm at 37 ° C for one hour. Incubation was carried out in combination. Ex helper phage (Ig therapy, Chuncheon, Korea) of lxiO ⁇ pfu was added thereto and incubated under the same conditions for one hour.
  • helper phage Ig therapy, Chuncheon, Korea
  • This mixture was prepared by mTNFa insert by PCR reaction (94 5 min, 30 cycle: 55 ° C 30 sec and 72 0 C 1 min, 94 0 C 30 sec) and purified using a PCR purification kit.
  • restriction enzyme treatment was performed on the mTNFa Insert gene and the pET28b vector.
  • Colonies grown on agar plate medium were inoculated into 5 ml of LB medium, incubated at 37 rpm at 200 rpm for one day, and then purified by plasmid preparation using a plasmid preparation kit for sequencing. Check for success. Human TNFa was also inserted into the pET28b vector in the same manner.
  • ImM i sopr opy 1 - ⁇ -Dt hi oga 1 ac t opyr anos i de (I PTG) 3 ⁇ 4 ⁇ was added and mixed at 37 0 C at 200 rpm for 8 hours. Centrifugation was performed at 4,000 g for 20 minutes to remove all supernatants except the sunk cells and resuspended in lysis buffer (50 mM sodium phosphate (pH 8.0), 300 mM NaCl and 5 mM imidazole) at -80 ° C. After storage for 1 day, dissolve E. coli using Sonicator, and remove 1 g of raw ginseng for 1 hour and attach the supernatant to Ni-NTA affinity resin.
  • lysis buffer 50 mM sodium phosphate (pH 8.0), 300 mM NaCl and 5 mM imidazole
  • N-terminal His-tag TNFa protein was collected using Elution buffer (50 mM sodium phosphate (pH 8.0), 300 mM NaCl and 300 mM imidazole). The protein thus collected is subjected to gel filtration using a superdex75 column and PBS (pH7.4) buffer to collect high purity TNFa protein,
  • Elution buffer 50 mM sodium phosphate (pH 8.0), 300 mM NaCl and 300 mM imidazole.
  • the protein thus collected is subjected to gel filtration using a superdex75 column and PBS (pH7.4) buffer to collect high purity TNFa protein
  • Biopanning was performed for TNF- ⁇ as a representative protein of cytokine.
  • Fibronectin ED-B was selected as a model protein for confirming the basic function of ⁇ and biopanning was also performed.
  • Biopanning was performed on the BPB (Bipodal-peptide binder) library prepared in Example 1 for each protein at five times, and The output phage / input phage ratio of the phage peptides recovered in the panning step was determined.
  • the protein (5 / g /) was placed in 10 wells of 96 well ELISA folate (50 ⁇ ), and then allowed to stand overnight at 4 ° C., and blocked for 2 hours at room temperature using 2% BSA the next day. After that, the solution was discarded and washed three times with 0.1% PBST.
  • the bipodal peptide binder recombinant phage containing solution 800 ⁇ and 10% BSA 200 ⁇ were mixed, transferred to 10 wells bound to the GPR 39 protein, and allowed to stand at room temperature for 1 hour.
  • the mixture was incubated for one day at a speed of 200 rpm. Cultures were centrifuged at 4,000> ⁇ g, 20 min and 4 ° C. To the supernatant was added 8 m £ of 5x PEG / NaCl [20% PEG (w / v) and 15% NaCl (w / v)] and then left at 4 ° C. for 1 hour. After centrifugation, the PEG solution was completely removed and the phage peptide pellets were dissolved in 1 PBS solution and used for the second biopanning. The same method was used for each panning step, but the washing process was increased 20 times and 30 times (0.1% PBST), respectively, step by step.
  • the culture was centrifuged at l, 000Xg for 10 minutes, then the supernatant was removed and the precipitated cells were resuspended in 1 LB liquid medium containing ampicillin (50 g / mt) and kanamycin (25 «g / mO). The mixture was incubated for one day at a speed of 200 rpm at ° C. The culture solution was centrifuged at 10,000 ⁇ g, 20 minutes and 4 ° C. to recover the supernatant, and then skim milk was added and used for phage peptide search.
  • Example 5 Binding Assays A bipodal peptide binder peptide specific to ED-B overlapped in DNA sequencing was synthesized (Anigen, Korea). Affinity was measured using BIAcore X (Biacore AB, Uppsala, Sweden). ED-B was immobilized with as much as 2,000 RU of Biotin-EDB on a Straptavidin SA chip (Biacore).
  • TNF-a-BPP synthesized TNF-a was performed using L929 fibroblast, a TNF-a sensitive cell. After 10 5 L929 cells were placed in a 96 well plate, after 12 hours, TNF- ⁇ and TNF-a-BPB were treated with 5 uM, and after 20 hours, MTT solution was used to measure the cytotoxicity.
  • the structure stabilization site of the bipodal peptide binder As the structure stabilization site of the bipodal peptide binder, a stable beta-hairpin motif was used.
  • tryptophan zippers (Andrea et al., Proc. Natl. Acad. Sci. 98: 5578-5583 (2001)), which stabilize the beta-hairpin motif structure by the interaction of tryptophan-tryptophan amino acids, were used.
  • Variable regions were created in two portions by randomly arranging six amino acids in each of the N- and C-terminal portions of the tryptophan zipper (FIG. La).
  • This is called a bipodal peptide binder and has variable regions on both sides so that it can be cooperatively attached to the antigen and thus have high affinity and specificity.
  • the structure stabilization site of the bipodal peptide binder may be configured in various ways as shown in FIGS.
  • the bipodal peptide binder library was subjected to biopanning three to five times for fibronectin ED-B or TNF- ⁇ protein and the ratio of output phage / input phage of phage peptides recovered at each panning step was determined (Table la And lb).
  • Example 9 Phage Peptide Search (Phase ELISA) Specific to the Target and Sequencing Phage recovered at the highest output / input ratio during the panning step of each library was obtained in plaque form. ELISA was performed on BSA after amplifying 60 phages from each plaque. Clones with higher absorbance than BSA were selected and requested for DNA sequencing. From this a peptide sequence specific to each overlapped protein was obtained (Table
  • TNFa-BPB Inhibition experiment of TNFa-BPB was performed using L929 cells, which are TNF-a sensitive cells. TNFa-BPB can be seen that 5 uM administered with TNF-a significantly inhibited athetosis (FIG. 3).
  • Example 11 Determination of the affinity of fibronectin ED-B
  • the peptide for fibronectin ED-B was synthesized and affinity was measured using the SPR Biacore system (Biacore AB, Uppsala, Sweden). As a result of measuring affinity for fibronectin ED-B, peptide 1 showed 620 nM, peptide 2 showed 75 nM, and peptide 3 showed 2,5 ⁇ (FIG. 4A).
  • Example 12 Confirmation of the synergistic effect by SPRCSurface Plasmon Resonance
  • a peptide was obtained by synthesizing a peptide in which only one portion of the N- and C-terminus of the peptide 2 to ED-B of Table 2a having the best affinity was synthesized.
  • the N-terminal portion had 592 ⁇ and the C-terminal portion showed 12.8 ⁇ (FIG. 4B).
  • the synergistic effect exhibited by having bipodal in the bipodal peptide binder proved to be an affinity of 43 nM (FIG. 4A).
  • Example 13 Binding Assays for Other ⁇ -Hairpins
  • peptides were synthesized to have N-terminal sequences (HCSSAV) and C-terminal sequences (IIRLEQ) of Peptide2 that specifically bind ED-B to other ⁇ -hairpin backbones, GBlm3 and HP7 (Anigen). , Korea). That is, the sequence of the bipodal peptide binder including tryptophan zipper is HCSSAVGSWTWENGK T KGI IRLEQ, the bipodal peptide binder including GBlm3 is HCSSAVG KWTYNPATGKFTVQEGnRLEQ, and the bipodal peptide binder including HP7 is HCSSAVGKTWNPA GKWTEGIQ.
  • HCSSAV N-terminal sequences
  • IIRLEQ C-terminal sequences
  • IIRLEQ C-terminal sequence of peptide 2 that specifically binds ED-B to the leucine zipper as a structural stabilization site.
  • IRLEQGGSMKQLEDKVEELLSK YHLENEVARLKKLVGER peptide was synthesized (Anigen, Korea). The two peptides were dimerized and then BIAcore X (Biacore AB, Affinity was measured using Uppsala, Sweden).
  • the leucine zipper showed an affinity of 5 ⁇ , which is lower than the similar affinity of tryptophan zipper (43 ⁇ ), while leucine zipper also functions as a structural stabilizing site for bipodal peptide binders. It can be seen that (FIG. 6).
  • IPTG isopropyl- ⁇ -D-kiogallactopyranoside
  • NTA affinity resin Elpisbio, Dae j eon, Korea
  • Illution buffer 50 mM sodium phosphate (pH 8.0), 300 mM NaCl and 300 mM imidazole
  • Trx-VEGF121 Obtained by eluting the Trx-VEGF121 protein.
  • VEGF 121 was obtained by cutting between VEGF and Trx (thioredoxin reductase) with thrombin. Bio panning method of VEGF
  • VEGF vascular endothelial growth factor
  • Recombinant phage that specifically binds to VEGF protein was tested for specificity using ELISA.
  • ELISA ELISA-Linked Immunosorbent assay
  • each protein was placed in a well of 5 5 50 ⁇ , washed three times with 0.13 ⁇ 4 PBST (Tween-20) the next day and blocked for 2 hours at room temperature using 2% BSA. Discard all and wash three times with 0.1% PBST.
  • Recombinant phage with peptides of the present invention were well mixed with 2% BSA and dispensed into wells containing 10 proteins bound by 100 ⁇ for 2 hours at 27 ° C. It was political.
  • a bipodal peptide binder peptide specific to VEGF overlapped in DNA sequencing was synthesized (Anigen, Korea). Affinity was measured using BIAcore XCBiacore AB, Uppsala, Sweden). VEGF was fixed to CM5 chip (Biacore) using EDC / NHS. PBS (pH 7.4) was used as the running buffer, and the flow was measured at various concentrations while holding at 30 ⁇ per minute, and the affinity was calculated using BIAevaluation software (Biacore AB, Uppsala, Sweden).
  • VEGF activity inhibition test (HUVEC proliferation assay) 1% of HUVEC cells (Human Umbilical Vein Endothelial Cell, ATCC)
  • the bipodal peptide binder library was subjected to biopanning four times for VEGF and the ratio of output phage / input phage of phage peptides recovered in each panning step was determined (FIG. 7).
  • Target specific phage peptide search phage ELISA
  • the peptide for VEGF was synthesized and affinity was measured using SPR Biacore system (CBiacore AB, Uppsala, Sweden).
  • the affinity for VEGF is as follows (Table 4). Table 4
  • VEGF121 BPB 1 VEGF 3.2 x 10 5 1.9 x ⁇ 2 60 x 10— 9
  • VEGF121 BPB2 ⁇ 1.2 x 10 5 1.1 x 10— 2 90 x 10_ 9
  • each BPB specific for VEGF has specificity for VEGF.
  • VEGF activity inhibition test (HUVEC growth assay)
  • HUVEC proliferation assay was attempted to determine whether BPBVEGF can inhibit VEGF activity in HUVEC cells.
  • VEGF is a growth hormone that promotes the growth of epithelial cells. Blocking it can inhibit the growth of epithelial cells. As can be seen in Figure 9, when treated with 20 ⁇ , 10 ⁇ and 5 ⁇ BPBVEGF completely inhibited the activity of VEGF at 20 ⁇ . Among them, BPB3VEGF had the best IC 50 activity of 5 ⁇ .

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne un lieur peptidique bipied de RTK se liant spécifiquement à RTK, comprenant : (a) une région de stabilisation de structure comprenant des brins d'acides aminés parallèles, antiparallèles, ou parallèles et antiparallèles dans lesquels des liaisons non covalentes inter-brins sont formées; et (b) une région de liaison cible de RTK I et une région de liaison cible de RTK II qui se lient respectivement aux deux extrémités de la région de stabilisation de structure et comprennent n et m acides aminés sélectionnés de façon aléatoire, respectivement. Le lieur peptidique bipied de RTK de la présente invention présente une très faible valeur de KD (constante de dissociation) (par exemple, au niveau nM) pour RTK et présente donc une affinité très élevée pour une cible RTK. Le lieur peptidique bipied de RTK de la présente invention peut avoir une utilisation en tant que médicament, peut être utilisé pour l'imagerie moléculaire in vivo et le ciblage d'administration de médicament, et peut être très utile en tant que molécule escorte.
PCT/KR2011/002839 2010-04-20 2011-04-20 Rtk-bpb se liant spécifiquement à rtk WO2011132939A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020127023553A KR20130103302A (ko) 2010-04-20 2011-04-20 Ｃｙｔｏｋｉｎｅ에 특이적으로 결합하는 ｃｙｔｏｋｉｎｅ―ｂｐｂ

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20100036607 2010-04-20
KR10-2010-0036607 2010-04-20

Publications (3)

Publication Number Publication Date
WO2011132939A2 true WO2011132939A2 (fr) 2011-10-27
WO2011132939A3 WO2011132939A3 (fr) 2012-04-05
WO2011132939A8 WO2011132939A8 (fr) 2012-08-09

Family

ID=44834645

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/002839 WO2011132939A2 (fr) 2010-04-20 2011-04-20 Rtk-bpb se liant spécifiquement à rtk

Country Status (2)

Country Link
KR (1) KR20130103302A (fr)
WO (1) WO2011132939A2 (fr)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5427908A (en) * 1990-05-01 1995-06-27 Affymax Technologies N.V. Recombinant library screening methods
JP2001002592A (ja) * 1999-06-18 2001-01-09 Dai Ichi Seiyaku Co Ltd 遺伝子導入用組成物
US20040152647A1 (en) * 2003-01-31 2004-08-05 Max-Delbruck-Cenrum Fur Molekulare Medizin Agent for gene transfer
US6914123B2 (en) * 2001-04-17 2005-07-05 Genentech, Inc. Hairpin peptides with a novel structural motif and methods relating thereto
WO2010047515A2 (fr) * 2008-10-20 2010-04-29 광주과학기술원 Liant peptidique bipode

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5427908A (en) * 1990-05-01 1995-06-27 Affymax Technologies N.V. Recombinant library screening methods
JP2001002592A (ja) * 1999-06-18 2001-01-09 Dai Ichi Seiyaku Co Ltd 遺伝子導入用組成物
US6914123B2 (en) * 2001-04-17 2005-07-05 Genentech, Inc. Hairpin peptides with a novel structural motif and methods relating thereto
US20040152647A1 (en) * 2003-01-31 2004-08-05 Max-Delbruck-Cenrum Fur Molekulare Medizin Agent for gene transfer
WO2010047515A2 (fr) * 2008-10-20 2010-04-29 광주과학기술원 Liant peptidique bipode

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
TIM CLACKSON ET AL.: 'Making antibody fragments using phage display libraries' NATURE vol. 352, 15 August 1991, pages 624 - 628 *
VAISHALI BAGALKOT ET AL.: 'An Aptamer-Doxorubicin Physical Conjugate as a Novel Targeted Drug-Delivery Platform' ANGEW. CHEM. INT. ED. vol. 45, 2006, pages 8149 - 8152 *

Also Published As

Publication number Publication date
KR20130103302A (ko) 2013-09-23
WO2011132939A8 (fr) 2012-08-09
WO2011132939A3 (fr) 2012-04-05

Similar Documents

Publication Publication Date Title
KR101151805B1 (ko) 바이포달 펩타이드 바인더
JP6437468B2 (ja) ポリペプチドの修飾
JP6041799B2 (ja) Ｔｒａｉｌｒ２特異的多量体足場
CA2751505C (fr) Peptides a specificite multiple
AU2012268970B2 (en) Dimeric binding proteins based on modified ubiquitins
TW201130501A (en) Fibronectin based scaffold domain proteins that bind IL-23
JP2008516210A (ja) 治療、診断およびクロマトグラフィーに使用するためのタンパク質複合体
JP5677454B2 (ja) 細胞内ターゲット結合用二座ペプチドバインダー
JP2014523238A (ja) インターフェロンと標的化修飾ユビキチンタンパク質とを含むヒト融合タンパク質
JP2006526999A (ja) 伝達可能なｄｎａ−結合タンパク質
AU2012268970A1 (en) Dimeric binding proteins based on modified ubiquitins
JP2023550191A (ja) Ｄｒ４および／またはｄｒ５を標的とするポリペプチドならびに関連する組成物および方法
WO2011132939A2 (fr) Rtk-bpb se liant spécifiquement à rtk
KR20150118252A (ko) 환형의 β-헤어핀 기반 펩타이드 바인더 및 이의 제조방법
WO2011132940A2 (fr) Rtk-bpb se liant spécifiquement à rtk
WO2011132941A2 (fr) Tf-bpb se liant spécifiquement à un facteur de transcription
WO2023145860A1 (fr) Peptide se liant au récepteur scf
WO2011132938A2 (fr) Gpcr-bpb se liant spécifiquement à gpcr
JP2015214568A (ja) 多重特異性ペプチド
KR101443839B1 (ko) 펩타이드의 타겟 친화도 개선방법
KR20110116930A (ko) 이온채널에 특이적으로 결합하는 이온채널―ｂｐｂ
WO2008024128A2 (fr) Domaines pdz variants de boucle en tant que produits biothérapeutiques, produits diagnostiques et réactifs de recherche
CN115175691A (zh) 结合血清白蛋白的纤连蛋白iii型结构域及其应用
KR20080113759A (ko) 신규한 단백질 유입 도메인 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11772227

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 20127023553

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11772227

Country of ref document: EP

Kind code of ref document: A2