WO2011132939A2

WO2011132939A2 - Rtk-bpb specifically binding to rtk

Info

Publication number: WO2011132939A2
Application number: PCT/KR2011/002839
Authority: WO
Inventors: 전상용; 김성현; 박세호; 김대진; 이상헌
Original assignee: 광주과학기술원
Priority date: 2010-04-20
Filing date: 2011-04-20
Publication date: 2011-10-27
Also published as: WO2011132939A3; WO2011132939A8; KR20130103302A

Abstract

The present invention relates to an RTK-bipodal peptide binder specifically binding to RTK, comprising: (a) a structure stabilizing region comprising parallel, antiparallel, or parallel and antiparallel amino acid strands in which interstrand non-covalent bonds are formed; and (b) an RTK-target binding region I and an RTK-target binding region II which bond to both terminals of the structure stabilizing region and which comprise n and m amino acids randomly selected, respectively. The RTK-bipodal peptide binder of the present invention exhibits a very low KD value (dissociation constant) (for example, nM level) relative to RTK and therefore exhibits a very high affinity toward an RTK target. The RTK-bipodal peptide binder of the present invention may have a use as a medicine, may be used for in vivo molecular imaging and drug delivery targeting, and may be very useful as an escort molecule.

Description

【Specification】

[Name of invention]

Cytokine_BPB that specifically binds to cytokine

The present invention relates to Cytokine_BPB which specifically binds to Cytokine.

[Background technology]

Antibodies are immunoglobulin proteins, a type of plasma protein produced by B cells, that specifically inactivate and inactivate antigens by specifically recognizing and binding to specific sites of antigens. The specificity and high affinity of these antigen-antibody reactions and the diversity of antibodies that can distinguish tens of millions of antigens have led to the emergence of many types of antibody products, including diagnostics and therapeutics. Currently, the FDA has approved 21 monoclonal antibodies, and antibodies such as Rituximab and Herceptin have been effective in more than 50% of patients who have not responded to other treatments. Has demonstrated successful clinical treatment of lymphoma, colon cancer or breast cancer using monoclonal antibodies. The total market size of therapeutic antibodies is estimated to grow at an annual average of 20¾, from $ 10 billion in 2004 to $ 30 billion in 2010, and the market is expected to grow exponentially. The development of new drugs using antibodies is active because the drug development period is short, investment costs are low, and side effects can be easily predicted. In addition, since the antibody is a herbal medicine, the human body is hardly affected, and the half-life in the body is overwhelmingly long compared to low molecular weight drugs, so the patient is friendly. Despite this usefulness, monoclonal antibodies in humans are recognized as foreign antigens and can cause severe allergic reactions or hypersensitivity. In addition, when the anti-cancer monoclonal antibody is used clinically, the production cost is high, and thus the price of the therapeutic agent increases rapidly. The method of culturing the antibody and the purification method, etc. Since a wide range of technologies are protected by various intellectual property rights, expensive licensing fees are required.

Therefore, in order to solve this problem, the development of antibody replacement proteins in the European Union centered on the United States is in the early stage. Antibody-replacement protein is a recombinant protein made to have constant and variable regions like an antibody. A small and stable protein is replaced with a random sequence of amino acids to make a library, which is then screened for the target material, thereby providing high affinity and good Substances with specificity can be found. For example, avimers and affibodies among antibody replacement proteins have been reported to have a picomol affinity for a target substance. These antibodies alternative protein can penetrate deep in the tumor size by a small, stable and has high-beam ^"and is generally less cause an immune banung. First of all, it is possible to escape from a wide range of antibody patent problems, and because it can be easily purified in large quantities from bacteria, it is economically superior to antibodies because of low production cost. There are currently 40 antibody replacement proteins that have been developed. Among these, antibody replacement proteins that are being commercialized by venture companies or multinational pharmaceutical companies are fibronectin type ΠΙ domain, lipocalin, LDLR-A domain, crystallin, protein A and ankyrin. It uses a protein called repeat (Ankyrin repeat), BPTI, and has a high affinity of several nanomolar to picomolar to target. Adnectin, Avimer, and Kunitz domains are currently undergoing FDA clinical trials.

The present invention focused on peptide-based antibody replacement proteins that are different from antibody replacement proteins using proteins up to now. Peptides have been widely used in place of antibody therapeutics due to proper pharmacokinetics, mass productivity, low toxicity, antigenic inhibition and low production cost compared to antibodies. The advantages of peptides as therapeutic drugs are low production costs, high safety and responsiveness, relatively low patent royalties, and less exposure to unwanted immune systems, which can inhibit the production of antibodies to the peptides themselves. Deformation through is easy and accurate. However, since most peptides exhibit low affinity and specificity for specific protein targets compared to antibodies, they cannot be used for various applications. therefore, There is a need in the art for the development of new peptide-based antibody replacement proteins that can overcome the disadvantages of peptides. Accordingly, the present inventors have tried to develop a peptide material capable of specific binding with high affinity to a biological target molecule. This is expected to be a technology that can produce new drug candidates with high affinity and specificity in a short time using peptides having low affinity reported for a large number of targets.

Cytokines, on the other hand, are secreted by certain immune cells that carry signals between cells. Cytokines stimulate immune cells to activate immune response or inhibit black.

Cytokines are involved in various biological and pathological phenomena (eg, autoimmune diseases), and many studies have been conducted on medicines targeting them.

Throughout this specification, a number of papers and patent documents are referred to and their citations are indicated. The disclosures of cited papers and patent documents are incorporated herein by reference in their entirety and the level of the technical field to which the present invention belongs. The content of the present invention is explained more clearly.

[Detailed Description of the Invention]

The inventors have sought to develop a system capable of delivering various substances intracellularly or to the cell surface based on Cytokine binding and specificity. As a result, the peptides are randomly bound to both ends of the structural stabilization site having a relatively rigid peptide backbone, and when the two peptides are jointly bound to the cytokine molecule, the binding ability and specificity are greatly increased. By confirming that a bipodal peptide binder (BPB) having a compound can be obtained, the present invention was completed.

Accordingly, an object of the present invention is to provide a Cytokine-bipodal peptide binder (Cytokine-BPB).

Another object of the present invention is to provide a Cytokine-bipodal peptide binder (Cytokine-BPB).

Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings. According to one aspect of the invention, the invention provides a Cytokine-bipodal peptide binder (Cytokine-BPB) comprising:

(a) a structure stabilizing region comprising parallel lei, antiparallel or parallel and antiparallel amino acid strands having interstrand noncovalent bonds; and

(b) Cytokine-target binding region I and Cytokine-target binding region Π (Cytokine) bound to both ends of the structural stabilization site and each comprising n and m amino acids selected at random; Cytokine—bipodal peptide binders that specifically bind to Cytokine, including -target binding region Π).

The inventors have sought to develop a system capable of delivering various substances intracellularly or to the cell surface based on Cytokine binding and specificity. As a result, the peptides are randomly bound to both ends of the structural stabilization site having a relatively rigid peptide backbone, and when the two peptides are jointly bound to the cytokine molecule, the binding ability and specificity are greatly increased. It was confirmed that a bipodal peptide binder (BPB) having a was obtained.

The basic strategy of the present invention is to connect peptides that are bound to the target at both ends of the rigid peptad backbone. In this case, the rigid peptide backbone acts to stabilize the overall structure of the bipodal peptide provider and enhances the binding of the target binding site I and the target binding site Π to the target molecule.

Structural stabilization sites usable in the present invention include parallel, antiparallel or parallel and antiparallel amino acid strands, interstrand hydrogen bonds, electrostatic interactions, hydrophobic interactions, van der Waals interactions, pi-pi Protein structure motifs in which non-covalent bonds are formed by interaction, cation-pi interaction, or a combination thereof. Hydrogen bonds between the strands, electrostatic interactions, hydrophobic interactions, van der Waals interactions, pi-pi interactions, cation-pi interactions, or their Non-covalent bonds formed by combination contribute to the rigidity of the structure stabilization site.

According to a preferred embodiment of the invention, interstrand non-covalent bonds at the structure stabilization site include hydrogen bonds, hydrophobic interactions, van der Waals interactions, pi-pi interactions or combinations thereof.

Optionally, there may be a covalent bond to the structured stabilization site. For example, disulfide bonds may be formed at the structured stabilization site to further increase the robustness of the structure stabilized site. The increase in firmness by such covalent bonds is given in consideration of the specificity and affinity of the bipodal peptide binder for the target.

According to a preferred embodiment of the invention, the amino acid strands of the structure stabilization site are linked by a linker. As used herein, the term "linker" as used to refer to the strands refers to the material that connects the strands. For example, when β_hairpin is used as a structure stabilization site, the turn sequence in β-hairpin acts as a linker, and when leucine zipper is used, a substance connecting two c-terminus of leucine zipper (eg , Peptide linkers) serve as linkers.

The linker connects the parallel, antiparallel or parallel and antiparallel amino acid strands. For example, at least two strands (preferably two strands) arranged in parallel fashion, at least two strands (preferably two strands) arranged in antiparallel fashion, and at least three strands arranged in parallel and antiparallel fashion. The linker (preferably three strands) is connected by the linker.

According to a preferred embodiment of the invention, the linker is a turn sequence or peptide linker.

According to a preferred embodiment of the invention, the turn sequence is β-turn, Υ-turn, α-turn, π-turn or ω-loop (Venkatachalam CM (1968), Biopolymers, 6, 1425-1436; Nemethy G and Printz MP. (1972), Macro / no 1 ecu les, 5, 755-758; Lewis PN et al,, (1973), Biochi. Biophys. Acta, 303, 211-229; Toniolo C. (1980) CRC Crit. Rev. Biochem., 9, 1-44; Richardson JS. (1981), Adv. Protein Chem., 34, 167-339; Rose GD et al., (1985), A / .Protein Chem., 37 , 1-109; Mi lner— White EJ and Poet R. (1987), TIBS, 12 189-192; Wilmot CM and Thornton JM. (1988), J. Mol. Biol., 203, 221-232; Milner-White EJ. (1990), J. Mol. Biol. , 216, 385-397; Pavone V et al. (1996), Biopolymers, 38, 705-721; Rajashankar KR and Ramakumar S. (1996), Protein Sci. , 5, 932-946). Most preferably, the turn sequence used in the present invention is β-turn.

When β-turn is used as the turn sequence, it is preferably a type I, type Γ, type π, type π ', type m or type m' turn sequence, more preferably type I, type I 'ᅳ type π , A type π 'turn sequence, even more preferably a type j' or type π 'turn sequence, and most preferably a type Γ turn sequence (β, L. Sibanda et al., /. Mol. Biol., 1989, 206, 4, 759-777; BL Sibanda et al., Methods Enzymol., 1991, 202, 59-82).

According to another preferred embodiment of the present invention, which can be used as the turn sequence in the present invention is H. Jane Dyson et al. , Eur. J. Biochem. 255: 462-471 (1998), which is incorporated herein by reference. Available for the turn sequence include the following amino acid sequences: X-Pro-Gly-Glu-Val; Ala— X-Gly—Glu-Val (X is selected from 20 amino acids). According to one embodiment of the invention, when a β-sheet or leucine zipper is used as the structure stabilization site, it is preferred that the peptide linker connects two strands arranged in a parallel manner or two strands arranged in an antiparallel manner. Desirable

Peptide linkers can be used in any known in the art. The sequence of a suitable peptide linker may be selected in consideration of the following factors: (a) the ability to be applied to flexible extended conformation; (b) the ability not to create secondary structures that interact with biological target molecules; And (C) absence of hydrophobic residues or residues with charges that interact with the biological target molecule. Preferred peptide linkers include Gly, Asn and Ser residues. Other neutral amino acids such as Thr and Ala can also be included in the linker sequence. Suitable amino acid sequences for linkers are Marat ea et al., Gene 40: 39-46 (1985); Murphy et al., Proc. Natl. Acad Sci. USA 83: 8258-8562 (1986); US Pat. Nos. 4,935,233, 4,751,180 and 5,990,275. The peptide linker sequence may consist of 1-50 amino acid residues.

According to a preferred embodiment of the present invention, the structural stabilization site is a β-hairpin, a linker linked β-sheet or a linker leucine zipper, more preferably the structural stabilization site is a β-hairpin or linker linked β-sheet And most preferably β-hairspray.

As used herein, the term "β-hairpin" refers to the simplest protein motif comprising two β strands, the two β strands representing an antiparallel alignment with each other. In this β-hairpin the two β strands are generally linked by turn sequences.

Preferably, the turn sequence applied to the β-hairpin is a type I, type Γ, type π, type π ', type m or type ΓΠ' turn sequence, more preferably type I, type 1 ', type n, It is a type π 'turn sequence, even more preferably a type Γ or type π' turn sequence, and most preferably a type Γ turn sequence. In addition, turn sequences represented by X-Pro-Gly-Glu-Val; or Ala-X-Gly-Glii-Val (X is selected from 20 amino acids) can also be used for β-hairpins.

According to an exemplary embodiment of the invention, the type I turn sequence is Asp-Asp-Ala-Thr-Lys-Thr, the type Γ turn sequence is Glu-Asn-Gly-Lys, and the type Π turn sequence is X-Pro -Gly-Glu-Val; or Ala-X—Gly—Glu-Val (X is selected from 20 amino acids), and the type Π ′ turn sequence is Glu-Gly-Asn-Lys or Glu-D-Pro—Asn -Lys.

Peptides with β-hairpin formulations are well known in the art. See, for example, US Pat. No. 6,914,123 and Andrea G. Cochran et al. , PNAS, tryptophan zipper disclosed in 98 (10): 5578-5583, template-fixed β-hairpin mimetic disclosed in WO 2005/047503, disclosed in US Pat. No. 5,077,979. β-hairpin variants are well known. In addition, — peptides with hairpin conformation are described by Smith & Regan (1995) Science 270: 980-982; Chou & Fassman (1978) Annu. Rev. Biochem. 47: 251-276; Kim & Berg (1993) Nature 362: 267-270; Minor & Kim (1994) Nature 367: 660-663; Minor & Kim (1993) Nature 371: 264-267; Smith et al. Biochemistry (1994) 33: 5510-5517; Searle et al. (1995) Nat. Struct. Biol. 2: 999-1006; Haque & Gel 1 man (1997) J. Am. Chem. Soc. 119: 2303-2304; Blanco et al. (1993) J. Am. Chem. Soc. 115: 5887-5888; de Alba et al. (1996) Fold. Des. 1: 133-144; de Alba et al. (1997) Protein Sci. 6: 2548-2560; Rami rez-Alvar ado et al. (1996) Nat. Struct. Biol. 3: 604-612; St anger & Gel 1 man (1998) J. Am. Chem. Soc. 120: 4236-4237; Maynard & Searle (1997) Chem. Co 醒 un. 1297-1298; Griffiths-Jones et al. (1998) Chem. Commun. 789-790; Maynard et al. (1998) J. Am. Chem. Soc. 120: 1996- 2007; and Blanco et al. (1994) Nat. Struct. Biol. 1: 584-590, which is incorporated herein by reference.

When a peptide having β-hairpin conformation is used as the structure stabilization site, most preferably a tryptophan zipper is used.

According to a preferred embodiment of the present invention, the tryptophan zipper used in the present invention is represented by the following general formula (I):

Formula I

X ₁ -Trp (X ₂ ) X3-X4-X5 (X ^, 2) X6-X7

¾ is Ser or Gly-Glu, X ₂ and X ' ₂ are independently of each other Thr, His, Val, lie, Phe or Tyr, X ₃ is Trp or Tyr, X4 is Type I ， Type Ι ′, Type Π, type Π 'or type m or type ΠΓ turn sequence, ¾ is Trp or Phe, ¾ is Trp or Val, and X ₇ is Lys or Thr-Glu.

More preferably, in Formula I, ¾ is Ser or Gly-Glu, and χ'2 is independently of each other Thr, His or Val, ¾ is Trp or Tyr, is Type I, Type Γ, Type Π Or type Π 'turn sequence, ¾ is Trp or Phe, ¾ is Trp or Val, and X? Is Lys or Thr-Glu. Even more preferably, ¾ in Formula I is Ser or Gly— Glu,

X ₂ and X ' ₂ are independently of each other Thr, His or Val, ¾ is Trp, is type I, type Γ, type Π or type Π' turn sequence, ¾ is Trp, ¾ is Trp, X ₇ is Lys or Thr-Glu.

Even more preferably, in formula I, ¾ is ser, ¾ and X ' ₂ are Thr, ¾ is Trp, is a type Γ or type Π' turn sequence, ¾ is Trp, ¾ is Trp ¾ is Lys. Most preferably, in Formula I, _Xl is Ser, ¾ and X'2 are Thr, ¾ is Trp, X4 is type Γ turn sequence (ENGK) or type Π 'turn sequence (EGNK), ¾ is Trp, ¾ is Trp, and X ₇ is Lys.

Exemplary amino acid sequences of tryptophan zippers suitable for the present invention are described in SEQ ID NOs: 1 to 3 and 5 to 10.

Β-hairpin peptides usable as structural stabilization sites in the present invention are peptides derived from B1 domaine of protein G, ie GB1 peptides.

When the GB1 peptide is used in the present invention, the structural stabilization site is preferably represented by the following general formula Π:

Formula Π

Xi-Trp-X ₂ -Tyr-X3-Phe-Thr-Va 1 -¾

¾ is Arg, Gly-Glu or Lys-Lys, X ₂ is Gin or Thr, ¾ is type I, type Γ, type Π, type ΓΓ or type m or type ΠΓ turn sequence, X4 is Gin, Thr- Glu or Gln-Glu.

More preferably, the structural stabilization site of the general formula π is

It is represented by ΙΓ:

Formula Π

X 厂 Trp-Thr-Tyr-¾-Phe-Thr— Va 1 -¾

¾ is Gly-Glu or Lys-Lys, X ₂ is type I, type Γ, type Π, type Π 'or type m or type ΠΓ turn sequence, ¾ is Thr-Glu or Gln-Glu.

Exemplary amino acid sequences of GB1 β-hairpins suitable for the present invention are described in SEQ ID NO: 4 and 14 to 15 sequences.

Β-hairpin peptides usable as structural stabilization sites in the present invention

HP peptide. When the HP peptide is used in the present invention, the structural stabilization site is preferably represented by the following general formula m:

General formula m

¾-¾-¾— Trp-X4-X ₅ -Thr-¾-X ₇

¾ is Lys or Lys— Lys, ¾ is Trp or Tyr, ¾ is Val or

Thr is, type I ， type Γ ， type Π ， type ΓΓ or type m or Type ΠΓ turn sequence, ¾ is Trp or Ala, ¾ is Trp or Val, and X ₇ is Glu or Gln-Glu.

Another β-hairpin peptide that can be used as a structural stabilization site in the present invention is represented by the following general formula IV:

Formula IV

¾ is Lys-Thr or Gly, ¾ is Trp or Tyr, ¾ is type I, type Γ, type II, type Π 'or type m or type ΠΓ turn sequence, and is Thr-Glu or Gly.

Exemplary amino acid sequences of β-hairpins of Formulas III and IV are described in SEQ ID NOs: 11-12, 15, and 16-19.

According to the present invention, a -sheet connected by a linker can be used as the structural stabilization site. In the β-sheet structure, two or more amino acid strands, which are parallel or antiparallel, preferably antiparallel, are in an extended form, and hydrogen bonds are formed between the amino acid strands.

In the β-sheet structure, two adjacent ends of two amino acid strands are connected by a linker. As the linker, various turn-sequences or peptide linkers described above may be used. If the turn-sequence is used as a linker, the β-turn sequence is most preferred.

According to another variant of the invention, leucine zippers or leucine zippers linked by linkers may be used as structural stabilization sites. Leucine zippers are conserved peptide domains that cause parallel dimerization of two α-chains and are generally dimerized domains found in proteins involved in gene expression (“Leucine scissors”. Glossary of Biochemistry and Molecular Biology ( (1997) .Ed. David M. Glick.London: Portland Press; Lands chulz WH, et al. (1988) Science 240: 1759-1764). Leucine zippers generally comprise a heptad repeat sequence, with the leucine residues located at the fourth or fifth. For example, leucine zippers that may be used in the present invention include the amino acid sequence of LEALKEK, LKALEKE, LKKLVGE, LEDKVEE, LENEVAR or LLSKNYH. Leucine used in the present invention Specific examples of zippers are described in SEQ ID NO: 39. Each half of the leucine zipper consists of short α-hexens with direct leucine contact between the α-chains. The leucine zipper in the transcription factor generally consists of a hydrophobic leucine zipper site and a basic site (site that interacts with the main groove of the DNA molecule). When the leucine zipper is used in the present invention, the basic site is not necessarily required. In the leucine zipper structure, two adjacent ends of two amino acid strands (ie, two α-chains) may be linked by a linker. As the linker, various turn-sequences or peptide linkers described above may be used, and preferably, a peptide linker that does not affect the structure of the leucine zipper is used.

Random amino acid sequences are joined to both ends of the structure stabilization site described above. The random amino acid sequence forms Cytokine-target binding site I and Cytokine-target binding site Π. One of the biggest features of the present invention is to prepare a peptide binder in a bipodal manner by connecting Cytokine-target binding site I and Cytokine-target binding site Π to both ends of the structure stabilization site. Cytokine-target binding site I and Cytokine-target binding site Π cooperatively bind to the target, thereby greatly increasing affinity for Cytokine.

The amino acid number n of the cytokine-target binding site I is not particularly limited, preferably an integer of 2-100, more preferably an integer of 2-50, even more preferably an integer of 2-20, most preferred Preferably an integer of 3-10.

The number of amino acids m of the cytokine-target binding site Π is not particularly limited, and is preferably 2-100 and an integer, more preferably an integer of 2-50, even more preferably an integer of 2-20, most preferably Preferably an integer of 3-10.

Cytokine-target binding site I and Cytokine-target binding site Π may each contain different or identical numbers of amino acid residues. Cytokine-target binding site I and Cytokine-target binding site Π may include different or identical amino acid sequences, and preferably include different amino acid sequences. The amino acid sequence contained in Cytokine-target binding site I and / or Cytokine-target binding site Π is a linear amino acid sequence or a cyclic amino acid sequence. In order to increase the stability of the peptide sequence of the target binding site, at least one amino acid residue among the amino acid sequences included in the Cytokine-target binding site I and / or the Cytokine-target binding site Π is an acetyl group, a fluorenyl methoxy carbonyl group, Formyl, palmitoyl, myristyl, stearyl or polyethylene glycol (PEG).

Cytokine-BPB of the present invention, which is bound to a biological target molecule, can be used for the regulation of physiological responses in vivo, detection of substances in vivo, imaging of in vivo molecules, and targeting for drug delivery, and also as an escort molecule. Can be

According to a preferred embodiment of the present invention, a cargo is added to the structure stabilization site, the Cytokine-target binding site I or the Cytokine-target binding site Π (more preferably, the structure stabilization site, even more preferably the linker of the structure stabilization site). Are combined. Examples of the cargo include, but are not limited to, labels, chemicals, biopharmaceuticals or nanoparticles that generate detectable signals.

Labels that generate the detectable signal include T1 contrast (eg Gd chelate compounds), T2 contrast (eg superparamagnetics (eg magnetite, Fe ₃ 0 ₄ , Y-Fe ₂ 0 ₃ , manganese ferrite, cobalt) Ferrites and nickel ferrites)), radioisotopes (e.g., ¹⁵ 0, ¹³ N, P ³² , S ³⁵ , ⁴⁴ Sc, ⁴⁵ Ti, ¹¹⁸ 1, ¹³⁶ La, ¹⁹⁸ T1, ²⁰⁰ Τ1, ²⁰⁵ Bi and ²⁰⁶ Bi) , Including but not limited to fluorescent materials (fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5), chemilumines, magnetic particles, mass labels or electron-dense particles It doesn't happen.

Cytokine—target binding site I and / or Cytokine-target binding site Π comprises an amino acid sequence that binds to Cytokine.

Cytokine to which the BPB molecule of the present invention binds includes various Cytokines known in the art, preferably TNF (tumor necrosis factor) alpha, TNF beta, inter leukin-lO (IL-lO), interferon beta (IFN | 3 ), interferon alphaClFN a), interferon gamma (IFNy), granulocyte colony stimulating factor (G-CSF), leukemia inhibitory factor (LIF), human growth hormone (hGH), ciliary neurotrophic factor (CNTF), leptin, oncost at in M, inter leukin-6 (IL-6) and inter leukin-12 ( IL-12), erythropoietin (EPO), granulocyte—macrophage colony stimulating factor (GM-CSF), inter leukin-2 (IL-2), inter leukin-3 (IL-3), inter leukin-4 (IL— 4 ), interleukin-5 (IL-5), inter leukin- 13 (IL'13), Fit 13 1 igand and stem cell factor (SCF).

Cytokine-BPB of the present invention binds to cytokine and acts to inhibit the action of cytokine.

As mentioned above, the bipodal peptide binder of the present invention is typically referred to as "one strand of the N-Cytokine-target binding site 1_structural stabilization site-linker-the other strand of the structural stabilization site-Cytokine-target binding site Π-C" Has a construct of

According to a preferred embodiment of the invention, between the Cytokine-target binding site I and one strand of the structure stabilization site and / or between the other strand of the structure stabilization site -Cytokine-target binding site Π in the Cytokine-bipodal peptide binder of the present invention Includes a structure influence inhibiting region that blocks the cross-structural effects between the cytokine-target binding site and the structure stabilization site. At the site of rotation are amino acids that are relatively free of rotation of ^ and ^ in the peptide molecule. Preferably, the amino acids having relatively free rotation of and ^ are glycine, alanine and serine. 1-10, preferably 1-8, more preferably 1-3 amino acid residues may be located in the structure influence inhibitory site.

The library of Cytokine-bipodal peptide binders of the present invention having the constructs described above can be obtained by various methods known in the art. In this library, the Cytokine-bipodal peptide binder will have a random sequence, which has no sequence preference or designation (or immobilization) at any position of Cytokine-target binding site I and / or Cytokine-target binding site Π. It means no amino acid residues.

For example, a library of Cytokine-bipodal peptide binders may be prepared on solid phase supports (eg, polystyrene or polyacrylamide resins). It can be constructed according to the split-synthesis method carried out (Lam et al. (1991) Nature 354: 82; WO 92/00091).

According to a preferred embodiment, a library of bi Cytokine- podal peptide binder is constructed by a cell surface display (display surface _ce ll) scheme (e.g., phage display, bacteria display or yeast display). Preferably, the library of Cytokine-bipodal peptide binder may be prepared through a display method based on plasmid, bacteriophage, phagemid, yeast, bacteria, mRNA or ribosomes.

Phage display is a technique for displaying various polypeptides in the form of proteins fused to coat proteins on the surface of the phage (Scott, JK and Smith, GP (1990) Science 249: 386; Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001); Clackson and Lowman, Phage Display, Oxford University Press (2004). Random peptides are displayed by fusing the gene to be expressed in gene ΙΠ or gene uptake of filamentous phage (eg, M13).

Phageimide may be used for the fiji display. Phageimide is a plasmid vector with one copy of the bacterial origin of replication (eg, ColEl) and the intergenic site of the bacteriophage. DNA fragments cloned in this phagemid are propagated like plasmids.

When constructing a library of Cytokine-bipodal peptide binders by phage display, a preferred embodiment of the present invention comprises the following steps: (i) phage coat protein (eg, gene m of filamentous phage such as M13 or A fusion gene in which a gene encoding a gene free coat protein) and a gene encoding a bipodal tempide binder are fused; And constructing a library of expression vectors comprising transcriptional regulatory sequences (eg, lac promoters) operably linked to the fusion gene; (ii) introducing said expression vector library into a suitable host cell; (Hi) culturing the host cell to form a recombinant phage or phagemid virus particle so that the fusion protein is displayed on the surface; (iv) Contacting the cytokine molecule with the viral particle to bind the particle to the target molecule; And (V) separating particles not bound to the Cytokine molecule.

Methods for constructing peptide libraries and screening these libraries using phage display are described in U.S. Pat. , 5,763,192 and 5,723,323.

The method of producing an expression vector comprising a bipodal peptide binder gene may be carried out according to methods known in the art. For example, known phagemid or phage vector (e.g. pIGT2, fUSE5, fAFFl, fd-CATl, m663, fdtetDOG, pHENl, pComb3, pComb8, pCANTAB 5E (Pharmacia) LamdaSurfZap, pIF4, PM48, PM52, PM54, fdH) And p8V5) by inserting a bipodal peptide binder gene, an expression vector can be prepared.

Although most phage display methods are performed using filamentous phage, lambda phage display (W0 95/34683; US Pat. No. 5,627,024), T4 phage display (Ren et al. (1998) Gene 215: 439; Zhu (1997) ) CAN 33: 534) and T7 phage display (US Pat. No. 5,766,905) can also be used to build a library of bipodal peptide binders.

The method of introducing the vector library into a suitable host cell can be carried out according to a variety of transformation methods, most preferably according to the electroporation method (see US Pat. Nos. 5,186,800, 5,422,272, 5,750,373), suitable hosts are gram negative bacterial cells such as E. coli, and suitable E. coli hosts are JM101, E. coli K12 strain 294, E. coli strain W3110 and E. coli XL-lBlue. (Stratagene), including but not limited to. Host cells are preferably prepared as competent cells prior to transformation (Sambn ik, J. et al., Molecular Cloning. A Laboratory Manual 3rd ed. Cold Spring Harbor Press (2001)), selection of transformed cells Generally include antibiotics (eg, tetracycline and ampicillin) It is carried out by culturing in the medium. Selected transformed cells are further cultured in the presence of helper phage to generate recombinant phage or phagemid virus particles. Suitable helper phage phages include, but are not limited to, Ex helper phage, M13-K07, M13-VCS, and R408. The selection of virus particles binding to the biological target molecule can typically be carried out via a biopanning process (Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001); Clackson and Lowman, Phage Display, Oxford University Press (2004).

According to another aspect of the present invention, the present invention provides a nucleic acid molecule encoding the above-described Cytokine-bipodal peptide binder.

According to another aspect of the present invention, the present invention provides a vector for expression of a Cytokine-bipodal peptide binder comprising a nucleic acid molecule encoding a Cytokine-bipodal peptide binder.

According to another aspect of the present invention, the present invention provides a transformant comprising a vector for expression of a Cytokine-bipodal peptide binder.

As used herein, the term “nucleic acid molecule” is meant to encompass DNA (gDNA and cDNA) and RNA molecules inclusively, and the nucleotides, which are the basic structural units in nucleic acid molecules, are naturally modified nucleotides, as well as modified sugar or base sites. Analogues (Scheit, Nucleotide Analogs,

John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews,

90: 543-584 (1990).

According to a preferred embodiment of the present invention, the vector of the present invention is a powerful promoter capable of transferring transcription to the nucleic acid molecule in addition to the nucleic acid molecule encoding the Cytokine-bipodal peptide binder (e.g., tac promoter, lac promoter, 7adJV5 promoter , Ipp promoter, ¾ ^λ promoter, p _R ^x promoter, rad promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.), ribosomal binding site and transcription / detox termination sequence for initiation of translation Include.

According to a preferred embodiment of the invention, the vector of the invention is a signal on the 5'-direction of the nucleic acid molecule encoding the Cytokine-bipodal peptide binder. Sequences (eg, pelB) may be further included. In addition, according to a preferred embodiment of the present invention, the vector of the present invention further comprises a tagging sequence (eg, myc tag) for confirming that the bipodal peptide binder is well expressed on the surface of the phage.

According to a preferred embodiment of the invention, the vector of the invention comprises a gene encoding a phage coat protein, preferably a gene of filamentous phage such as M13 or a gene VI coat protein. According to a preferred embodiment of the invention, the vector of the invention is the origin of replication of bacteria (e.g.

ColEl) and / or origin of replication of bacteriophage. On the other hand, the vector of the present invention may include antibiotic resistance genes commonly used in the art as a selection marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neo Resistance genes for mycin and tetracycline.

The transformants of the present invention are preferably Gram-negative bacterial cells such as E. coli, and suitable E. coli hosts include JM101, E. coli K12 strain 294 _; E. coli strain W3110 and E. coli XL-lBlue (Stratagene), including but not limited to: The method of carrying the vector of the present invention into a host cell includes the CaCl ₂ method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9: 2110-2114 (1973)), one method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9: 2110-2114 (1973); and Hanahan, D., J. Mol. Biol., 166: 557-580 (1983)) and electroporation methods (US Pat. Nos. 5,186,800, 5,422,272, 5,750,373) and the like.

Cytokine-bipodal peptide binders of the present invention exhibit very low levels (e.g., nM levels) of ¾ values (dissociation constants), providing peptides that exhibit very high affinity to Cytokine molecules. As described in the Examples below, bipodal peptide binders exhibit about 10 ² -10 ⁵ times (preferably about 10 ³ -10 ⁴ times) high affinity compared to binders made in a monopodal manner. The Cytokine-bipodal peptide binder of the present invention not only has a use as a medicament, but also detects substances in vivo, in vivo molecular imaging, phosphorus It can be used to target cell imaging and drug delivery in vitro, and can also be used as an escort molecule.

In summary, the features and advantages of the present invention are as follows:

(i) The present invention provides Cytokine-BPB that specifically binds to Cytokine.

(ii) In the Cytokine-bipodal peptide binder of the present invention, two distant Cytokine-target binding sites bound to both ends of the structural stability site are cooperatively and synergistically. ) To the target.

(iii) The Cytokine-bipodal peptide binders of the present invention thus exhibit very low levels (eg, nM levels) of K _D values (dissociation constants), resulting in very high affinity to the target.

(iv) Cytokine-BPB of the present invention can transport various substances into cell surface or cells based on Cytokine binding and specificity.

[Brief Description of Drawings]

La shows a schematic diagram of a bipodal-peptide binder and Cytokine—BPB including β-hairpin as a structural stabilization site.

Lb shows a schematic diagram of Cytokine-BPB containing β-sheets linked by linkers as structural stabilization sites.

Figure lc shows a schematic of Cytokine-BPB containing leucine zippers linked by linkers as structural stabilization sites.

FIG. ID shows a schematic of Cytokine-BPB comprising leucine-rich motifs linked by linkers as structural stabilization sites, FIG. 2 shows a strategy for cloning Cytokine-BPB libraries. In the IGT2 pyrimid vector map, the pelB signal sequence, myc tag, is a tagging sequence to confirm that the target gene is well expressed on the surface of the phage. The lac promoter was used as a promoter.

Figure 3 shows the results of TNF- a cytotoxic inhibition assay of TNFa-BPB. Figure 4a is a result of measuring the affinity of a specific bipodal peptide binder that binds to the pyronectin ED-B protein.

Figure 4b is the result of measuring the affinity for the demonstration of the synergistic effect of the bipodal peptide binder BPB.

5 is a result of measuring the affinity of the bipodal peptide binder by replacing the structural stabilization site in the bipodal peptide binder with various β-hairpin motifs instead of tryptophan zipper.

6 is a result of measuring the affinity of the bipodal peptide binder by replacing the structural stabilization site with leucine zipper instead of tryptophan zipper in the bipodal peptide binder.

FIG. 7 shows biopanning results for VEGF proteins performed to select bipodal peptide binders specific for VEGF.

8 is a result of measuring the specificity of a specific bipodal peptide binder that binds to VEGF. a) BPBIVEGF b) BPB2 _VEGF C) BPB3 _VEG F d) BPB4vE _GF

Figure 9 shows in cells of specific bipodal peptide binders that bind VEGF.

It is the result of measuring the degree of inhibition of VEGF activity.

EXAMPLE

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it is to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. Will be self-evident. EXAMPLE

Experimental Materials and Methods

Example 1: Construction of the Library

Bipodal Peptide Binder Gene Production and Insertion into Phagemid Vectors

Two oligonucleotides Beta-Fl (5'-TTCTATGCGGCCCAGCTGGCC

(NK) ₆ GGATCTTGGACATGGGAAAACGGAAAA-3 ') and Beta-Bl (5'- AACAGTTTCTGCGGCCGCTCCTCC Τ00 (ΜΝΝ) ₆ Τ000ΤΤ00ΑΤ6Τ00ΑΤΤΤΤ000π-3 ') (N is A, T, G or C; K is G or T; M is C or A). Beta-Fl 4 μΜ, Beta-Bl 4 μΜ, 2.5 mM dNTP mixture 4 ≠, ExTaq DNA polymerase 1 ^ (Takara, Seoul, Korea) and 5 μΚ of 10XPCR buffer to make a double chain, total 50 ^ A total of 25 mixtures with distilled water were made. It is a common hapaek PCR reaction: After creating (5 minutes at 94 ^° C, 60 cycles at 30 ^° C 30 seconds, at 72 ^° from the C 30 sec and 72 ^° C 7 minutes) to the double-stranded PCR purification kit (GeneAll , Seoul, Korea) to obtain a bipodal peptide binder gene. In order to connect the gene to be inserted into the bipodal peptide binder to the pIGT2 phagemid vector (Ig therapy, Chuncheon, Korea), the restriction gene was treated to the insert gene and the pIGT2 phagemid vector. Approximately 11 // g of insert DNA was reacted with S / 7 / (New England Biolabs (NEB, Ipswich) and /? / (ΝΕΒ, Ipswich) for 4 hours and purified using a PCR purification kit. The piGT2 phagemid vector of about 40 j¾g was reacted with sni and Notl for 4 hours, and then added with CIAP Calf Intestinal Alkaline Phosphatase (NEB, Ipswich) for 1 hour, and then purified using a PCR purification kit. These were quantified by UV-Vis spectroscopy (Ultrospec 2100pro, Amersham Bioscience) to 2.9 insert genes using T4 DNA ligase (Bioneer, Dae j eon, Korea) for 15 hours at pIGT2 phagemid vector 12 / and 18 ^° C. After connecting, precipitated with ethanol to lyse TE buffer 100 i — DNA. Preparation of Competent Cells

E. coli XL1-BLUE cells (American Type Culture Collection, Manassas, USA) were plated on LB agar-plates. After the inoculating colonies grown in an agar plate medium in LB medium with 5 heunhap at 37 ^° C at a rate of 200 rpm and incubated for one day. Cultured 10 cells were inoculated in 2 LB medium and incubated in the same manner until the absorbance was 0.3-0.4 at a wavelength of 600 nm. The incubated flask was left on ice for 30 minutes, then centrifuged at 4.000 × g for 20 minutes at 4 ^° C. to remove all supernatants except the sunk cells and suspended in 1 sterile sterile distilled water. This again Centrifuge in the same manner, remove the supernatant, resuspend in 1 «sterile sterile distilled water, repeat centrifugation with 10% glycerol solution 40 in the same manner, and finally 10% glycerol to solution 4 After suspension, the solution was dispensed by 200 ^, stirred in liquid nitrogen, and stored at -80 ^° C. Electroporation method

Electroporation was performed by dispensing 25 // 100 of phagemid vector 12 and 100 / ^ reacted with insert 2.9 fig of insert DNA on a bipodal peptide binder. The competent cells were dissolved on ice, mixed with 200 ^ of competent cells and mixed with a solution 4 ^, and then placed in a cooled 0.2 cm cuvette and placed on ice for 1 minute. An electroporator (BioRad, Hercules, CA) was programmed at 200 Ω at 25 uF and 2.5 kV, drained the prepared cuvettes, placed in the electroporator and pulsed (time constant is 4.5-5 msec). Thereafter immediately placed in 1 LB medium containing 20 mM glucose prepared ^at 37 ^° C. A total of 25 cells obtained were transferred to a 100 ml test tube. After incubation at 200 rpm at 37 ^° C. for one hour, the cells were incubated with 10 χ dilution to measure the number of libraries and plated in ampicillin agar medium. The remaining cells in 1 LB of 20 mM glucose and 50 / / ι Ampicillin was added and incubated for one day at 30 ^° C. After centrifugation at 4 ^° C. at 4,000 × g for 20 minutes, the supernatant except for the precipitated cells was removed, resuspended in LB of 40 1 and glycerol was added at a final concentration of 20% or higher and stored at -80 ^° C. . Recombinant Phage Production and PEG Precipitation in Libraries

Recombinant phage was produced in a bipodal peptide binder library stored ^at -80 ^° C. Ampicillin (50 β / ιηί) and 20 mM glucose were added to a 100 1 LB medium in 500 flasks, and then library 1 stored at -80 ^° C was added at a rate of 150 rpm at 37 ^° C for one hour. Incubation was carried out in combination. Ex helper phage (Ig therapy, Chuncheon, Korea) of lxiO ^ pfu was added thereto and incubated under the same conditions for one hour. The supernatant was removed by centrifugation at 1,000 × g for 10 minutes and 100 LB medium containing ampicillin (50 g / mi) and kanamycin (25 «g /) was incubated for one day to produce recombinant phage. . The supernatant obtained by centrifuging the culture solution at 3,000Xg for 10 minutes was mixed with PEG / NaCl 25 ^ and left on ice for 1 hour, and then centrifuged at 10, 000 X g for 20 minutes at 4 ° C. The solution was carefully removed and the pellet resuspended in 2 PBS (pH 7'4). Example 2: Preparation of Protein

Human and Mouse TNFa Gene Production and Insertion into Expression Vectors

We received human and mouse TNFa gene from Korea Biotechnology Research Institute. Two primers, 5'-AATAAAACATATGCTCAGATCATCTTCTC-3 '(mTNF_F: L) and 5'-AT GGATCCCAGAGCAATGACTCC-3' (mTNF_Bl), were synthesized to synthesize mTNF-Fl 20 pmol, mTNF-Bl 20 pmol, 2.5mM dNTP mixture 4μ 1, Ex Taq DNA polymerase 1μ 1 (10 U) and 10 PCR buffer 5μ 1 were mixed and distilled water was added to make a total solution of 50μ 1. This mixture was prepared by mTNFa insert by PCR reaction (94 5 min, 30 cycle: 55 ° C 30 sec and 72 ⁰ C 1 min, 94 ⁰ C 30 sec) and purified using a PCR purification kit. In order to link the mTNFa Insert gene to the pET28b vector, restriction enzyme treatment was performed on the mTNFa Insert gene and the pET28b vector. About 2yg's Insert DNA BamHI

After 4 hours of reaction with (NEB) and 7½fc / (NEB), the reaction was purified using a PCR purification kit, and about 2 ug of pET28b vector was reacted with BamHI (NEB) and Λ¾ / (ΝΕΒ) for 3 hours and then calf Intestinal Alkaline Phosphatase (CIP) was reacted for 1 hour and purified using a PCR purification kit. These were linked to a molar ratio vector: Insert = l: 3 using T4 DNA ligase (Bioneer) at 18 ° C for 10 hours, transformed into XL-1 competent cells, and plated on kanamycine agar. Colonies grown on agar plate medium were inoculated into 5 ml of LB medium, incubated at 37 rpm at 200 rpm for one day, and then purified by plasmid preparation using a plasmid preparation kit for sequencing. Check for success. Human TNFa was also inserted into the pET28b vector in the same manner.

TNFa Expression and Purification

The pET28b vector cloned with TNF-a was transformed into BL21 cells and plated in kanamycine agar medium. Colonies grown on agar plate medium were inoculated in 5ml LB medium containing kanamycine (25ug / ml), incubated at 37 rpm for 200 rpm, and then transferred to 50ml kanamycine (25ug / ml) LB medium. Raised 3 hours. E. coli grown in 2L LB kanamycine (25ug / ml) and 50ml E. coli was added to 0D = 0.6-0.8. ImM i sopr opy 1 -β -Dt hi oga 1 ac t opyr anos i de (I PTG) ¾ · was added and mixed at 37 ⁰ C at 200 rpm for 8 hours. Centrifugation was performed at 4,000 g for 20 minutes to remove all supernatants except the sunk cells and resuspended in lysis buffer (50 mM sodium phosphate (pH 8.0), 300 mM NaCl and 5 mM imidazole) at -80 ° C. After storage for 1 day, dissolve E. coli using Sonicator, and remove 1 g of raw ginseng for 1 hour and attach the supernatant to Ni-NTA affinity resin. After washing the resin with Lysis buffer, N-terminal His-tag TNFa protein was collected using Elution buffer (50 mM sodium phosphate (pH 8.0), 300 mM NaCl and 300 mM imidazole). The protein thus collected is subjected to gel filtration using a superdex75 column and PBS (pH7.4) buffer to collect high purity TNFa protein, Example 3: Bio panning

Biopanning was performed for TNF-α as a representative protein of cytokine. In addition, Fibronectin ED-B was selected as a model protein for confirming the basic function of ΒΡΒ and biopanning was also performed.

Biopanning was performed on the BPB (Bipodal-peptide binder) library prepared in Example 1 for each protein at five times, and The output phage / input phage ratio of the phage peptides recovered in the panning step was determined.

The protein (5 / g /) was placed in 10 wells of 96 well ELISA folate (50 ^), and then allowed to stand overnight at 4 ^° C., and blocked for 2 hours at room temperature using 2% BSA the next day. After that, the solution was discarded and washed three times with 0.1% PBST. The bipodal peptide binder recombinant phage containing solution 800 ≠ and 10% BSA 200 ^ were mixed, transferred to 10 wells bound to the GPR 39 protein, and allowed to stand at room temperature for 1 hour. Remove all 10 wells, wash 10 times with 0.1¾> PBST, elute phage for 20 min with 0.2 M glycine / HCKpH 2.2) 1 ^ per well for 50 min, collect 1 into tube, and add 2M Tris- base (pH 9.0) 150. ^ was added to neutralize the solution. Each biopanning was mixed with XL-1 BLUE cells with 0D = 0.7 in order to determine the number of input phages and eluent phages and plated in agar medium containing ampicillin. In order to repeat panning, the cells were mixed with 10 Ε · coli XL1-BLUE cells and incubated at 37 ^° C for 1 hour at 200 rpm. Ampicillin (50 βg / mi) and 20 mM and then the combined common glucose, Ex helper phage was added to the 2 i0 ¹⁰ pfu by heunhap at a rate of 200 rpm for one hour at 37 ^° C, and were cultured. After centrifugation of the culture broth at l, 000Xg for 10 minutes, the supernatant was removed and the precipitated cells were resuspended in 40 LB liquid medium containing ampicillin (50 g / mi) and kanamycin (25) at 30 ^° C.

The mixture was incubated for one day at a speed of 200 rpm. Cultures were centrifuged at 4,000><g, 20 min and 4 ^° C. To the supernatant was added 8 m £ of 5x PEG / NaCl [20% PEG (w / v) and 15% NaCl (w / v)] and then left at 4 ^° C. for 1 hour. After centrifugation, the PEG solution was completely removed and the phage peptide pellets were dissolved in 1 PBS solution and used for the second biopanning. The same method was used for each panning step, but the washing process was increased 20 times and 30 times (0.1% PBST), respectively, step by step. Example 4: Phage Peptide Search Specific for T F-α or Fibronectin ED—B (Phase ELISA) Phages recovered at the biopanning stage with the highest output phage / input phage ratio were infected with XL1-BLUE cells and plated at about 100-200 plaques per folate. 60 plaques were inoculated into a 2 1 ^ LB-ampicillin (50 jg /) medium using a sterile tip and shaken incubated at 37 ° C for 5 hours to exert 5X10 ⁹ pfu of ex helper phage at 0D = 0.8-1. The mixture was incubated at 37 ° C for 1 hour at a speed of 200 rpm. The culture was centrifuged at l, 000Xg for 10 minutes, then the supernatant was removed and the precipitated cells were resuspended in 1 LB liquid medium containing ampicillin (50 g / mt) and kanamycin (25 «g / mO). The mixture was incubated for one day at a speed of 200 rpm at ° C. The culture solution was centrifuged at 10,000 × g, 20 minutes and 4 ° C. to recover the supernatant, and then skim milk was added and used for phage peptide search. In a 96 well ELISA plate, add 5 «g / m of GPR 39 or Fibronectin ED-B to 30 wells at 50 ^ per well, and 10 // g / m £ BSA to 30 wells at 50 each well. And left for 4 days at 4 ° C. The next day all wells were washed three times with 0.1% PBST and blocked for 2 hours at room temperature using 2% skim milk diluted with PBS, then discarded all solutions and 0,1% Washed three times with PBST 100 ^ each phage peptide solution amplified for each clone All wells were dispensed and left for 1 hour and 30 minutes at 27 ° C. 5 washes with 0,1% PBST solution followed by dilution of HRP-conjugate anti-M13 antibody (GE Healthcare) 1: 1,000 to 271 ： The reaction was stopped for 5 hours with 0.1% PBST, followed by dispensing 100 μί of TMB solution to induce color reaction, and then stopping reaction by adding 1 M HC1 of 100. BSA was measured at 450 nm. Clones with high absorbance were selected, compared to 100-200 plaques per plate after infecting their phage with XL1 cells, using a sterile tip to plaque 4 LB-ampicillin (50 ^). g / m ^) was inoculated into the culture solution and shaken at 37 ° C. for one day to purify the plasmid using the plasmid flap kit (Genotech, Dae j eon, Korea). 5 '-GATTACG CCAAGC1TTGGAGC-3 'was used. Example 5: Binding Assays A bipodal peptide binder peptide specific to ED-B overlapped in DNA sequencing was synthesized (Anigen, Korea). Affinity was measured using BIAcore X (Biacore AB, Uppsala, Sweden). ED-B was immobilized with as much as 2,000 RU of Biotin-EDB on a Straptavidin SA chip (Biacore). PBS (pH 7.4) was used as the running buffer, and the flow was measured at various concentrations at 30 μί / min and the affinity was calculated using BIAevaluation software (Biacore AB, Uppsala, Sweden). Example 6: Cytotoxicity Inhibition of TNF-α

Cytotoxicity inhibition of TNF-a-BPP synthesized TNF-a was performed using L929 fibroblast, a TNF-a sensitive cell. After 10 ⁵ L929 cells were placed in a 96 well plate, after 12 hours, TNF-α and TNF-a-BPB were treated with 5 uM, and after 20 hours, MTT solution was used to measure the cytotoxicity. Experiment result

Example 7: Construction of Bipodal Peptide Binder Library

As the structure stabilization site of the bipodal peptide binder, a stable beta-hairpin motif was used. In particular, tryptophan zippers (Andrea et al., Proc. Natl. Acad. Sci. 98: 5578-5583 (2001)), which stabilize the beta-hairpin motif structure by the interaction of tryptophan-tryptophan amino acids, were used. Variable regions were created in two portions by randomly arranging six amino acids in each of the N- and C-terminal portions of the tryptophan zipper (FIG. La). This is called a bipodal peptide binder and has variable regions on both sides so that it can be cooperatively attached to the antigen and thus have high affinity and specificity. In addition, the structure stabilization site of the bipodal peptide binder may be configured in various ways as shown in FIGS.

Two random sequence oligonucleotides were synthesized into double chains by PCR, cut into restriction enzymes 5 // I and Not \, and cloned into pIGT2 phagemid vector to construct a library of ⁸ × 10 ⁸ or more (FIG. 2). . Example 8: Bio Panning Results

The bipodal peptide binder library was subjected to biopanning three to five times for fibronectin ED-B or TNF-α protein and the ratio of output phage / input phage of phage peptides recovered at each panning step was determined (Table la And lb).

[Table la ^]

Biopanning Results for Fibronectin ED-B Protein

[Table lb]

Biopanning Results for TNF-α Proteins

Example 9 Phage Peptide Search (Phase ELISA) Specific to the Target and Sequencing Phage recovered at the highest output / input ratio during the panning step of each library was obtained in plaque form. ELISA was performed on BSA after amplifying 60 phages from each plaque. Clones with higher absorbance than BSA were selected and requested for DNA sequencing. From this a peptide sequence specific to each overlapped protein was obtained (Table

2a and Table 2b).

Table 2a

Example 10 TNF-a Cytotoxicity Inhibition Experiment

Inhibition experiment of TNFa-BPB was performed using L929 cells, which are TNF-a sensitive cells. TNFa-BPB can be seen that 5 uM administered with TNF-a significantly inhibited athetosis (FIG. 3). Example 11: Determination of the affinity of fibronectin ED-B

The peptide for fibronectin ED-B was synthesized and affinity was measured using the SPR Biacore system (Biacore AB, Uppsala, Sweden). As a result of measuring affinity for fibronectin ED-B, peptide 1 showed 620 nM, peptide 2 showed 75 nM, and peptide 3 showed 2,5 μΜ (FIG. 4A). Example 12: Confirmation of the synergistic effect by SPRCSurface Plasmon Resonance In order to demonstrate the co-action effect on the antigen of the bipodal peptide binder, a peptide was obtained by synthesizing a peptide in which only one portion of the N- and C-terminus of the peptide 2 to ED-B of Table 2a having the best affinity was synthesized. The N-terminal portion had 592 μΜ and the C-terminal portion showed 12.8 μΜ (FIG. 4B). The synergistic effect exhibited by having bipodal in the bipodal peptide binder proved to be an affinity of 43 nM (FIG. 4A). Example 13: Binding Assays for Other β-Hairpins

In addition to tryptophan zippers, peptides were synthesized to have N-terminal sequences (HCSSAV) and C-terminal sequences (IIRLEQ) of Peptide2 that specifically bind ED-B to other β-hairpin backbones, GBlm3 and HP7 (Anigen). , Korea). That is, the sequence of the bipodal peptide binder including tryptophan zipper is HCSSAVGSWTWENGK T KGI IRLEQ, the bipodal peptide binder including GBlm3 is HCSSAVG KWTYNPATGKFTVQEGnRLEQ, and the bipodal peptide binder including HP7 is HCSSAVGKTWNPA GKWTEGIQ. The affinity of each peptide was measured using BIAcore X (Biacore AB, Uppsala, Sweden). Biotin-EDB was flowed onto the straptavidin SA chip (Biacore AB, Uppsala, Sweden) by 2,000 RU and fixed. PBS (pH 7.4) was used as the running buffer, and the flow was measured at various concentrations while the flow was held at 30 μί / min and the affinity was calculated by BIAevaluation. As a result of measuring the affinity, it was confirmed that GBlm3 had affinity similar to tryptophan zipper (43 nM) with 70 nM and HP7 with 84 nM (FIG. 5). This is the result demonstrating that all stable β-hairpin motifs are possible as structure stabilization sites. Example 14 Binding Assay for Bipodal Peptide Binders Comprising a Leucine Zipper as Structural Stabilization Site

In addition to the β-hairpin backbone, it has the N-terminal sequence 0 peptide: 53) and C-terminal sequence (IIRLEQ) of peptide 2 that specifically binds ED-B to the leucine zipper as a structural stabilization site. IRLEQGGSMKQLEDKVEELLSK YHLENEVARLKKLVGER peptide was synthesized (Anigen, Korea). The two peptides were dimerized and then BIAcore X (Biacore AB, Affinity was measured using Uppsala, Sweden). As a result of measuring affinity, the leucine zipper showed an affinity of 5 μΜ, which is lower than the similar affinity of tryptophan zipper (43 ηΜ), while leucine zipper also functions as a structural stabilizing site for bipodal peptide binders. It can be seen that (FIG. 6).

Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that the specific technology is merely a preferred embodiment, and the scope of the present invention is not limited thereto. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof. Example 15 ΒΡΒ Specific for Cytokine VEGF121

Expression and Purification of VEGF121

PET32a vector (Novagen) cloned from VEGF121 was transformed into AD494 cells and plated in agar medium containing ampicillin. After culture for one day while heunhap then inoculated with the colonies grown on the agar plate medium on LB medium ampicillin (25 / g / m £) the Domain include at 37 ^° C at a rate of 200 rpm, ampicillin (25 zg / ni £) containing 50 LB medium and incubated for 3 hours. The cultured E. coli was inoculated in LB of ampicillin (2 containing 25 and incubated to OD = 0.6-0.8. Then, 1 mM isopropyl-β-D-kiogallactopyranoside (IPTG) was added 37 Incubate for 8 hours, mixing at 200 rpm at ^° C. Centrifugation at 4,000 × g for 20 minutes to remove all supernatants except precipitated cells, Lysis buffer (50 mM sodium phosphate, pH 8.0), 300 mM NaCl and 5 mM imidazole), stored at −80 ^° C. for one day, and then dissolved in E. coli using a sonicator, followed by centrifugation at 15,000 × g for 1 hour. Bind to NTA affinity resin (Elpisbio, Dae j eon, Korea) Wash the resin with Lysis buffer and then use the Illution buffer (50 mM sodium phosphate (pH 8.0), 300 mM NaCl and 300 mM imidazole) Obtained by eluting the Trx-VEGF121 protein. Vaginal filtration of gels using a Superdex75 column (GE Healthcare, United Kingdom) and PBS (pH 7.4) buffer filtration) to obtain high purity VEGF-Trx protein. To obtain pure VEGF, VEGF 121 was obtained by cutting between VEGF and Trx (thioredoxin reductase) with thrombin. Bio panning method of VEGF

Purified VEGF (5 / zg /) was added to 10 wells of 96 well ELISA plate (Corning), and then allowed to stand overnight at 4 ^° C., and then blocked for 2 hours at room temperature using 2% BSA the next day. After that, the solution was discarded and washed three times with 0.1% PBST. The bipodal peptide binder recombinant phage containing solution 800 μ 免 and 10% BSA 200 ^ were mixed and transferred to 10 wells in which VEGF was bound and left at room temperature for 1 hour. Remove all 10 wells, wash 10 times with 0.1% PBST, add 0.2 M glycine / HCKpH 2.2) 1 to each well and elute the phage for 20 minutes, collect 1 into the tube and add 2M Tris-base ( pH 9.0) 150 ^ was added to neutralize the solution. Each biopanning was mixed with XL-1 BLUE cells with 0D = 0.7 to measure the number of input phages and elution phages and plated in agar medium containing ampicillin. To repeat panning, 10 m £ of E. coli XL1-BLUE cells were mixed and incubated at 37 ^° C for 1 hour at 200 rpm. Ampicillin (50 g / ml) and 20 mM and then the combined common glucose, Ex helper phage was added to the 2X10 ¹⁰ pfu by heunhap at a rate of 200 rpm for one hour at 37 ^° C, and were cultured. After centrifugation of the culture solution at 10,000 × g for 10 minutes, the supernatant was removed and the precipitated cells were resuspended in 40 LB liquid medium containing ampicillin (50 βg / mi) and kanamycin (25 ^ g /) at 30 ^° C. The mixture was incubated at C at 200 rpm for one day. Cultures were centrifuged at 4,000 × g, 20 min and 4 ^° C. 8 ^ of 5x PEG / NaCl [20% PEG (w / v) and 15% NaCl (w / v)] was added to the supernatant and allowed to stand at 4 ^° C. for 1 hour. The phage peptide pellet was removed and dissolved in 1 PBS solution and used for secondary biopanning. The same method was used for each panning step, and the washing process was increased 20 times and 30 times (0.1% PBST), respectively, step by step. Establishment of Specificity of VEGF-Specific Bipodalpeptide Binders

Recombinant phage that specifically binds to VEGF protein was tested for specificity using ELISA. In a 96-well ELISA plate, each protein was placed in a well of 5 5 50 ^, washed three times with 0.1¾ PBST (Tween-20) the next day and blocked for 2 hours at room temperature using 2% BSA. Discard all and wash three times with 0.1% PBST. Recombinant phage with peptides of the present invention were well mixed with 2% BSA and dispensed into wells containing 10 proteins bound by 100 ^ for 2 hours at 27 ^° C. It was political. After washing 5 times with 0.1% PBST solution, HRP-conjugated anti-M13 antibody (GE Healthcare) was diluted 1: 1,000 and reacted for 1 hour at 27 ^° C. After washing 5 times with 0.1% PBST, TMB solution 100 ^ was dispensed to induce color reaction, and then 1M HC1 100 was added to stop reaction and absorbance was measured at 450 nm. Affinity Measurement of VEGF-specific Bipodalpeptide Binders

A bipodal peptide binder peptide specific to VEGF overlapped in DNA sequencing was synthesized (Anigen, Korea). Affinity was measured using BIAcore XCBiacore AB, Uppsala, Sweden). VEGF was fixed to CM5 chip (Biacore) using EDC / NHS. PBS (pH 7.4) was used as the running buffer, and the flow was measured at various concentrations while holding at 30 ^ per minute, and the affinity was calculated using BIAevaluation software (Biacore AB, Uppsala, Sweden).

VEGF activity inhibition test (HUVEC proliferation assay) 1% of HUVEC cells (Human Umbilical Vein Endothelial Cell, ATCC)

Starvation in M199 medium (Gibco) with FBS was followed by attachment of 5000 cells per well to 96-well plates. After 12 hours, the cells were simultaneously treated with medium containing various concentrations of BPBIVEGF, BPB2VEGF, BPB3VEGF, BPB½GF and 20ng / ml of VEGF ₁₆₅ (R & D Systems), and then after 72 hours, EZ- to measure the growth of cells. cytox cell viability analysis The kit (Daeil Labservice, South Korea) was used to measure how much inhibition of the growth of HUVEC cells. Bio Panning Results

The bipodal peptide binder library was subjected to biopanning four times for VEGF and the ratio of output phage / input phage of phage peptides recovered in each panning step was determined (FIG. 7). Target specific phage peptide search (phage ELISA) and sequence

Panning Stages of Each Library The phages recovered at the stage with the highest output / input ratio were obtained in plaque form. ELISA was performed on BSA after amplifying 60 phages from each plaque. Clones with higher absorbance than BSA were selected to request DNA sequencing. From this a peptide sequence specific to each overlapped protein was obtained (Table 3).

Table 3

Measurement of affinity for VEGF

The peptide for VEGF was synthesized and affinity was measured using SPR Biacore system (CBiacore AB, Uppsala, Sweden). The affinity for VEGF is as follows (Table 4). Table 4

Target BPB name k _a [M ^'x s ^"1 ] ^ [s ^_1 ] K _d [M]

VEGF121 BPB 1 VEGF 3.2 x 10 ⁵ 1.9 x ΚΓ ² 60 x 10— ⁹

VEGF121 BPB2 醫 1.2 x 10 ⁵ 1.1 x 10— ² 90 x 10_ ⁹

VEGF121 BPB3VEGF 4.0 x 10 ⁴ 6.1 x ΚΓ ³ 154 x 10

VEGF _m BPB4 VEGF 3.5 x 10 ⁴ 1.1 x 10 ^"2 326 x 10

Specificity Analysis for VEGF

As can be seen in Figure 8, it can be seen that each BPB specific for VEGF has specificity for VEGF.

VEGF activity inhibition test (HUVEC growth assay)

HUVEC proliferation assay was attempted to determine whether BPBVEGF can inhibit VEGF activity in HUVEC cells. VEGF is a growth hormone that promotes the growth of epithelial cells. Blocking it can inhibit the growth of epithelial cells. As can be seen in Figure 9, when treated with 20 μΜ, 10 μΜ and 5 μΜ BPBVEGF completely inhibited the activity of VEGF at 20 μΜ. Among them, BPB3VEGF had the best IC ₅₀ activity of 5 μΜ. The specific parts of the present invention have been described in detail, and for those skilled in the art, these specific technologies are merely preferred embodiments, and the scope of the present invention is not limited thereto. It is obvious. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents.

Claims

[Range of request]

[Claim 1]

Method for preparing Cytokine-bipodal peptide binder (Cytokine-BPB) that specifically binds to a cytokine target comprising the following steps:

(a) (i) a structure stabilizing region comprising parallel, antiparallel or parallel and antiparallel amino acid strands on which interstrand noncovalent bonds are formed ; (ii) a Cytokine-target binding region KCytokine-target binding region I) and a Cytokine-target binding region Π (Cytokine-target binding site), each of which binds to both ends of the structural stabilization site and comprises randomly selected n and m amino acids, respectively. providing a library of Cytokine-bipodal peptide binders (Cytokine-BPB) comprising a binding region Π);

(b) contacting said library with Cytokine as a target; And,

(c) selecting a Cytokine-bipodal peptide binder (Cytokine-BPB) bound to the Cytokine. [Claim 2]

The non-covalent bond between the strands formed at the structural stabilization site is hydrogen bond, electrostatic interaction, hydrophobic interaction, van der Waals interaction, pi-pi interaction, cation-pi interaction or their Method characterized in that the combination.

[Claim 3] ^"

The method of claim 1 wherein the amino acid strands of the structural stabilization site are linked by a linker. [Claim 4] The method of claim 1, wherein the structural stabilization site is characterized in that β-hairpin, β-sheet linked by a linker, leucine zipper, leucine zipper linked by a linker, leucine rich motif or leucine rich motif linked by a linker Method, [claim 5]

The method of claim 4, wherein the structural stabilization site is β-hairpin.

[Claim 6]

6. The method of claim 5, wherein the β_hairpin comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 1 to 19 sequences.

[Claim 7]

7. The method of claim 6, wherein the β-hairpin comprises an amino acid sequence selected from SEQ ID NO: 2, 14 or 18 sequence.

[Claim 8]

The method of claim 5, wherein the -hairpin is represented by the following general formula I:

Formula I

X ₁ -Trp (X ₂ ) X ₃ -X4-X5 (X ^, 2) ¾-X7

¾ is Ser or Gly-Glu, ¾ and X ' ₂ are independently of each other Thr, His, Val, lie, Phe or Tyr, ¾ is Trp or Tyr, X4 is Type I, Type Γ, Type Π, Type Π ′ or type m or type ΠΓ turn sequence, ¾ is Trp or Phe, ¾ is Trp or Val, and X ₇ is Lys or Thr-Glu.

[Claim 9]

The method of claim 5, wherein the β_hairpin is represented by the following general formula Π: Formula Π

X 厂 Trp-X ₂ -Tyr-¾-Phe-Thr-Va 1-

¾ is Arg, Gly-Glu or Lys-Lys, X ₂ is Gin or Thr, ¾ is type I, type 1 ', type Π, type Π' or type ΙΠ or type ΠΓ turn sequence, ¾ is Gin, Thr-Glu or Gln-Glu.

[Claim 10]

The method of claim 5, wherein the β-hairpin is represented by the following general formula m:

General formula m

X ₁ -X ₂ -X3-Trp-X4-X5-Thr-X ₆ -X7

Xi is Lys or Lys-Lys, X ₂ is Trp or Tyr, ¾ is Val or Thr, X4 is type I, type Γ, type Π, type Π 'or type m or type ΠΓ turn sequence, ¾ is Trp or Ala, ¾ is Trp or Val, and X ₇ is Glu or Gln-Glu.

I ： Claim 11

The method of claim 5, wherein the β-hairpin is represented by the following general formula IV:

Formula IV

-X ₁ -X ₂ -X3-Trp-X ₄

¾ is Lys-Thr or Gly, ¾ is Trp or Tyr, ¾ is type I, type 1 ', type Π, type Π' or type ΠΙ or type ΠΓ turn sequence, and X4 is Thr— Glu or Gly.

[Claim 12]

According to claim 8, wherein the β-hairpin in the general formula I ¾ is Ser or Gly-Glu, ¾ and X'2 are independently of each other Thr, His or Val, ¾ is Trp or Tyr, X4 is Type I, type Γ, type Π or type Π 'sequence, ¾ is Trp or Phe, ¾ is Trp or Val, and X ₇ is Lys or Thr-Glu. [Claim 13]

The method of claim 1, wherein the amino acid number n of the Cytokine-target binding site I is 2-20. [Claim 14]

The method of claim 1, wherein the amino acid number m of the Cytokine-target binding site Π is 2-20.

[Claim 15]

The method of claim 1, wherein the library is made of plasmid, bacteriophage, phagemid, yeast or bacteria.

The method of claim 1, wherein the Cytokine-target binding site I and the Cytokine-target binding site Π cooperatively bind to Cytokine.

[Claim 17]

According to claim 1, wherein the structural stabilization site, Cytokine-target binding site

A method characterized in that a functional molecule is additionally bound to I or a Cytokine-target binding site Π.

[Claim 18]

18. The method of claim 17, wherein the functional molecule is a label, chemical, biopharmaceutical, cell transmembrane peptide (CPP) or nanomipza that generates a detectable signal.

[Claim 19]

(a) parallel, antiparallel or parallel with interstrand noncovalent bonds; Structure stabilizing region comprising antiparallel amino acid strands; and

(b) Cytokine-target binding region KCytokine-target binding region I) and Cytokine-target binding region II (Cytokine-target binding site), each of which binds to both ends of the structural stabilization site and comprises randomly selected n and m amino acids, respectively. Cytokine-bipodal peptide binder that specifically binds to Cytokine including binding region Π).

[Claim 20]

The method of claim 19, wherein the non-covalent bond between the strands formed in the structure stabilizing region is a hydrogen bond, an electrostatic interaction hydrophobic interaction, van der Waals interactions, pi-in pi interaction or a combination thereof pi-interaction _yae cation Cytokine-bipodal peptide binder, characterized in that. [Claim 21]

20. The Cytokine-bipodal peptide binder according to claim 19, wherein the amino acid strands of the structural stabilization site are linked by a linker.

[Claim 22]

20. The Cytokine-bipodal peptide binder according to claim 19, wherein the structural stabilization sites are β-hairpins, β-sheets linked by linkers, leucine zippers, or leucine zippers linked by linkers, and leucine rich motifs.

[Claim 23]

20. The Cytokine-bipodal peptide binder according to claim 19, wherein the structural stabilization site is β-hairpin.

[Claim 24]

24. The Cytokine-bipodal peptide binder according to claim 23, wherein the β-hairpin is selected from the group consisting of SEQ ID NO: 1 to 19 sequences. [Claim 25]

The Cytokine-bipodal peptide binder according to claim 24, wherein the -hairpin is selected from SEQ ID NO: 2, 14 or 18 sequence.

[Claim 26]

24. The Cytokine-bipodal peptide binder according to claim 23, wherein the β-hairpin is represented by the following general formula:

Formula I

Χι-ΤΓρ (Χ2) Χ3-Χ4-Χ5 (Χ'2) Χ6-Χ7

¾ is Ser or Gly-Glu, X ₂ and X ' ₂ are independently of each other Thr, His, Val, lie, Phe or Tyr, ¾ is Trp or Tyr and X4 is Type I, type. Γ, type Π, type Π 'or type m or type ΠΓ turn sequence, ¾ is Trp or Phe, ¾ is Trp or Val, and X ₇ is Lys or Thr-Glu.

[Claim 27]

Formula Π

Xi-Trp-X ₂ -Tyr-¾-Phe-Thr-Va 1 -X4

¾ is Arg, Gly-Glu or Lys-Lys, X ₂ is Gin or Thr, ¾ is type I, type I ', type Π, type Π' or type ΠΙ or type ΠΓ turn sequence, ¾ is Gin, Thr-Glu or Gln-Glu. [Claim 28]

24. The Cytokine-bipodal peptide binder according to claim 23, wherein the β-hairpin is represented by the following general formula m:

General formula m

Xi-X2-¾-Trp-X4-X ₅ -Thr-X ₆ -X ₇

¾ is Lys or Lys-Lys, ¾ is Trp or Tyr, ¾ is Val or

Thr and ¾ is type I, type 1 ', type Π, type Π' or type m or Type ΠΓ turn sequence, ¾ is Trp or Ala, ¾ is Trp or Val, and X ₇ is Glu or Gln-Glu.

[Claim 29]

24. The Cytokine-bipodal peptide binder according to claim 23, wherein the β-hairpin is represented by the following general formula IV:

Formula IV

X Xa-Xs-Trp ^

¾ is Lys-Thr or Gly, X ₂ is Trp or Tyr, ¾ is type I, type Γ, type π, type π 'or type m or type nr turn sequence,

¾ is Thr-Glu or Gly. [Claim 30]

The method according to claim 24, wherein the β-hairpin in Formula I ¾ is Ser or Gly-Ghi, ¾ and X'2 are independently of each other Thr, His or Val, ¾ is Trp or Tyr, X4 is A type I, type Γ, type Π or type Π 'sequence, ¾ is Trp or Phe, ¾ is Trp or Val, X ₇ is Lys or Thr-Glu, Cytokine-bipodal peptide binder. [Claim 31]

20. The Cytokine-bipodal peptide binder according to claim 19, wherein the amino acid number n of the Cytokine-target binding site I is 2-20.

[Claim 32]

20. The Cytokine-bipodal peptide binder according to claim 19, wherein the amino acid number m of the Cytokine-target binding site Π is 2-20.

[Claim 33]

20. The Cytokine-bipodal peptide binder according to claim 19, wherein the Cytokine-target binding site I and the Cytokine-target binding site Π cooperatively bind to Cytokine. [Claim 34]

20. The Cytokine-bipodal peptide binder according to claim 19, wherein a functional molecule is additionally bound to the structural stabilization site, Cytokine-target binding site I or Cytokine-target binding site I.

[Claim 35]

35. The Cytokine-bipodal peptide binder according to claim 34, wherein the functional molecule is a label, a chemical, a biopharmaceutical, a cell transmembrane peptide (CPP) or a nanoparticle that generates a detectable signal.

[Claim 36]

A nucleic acid molecule encoding the bipodal peptide binder of any one of claims 19 to 35.

[Claim 37]

A bipodal peptide binder comprising the nucleic acid molecule of claim 36 and an expression vector.