WO2011130566A2 - Method for treating solid tumors - Google Patents
Method for treating solid tumors Download PDFInfo
- Publication number
- WO2011130566A2 WO2011130566A2 PCT/US2011/032572 US2011032572W WO2011130566A2 WO 2011130566 A2 WO2011130566 A2 WO 2011130566A2 US 2011032572 W US2011032572 W US 2011032572W WO 2011130566 A2 WO2011130566 A2 WO 2011130566A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antigen
- subject
- nucleotide sequence
- multimeric ligand
- administering
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/337—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having four-membered rings, e.g. taxol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/711—Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/11—T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/19—Dendritic cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/20—Cellular immunotherapy characterised by the effect or the function of the cells
- A61K40/24—Antigen-presenting cells [APC]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/30—Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
- A61K40/34—Antigenic peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4274—Prostate associated antigens e.g. Prostate stem cell antigen [PSCA]; Prostate carcinoma tumor antigen [PCTA]; Prostatic acid phosphatase [PAP]; Prostate-specific G-protein-coupled receptor [PSGR]
- A61K40/4276—Prostate specific membrane antigen [PSMA]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/08—Drugs for disorders of the urinary system of the prostate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/31—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the route of administration
Definitions
- the technology relates generally to the field of immunology and relates in part to methods for treating a solid tumor in a subject in need thereof by inducing an immune response.
- the technology further relates in part to optimized therapeutic treatments of solid tumors.
- Antigen-presenting cells present foreign antigens to naive T cells, inducing a cytotoxic T lymphocyte response.
- Dendritic cells are effective antigen presenting cells, and activation of the cells often results in a high level expression of costimulatory and cytokine molecules.
- any immune response against the cells needs to have a long enough life span to be able to continually activate T cells.
- the antigen presenting cells need to be sufficiently activated, have sufficient migration to the lymph node, and have a lifespan that is long enough to activate T cells in the lymph node.
- Dendritic cells and other vaccines acting through antigen presenting cells have been tested for use as vaccines against prostate cancer, including, for example, Sipuleucel-T and Prostvac, but no statistically significant benefit in time to disease progression was found in treated subjects in randomized clinical trials evaluating either agent.
- An inducible CD40 (iCD40) system has been applied to human dendritic cells, and used to reduce tumor size in cancer patients. These features form the basis of cancer immunotherapies for treating or preventing such cancers as advanced, hormone-refractory prostate cancer, for example. Accordingly, it has been found that inducing CD40 in antigen presenting cells, and activating an antigenic response against a prostate cancer antigen, for example, a prostate specific membrane antigen (PSMA) provides an anti-tumor effect against not only prostate cancer associated tumors, but also other solid tumors by both direct effects and by targeting tumor vasculature. By inducing an immune response against prostate specific protein antigen, for example, a PSMA polypeptide, the size or growth of solid tumors may be reduced.
- a PSMA polypeptide provides an anti-tumor effect against not only prostate cancer associated tumors, but also other solid tumors by both direct effects and by targeting tumor vasculature.
- the therapeutic course of treatment may be monitored by determining the size and vascularity of tumors by various imaging modalities (e.g. CT, bonescan, MRI, PET scans, Trofex scans), by various standard blood biomarkers (e.g. PSA, Circulating Tumor Cells), or by serum levels of various inflammatory, hypoxic cytokines, or other factors in the treated patient.
- imaging modalities e.g. CT, bonescan, MRI, PET scans, Trofex scans
- standard blood biomarkers e.g. PSA, Circulating Tumor Cells
- serum levels of various inflammatory, hypoxic cytokines, or other factors in the treated patient e.g. PSA, Circulating Tumor Cells
- a transduced or transfected antigen presenting cell comprising administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with a prostate cancer antigen, such as, for example, a prostate specific protein antigen, for example, a prostate specific membrane antigen; and administering a multimeric ligand that binds to the multimeric ligand binding region, whereby the antigen presenting cell and ligand are administered in an amount effective to treat or prevent the prostate cancer in the subject.
- a prostate cancer antigen such as, for example, a prostate specific protein antigen, for example, a prostate
- a tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen
- administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen or a prostate specific membrane antigen; and administering an FK506 dimer or a dimeric FK506 analog ligand.
- a tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen or a prostate specific membrane anti
- Also featured in some embodiments are methods of reducing tumor size or inhibiting tumor growth in a subject, comprising inducing an immune response against a tumor antigen, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen in the subject.
- a tumor antigen for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen in the subject.
- the immune response is a cytotoxic T-lymphocyte immune response.
- the method comprises administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with an antigen, for example, a prostate specific membrane antigen; and administering a multimeric ligand that binds to the multimeric ligand binding region, whereby the antigen presenting cell and ligand are
- the subject has prostate cancer.
- the tumor is in the prostate.
- the tumor is in a lung, bone, liver, prostate, brain, breast, ovary, bowel, testes, colon, pancreas, kidney, bladder, neuroendocrine system, lymphatic system, or is a soft tissue sarcoma, glioblastoma, or malignant myeloma.
- the transduced or transfected antigen presenting cell is loaded with an antigen, for example, a prostate specific membrane antigen by contacting the cell with a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen.
- a tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen.
- the transduced or transfected antigen presenting cell is loaded with an antigen, for example, a prostate specific membrane antigen by transducing or transfecting the antigen presenting cell with a nucleic acid coding for a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen.
- the tumor is in the prostate, in some embodiments the subject has prostate cancer. In some embodiments, wherein the tumor is in the lung; in some embodiments, the subject has lung cancer. In some embodiments, the tumor is in the lung, lymph node, bone, or liver.
- Also featured in some embodiments are methods of reducing tumor vascularization or inhibiting tumor vascularization in a subject, comprising inducing an immune response against a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen in the subject.
- a tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen in the subject.
- the immune response is a cytotoxic T-lymphocyte immune response.
- the method comprises administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with an antigen, for example, a prostate specific membrane antigen; and administering a multimeric ligand that binds to the multimeric ligand binding region, whereby the antigen presenting cell and ligand are administered in an amount effective to treat reduce tumor vascularization or inhibit tumor vascularization in the subject.
- the subject has prostate cancer.
- the tumor is in the prostate.
- the tumor is in a lung, bone, liver, prostate, brain, breast, ovary, bowel, testes, colon, pancreas, kidney, bladder, neuroendocrine system, lymphatic system, or is a soft tissue sarcoma, glioblastoma, or malignant myeloma.
- the transduced or transfected antigen presenting cell is loaded with an antigen, for example, a prostate specific membrane antigen by contacting the cell with an antigen, for example, a prostate specific membrane antigen.
- the transduced or transfected antigen presenting cell is loaded with an antigen, for example, a prostate specific membrane antigen by transducing or transfecting the antigen presenting cell with a nucleic acid coding for the antigen, for example, a prostate specific membrane antigen.
- the level of vascularization is determined by molecular imaging.
- the molecular imaging comprises administration of an iodine 123-labelled PSA, for example, PSMA inhibitor.
- the inhibitor is TROFEXTM/MIP- 1072/1095.
- Also featured in some embodiments are methods of reducing or slowing tumor vascularization in a subject, comprising administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with a tumor antigen, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen; and administering a multimeric ligand that binds to the multimeric ligand binding region, whereby the antigen presenting cell and ligand are administered in an amount effective to reduce or slow tumor vascularization in the subject.
- the tumor vascularization is reduced in the prostate.
- the subject has prostate cancer.
- the tumor is in the lung, liver, lymph node, or bone.
- the membrane targeting region is selected from the group consisting of a myristoylation region, palmitoylation region, prenylation region, and transmembrane sequences of receptors. In some embodiments, the membrane targeting region is a myristoylation region.
- the multimeric ligand binding region is selected from the group consisting of FKBP, cyclophilin receptor, steroid receptor, tetracycline receptor, heavy chain antibody subunit, light chain antibody subunit, single chain antibodies comprised of heavy and light chain variable regions in tandem separated by a flexible linker domain, and mutated sequences thereof. In some embodiments, the multimeric ligand binding region is an FKBP12 region.
- the multimeric ligand is an FK506 dimer or a dimeric FK506 analog ligand.
- the ligand is AP1903.
- the antigen presenting cell is administered to the subject by intravenous, intradermal, subcutaneous, intratumor, intraprotatic, or intraperitoneal administration.
- the prostate cancer is selected from the group consisting of metastatic, metastatic castration resistant, metastatic castration sensitive, regionally advanced, and localized prostate cancer.
- at least two doses of the antigen presenting cell and the ligand are administered to the subject.
- the antigen presenting cell is a dendritic cell.
- the CD40 cytoplasmic polypeptide region is encoded by a polynucleotide sequence in SEQ ID NO: 1 .
- the prostate specific membrane antigen comprises the amino acid sequence of SEQ ID NO: 4, or a fragment thereof, or is encoded by the nucleotide sequence of SEQ ID NO: 3, or a fragment thereof.
- the antigen presenting cell is transfected with a vector, for example, a virus vector, for example, an adenovirus vector.
- the antigen presenting cell is transfected with an Ad5f35 vector.
- the FKB12 region is an FKB12v36 region.
- the method further comprises determining the level of IL-6 in the subject after the administration of the antigen presenting cell and the ligand. In some embodiments, the method further comprises determining whether to administer an additional dose or additional doses of the antigen presenting cell and the ligand to the subject, wherein the determination is based upon the level of IL-6 in the subject after administration of at least one dose. In some
- an additional dose is administered where the IL-6 level is above normal.
- the IL-6 is from serum.
- the methods further comprise determining the level of VCAM-1 in the subject after the administration of the antigen presenting cell and the ligand.
- the method further comprises determining whether to administer an additional dose or additional doses of the antigen presenting cell and the ligand to the subject, wherein the determination is based upon the level of VCAM-1 in the subject after administration of at least one dose.
- an additional dose is administered where the VCAM-1 level is above normal.
- the VCAM-1 is from serum.
- the progression of prostate cancer is prevented or progression of prostate cancer is delayed in the subject.
- the transduced or transfected antigen presenting cell is loaded with a prostate cancer antigen, for example, a prostate specific protein antigen or a prostate specific membrane antigen by contacting the cell with a prostate cancer antigen, for example, a prostate specific membrane antigen.
- the transduced or transfected antigen presenting cell is loaded with a prostate cancer antigen, for example, a prostate specific membrane antigen by transducing or transfecting the antigen presenting cell with a nucleic acid coding for a prostate cancer antigen, for example, a prostate specific membrane antigen.
- the nucleic acid coding for the prostate cancer antigen for example, a prostate specific membrane antigen is DNA.
- the nucleic acid coding for the prostate cancer antigen, for example, a prostate specific membrane antigen is RNA.
- the antigen presenting cell is a B cell. In some embodiments,
- the chimeric protein further comprises a MyD88 polypeptide or a truncated MyD88 polypeptide lacking the TIR domain.
- the truncated MyD88 polypeptide has the peptide sequence of SEQ ID NO: 6, or a fragment thereof, or is encoded by the nucleotide sequence of SEQ ID NO: 5, or a fragment thereof.
- the prostate cancer antigen for example, a prostate specific membrane antigen is a prostate specific membrane antigen polypeptide.
- Also featured in some embodiments are methods of treating or preventing prostate cancer in a subject, comprising administering a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a prostate cancer antigen, for example, a prostate specific protein antigen or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; and administering a multimeric ligand that binds to the multimeric ligand binding region; whereby the composition and ligand are administered in an amount effective to treat or prevent the prostate cancer in the subject.
- a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a prostate cancer antigen, for example, a prostate specific protein antigen or a prostate specific membrane antigen to a subject in need thereof, where
- Also featured in some embodiments are methods of treating or preventing prostate cancer in a subject, comprising administering a nucleotide sequence that encodes a chimeric protein, and a nucleotide sequence encoding a prostate cancer antigen, for example, a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, wherein the nucleotide sequence encoding the chimeric protein and the nucleotide sequence encoding a prostate cancer antigen, for example, a prostate specific membrane antigen are delivered using a vector, for example, a virus vector, for example, an adenovirus vector; and administering a multimeric ligand that binds to the multimeric ligand binding region; whereby the composition and ligand are administered in an amount effective to treat or prevent the prostate cancer in the subject.
- a vector for example, a virus
- progression of prostate cancer is prevented or delayed at least 6 months. In some embodiments, progression of prostate cancer is prevented or delayed at least 12 months. In some embodiments, the prostate cancer has a Gleason score of 7, 8, 9, 10, or greater. In some embodiments, the subject has a partial or complete response by 3 months after administration of the multimeric ligand. In some embodiments, the subject has a partial or complete response by 6 months after administration of the multimeric ligand. In some embodiments, the subject has a partial or complete response by 9 months after administration of the multimeric ligand. In some embodiments, the level of serum PSA in the subject is reduced 20%, 30%, 40%. 50%, 60%, 70%, 80% 90% or 95% by 6 weeks after administration of the multimeric ligand.
- the level of serum PSA in the subject is reduced by 3 months 20%, 30%, 40%. 50%, 60%, 70%, 80% 90% or 95% after administration of the multimeric ligand. In some embodiments, the level of serum PSA in the subject is reduced 20%, 30%, 40%. 50%, 60%, 70%, 80% 90% or 95% by 6 months after administration of the multimeric ligand. In some embodiments, the level of serum PSA in the subject is reduced 20%, 30%, 40%. 50%, 60%, 70%, 80% 90% or 95% by 9 months after administration of the multimeric ligand. In some embodiments, the size of the prostate cancer tumor is reduced 30%, 40%. 50%, 60%, 70%, 80% 90% or 95% by 3 months after administration of the multimeric ligand.
- the size of the prostate cancer tumor is reduced 30%, 40%. 50%, 60%, 70%, 80% 90% or 95% by 6 months after administration of the multimeric ligand. In some embodiments, the size of the prostate cancer tumor is reduced 30%, 40%. 50%, 60%, 70%, 80% 90% or 95% by 9 months after administration of the multimeric ligand. In some embodiments, the vascularization of the prostate cancer tumor is reduced 30%, 40%. 50%, 60%, 70%, 80% 90% or 95% by 3 months after administration of the multimeric ligand. In some embodiments, the vascularization of the prostate cancer tumor is reduced 30%, 40%. 50%, 60%, 70%, 80% 90% or 95% by 6 months after administration of the multimeric ligand.
- the vascularization of the prostate cancer tumor is reduced 30%, 40%. 50%, 60%, 70%, 80% 90% or 95% by 9 months after administration of the multimeric ligand.
- a T H 1 or T H 2 antigen-specific immune response is detected in the subject after administration of the multimeric ligand.
- Also featured in some embodiments are methods of inducing an immune response against a tumor antigen, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen in a subject, comprising administering a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding an antigen, for example, a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; and
- composition and the ligand are administered in an amount effective to induce an immune response in the subject.
- methods of inducing an immune response against a tumor antigen for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen, in a subject, comprising administering a nucleotide sequence that encodes a chimeric protein, and a nucleotide sequence encoding an antigen, for example, a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, wherein the nucleotide sequence encoding the chimeric protein and the nucleotide sequence encoding the antigen, for example, a prostate specific membrane antigen are delivered using a vector, for example
- Also featured in some embodiments are methods of reducing tumor size or inhibiting tumor growth in a subject, comprising inducing an immune response against a tumor antigen, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen, in the subject.
- a tumor antigen for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen
- the method comprises administering a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding an antigen, for example, a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; and administering a multimeric ligand that binds to the multimeric ligand binding region.
- the method comprises administering a nucleotide sequence that encodes a chimeric protein, and a nucleotide sequence encoding an antigen, for example, a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic
- the nucleotide sequence encoding the chimeric protein and the nucleotide sequence encoding the antigen, for example, a prostate specific membrane antigen are delivered using a vector, for example, a virus vector, for example, an adenovirus vector; and administering a multimeric ligand that binds to the multimeric ligand binding region.
- the composition or nucleotide sequences and the ligand are administered in an amount effective to reduce tumor size or inhibit tumor growth in the subject.
- the subject has prostate cancer.
- the tumor is in the prostate.
- the tumor is in a lung, bone, liver, prostate, brain, breast, ovary, bowel, testes, colon, pancreas, kidney, bladder, neuroendocrine system, lymphatic system, or is a soft tissue sarcoma, glioblastoma, or malignant myeloma.
- the tumor is in the lung, liver, lymph node, or bone.
- methods of reducing tumor vascularization or inhibiting tumor vascularization in a subject comprising inducing an immune response against a tumor antigen, for example a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen in the subject.
- the method comprises administering a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding an antigen, for example, a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; and administering a multimeric ligand that binds to the multimeric ligand binding region.
- the method comprises administering a nucleotide sequence that encodes a chimeric protein, and a nucleotide sequence encoding an antigen, for example, a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, wherein the nucleotide sequence encoding the chimeric protein and the nucleotide sequence encoding the antigen, for example, a prostate specific membrane antigen are delivered using a vector, for example, a virus vector, for example, an adenovirus vector; and administering a multimeric ligand that binds to the multimeric ligand binding region.
- a vector for example, a virus vector, for example, an adenovirus vector
- the composition or nucleotide sequences and the ligand are administered in an amount effective to reduce tumor vascularization or inhibit tumor vascularization in the subject.
- the subject has prostate cancer.
- the tumor is in the prostate.
- the tumor is in a lung, bone, liver, prostate, brain, breast, ovary, bowel, testes, colon, pancreas, kidney, bladder, neuroendocrine system, lymphatic system, or is a soft tissue sarcoma, glioblastoma, or malignant myeloma.
- the tumor is in a bone, lung, liver, or lymph node.
- the level of vascularization is determined by molecular imaging.
- the molecular imaging comprises administration of an iodine 123-labelled PSA, for example, PSMA inhibitor.
- the inhibitor is TROFEXTM/MIP-1072/1095.
- methods comprising: administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with a tumor antigen, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen, administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the presence, absence or amount
- Also featured in some embodiments are methods comprising: administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with a tumor antigen, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the presence, absence or amount of a biomarker in the subject, wherein the biomarker is IL-6 or VCAM-1 , or a portion of the foregoing; and determining whether the dosage of the cells or ligand subsequently administered to the
- a transduced or transfected antigen presenting cell comprising: administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the presence, absence or amount of a biomarker in the subject, wherein the biomarker is uPAR, HGF, EGF, or VEGF, or a portion of the foregoing; and maintaining
- Also featured in some embodiments are methods comprising: administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a, prostate specific membrane antigen; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the presence, absence or amount of a biomarker in the subject, wherein the biomarker is uPAR, HGF, EGF, or VEGF, or a portion of the foregoing; and determining whether the dosage of
- each dose of antigen presenting cells comprises about 4 x 10 6 cells. In some embodiments, each dose of antigen presenting cells comprises about 12.5 x 10 6 cells. In some embodiments, each dose of antigen presenting cells comprises about 25 x 10 6 cells.
- the methods further comprise administering a chemotherapeutic agent.
- a chemotherapeutic agent whereby the composition, ligand, and the chemotherapeutic agent are administered in an amount effective to treat the prostate cancer in the subject.
- the composition or the nucleotide sequences, the ligand, and the chemotherapeutic agent are administered in an amount effective to treat the prostate cancer in the subject.
- the chemotherapeutic agent is selected from the group consisting of carboplatin, estramustine phosphate (Emcyt), and thalidomide.
- the chemotherapeutic agent is a taxane.
- the taxane may be, for example, selected from the group consisting of docetaxel (Taxotere), paclitaxel, and cabazitaxel. In some embodiments, the taxane is docetaxel.
- the chemotherapeutic agent is administered at the same time or within one week after the administration of the antigen presenting cell or the ligand. In other embodiments, the chemotherapeutic agent is administered after the administration of the ligand. In other embodiments, the chemotherapeutic agent is administered from 1 to 4 weeks or from 1 week to 1 month, 1 week to 2 months, or 1 week to 3 months after the administration of the ligand. In other embodiments, the methods further comprise administering the chemotherapeutic agent from 1 to 4 weeks, or from 1 week to 1 month, 1 week to 2 months, or 1 week to 3 months before the administration of the antigen presenting cell. In some embodiments, the chemotherapeutic agent is administered at least 2 weeks before administering the antigen presenting cell.
- the chemotherapeutic agent is administered at least 1 month before administering the antigen presenting cell. In some embodiments, the chemotherapeutic agent is administered after administering the multimeric ligand. In some embodiments, the chemotherapeutic agent is administered at least 2 weeks after administering the multimeric ligand. In some embodiments, wherein the chemotherapeutic agent is administered at least 1 month after administering the multimeric ligand.
- the methods further comprise administering two or more chemotherapeutic agents.
- the chemotherapeutic agents are selected from the group consisting of carboplatin, Estramustine phosphate, and thalidomide.
- at least one chemotherapeutic agent is a taxane.
- the taxane may be, for example, selected from the group consisting of docetaxel, paclitaxel, and cabazitaxel.
- the taxane is docetaxel.
- the chemotherapeutic agents are administered at the same time or within one week after the administration of the antigen presenting cell or the ligand.
- the chemotherapeutic agents are administered after the administration of the ligand. In other embodiments, the chemotherapeutic agents are administered from 1 to 4 weeks or from 1 week to 1 month, 1 week to 2 months, or 1 week to 3 months after the administration of the ligand. In other embodiments, the methods further comprise administering the chemotherapeutic agents from 1 to 4 weeks or from 1 week to 1 month, 1 week to 2 months, or 1 week to 3 months before the administration of the antigen presenting cell.
- Also featured in some embodiments are methods of increasing the chemosensitivity of a tumor, comprising administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with a prostate specific membrane antigen; and administering a multimeric ligand that binds to the multimeric ligand binding region, whereby the antigen presenting cell and ligand are administered in an amount effective to increase the chemosensitivity of the tumor in the subject.
- the tumor may become more chemo-sensitive to any chemotherapeutic, such as, for example, a taxane, such as, for example, docetaxel or
- chemo-sensitivity of a tumor By increasing the chemo-sensitivity of a tumor is meant, for example, increasing the sensitivity of a tumor to any chemotherapeutic, as measured by any method such as, for example, tumor size, growth rate, appearance, or vascularity. By increasing the chemo-sensitivity of a tumor is meant that the tumor is more sensitive to the chemotherapeutic than before vaccine therapy by, for example, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%.
- Also featured in some embodiments are methods comprising: identifying the presence, absence or amount of a biomarker in a subject to whom a prostate membrane protein antigen-loaded antigen presenting cell and a multimeric ligand have been administered, the antigen presenting cell having been transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, and wherein the multimeric ligand binds to the multimeric ligand binding region; and maintaining a subsequent dosage of the cells or ligand or adjusting a subsequent dosage of the cells or ligand administered to the subject based on the presence, absence or amount of the biomarker identified in the subject.
- Also featured in some embodiments are methods comprising: identifying the presence, absence or amount of a biomarker in a subject to whom a prostate membrane protein antigen-loaded antigen presenting cell and a multimeric ligand have been administered, the antigen presenting cell having been transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, and wherein the multimeric ligand binds to the multimeric ligand binding region; and determining whether the dosage of the cells or ligand subsequently administered to the subject is adjusted based on the presence, absence or amount of the biomarker identified in the subject.
- Also featured in some embodiments are methods comprising: receiving information comprising the presence, absence or amount of a biomarker in a subject to whom a prostate membrane protein antigen-loaded antigen presenting cell and a multimeric ligand have been administered, the antigen presenting cell having been transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic
- Also featured in some embodiments are methods comprising: identifying the presence, absence or amount of a biomarker in a subject to whom a prostate membrane protein antigen peptide-loaded antigen presenting cell and a multimeric ligand have been administered, the antigen presenting cell having been transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, and wherein the multimeric ligand binds to the multimeric ligand binding region; and transmitting the presence, absence or amount of the biomarker to a decision maker who maintains a subsequent dosage of the cells or ligand or adjusts a subsequent dosage of the cells or ligand administered to the subject based on the presence, absence or amount of the biomarker identified in the subject.
- Also featured in some embodiments are methods comprising: identifying the presence, absence or amount of a biomarker in a subject to whom a prostate membrane protein antigen peptide-loaded antigen presenting cell and a multimeric ligand have been administered, the antigen presenting cell having been transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, and wherein the multimeric ligand binds to the multimeric ligand binding region; and transmitting an indication to maintain a subsequent dosage of the cells or ligand or adjust a subsequent dosage of the cells or ligand administered to the subject based on the presence, absence or amount of the biomarker identified in the subject.
- Also featured in some embodiments are methods for optimizing therapeutic efficacy, comprising: administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the presence, absence or amount of a biomarker in the subject, wherein the biomarker is IL-6 or VCAM-1 , or the biomarker is uPAR, HGF, EGF,
- Also featured in some embodiments are methods for reducing toxicity of a treatment, comprising: administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the presence, absence or amount of a biomarker in the subject, wherein the biomarker is IL-6 or VCAM-1 , or the biomarker is uPAR, HGF, E
- Also featured in some embodiments are methods for administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the amount of IL-6 polypeptide or portion thereof in the subject; and maintaining a subsequent dosage of the cells or ligand or adjusting a subsequent dosage of the cells or ligand administered to the subject based on the amount of the IL-6 polypeptid
- Also featured in some embodiments are methods comprising administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the amount of VCAM-1 polypeptide or portion thereof in the subject; and maintaining a subsequent dosage of the cells or ligand or adjusting a subsequent dosage of the cells or ligand administered to the subject based on the amount of the VCAM-1 poly
- Also featured in some embodiments are methods comprising administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the amount of uPAR, HGF, EGF, or VEGF, polypeptide or portion thereof in the subject; and maintaining a subsequent dosage of the cells or ligand or adjusting a subsequent dosage of the cells or ligand administered to
- Also featured in some embodiments are methods comprising administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the amount of an individual secreted factor, or a panel of secreted factors, in the subject wherein the secreted factors are selected from the group consisting of GM- CSF, MIP-1 alpha, MIP-1 beta, MCP-1
- Also featured in some embodiments are methods of reducing or slowing tumor vascularization in a subject, comprising administering a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; and administering a multimeric ligand that binds to the multimeric ligand binding region.
- a tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen
- Also featured in some embodiments are methods of reducing or slowing tumor vascularization in a subject, comprising administering a nucleotide sequence that encodes a chimeric protein, and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, wherein the nucleotide sequence encoding the chimeric protein and the nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen are delivered using a vector, for example, a virus vector, for example, an adenovirus vector; and administering a multimeric ligand that binds to the multimeric ligand
- the nucleotide sequence encoding the tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen
- the nucleotide sequence encoding the chimeric protein are on different nucleic acids or on the same nucleic acid.
- the nucleotide sequence encoding the tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen and the nucleotide sequence encoding the chimeric protein are on different adenovirus vectors or on the same adenovirus vector.
- the membrane targeting region is selected from the group consisting of a myristoylation region, palmitoylation region, prenylation region, and transmembrane sequences of receptors. In some embodiments, the membrane targeting region is a myristoylation region.
- the multimeric ligand binding region is selected from the group consisting of FKBP, cyclophilin receptor, steroid receptor, tetracycline receptor, heavy chain antibody subunit, light chain antibody subunit, single chain antibodies comprised of heavy and light chain variable regions in tandem separated by a flexible linker domain, and mutated sequences thereof. In some embodiments, the multimeric ligand binding region is an FKBP12 region.
- the multimeric ligand is an FK506 dimer or a dimeric FK506 analog ligand.
- the prostate tumor antigen for example, is a prostate specific membrane antigen polypeptide.
- the composition further comprises particles, and the composition is administered by a propelling force.
- the particles are gold particles or nanoparticles.
- the ligand is AP1903.
- the prostate cancer is selected from the group consisting of metastatic, metastatic castration resistant, metastatic castration sensitive, regionally advanced, and localized prostate cancer. In some embodiments, at least two doses of the composition and the ligand are administered to the subject.
- the CD40 cytoplasmic polypeptide region is encoded by a polynucleotide sequence in SEQ ID NO: 1 .
- the prostate specific membrane antigen comprises the amino acid sequence of SEQ ID NO: 4 or a fragment thereof, or is encoded by the nucleotide sequence of SEQ ID NO: 3 or a fragment thereof.
- the FKB12 region is an FKB12v36 region.
- the methods further comprise determining the level of IL-6 in the subject after the administration of the composition or adenovirus vectors and the ligand. In some embodiments, the method further comprises determining whether to administer an additional dose or additional doses to the subject, wherein the determination is based upon the level of IL-6 in the subject after administration of at least one dose. In some embodiments, the method further comprises administering an additional dose where the IL-6 level is above normal. In some embodiments, the IL-6 is from serum.
- the methods further comprise determining the level of VCAM-1 in the subject after the administration of the composition or adenovirus vectors and the ligand. In some embodiments, the method further comprises determining whether to administer an additional dose or additional doses to the subject, wherein the determination is based upon the level of VCAM-1 in the subject after administration of at least one dose. In some embodiments, the method further comprises administering an additional dose is where the VCAM-1 level is above normal. In some embodiments, the VCAM-1 is from serum. In some embodiments, the methods further comprise determining the level of uPAR, HGF, EGF, or VEGF in the subject after the administration of the composition or adenovirus vectors and the ligand.
- the method further comprises determining whether to administer an additional dose or additional doses to the subject, wherein the determination is based upon the level of uPAR, HGF, EGF, or VEGF in the subject after administration of at least one dose. In some embodiments, the method further comprises administering an additional dose is where the VCAM-1 level is above normal. In some embodiments, the uPAR, HGF, EGF, or VEGF is from serum.
- the progression of prostate cancer is prevented or progression of prostate cancer is delayed in the subject.
- the transduced or transfected antigen presenting cell is loaded with a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen by contacting the cell with a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen.
- the transduced or transfected antigen presenting cell is loaded with tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen by transducing or transfecting the antigen presenting cell with a nucleic acid coding for a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen.
- tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen.
- the nucleic acid coding for the tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen is DNA.
- the nucleic acid coding for the tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen is RNA.
- the antigen presenting cell is a B cell.
- the chimeric protein further comprises a MyD88 polypeptide or a truncated MyD88 polypeptide lacking the TIR domain.
- the truncated MyD88 polypeptide has the peptide sequence of SEQ ID NO: 6, or a fragment thereof, or is encoded by the nucleotide sequence of SEQ ID NO: 5, or a fragment thereof.
- the tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen is a prostate specific membrane antigen polypeptide.
- a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the presence, absence or amount of a biomarker in the subject, wherein the biomarker is IL-6 or VCAM-1 , or a portion of the foregoing; and maintaining a subsequent dosage of the composition or ligand or adjusting a subsequent dosage of the composition or ligand to the subject based on the presence, absence or amount of the biomarker identified in the subject.
- a tumor antigen such as, for example, a prostate cancer
- Also featured in some embodiments are methods comprising: administering a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the presence, absence or amount of a biomarker in the subject, wherein the biomarker is IL-6 or VCAM-1 , or a portion of the foregoing; and determining whether the dosage of the composition or ligand subsequently administered to the subject is adjusted based on the presence, absence or amount of the biomarker identified in the subject.
- a tumor antigen such as, for example,
- a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the presence, absence or amount of a biomarker in the subject, wherein the biomarker is uPAR, HGF, EGF, or VEGF, or a portion of the foregoing; and maintaining a subsequent dosage of the composition or ligand or adjusting a subsequent dosage of the composition or ligand to the subject based on the presence, absence or amount of the biomarker identified in the subject.
- tumor antigen such as, for example,
- Also featured in some embodiments are methods comprising: administering a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the presence, absence or amount of a biomarker in the subject, wherein the biomarker is uPAR, HGF, EGF, or VEGF, or a portion of the foregoing; and determining whether the dosage of the composition or ligand subsequently administered to the subject is adjusted based on the presence, absence or amount of the biomarker identified in the subject.
- Also featured in some embodiments are methods comprising: administering a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; administering a multimeric ligand that binds to the multimeric ligand binding region; maintaining a subsequent dosage of the composition or ligand or adjusting a subsequent dosage of the composition or ligand administered to the subject based on the presence, absence or amount of the biomarker identified in the subject.
- a tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen
- the chimeric protein comprises a membrane targeting
- Also featured in some embodiments are methods comprising: identifying the presence, absence or amount of a biomarker in a subject to whom a composition and a multimeric ligand have been administered, the composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, and wherein the multimeric ligand binds to the multimeric ligand binding region; and determining whether the dosage of the composition or ligand subsequently administered to the subject is adjusted based on the presence, absence or amount of the biomarker identified in the subject.
- a tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific
- Also featured in some embodiments are methods comprising: receiving information comprising the presence, absence or amount of a biomarker in a subject to whom a composition and a multimeric ligand have been administered, the composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen w herein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, and wherein the multimeric ligand binds to the multimeric ligand binding region; and wherein the multimeric ligand binds to the multimeric ligand binding region; and maintaining a subsequent dosage of the composition or adjusting a subsequent dosage of the composition administered to the subject based on the presence, absence or amount of the biomarker identified in the subject.
- Also featured in some embodiments are methods comprising: identifying the presence, absence or amount of a biomarker in a subject to whom a composition and a multimeric ligand have been administered, the composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, and wherein the multimeric ligand binds to the multimeric ligand binding region; and wherein the multimeric ligand binds to the multimeric ligand binding region; and transmitting the presence, absence or amount of the biomarker to a decision maker who maintains a subsequent dosage of the composition or ligand or adjusts a subsequent dosage of the composition or ligand administered to the subject based
- Also featured in some embodiments are methods comprising: identifying the presence, absence or amount of a biomarker in a subject to whom a composition and a multimeric ligand have been administered, the composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, and wherein the multimeric ligand binds to the multimeric ligand binding region; and wherein the multimeric ligand binds to the multimeric ligand binding region; and transmitting an indication to maintain a subsequent dosage of the composition or ligand or adjust a subsequent dosage of the composition or ligand administered to the subject based on the presence, absence or amount of the biomarker identified in
- Also featured in some embodiments are methods for optimizing therapeutic efficacy, comprising: administering a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain;
- a tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen
- a multimeric ligand that binds to the multimeric ligand binding region identifying the presence, absence or amount of a biomarker in the subject, wherein the biomarker is IL-6 or VCAM-1 , or a portion of the foregoing; and maintaining a subsequent dosage of the composition or ligand or adjusting a subsequent dosage of the composition or ligand to the subject based on the presence, absence or amount of the biomarker identified in the subject.
- Also featured in some embodiments are methods for reducing toxicity of a treatment, comprising: administering a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; administering a multimeric ligand that binds to the multimeric ligand binding region;
- biomarker is IL-6 or VCAM-1 , or uPAR, HGF, EGF, or VEGF, or a portion of the foregoing; and maintaining a subsequent dosage of the composition or ligand or adjusting a subsequent dosage of the composition or ligand to the subject based on the presence, absence or amount of the biomarker identified in the subject.
- Also featured in some embodiments are methods comprising: administering a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the amount of IL-6 polypeptide or portion thereof in the subject; and maintaining a subsequent dosage of the composition or ligand or adjusting a subsequent dosage of the composition or ligand administered to the subject based on the amount of the IL-6 polypeptide or portion thereof identified in the subject.
- a tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen
- the subject has a level of IL-6 polypeptide or portion thereof that is elevated relative to healthy subjects prior to administration of the composition.
- methods comprising: administering a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the amount of VCAM-1 polypeptide or portion thereof in the subject; and maintaining a subsequent dosage of the composition or ligand or adjusting a subsequent dosage of the composition or ligand administered to the subject based on the amount of the VCAM-1 polypeptide or
- Also featured in some embodiments are methods comprising: administering a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the amount of uPAR, HGF, EGF, or VEGF polypeptide or portion thereof in the subject; and maintaining a subsequent dosage of the composition or ligand or adjusting a subsequent dosage of the composition or ligand administered to the subject based on the amount of the uPAR, HGF, EGF, or VEGF polypeptide or portion thereof identified in the subject.
- Also featured in some embodiments are methods comprising administering a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; administering a multimeric ligand that binds to the multimeric ligand binding region; identifying the amount of an individual secreted factor, or a panel of secreted factors, in the subject wherein the secreted factors are selected from the group consisting of GM-CSF, Ml P-1 alpha, MIP-1 beta, MCP-1 , IFN- gamma, RANTES, EGF and HGF, and maintaining a subsequent dosage of the cells or ligand or adjusting
- the subject has prostate cancer, in some embodiments, the subject has a solid tumor, in some embodiments, an immune response against a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen is induced by administration of the cells or composition and the ligand. In some embodiments, a cytotoxic T lymphocyte response is induced. In some embodiments, tumor vascularization is decreased or inhibited by administration of the cells or composition and the ligand. In some embodiments, the subject is in need of preventing prostate cancer. In some embodiments, the chimeric protein further comprises a MyD88 polypeptide or a truncated MyD88 polypeptide lacking the TIR domain.
- a tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen is induced by administration of the cells or composition and the ligand.
- a cytotoxic T lymphocyte response is induced.
- tumor vascularization
- the presence, absence or amount of the biomarker is determined from a biological sample from the subject.
- the sample contains blood or a blood fraction.
- the biomarker is the IL-6 polypeptide or portion thereof.
- the presence, absence or amount of the IL-6 polypeptide or portion thereof is determined by a method that comprises contacting the IL-6 polypeptide or portion thereof with an antibody that specifically binds to the IL-6 polypeptide or portion thereof.
- the presence, absence or amount of the IL-6 polypeptide or portion thereof is determined by a method that comprises analyzing the IL-6 polypeptide or portion thereof by high performance liquid chromatography.
- the presence, absence or amount of the IL-6 polypeptide or portion thereof is determined by a method that comprises analyzing the IL-6 polypeptide or portion thereof by mass spectrometry.
- the biomarker is the VCAM-1 polypeptide or portion thereof.
- the presence, absence or amount of the VCAM-1 polypeptide or portion thereof is determined by a method that comprises contacting the VCAM-1 polypeptide or portion thereof with an antibody that specifically binds to the VCAM-1 polypeptide or portion thereof.
- the presence, absence or amount of the VCAM-1 polypeptide or portion thereof is determined by a method that comprises analyzing the VCAM-1 polypeptide or portion thereof by high performance liquid chromatography.
- the presence, absence or amount of the VCAM-1 polypeptide or portion thereof is determined by a method that comprises analyzing the VCAM-1 polypeptide or portion thereof by mass spectrometry.
- Also featured in some embodiments are methods for treating a solid tumor in a subject, comprising administering a pharmaceutical composition in an amount effective to reduce the amount of IL-6 or the amount of VCAM-1 , or both, in the subject.
- the method further comprises comprising administering an antibody to the subject.
- the method further comprises administering a steroid agent to the subject.
- the method further comprises administering a chemotherapy agent to the subject.
- the pharmaceutical composition comprises a nucleic acid composition.
- the solid tumor is classified as a prostate cancer tumor.
- the biomarker is the uPAR, HGF, EGF, or VEGF polypeptide or portion thereof.
- the presence, absence or amount of the uPAR, HGF, EGF, or VEGF polypeptide or portion thereof is determined by a method that comprises contacting the uPAR, HGF, EGF, or VEGF polypeptide or portion thereof with an antibody that specifically binds to the uPAR, HGF, EGF, or VEGF polypeptide or portion thereof.
- the presence, absence or amount of the uPAR, HGF, EGF, or VEGF polypeptide or portion thereof is determined by a method that comprises analyzing the uPAR, HGF, EGF, or VEGF polypeptide or portion thereof by high performance liquid chromatography. In some embodiments, the presence, absence or amount of the uPAR, HGF, EGF, or VEGF polypeptide or portion thereof is determined by a method that comprises analyzing the uPAR, HGF, EGF, or VEGF polypeptide or portion thereof by mass spectrometry.
- Also featured in some embodiments are methods for improving quality of life in a subject, comprising administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen; and administering a multimeric ligand that binds to the multimeric ligand binding region; whereby the antigen presenting cell, and the ligand are administered in an amount effective to improve quality of life in the subject.
- a tumor antigen such as, for example, a prostate cancer antigen,
- the subject has cancer, for example, end stage cancer.
- the subject has prostate cancer, for example, end stage prostate cancer.
- one or more symptoms of cachexia, fatigue, or anemia is alleviated.
- two or more symptoms of cachexia, fatigue, or anemia are alleviated.
- Also featured in some embodiments are methods for improving quality of life in a subject, comprising administering a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen, to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; and administering a multimeric ligand that binds to the multimeric ligand binding region; whereby the antigen compound, and the ligand are administered in an amount effective to improve quality of life in the subject.
- a tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen
- Also featured in some embodiments are methods for improving quality of life in a subject, comprising administering a nucleotide sequence that encodes a chimeric protein, and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, wherein the nucleotide sequence encoding the chimeric protein and the nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen are delivered using a vector, for example, a virus vector, for example, an adenovirus vector; and administering a multimeric ligand that binds to the multimeric ligand binding region; whereby
- the subject has cancer, for example, end stage cancer.
- the subject has prostate cancer, for example, end stage prostate cancer.
- one or more symptoms of cachexia, fatigue, or anemia is alleviated.
- two or more symptoms of cachexia, fatigue, or anemia are alleviated.
- Also featured in some embodiments are methods comprising administering a transduced or transfected antigen presenting cell to a subject in need thereof, wherein: the antigen presenting cell is transduced or transfected with a nucleic acid including a nucleotide sequence that encodes a chimeric protein, the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, the transduced or transfected antigen presenting cell is loaded with a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen; administering a multimeric ligand that binds to the multimeric ligand binding region; and measuring one or more quality of life indicators in the subject.
- a tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen
- the subject has cancer, for example end stage cancer.
- the subject has prostate cancer, for example, end stage prostate cancer.
- one or more symptoms of cachexia, fatigue, or anemia is measured.
- two or more symptoms of cachexia, fatigue, or anemia are measured.
- Also featured in some embodiments are methods comprising administering a composition comprising a nucleotide sequence that encodes a chimeric protein and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain; administering a multimeric ligand that binds to the multimeric ligand binding region; and measuring one or more quality of life indicators in the subject.
- a tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen
- Also featured in some embodiments are methods comprising administering a nucleotide sequence that encodes a chimeric protein, and a nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen to a subject in need thereof, wherein the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, wherein the nucleotide sequence encoding the chimeric protein and the nucleotide sequence encoding a tumor antigen, such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen are delivered using a vector, for example, a virus vector, for example, an adenovirus vector; administering a multimeric ligand that binds to the multimeric ligand binding region; and measuring one or more quality of life indicators in the subject.
- the subject has cancer, for example end stage cancer.
- the subject has prostate cancer, for example, end stage prostate cancer.
- one or more symptoms of cachexia, fatigue, or anemia is measured.
- two or more symptoms of cachexia, fatigue, or anemia are measured.
- a nucleotide sequence that encodes a chimeric protein and a tumor antigen such as, for example, a prostate cancer antigen, a prostate specific protein antigen, or a prostate specific membrane antigen
- the chimeric protein comprises a membrane targeting region, a multimeric ligand binding region and a CD40 cytoplasmic polypeptide region lacking the CD40 extracellular domain, and administering a multimeric ligand that binds to the multimeric ligand binding region
- a prostate specific membrane antigen polypeptide is administered to the subject rather than a nucleotide sequence encoding a prostate specific membrane antigen polypeptide.
- the subject is a mammal. In some embodiments, the subject is a human.
- FIG. 1 Schematic diagram of iCD40 and expression in human DCs.
- the human CD40 cytoplasmic domain can be subcloned downstream of a myristoylation-targeting domain (M) and two tandem domains (Fv)( Clackson T, Yang W, Rozamus LW, et al., Proc Natl Acad Sci U S A. 1998;95:10437-10442).
- M-Fv-Fv-CD40 chimeric protein referred to here as inducible CD40 (iCD40) can be under cytomegalovirus (CMV) promoter control.
- CMV cytomegalovirus
- B The expression of endogenous (eCD40) and recombinant inducible (iCD40) forms of CD40 assessed by Western blot.
- Lane 1 wild type DCs (endogenous CD40 control); lane 2, DCs stimulated with 1
- FIG. 1 iRIG-1 and iMyD88 in RAW264.7 cells.
- RAW 264.7 cells were cotransfected transiently with 3 micrograms expression plasmids for iRIG-1 and 1 microgram IFNgamma-dependent SEAP reporter plasmid; and 3 micrograms iMyD88 with 1 microgram NF-kappaB-dependent SEAP reporter plasmid..
- Figure 3 is a schematic of inducible CD40 and MyD88 receptors and induction of NF-kappa B activity.
- Figure 4 is a schematic of inducible chimeric CD40/MyD88 receptors and induction of NF-kappaB activity.
- Figure 5 is a graph of NF-kappa B activation in 293 cells by inducible MyD88 and chimeric MyD88- CD40 receptors.
- CD40T indicates "turbo" CD40, wherein the receptor includes 3 copies of the FKBP12v 36 domain (Fv').
- Figure 6 is a graph of NF-kappa B activity by inducible truncated MyD88 (MyD88L) and chimeric inducible truncated MyD88/CD40 after 3 hours of incubation with substrate.
- Figure 7 is a graph of NF-kappa B activity by inducible truncated MyD88 (MyD88L) and chimeric inducible truncated MyD88/CD40 after 22 hours of incubation with substrate. Some assay saturation is present in this assay.
- Figure 8 is a Western blot of HA protein, following adenovirus-MyD88L transduction of 293T cells.
- Figure 9 is a Western blot of HA protein, following adenovirus-MyD88L-CD40 transduction of 293T cells.
- Figure 10 is a graph of an ELISA assay after adenovirus infection of bone marrow derived DCs with the indicated inducible CD40 and MyD88 constructs.
- Figure 1 1 is a graph of the results of an ELISA assay similar to that in Figure 10.
- Figure 12 is a graph of the results of an ELISA assay similar to that in Figures 10 and 1 1 , after infection with a higher amount of adenovirus.
- Figure 13 is a construct map of pShuttleX-iMyD88.
- Figure 14 is a construct map of pShuttleX-CD4-TLR4L3-E.
- Figure 15 is a construct map of pShuttleX-iMyD88E-CD40.
- Figure 16 is a bar graph depicting the results of a dose-dependent induction of IL-12p70 expression in human monocyte-derived dendritic cells (moDCs) transduced with different multiplicity of infections of adenovirus expressing an inducible MyD88.CD40 composite construct.
- Figure 17 is a bar graph depicting of the results of a drug-dependent induction of I L-12p70 expression in human monocyte-derived dendritic cells (moDCs) transduced with adenoviruses expressing different inducible constructs.
- Figure 18 is a bar graph depicting the IL-12p70 levels in transduced dendritic cells prior to vaccination.
- Figure 19(a) is a graph of EG.7-OVA tumor growth inhibition in mice vaccinated with transduced dendritic cells;
- Figure 19(b) presents photos of representative vaccinated mice;
- Figure 19(c) is the graph of 19(a), including error bars.
- Figure 20(a) is a scatter plot
- 20(b) is a bar graph, showing the enhanced frequency of Ag- specific CD8+ T cells induced by transduced dendritic cells.
- Figure 21 is a bar graph showing the enhanced frequency of Ag-Specific IFN gamma+ CD8+ T cells and CD4+ TH1 cells induced by transduced dendritic cells.
- Figure 22 presents a schematic and the results of an in vivo cytotoxic lymphocyte assay.
- Figure 23 is a bar graph summarizing the data from an enhanced in vivo CTL activity induced by dendritic cells.
- Figure 24 presents representative results of a CTL assay in mice induced by transduced dendritic cells.
- Figure 25 presents the results of intracellular staining for IL-4 producing TH2 cells in mice inoculated by transduced dendritic cells.
- Figure 26 presents the results of a tumor growth inhibition assay in mice treated with Ad5- iCD40.MyD88 transduced cells.
- Figure 27 presents a tumor specific T cell assay in mice treated with Ad5-iCD40.MyD88 transduced cells.
- Figure 28 presents the results of a natural killer cell assay using splenocytes from the treated mice as effectors.
- Figure 29 presents the results of a cytotoxic lymphocyte assay using splenocytes from the treated mice as effectors.
- Figure 30 presents the results of an IFN-gamma ELISPot assay using T cells co-cultured with dendritic cells transduced with the indicated vector.
- Figure 31 presents the results of a CCR7 upregulation assay using dendritic cells transformed with the indicated vector, with or without LPS as an adjuvant.
- Figure 32 presents the results of a CCR7 upregulation assay, with the data from multiple animals included in one graph.
- Figure 33 is a plasmid map of Ad5f35ihCD40.
- Figure 34 is a chart presenting exploratory efficacy assessments.
- Figure 35 is a chart of the 12 week immunological and clinical response summary for subjects 1001 -1006.
- Figure 36 presents waterfall plots presenting the analysis of a 12 week change from baseline for measurable metastatic disease, vascularity, and PSA levels.
- Figure 37 is a graph of cytokine levels in Subject 1008 following treatment.
- Figure 38 is a graph of the results of VCAM-1 serum analysis.
- Figure 39 is a waterfall plot of PSA levels at 12 weeks.
- Figure 40 presents the results of CT scans of patient 1003 at 7, 12, and 52 weeks.
- Figure 41 presents a graph of a soft tissue partial response of Subject 1003.
- Figure 42 presents a graph of various serum markers showing a potential anti-vasculature effect.
- Figure 43 presents PSA levels measured in Subject 1003.
- Figure 44 presents a map of an inducible CD40 transgene.
- Figure 45 is a graph of serum marker analysis of patient 1001 .
- Figure 46 is a graph of serum marker analysis of patient 1002.
- Figure 47 is a graph of serum marker analysis of patient 1003.
- Figure 48 is a graph of serum marker analysis of patient 1004.
- Figure 49 is a graph of serum marker analysis of patient 1005.
- Figure 50 is a graph of serum marker analysis of patient 1006.
- Figure 51 is a bar graph of a PSMA specific injection site immune response in patient 1006.
- Figure 52 presents graphs of KPS and CTC assessments.
- Figure 53 presents a graph of PSA levels serum concentration for subject 1006 over the course of treatment.
- Figure 54 presents a graph of uPAR, HGF, EGF, and VEGF concentrations for subject 1003 over the course of treatment.
- Figure 55 is a Safety and Response Summary table for subjects 1001 through 1006.
- Figure 56 is a Safety and Response Summary table for subjects 1007 through 1012.
- Figure 57 is a Patient Demographics table for subjects 1001 through 1012.
- Figure 58 is a timeline presenting the clinical trial status for subjects 1001 through 1012.
- Figure 59 presents photos showing lung tumor shrinkage following treatment of Subject 1008.
- Figure 60 is a graph of PSA levels for Subject 101 1.
- Figure 61 is a graph of PSA levels for Subject 1010.
- Figure 62 presents photographs of bone scans of subject 1010.
- Figure 63 is a chart of subject responses to combination treatment with taxane-based
- Figure 64 presents photos showing tumor shrinkage in Subject 1006.
- syngeneic mice can differ at one or more loci (congenics) and allogeneic mice can have the same
- antigen as used herein is defined as a molecule that provokes an immune response. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both.
- An antigen can be derived from organisms, subunits of proteins/antigens, killed or inactivated whole cells or lysates.
- Exemplary organisms include but are not limited to, Helicobacters, Campylobacters, Clostridia, Corynebacterium diphtheriae, Bordetella pertussis, influenza virus, parainfluenza viruses, respiratory syncytial virus, Borrelia burgdorfei, Plasmodium, herpes simplex viruses, human immunodeficiency virus, papillomavirus, Vibrio cholera, E. coli, measles virus, rotavirus, shigella, Salmonella typhi, Neisseria gonorrhea.
- any macromolecules can serve as antigens.
- antigens can be derived from recombinant or genomic DNA. Any DNA that contains nucleotide sequences or partial nucleotide sequences of a pathogenic genome or a gene or a fragment of a gene for a protein that elicits an immune response results in synthesis of an antigen.
- the present methods are not limited to the use of the entire nucleic acid sequence of a gene or genome. It is readily inherent that the present invention includes, but is not limited to, the use of partial nucleic acid sequences of more than one gene or genome and that these nucleic acid sequences are arranged in various combinations to elicit the desired immune response.
- antigen-presenting cell is any of a variety of cells capable of displaying, acquiring, or presenting at least one antigen or antigenic fragment on (or at) its cell surface.
- the term “antigen-presenting cell” can be any cell that accomplishes the goal of aiding the enhancement of an immune response (i.e., from the T-cell or -B-cell arms of the immune system) against an antigen or antigenic composition. As discussed in Kuby, 2000, Immunology, 4.sup.th edition, W.H.
- a cell that displays or presents an antigen normally or with a class II major histocompatibility molecule or complex to an immune cell is an "antigen-presenting cell.”
- a cell e.g., an APC cell
- another cell such as a recombinant cell or a tumor cell that expresses the desired antigen.
- the immune cell to which an antigen- presenting cell displays or presents an antigen to is a CD4+TH cell.
- Additional molecules expressed on the APC or other immune cells may aid or improve the enhancement of an immune response.
- Secreted or soluble molecules, such as for example, cytokines and adjuvants, may also aid or enhance the immune response against an antigen.
- cytokines and adjuvants may also aid or enhance the immune response against an antigen.
- cancer as used herein is defined as a hyperproliferation of cells whose unique trait— loss of normal controls— results in unregulated growth, lack of differentiation, local tissue invasion, and metastasis.
- examples include but are not limited to, melanoma, non-small cell lung, small-cell lung, lung, hepatocarcinoma, leukemia, retinoblastoma, astrocytoma, glioblastoma, gum, tongue, neuroblastoma, head, neck, breast, pancreatic, prostate, renal, bone, testicular, ovarian, mesothelioma, cervical, gastrointestinal, lymphoma, brain, colon, sarcoma or bladder.
- cell may be used interchangeably. All of these terms also include their progeny, which are any and all subsequent generations. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations.
- the term “iCD40 molecule” is defined as an inducible CD40. This iCD40 can bypass mechanisms that extinguish endogenous CD40 signaling.
- the term “iCD40” embraces "iCD40 nucleic acids,” “iCD40 polypeptides” and/or iCD40 expression vectors.
- the term “cDNA” is intended to refer to DNA prepared using messenger RNA (mRNA) as template. The advantage of using a cDNA, as opposed to genomic DNA or DNA polymerized from a genomic, non- or partially-processed RNA template, is that the cDNA primarily contains coding sequences of the corresponding protein. There are times when the full or partial genomic sequence is used, such as where the non-coding regions are required for optimal expression or where non-coding regions such as introns are to be targeted in an antisense strategy.
- dendritic cell is an antigen-presenting cell existing in vivo, in vitro, ex vivo, or in a host or subject, or which can be derived from a hematopoietic stem cell or a monocyte. Dendritic cells and their precursors can be isolated from a variety of lymphoid organs, e.g., spleen, lymph nodes, as well as from bone marrow and peripheral blood.
- the DC has a characteristic
- dendritic cells express high levels of MHC and costimulatory (e.g., B7-1 and B7-2) molecules. Dendritic cells can induce antigen specific differentiation of T cells in vitro, and are able to initiate primary T cell responses in vitro and in vivo.
- expression construct or "transgene” is defined as any type of genetic construct containing a nucleic acid coding for gene products in which part or all of the nucleic acid encoding sequence is capable of being transcribed can be inserted into the vector.
- the transcript is translated into a protein, but it need not be.
- expression includes both transcription of a gene and translation of mRNA into a gene product.
- expression only includes transcription of the nucleic acid encoding genes of interest.
- therapeutic construct may also be used to refer to the expression construct or transgene.
- the expression construct or transgene may be used, for example, as a therapy to treat
- the expression construct or transgene is a therapeutic construct or a prophylactic construct.
- expression vector refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes.
- Expression vectors can contain a variety of control sequences, which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operatively linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are discussed infra.
- the term “ex vivo” refers to "outside" the body. The terms “ex vivo” and “in vitro” can be used interchangeably herein.
- the term “functionally equivalent,” as it relates to CD40 refers to a CD40 nucleic acid fragment, variant, or analog, refers to a nucleic acid that codes for a CD40 polypeptide, or a CD40 polypeptide, that stimulates an immune response to destroy tumors or hyperproliferative disease.
- “Functionally equivalent” refers, for example, to a CD40 polypeptide that is lacking the extracellular domain, but is capable of amplifying the T cell-mediated tumor killing response by upregulating dendritic cell expression of antigen presentation molecules.
- hyperproliferative disease is defined as a disease that results from a hyperproliferation of cells.
- exemplary hyperproliferative diseases include, but are not limited to cancer or autoimmune diseases.
- Other hyperproliferative diseases may include vascular occlusion, restenosis, atherosclerosis, or inflammatory bowel disease.
- the term "gene” is defined as a functional protein, polypeptide, or peptide-encoding unit. As will be understood, this functional term includes genomic sequences, cDNA sequences, and smaller engineered gene segments that express, or are adapted to express, proteins, polypeptides, domains, peptides, fusion proteins, and mutants.
- immunogen refers to a substance that is capable of provoking an immune response.
- immunogens include, e.g., antigens, autoantigens that play a role in induction of autoimmune diseases, and tumor-associated antigens expressed on cancer cells.
- immunocompromised as used herein is defined as a subject that has reduced or weakened immune system. The immunocompromised condition may be due to a defect or dysfunction of the immune system or to other factors that heighten susceptibility to infection and/or disease. Although such a categorization allows a conceptual basis for evaluation,
- immunocompromised individuals often do not fit completely into one group or the other. More than one defect in the body's defense mechanisms may be affected. For example, individuals with a specific T-lymphocyte defect caused by HIV may also have neutropenia caused by drugs used for antiviral therapy or be immunocompromised because of a breach of the integrity of the skin and mucous membranes.
- An immunocompromised state can result from indwelling central lines or other types of impairment due to intravenous drug abuse; or be caused by secondary malignancy, malnutrition, or having been infected with other infectious agents such as tuberculosis or sexually transmitted diseases, e.g., syphilis or hepatitis.
- the term "pharmaceutically or pharmacologically acceptable” refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human.
- pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like.
- the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the vectors or cells presented herein, its use in therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions.
- polynucleotide is defined as a chain of nucleotides.
- nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein are interchangeable.
- Nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric “nucleotides.”
- the monomeric nucleotides can be hydrolyzed into nucleosides.
- polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCRTM, and the like, and by synthetic means. Furthermore,
- polynucleotides include mutations of the polynucleotides, include but are not limited to, mutation of the nucleotides, or nucleosides by methods well known in the art.
- polypeptide is defined as a chain of amino acid residues, usually having a defined sequence.
- polypeptide is interchangeable with the terms “peptides” and "proteins”.
- promoter is defined as a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific
- the term “regulate an immune response” or “modulate an immune response” refers to the ability to modify the immune response.
- the composition is capable of enhancing and/or activating the immune response.
- the composition is also capable of inhibiting the immune response.
- the form of regulation is determined by the ligand that is used with the composition. For example, a dimeric analog of the chemical results in dimerization of the co-stimulatory polypeptide leading to activation of the DCs, however, a monomeric analog of the chemical does not result in dimerization of the co-stimulatory polypeptide, which would not activate the DCs.
- transfection and “transduction” are interchangeable and refer to the process by which an exogenous DNA sequence is introduced into a eukaryotic host cell.
- Transfection or
- transduction can be achieved by any one of a number of means including electroporation, microinjection, gene gun delivery, retroviral infection, lipofection, superfection and the like.
- genotypeic refers to cells, tissues or animals that have genotypes that are identical or closely related enough to allow tissue transplant, or are immunologically
- subject includes, but is not limited to, an organism or animal; a mammal, including, e.g., a human, non-human primate (e.g., monkey), mouse, pig, cow, goat, rabbit, rat, guinea pig, hamster, horse, monkey, sheep, or other non-human mammal; a non-mammal, including, e.g., a non-mammalian vertebrate, such as a bird (e.g., a chicken or duck) or a fish, and a non-mammalian invertebrate.
- a mammal including, e.g., a human, non-human primate (e.g., monkey), mouse, pig, cow, goat, rabbit, rat, guinea pig, hamster, horse, monkey, sheep, or other non-human mammal
- a non-mammal including, e.g., a non-mammalian vertebrate, such
- the term “under transcriptional control” or “operatively linked” is defined as the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene.
- the terms “treatment”, “treat”, “treated”, or “treating” refer to prophylaxis and/or therapy.
- a solid tumor such as a cancerous solid tumor
- the term refers to prevention by prophylactic treatment, which increases the subject's resistance to solid tumors or cancer.
- the subject may be treated to prevent cancer, where the cancer is familial, or is genetically associated.
- the term refers to a prophylactic treatment which increases the resistance of a subject to infection with a pathogen or, in other words, decreases the likelihood that the subject will become infected with the pathogen or will show signs of illness attributable to the infection, as well as a treatment after the subject has become infected in order to fight the infection, e. g., reduce or eliminate the infection or prevent it from becoming worse.
- the term "vaccine” refers to a formulation which contains a composition presented herein which is in a form that is capable of being administered to an animal.
- the vaccine comprises a conventional saline or buffered aqueous solution medium in which the composition is suspended or dissolved.
- the composition can be used conveniently to prevent, ameliorate, or otherwise treat a condition.
- the vaccine Upon introduction into a subject, the vaccine is able to provoke an immune response including, but not limited to, the production of antibodies, cytokines and/or other cellular responses.
- the nucleic acid is contained within a viral vector.
- the viral vector is an adenoviral vector. It is understood that in some embodiments, the antigen- presenting cell is contacted with the viral vector ex vivo, and in some embodiments, the antigen- presenting cell is contacted with the viral vector in vivo.
- the antigen-presenting cell is a dendritic cell, for example, a mammalian dendritic cell. Often, the antigen-presenting cell is a human dendritic cell.
- the antigen-presenting cell is also contacted with an antigen. Often, the antigen-presenting cell is contacted with the antigen ex vivo. Sometimes, the antigen-presenting cell is contacted with the antigen in vivo. In some embodiments, the antigen-presenting cell is in a subject and an immune response is generated against the antigen. Sometimes, the immune response is a cytotoxic T-lymphocyte (CTL) immune response. Sometimes, the immune response is generated against a tumor antigen. In certain embodiments, the antigen-presenting cell is activated without the addition of an adjuvant.
- CTL cytotoxic T-lymphocyte
- the antigen-presenting cell is transduced with the nucleic acid ex vivo and administered to the subject by intradermal administration. In some embodiments, the antigen-presenting cell is transduced with the nucleic acid ex vivo and administered to the subject by subcutaneous administration. Sometimes, the antigen-presenting cell is transduced with the nucleic acid ex vivo. Sometimes, the antigen-presenting cell is transduced with the nucleic acid in vivo.
- MyD88 is meant the myeloid differentiation primary response gene 88, for example, but not limited to the human version, cited as ncbi Gene ID 4615.
- truncated is meant that the protein is not full length and may lack, for example, a domain.
- MyD88L is also presented as SEQ ID NOS: 5 (nucleic acid sequence) and 6 (peptide sequence).
- SEQ ID NO: 5 includes the linkers added during subcloning.
- nucleic acid sequence coding for "truncated MyD88" is meant the nucleic acid sequence coding for the truncated MyD88 peptide, the term may also refer to the nucleic acid sequence including the portion coding for any amino acids added as an artifact of cloning, including any amino acids coded for by the linkers.
- the inducible CD40 portion of the peptide may be located either upstream or downstream from the inducible MyD88 or truncated MyD88 polypeptide portion. Also, the inducible CD40 portion and the inducible MyD88 or truncated MyD88 adapter protein portions may be transfected or transduced into the cells either on the same vector, in cis, or on separate vectors, in trans.
- the antigen-presenting cell in some embodiments is contacted with an antigen, sometimes ex vivo. In certain embodiments the antigen-presenting cell is in a subject and an immune response is generated against the antigen, such as a cytotoxic T-lymphocyte (CTL) immune response.
- CTL cytotoxic T-lymphocyte
- an immune response is generated against a tumor antigen (e.g., PSMA).
- a tumor antigen e.g., PSMA
- the nucleic acid is prepared ex vivo and administered to the subject by intradermal administration or by subcutaneous administration, for example. Sometimes the antigen-presenting cell is transduced or transfected with the nucleic acid ex vivo or in vivo.
- the nucleic acid comprises a promoter sequence operably linked to the polynucleotide sequence.
- the nucleic acid comprises an ex vivo-transcribed RNA, containing the protein-coding region of the chimeric protein.
- reducing tumor size or “inhibiting tumor growth” of a solid tumor is meant a response to treatment, or stabilization of disease, according to standard guidelines, such as, for example, the Response Evaluation Criteria in Solid Tumors (RECIST) criteria. For example, this may include a reduction in the diameter of a solid tumor of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or the reduction in the number of tumors, circulating tumor cells, or tumor markers, of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%.
- RECIST Response Evaluation Criteria in Solid Tumors
- the size of tumors may be analyzed by any method, including, for example, CT scan, MRI, for example, CT- MRI, chest X-ray (for tumors of the lung), or molecular imaging, for example, PET scan, such as, for example, a PET scan after administering an iodine 123-labelled PSA, for example, PSMA ligand, such as, for example, where the inhibitor is TROFEXTM/MIP-1072/1095, or molecular imaging, for example, SPECT, or a PET scan using PSA, for example, PSMA antibody, such as, for example, capromad pendetide (Prostascint), a 1 1 1 -iridium labeled PSMA antibody.
- CT scan such as, for example, CT- MRI, chest X-ray (for tumors of the lung)
- PET scan such as, for example, a PET scan after administering an iodine 123-labelled PSA, for example, PSMA ligand, such as, for example
- reducing, slowing, or inhibiting tumor vascularization is meant a reduction in tumor vascularization of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, or a reduction in the appearance of new vasculature of about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, when compared to the amount of tumor vascularization before treatment.
- the reduction may refer to one tumor, or may be a sum or an average of the vascularization in more than one tumor.
- Methods of measuring tumor vascularization include, for example, CAT scan, MRI, for example, CT-MRI, or molecular imaging, for example, SPECT, or a PET scan, such as, for example, a PET scan after administering an iodine 123-labelled PSA, for example, PSMA ligand, such as, for example, where the inhibitor is TROFEXTM/MIP-1072/1095, or a PET scan using PSA, for example, PSMA antibody, such as, for example, capromad pendetide (Prostascint), a 1 1 1-iridium labeled PSMA antibody.
- PSMA antibody such as, for example, capromad pendetide (Prostascint), a 1 1 1-iridium labeled PSMA antibody.
- a tumor is classified as a prostate cancer tumor when, for example, the tumor is present in the prostate gland, or has derived from or metastasized from a tumor in the prostate gland, or produces PSA.
- a tumor has metastasized from a tumor in the prostate gland, when, for exampl is determined that the tumor has chromosomal breakpoints that are the same as, or similar to, a tumor in the prostate gland of the subject.
- prostate cancer is the most common solid tumor malignancy in men. It was expected to account for an estimated 186,320 new cases of prostate cancer in 2008 and 28,660 deaths. Jemal A, et al., Cancer statistics, 2008. CA Cancer J Clin. 58: 71-96, 2008. Approximately 70% of patients who experience PSA-progression after primary therapy will have metastases at some time during the course of their disease. Gittes RF, N Engl J Med. 324: 236-45, 1991 .
- Androgen deprivation therapy is the standard therapy for metastatic prostate cancer and achieves temporary tumor control or regression in 80-85% of patients.
- Crawford ED et al., N Engl J Med. 321 : 419-24, 1989
- Schellhammer PF et al., J Urol. 157: 1731-5, 1997
- Scher HI and Kelly WK J Clin Oncol. 1 1 : 1566-72, 1993
- the Gleason Sum of the original tumor, or the Gleason score is used to grade levels of prostate cancer in men, based on the microscopic evaluation of the tumor.
- a higher Gleason score denotes a cancer that has a worse prognosis as it is more aggressive, and is more likely to spread.
- An example of the grading system is discussed in Gleason DF., The Veteran's Administration Cooperative Urologic Research Group: histologic grading and clinical staging of prostatic carcinoma. In Tannenbaum M (ed.) Urologic Pathology: The Prostate. Lea and Febiger, Philadelphia, 1977; 171 -198. Most patients with prostate cancer who have been started on ADT are treated for a rising PSA after failure of primary therapy (e.g.
- prostate cancer includes different forms or stages, including, for example, metastatic, metastatic castration resistant, metastatic castration sensitive, regionally advanced, and localized prostate cancer.
- Antigen presenting cells are cells that can prime T-cells against a foreign antigen by displaying the foreign antigen with major histocompatibility complex (MHC) molecules on their surface.
- MHC major histocompatibility complex
- APCs There are two types of APCs, professional and non-professional.
- the professional APCs express both MHC class I molecules and MHC class II molecules, the non-professional APCs do not constitutively express MHC class II molecules.
- professional APCs are used in the methods herein.
- Professional APCs include, for example, B-cells, macrophages, and dendritic cells.
- an antigen-presenting cell is "activated," when one or more activities associated with activated antigen-presenting cells may be observed and/or measured.
- an antigen-presenting cell is activated when following contact with an expression vector presented herein, an activity associated with activation may be measured in the expression vector-contacted cell as compared to an antigen-presenting cell that has either not been contacted with the expression vector, or has been contacted with a negative control vector.
- the increased activity may be at a level of two, three, four, five, six, seven, eight, nine, or ten fold, or more, than that of the non- contacted cell, or the cell contacted with the negative control.
- one of the following activities may be enhanced in an antigen-presenting cell that has been contacted with the expression vector: co-stimulatory molecule expression on the antigen-presenting cell, nuclear translocation of NF-kappaB in antigen-presenting cells, DC maturation marker expression, such as, for example, toll-like receptor expression or CCR7 expression, specific cytotoxic T lymphocyte responses, such as, for example, specific lytic activity directed against tumor cells, or cytokine (for example, IL-2) or chemokine expression.
- co-stimulatory molecule expression on the antigen-presenting cell nuclear translocation of NF-kappaB in antigen-presenting cells
- DC maturation marker expression such as, for example, toll-like receptor expression or CCR7 expression
- specific cytotoxic T lymphocyte responses such as, for example, specific lytic activity directed against tumor cells
- cytokine for example, IL-2
- chemokine expression for example, chemokine expression.
- an amount of a composition that activates antigen-presenting cells or that "enhances" an immune response refers to an amount in which an immune response is observed that is greater or intensified or deviated in any way with the addition of the composition when compared to the same immune response measured without the addition of the composition.
- the lytic activity of cytotoxic T cells can be measured, for example, using a 51 Cr release assay, with and without the composition.
- the amount of the substance at which the CTL lytic activity is enhanced as compared to the CTL lytic activity without the composition is said to be an amount sufficient to enhance the immune response of the animal to the antigen.
- the immune response may be enhanced by a factor of at least about 2, or, for example, by a factor of about 3 or more.
- the amount of cytokines secreted may also be altered.
- the enhanced immune response may be an active or a passive immune response.
- the response may be part of an adaptive immunotherapy approach in which antigen-presenting cells are obtained with from a subject (e.g., a patient), then transduced or transfected with a composition comprising the expression vector or construct presented herein.
- the antigen-presenting cells may be obtained from, for example, the blood of the subject or bone marrow of the subject.
- the antigen-presenting cells may then be administered to the same or different animal, or same or different subject (e.g., same or different donors).
- the subject for example, a patient
- has or is suspected of having a cancer such as for example, prostate cancer
- the method of enhancing the immune response is practiced in conjunction with a known cancer therapy or any known therapy to treat the infectious disease.
- the innate immune system uses a set of germline-encoded receptors for the recognition of conserved molecular patterns present in microorganisms. These molecular patterns occur in certain constituents of microorganisms including: lipopolysaccharides, peptidoglycans, lipoteichoic acids, phosphatidyl cholines, bacteria-specific proteins, including lipoproteins, bacterial DNAs, viral single and double-stranded RNAs, unmethylated CpG-DNAs, mannans and a variety of other bacterial and fungal cell wall components. Such molecular patterns can also occur in other molecules such as plant alkaloids. These targets of innate immune recognition are called
- PAMPs Pathogen Associated Molecular Patterns
- PRRs Pattern Recognition Receptors
- CD14, DEC205, collectins Some of these receptors recognize PAMPs directly (e.g., CD14, DEC205, collectins), while others (e.g., complement receptors) recognize the products generated by PAMP recognition.
- Cellular PRRs are expressed on effector cells of the innate immune system, including cells that function as professional antigen-presenting cells (APC) in adaptive immunity.
- effector cells include, but are not limited to, macrophages, dendritic cells, B lymphocytes and surface epithelia.
- APC professional antigen-presenting cells
- This expression profile allows PRRs to directly induce innate effector mechanisms, and also to alert the host organism to the presence of infectious agents by inducing the expression of a set of endogenous signals, such as inflammatory cytokines and chemokines, as discussed below. This latter function allows efficient mobilization of effector forces to combat the invaders.
- DCs dendritic cells
- DCs present antigen via their MHC II molecules to CD4+ T helper cells, inducing the upregulation of T cell CD40 ligand (CD40L) that, in turn, engages the DC CD40 receptor.
- CD40L T cell CD40 ligand
- This DC:T cell interaction induces rapid expression of additional DC molecules that are crucial for the initiation of a potent CD8+ cytotoxic T lymphocyte (CTL) response, including further upregulation of MHC I and II molecules, adhesion molecules, costimulatory molecules (e.g., B7.1 ,B7.2), cytokines (e.g., IL-12) and anti-apoptotic proteins (e.g., Bcl-2) (Anderson, D. M., et al., Nature, 1997, Nov. 13. 390: p. 175-9; Ohshima, Y., et al., J
- CD8+ T cells exit lymph nodes, reenter circulation and home to the original site of inflammation to destroy pathogens or malignant cells.
- CD40 receptor serving as the "on switch" for DCs
- CD40 is a 48-kDa transmembrane member of the TNF receptor superfamily (McWhirter, S. M., et al., Proc Natl Acad Sci U S A, 1999, Jul. 20. 96: p. 8408-13). CD40-CD40L interaction induces CD40 trimerization, necessary for initiating signaling cascades involving TNF receptor associated factors (TRAFs) (Ni, C, et al., PNAS, 2000, 97(19): 10395-10399; Pullen,
- TNF receptor associated factors TNF receptor associated factors
- CD40 uses these signaling molecules to activate several transcription factors in DCs, including NF-kappa B, AP-1 , STAT3, and p38MAPK (McWhirter, S.M., et al., 1999). Due to their unique method of processing and presenting antigens and the potential for high-level expression of costimulatory and cytokine molecules, dendritic cells (DC) are effective antigen- presenting cells (APCs) for priming and activating naive T cells (Banchereau J, et al., Ann N Y Acad Sci. 2003; 987:180-187).
- DC dendritic cells
- APCs effective antigen- presenting cells
- DC-based cancer vaccines have been unsatisfactory, probably due to a number of key deficiencies, including suboptimal activation, limited migration to draining lymph nodes, and an insufficient life span for optimal T cell activation in the lymph node environment.
- a parameter in the optimization of DC-based cancer vaccines is the interaction of DCs with immune effector cells, such as CD4+, CD8+ T cells and T regulatory (Treg) cells.
- DCs In these interactions, the maturation state of the DCs is a key factor in determining the resulting effector functions (Steinman RM, Annu Rev Immunol. 2003;21 :685-71 1 ).
- DCs need to be fully mature, expressing high levels of co-stimulatory molecules, (like CD40, CD80, and CD86), and pro-inflammatory cytokines, like IL- 12p70 and IL-6. Equally important, the DCs must be able to migrate efficiently from the site of vaccination to draining lymph nodes to initiate T cell interactions (Vieweg J, et al., Springer Semin Immunopathol. 2005;26:329-341 ).
- MC maturation cytokine cocktail
- PGE2 prostaglandin E2
- PGE2 has also been reported to have numerous properties that are potentially deleterious to the stimulation of an immune response, including suppression of T-cell proliferation, (Goodwin JS, et al., J Exp Med. 1977; 146:1719-1734; Goodwin JS, Curr Opin Immunol.
- DC activation system based on targeted temporal control of the CD40 signaling pathway has been developed to extend the pro-stimulatory state of DCs within lymphoid tissues.
- CD40 receptor was re-engineered so that the cytoplasmic domain of CD40 was fused to synthetic ligand-binding domains along with a membrane-targeting sequence.
- AP20187 AP20187
- CID chemical inducer of dimerization
- Pattern recognition receptor (PRR) signaling an example of which is Toll-like receptor (TLR) signaling also plays a critical role in the induction of DC maturation and activation; human DCs express, multiple distinct TLRs (Kadowaki N, et al., J Exp Med. 2001 ; 194:863-869).
- the eleven mammalian TLRs respond to various pathogen-derived macromolecules, contributing to the activation of innate immune responses along with initiation of adaptive immunity.
- Lipopolysaccharide and a clinically relevant derivative, monophosphoryl lipid A (MPL), bind to cell surface TLR-4 complexes(Kadowaki N, et al., J Exp Med. 2001 ;194:863-869), leading to various signaling pathways that culminate in the induction of transcription factors, such as NF- kappaB and IRF3, along with mitogen-activated protein kinases (MAPK) p38 and c-Jun kinase (JNK) (Ardeshna KM, et al., Blood. 2000;96:1039-1046; Ismaili J, et al., J Immunol. 2002; 168:926- 932).
- MPL monophosphoryl lipid A
- DCs mature, and partially upregulate pro-inflammatory cytokines, like IL- 6, IL-12, and Type I interferons (Rescigno M, et al., J Exp Med. 1998; 188:2175-2180). LPS- induced maturation has been shown to enhance the ability of DCs to stimulate antigen-specific T cell responses in vitro and in vivo (Lapointe R, et al., Eur J Immunol. 2000;30:3291 -3298).
- Expression constructs encode a co-stimulatory polypeptide and a ligand-binding domain, all operatively linked.
- operably linked is meant to indicate that the promoter sequence is functionally linked to a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA corresponding to the second sequence. More particularly, more than one ligand-binding domain is used in the expression construct.
- the expression construct contains a membrane-targeting sequence.
- Appropriate expression constructs may include a co-stimulatory polypeptide element on either side of the above FKBP ligand-binding elements.
- the expression construct may be inserted into a vector, for example a viral vector or plasmid.
- the steps of the methods provided may be performed using any suitable method, these methods include, without limitation, methods of transducing, transforming, or otherwise providing nucleic acid to the antigen-presenting cell, presented herein.
- the truncated MyD88 peptide is encoded by the nucleotide sequence of SEQ ID NO: 5 (with or without DNA linkers or has the amino acid sequence of SEQ ID NO: 6).
- the CD40 cytoplasmic polypeptide region is encoded by a polynucleotide sequence in SEQ ID NO: 1 .
- Co-stimulatory polypeptide molecules are capable of amplifying the T-cell-mediated response by upregulating dendritic cell expression of antigen presentation molecules.
- Co-stimulatory proteins that are contemplated include, for example, but are not limited, to the members of tumor necrosis factor (TNF) family (i.e., CD40, RANK/TRANCE-R, OX40, 4-1 B), Toll-like receptors, C-reactive protein receptors, Pattern Recognition Receptors, and HSP receptors.
- TNF tumor necrosis factor
- Co-stimulatory polypeptides include any molecule or polypeptide that activates the NF-kappaB pathway, Akt pathway, and/or p38 pathway.
- the DC activation system is based upon utilizing a recombinant signaling molecule fused to a ligand-binding domains (i.e., a small molecule binding domain) in which the co-stimulatory polypeptide is activated and/or regulated with a ligand resulting in oligomerization (i.e., a lipid-permeable, organic, dimerizing drug).
- co-stimulatory polypeptides include antibodies, natural ligands, and/or artificial cross-reacting or synthetic ligands.
- dimerization systems contemplated include the coumermycin/DNA gyrase B system.
- Co-stimulatory polypeptides that can be used include those that activate NF-kappaB and other variable signaling cascades for example the p38 pathway and/or Akt pathway.
- Such co-stimulatory polypeptides include, but are not limited to Pattern Recognition Receptors, C-reactive protein receptors (i.e., Nodi , Nod2, PtX3-R), TNF receptors (i.e., CD40, RANK/TRANCE-R, OX40, 4- 1 BB), and HSP receptors (Lox-1 and CD-91 ).
- C-reactive protein receptors i.e., Nodi , Nod2, PtX3-R
- TNF receptors i.e., CD40, RANK/TRANCE-R, OX40, 4- 1 BB
- HSP receptors Lox-1 and CD-91 .
- Pattern Recognition Receptors include, but are not limited to endocytic pattern-recognition receptors (i.e., mannose receptors, scavenger receptors (i.e., Mac-1 , LRP, peptidoglycan, techoic acids, toxins, CD1 1 c/CR4)); external signal pattern- recognition receptors (Toll-like receptors (TLR1 , TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10), peptidoglycan recognition protein, (PGRPs bind bacterial peptidoglycan, and CD14); internal signal pattern-recognition receptors (i.e., NOD-receptors 1 & 2), RIG1 , and PRRs shown in Figure 2.
- endocytic pattern-recognition receptors i.e., mannose receptors, scavenger receptors (i.e., Mac-1 , LRP, peptidoglycan, tech
- Pattern Recognition Receptors suitable for the present methods and composition also include, for example, those discussed in, for example, Werts C, et al., Cell Death and Differentiation (2006) 13:798-815; Meylan, E., et al., Nature (2006) 442:39-44; and Strober, W., et al., Nature Reviews (2006) 6:9-20.
- the co-stimulatory polypeptide molecule is CD40.
- the CD40 molecule comprises a nucleic acid molecule which: (1 ) hybridizes under stringent conditions to a nucleic acid having the sequence of a known CD40 gene and (2) codes for a CD40 polypeptide.
- the CD40 polypeptide may, in certain examples, lack the extracellular domain.
- Exemplary polynucleotide sequences that encode CD40 polypeptides include, but are not limited to SEQ.ID.NO: 1 and CD40 isoforms from other species. It is contemplated that other normal or mutant variants of CD40 can be used in the present methods and compositions.
- a CD40 region can have an amino acid sequence that differs from the native sequence by one or more amino acid substitutions, deletions and/or insertions.
- one or more TNF receptor associated factor (TRAF) binding regions may be eliminated or effectively eliminated (e.g., a CD40 amino acid sequence is deleted or altered such that a TRAF protein does not bind or binds with lower affinity than it binds to the native CD40 sequence).
- a TRAF 3 binding region is deleted or altered such that it is eliminated or effectively eliminated (e.g., amino acids 250-254 may be altered or deleted; Hauer et al., PNAS 102(8): 2874-2879 (2005)).
- the present methods involve the manipulation of genetic material to produce expression constructs that encode an inducible form of CD40 (iCD40).
- Such methods involve the generation of expression constructs containing, for example, a heterologous nucleic acid sequence encoding CD40 cytoplasmic domain and a means for its expression.
- the vector can be replicated in an appropriate helper cell, viral particles may be produced therefrom, and cells infected with the recombinant virus particles.
- the CD40 molecule presented herein may, for example, lack the extracellular domain.
- the extracellular domain is truncated or removed. It is also contemplated that the extracellular domain can be mutated using standard mutagenesis, insertions, deletions, or substitutions to produce a CD40 molecule that does not have a functional extracellular domain.
- a CD40 nucleic acid may have the nucleic acid sequence of SEQ.ID.NO: 1 .
- the CD40 nucleic acids also include homologs and alleles of a nucleic acid having the sequence of SEQ.ID.NO: 1 , as well as, functionally equivalent fragments, variants, and analogs of the foregoing nucleic acids.
- the gene will be a heterologous polynucleotide sequence derived from a source other than the viral genome, which provides the backbone of the vector.
- the gene is derived from a prokaryotic or eukaryotic source such as a bacterium, a virus, yeast, a parasite, a plant, or even an animal.
- the heterologous DNA also is derived from more than one source, i.e., a multigene construct or a fusion protein.
- the heterologous DNA also may include a regulatory sequence, which is derived from one source and the gene from a different source.
- the ligand-binding ("dimerization") domain of the expression construct can be any convenient domain that will allow for induction using a natural or unnatural ligand, for example, an unnatural synthetic ligand.
- the ligand-binding domain can be internal or external to the cellular membrane, depending upon the nature of the construct and the choice of ligand.
- a wide variety of ligand- binding proteins, including receptors, are known, including ligand-binding proteins associated with the cytoplasmic regions indicated above.
- the term "ligand-binding domain can be interchangeable with the term "receptor".
- ligand-binding proteins for which ligands for example, small organic ligands
- ligand-binding domains or receptors include the FKBPs and cyclophilin receptors, the steroid receptors, the tetracycline receptor, the other receptors indicated above, and the like, as well as "unnatural" receptors, which can be obtained from antibodies, particularly the heavy or light chain subunit, mutated sequences thereof, random amino acid sequences obtained by stochastic procedures, combinatorial syntheses, and the like.
- the ligand-binding region is selected from the group consisting of FKBP ligand-binding region, cyclophilin receptor ligand-binding region, steroid receptor ligand-binding region, cyclophilin receptors ligand-binding region, and tetracycline receptor ligand-binding region.
- the ligand-binding region comprises an Fv'Fvls sequence.
- the Fv'Fvls sequence further comprises an additional Fv' sequence. Examples include, for example, those discussed in Kopytek, S.J., et al., Chemistry & Biology 7:313-321 (2000) and in Gestwicki, J.E., et al., Combinatorial Chem.
- the ligand-binding domains or receptor domains will be at least about 50 amino acids, and fewer than about 350 amino acids, usually fewer than 200 amino acids, either as the natural domain or truncated active portion thereof.
- the binding domain may, for example, be small ( ⁇ 25 kDa, to allow efficient transfection in viral vectors), monomeric, nonimmunogenic, have synthetically accessible, cell permeable, nontoxic ligands that can be configured for dimerization.
- the receptor domain can be intracellular or extracellular depending upon the design of the expression construct and the availability of an appropriate ligand.
- the binding domain can be on either side of the membrane, but for hydrophilic ligands, particularly protein ligands, the binding domain will usually be external to the cell membrane, unless there is a transport system for internalizing the ligand in a form in which it is available for binding.
- the construct can encode a signal peptide and transmembrane domain 5' or 3' of the receptor domain sequence or may have a lipid attachment signal sequence 5' of the receptor domain sequence. Where the receptor domain is between the signal peptide and the transmembrane domain, the receptor domain will be extracellular.
- the portion of the expression construct encoding the receptor can be subjected to mutagenesis for a variety of reasons.
- the mutagenized protein can provide for higher binding affinity, allow for discrimination by the ligand of the naturally occurring receptor and the mutagenized receptor, provide opportunities to design a receptor-ligand pair, or the like.
- the change in the receptor can involve changes in amino acids known to be at the binding site, random mutagenesis using combinatorial techniques, where the codons for the amino acids associated with the binding site or other amino acids associated with conformational changes can be subject to mutagenesis by changing the codon(s) for the particular amino acid, either with known changes or randomly, expressing the resulting proteins in an appropriate prokaryotic host and then screening the resulting proteins for binding.
- Antibodies and antibody subunits e.g., heavy or light chain, particularly fragments, more particularly all or part of the variable region, or fusions of heavy and light chain to create high- affinity binding, can be used as the binding domain.
- Antibodies that are contemplated include ones that are an ectopically expressed human product, such as an extracellular domain that would not trigger an immune response and generally not expressed in the periphery (i.e., outside the
- CNS/brain area Such examples, include, but are not limited to low affinity nerve growth factor receptor (LNGFR), and embryonic surface proteins (i.e., carcinoembryonic antigen).
- LNGFR low affinity nerve growth factor receptor
- embryonic surface proteins i.e., carcinoembryonic antigen
- antibodies can be prepared against haptenic molecules, which are physiologically acceptable, and the individual antibody subunits screened for binding affinity.
- the cDNA encoding the subunits can be isolated and modified by deletion of the constant region, portions of the variable region, mutagenesis of the variable region, or the like, to obtain a binding protein domain that has the appropriate affinity for the ligand.
- almost any physiologically acceptable haptenic compound can be employed as the ligand or to provide an epitope for the ligand.
- natural receptors can be employed, where the binding domain is known and there is a useful ligand for binding.
- the transduced signal will normally result from ligand-mediated oligomerization of the chimeric protein molecules, i.e., as a result of oligomerization following ligand-binding, although other binding events, for example allosteric activation, can be employed to initiate a signal.
- the construct of the chimeric protein will vary as to the order of the various domains and the number of repeats of an individual domain.
- the ligand for the ligand-binding domains/receptor domains of the chimeric surface membrane proteins will usually be multimeric in the sense that it will have at least two binding sites, with each of the binding sites capable of binding to the ligand receptor domain.
- the subject ligands will be a dimer or higher order oligomer, usually not greater than about tetrameric, of small synthetic organic molecules, the individual molecules typically being at least about 150 Da and less than about 5 kDa, usually less than about 3 kDa.
- a variety of pairs of synthetic ligands and receptors can be employed.
- dimeric FK506 can be used with an FKBP12 receptor
- dimerized cyclosporin A can be used with the cyclophilin receptor
- dimerized estrogen with an estrogen receptor
- dimerized glucocorticoids with a glucocorticoid receptor
- dimerized tetracycline with the tetracycline receptor
- dimerized vitamin D with the vitamin D receptor
- higher orders of the ligands e.g., trimeric can be used.
- any of a large variety of compounds can be used.
- a significant characteristic of these ligand units is that each binding site is able to bind the receptor with high affinity and they are able to be dimerized chemically. Also, methods are available to balance the hydrophobicity/hydrophilicity of the ligands so that they are able to dissolve in serum at functional levels, yet diffuse across plasma membranes for most applications.
- the present methods utilize the technique of chemically induced dimerization (CID) to produce a conditionally controlled protein or polypeptide.
- CID chemically induced dimerization
- the CID system uses synthetic bivalent ligands to rapidly crosslink signaling molecules that are fused to ligand-binding domains. This system has been used to trigger the oligomerization and activation of cell surface (Spencer, D. M., et al., Science, 1993. 262: p. 1019-1024; Spencer D. M. et al., Curr Biol 1996, 6:839-847; Blau, C. A.
- the CID system is based upon the notion that surface receptor aggregation effectively activates downstream signaling cascades.
- the CID system uses a dimeric analog of the lipid permeable immunosuppressant drug, FK506, which loses its normal bioactivity while gaining the ability to crosslink molecules genetically fused to the FK506-binding protein, FKBP12.
- FK506 lipid permeable immunosuppressant drug
- FKBP12 FKBP12
- FKBP12 permits specific activation of the recombinant receptor in vivo without the induction of non-specific side effects through endogenous FKBP12.
- FKBP12 variants having amino acid substitutions and deletions, such as FKBP12V 36 , that bind to a dimerizer drug, may also be used.
- the synthetic ligands are resistant to protease degradation, making them more efficient at activating receptors in vivo than most delivered protein agents.
- the ligands used are capable of binding to two or more of the ligand-binding domains.
- the chimeric proteins may be able to bind to more than one ligand when they contain more than one ligand-binding domain.
- the ligand is typically a non-protein or a chemical.
- Exemplary ligands include, but are not limited to dimeric FK506 (e.g., FK1012).
- the ligand is a small molecule.
- the appropriate ligand for the selected ligand-binding region may be selected. Often, the ligand is dimeric, sometimes, the ligand is a dimeric FK506 or a dimeric FK506 analog.
- the ligand is AP1903 (CAS Index Name: 2-Piperidinecarboxylic acid, 1-[(2S)-1-oxo-2-(3,4,5-trimethoxyphenyl)butyl]-, 1 ,2- ethanediylbis[imino(2-oxo-2, 1-ethanediyl)oxy-3, 1 -phenylene[(1 R)-3-(3,4- dimethoxyphenyl)propylidene]]] ester, [2S-[1 (R * ),2R * [S * [S * [1 (R * ),2R * ]]]]]]]-(9CI)
- the ligand is AP20187.
- the multimeric molecule can be an antibody that binds to an epitope in the CD40 extracellular domain (e.g., humanized anti-CD40 antibody; Tai et al., Cancer Research 64, 2846- 2852 (2004)), can be a CD40 ligand (e.g., U.S. Patent No. 6,497,876 (Maraskovsky et al.)) or may be another co-stimulatory molecule (e.g., B7/CD28). It is understood that conservative variations in sequence, that do not affect the function, as assayed herein, are within the scope of the present claims.
- CD40 activation Since the mechanism of CD40 activation is fundamentally based on trimerization, this receptor is particularly amenable to the CID system. CID regulation provides the system with 1 ) temporal control, 2) reversibility by addition of a non-active monomer upon signs of an autoimmune reaction, and 3) limited potential for non-specific side effects. In addition, inducible in vivo DC CD40 activation would circumvent the requirement of a second "danger" signal normally required for complete induction of CD40 signaling and would potentially promote DC survival in situ allowing for enhanced T cell priming. Thus, engineering DC vaccines to express iCD40 amplifies the T cell- mediated killing response by upregulating DC expression of antigen presentation molecules, adhesion molecules, TH1 promoting cytokines, and pro-survival factors.
- dimerization systems contemplated include the coumermycin/DNA gyrase B system.
- Membrane-targeting A membrane-targeting sequence provides for transport of the chimeric protein to the cell surface membrane, where the same or other sequences can encode binding of the chimeric protein to the cell surface membrane.
- Molecules in association with cell membranes contain certain regions that facilitate the membrane association, and such regions can be incorporated into a chimeric protein molecule to generate membrane-targeted molecules.
- some proteins contain sequences at the N-terminus or C-terminus that are acylated, and these acyl moieties facilitate membrane association. Such sequences are recognized by acyltransferases and often conform to a particular sequence motif.
- Certain acylation motifs are capable of being modified with a single acyl moiety (often followed by several positively charged residues (e.g.
- human c-Src M-G-S-N-K- S-K-P-K-D-A-S-Q-R-R-R) to improve association with anionic lipid head groups
- others are capable of being modified with multiple acyl moieties.
- the N-terminal sequence of the protein tyrosine kinase Src can comprise a single myristoyl moiety.
- Dual acylation regions are located within the N-terminal regions of certain protein kinases, such as a subset of Src family members (e.g., Yes, Fyn, Lck) and G-protein alpha subunits.
- Such dual acylation regions often are located within the first eighteen amino acids of such proteins, and conform to the sequence motif Met-Gly-Cys-Xaa-Cys, where the Met is cleaved, the Gly is N-acylated and one of the Cys residues is S-acylated.
- the Gly often is myristoylated and a Cys can be palmitoylated.
- These and other acylation motifs include, for example, those discussed in
- a native sequence from a protein containing an acylation motif is incorporated into a chimeric protein.
- an N-terminal portion of Lck, Fyn or Yes or a G-protein alpha subunit such as the first twenty-five N-terminal amino acids or fewer from such proteins (e.g., about 5 to about 20 amino acids, about 10 to about 19 amino acids, or about 15 to about 19 amino acids of the native sequence with optional mutations), may be incorporated within the N-terminus of a chimeric protein.
- a C-terminal sequence of about 25 amino acids or less from a G-protein gamma subunit containing a CAAX box motif sequence can be linked to the C-terminus of a chimeric protein.
- an acyl moiety has a log p value of +1 to +6, and sometimes has a log p value of +3 to +4.5.
- Log p values are a measure of hydrophobicity and often are derived from octanol/water partitioning studies, in which molecules with higher hydrophobicity partition into octanol with higher frequency and are characterized as having a higher log p value.
- Log p values are published for a number of lipophilic molecules and log p values can be calculated using known partitioning processes (e.g., Chemical Reviews, Vol. 71 , Issue 6, page 599, where entry 4493 shows lauric acid having a log p value of 4.2). Any acyl moiety can be linked to a peptide composition discussed above and tested for antimicrobial activity using known methods and those discussed hereafter.
- the acyl moiety sometimes is a C1 -C20 alkyl, C2-C20 alkenyl, C2-C20 alkynyl, C3-C6 cycloalkyl, C1 -C4 haloalkyl, C4-C12 cyclalkylalkyl, aryl, substituted aryl, or aryl (C1 - C4) alkyl, for example.
- Any acyl-containing moiety sometimes is a fatty acid, and examples of fatty acid moieties are propyl (C3), butyl (C4), pentyl (C5), hexyl (C6), heptyl (C7), octyl (C8), nonyl (C9), decyl (C10), undecyl (C1 1 ), lauryl (C12), myristyl (C14), palmityl (C16), stearyl (C18), arachidyl (C20), behenyl (C22) and lignoceryl moieties (C24), and each moiety can contain 0, 1 , 2, 3, 4, 5, 6, 7 or 8 unsaturations (i.e., double bonds).
- An acyl moiety sometimes is a lipid molecule, such as a phosphatidyl lipid (e.g., phosphatidyl serine, phosphatidyl inositol, phosphatidyl ethanolamine, phosphatidyl choline), sphingolipid (e.g., shingomyelin, sphingosine, ceramide, ganglioside, cerebroside), or modified versions thereof .
- a phosphatidyl lipid e.g., phosphatidyl serine, phosphatidyl inositol, phosphatidyl ethanolamine, phosphatidyl choline
- sphingolipid e.g., shingomyelin, sphingosine, ceramide, ganglioside, cerebroside
- one, two, three, four or five or more acyl moieties are linked to a membrane association region.
- a chimeric protein herein also may include a single-pass or multiple pass transmembrane sequence (e.g., at the N-terminus or C-terminus of the chimeric protein).
- Single pass transmembrane regions are found in certain CD molecules, tyrosine kinase receptors, serine/threonine kinase receptors, TGFbeta, BMP, activin and phosphatases.
- Single pass transmembrane regions often include a signal peptide region and a transmembrane region of about 20 to about 25 amino acids, many of which are hydrophobic amino acids and can form an alpha helix.
- a short track of positively charged amino acids often follows the transmembrane span to anchor the protein in the membrane.
- Multiple pass proteins include ion pumps, ion channels, and transporters, and include two or more helices that span the membrane multiple times. All or substantially all of a multiple pass protein sometimes is incorporated in a chimeric protein.
- Sequences for single pass and multiple pass transmembrane regions are known and can be selected for incorporation into a chimeric protein molecule.
- membrane-targeting sequence can be employed that is functional in the host and may, or may not, be associated with one of the other domains of the chimeric protein.
- such sequences include, but are not limited to myristoylation-targeting sequence, palmitoylation- targeting sequence, prenylation sequences (i.e., farnesylation, geranyl-geranylation, CAAX Box), protein-protein interaction motifs or transmembrane sequences (utilizing signal peptides) from receptors. Examples include those discussed in, for example, ten Klooster JP et al, Biology of the Cell (2007) 99, 1 -12, Vincent, S., et al., Nature Biotechnology 21 :936-40, 1098 (2003).
- PH domains can increase protein retention at various membranes.
- an ⁇ 120 amino acid pleckstrin homology (PH) domain is found in over 200 human proteins that are typically involved in intracellular signaling.
- PH domains can bind various phosphatidylinositol (PI) lipids within membranes (e.g. PI (3,4,5)-P3, PI (3,4)-P2, PI (4,5)-P2) and thus play a key role in recruiting proteins to different membrane or cellular compartments.
- PI phosphatidylinositol
- PI phosphatidylinositol
- PI phosphatidylinositol
- PI phosphatidylinositol
- PTEN phosphatidylinositol
- interaction of membranes with PH domains is not as stable as by acyl lipids.
- the expression constructs contain nucleic acid constructs whose expression is identified in vitro or in vivo by including a marker in the expression construct. Such markers would confer an identifiable change to the cell permitting easy identification of cells containing the expression construct. Usually the inclusion of a drug selection marker aids in cloning and in the selection of transformants. For example, genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selectable markers. Alternatively, enzymes such as herpes simplex virus thymidine kinase (tk) are employed.
- tk herpes simplex virus thymidine kinase
- Immunologic surface markers containing the extracellular, non-signaling domains or various proteins also can be employed, permitting a straightforward method for magnetic or fluorescence antibody-mediated sorting.
- the selectable marker employed is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product.
- Further examples of selectable markers include, for example, reporters such as EGFP, beta-gal or chloramphenicol acetyltransferase (CAT).
- the particular promoter employed to control the expression of a polynucleotide sequence of interest is not believed to be important, so long as it is capable of directing the expression of the polynucleotide in the targeted cell.
- the polynucleotide sequence-coding region may, for example, be placed adjacent to and under the control of a promoter that is capable of being expressed in a human cell.
- a promoter might include either a human or viral promoter.
- the human cytomegalovirus (CMV) immediate early gene promoter can be used to obtain high-level expression of the coding sequence of interest.
- CMV cytomegalovirus
- the use of other viral or mammalian cellular or bacterial phage promoters which are well known in the art to achieve expression of a coding sequence of interest is contemplated as well, provided that the levels of expression are sufficient for a given purpose.
- a promoter with well-known properties, the level and pattern of expression of the protein of interest following transfection or transformation can be optimized.
- Selection of a promoter that is regulated in response to specific physiologic or synthetic signals can permit inducible expression of the gene product.
- a transgene or transgenes when a multicistronic vector is utilized, is toxic to the cells in which the vector is produced in, it is desirable to prohibit or reduce expression of one or more of the transgenes.
- transgenes that are toxic to the producer cell line are pro-apoptotic and cytokine genes.
- inducible promoter systems are available for production of viral vectors where the transgene products are toxic (add in more inducible promoters).
- the ecdysone system (Invitrogen, Carlsbad, CA) is one such system. This system is designed to allow regulated expression of a gene of interest in mammalian cells. It consists of a tightly regulated expression mechanism that allows virtually no basal level expression of the transgene, but over 200-fold inducibility.
- the system is based on the heterodimeric ecdysone receptor of Drosophila, and when ecdysone or an analog such as muristerone A binds to the receptor, the receptor activates a promoter to turn on expression of the downstream transgene high levels of mRNA transcripts are attained.
- both monomers of the heterodimeric receptor are constitutively expressed from one vector, whereas the ecdysone-responsive promoter, which drives expression of the gene of interest, is on another plasmid.
- Engineering of this type of system into the gene transfer vector of interest would therefore be useful.
- Cotransfection of plasmids containing the gene of interest and the receptor monomers in the producer cell line would then allow for the production of the gene transfer vector without expression of a potentially toxic transgene.
- expression of the transgene could be activated with ecdysone or muristeron A.
- Tet-OffTM or Tet-OnTM system (Clontech, Palo Alto, CA) originally developed by Gossen and Bujard (Gossen and Bujard, Proc. Natl. Acad. Sci. USA, 89:5547-5551 , 1992; Gossen et al., Science, 268:1766-1769, 1995).
- This system also allows high levels of gene expression to be regulated in response to tetracycline or tetracycline derivatives such as doxycycline.
- Tet-OnTM system gene expression is turned on in the presence of doxycycline
- Tet-OffTM system gene expression is turned on in the absence of doxycycline.
- tetracycline-controlled transactivator which is composed, in the Tet-OffTM system, of the VP16 domain from the herpes simplex virus and the wild-type tertracycline repressor.
- the tetracycline repressor is not wild type and in the presence of doxycycline activates transcription.
- the Tet-OffTM system may be used so that the producer cells could be grown in the presence of tetracycline or doxycycline and prevent expression of a potentially toxic transgene, but when the vector is introduced to the patient, the gene expression would be constitutively on.
- a transgene in a gene therapy vector.
- different viral promoters with varying strengths of activity are utilized depending on the level of expression desired.
- the CMV immediate early promoter is often used to provide strong transcriptional activation.
- the CMV promoter is reviewed in Donnelly, J.J., et al., 1997. Annu. Rev. Immunol.. 15:617-48. Modified versions of the CMV promoter that are less potent have also been used when reduced levels of expression of the transgene are desired.
- retroviral promoters such as the LTRs from MLV or MMTV are often used.
- viral promoters that are used depending on the desired effect include SV40, RSV LTR, HIV-1 and HIV-2 LTR, adenovirus promoters such as from the E1A, E2A, or MLP region, AAV LTR, HSV-TK, and avian sarcoma virus.
- tissue specific promoters are used to effect transcription in specific tissues or cells so as to reduce potential toxicity or undesirable effects to non-targeted tissues. These promoters may result in reduced expression compared to a stronger promoter such as the CMV promoter, but may also result in more limited expression, and immunogenicity. (Bojak, A., et al.,2002. Vaccine.
- tissue specific promoters such as the PSA associated promoter or prostate-specific glandular kallikrein, or the muscle creatine kinase gene may be used where appropriate.
- telomeres are hormone or cytokine regulatable.
- Cytokine and inflammatory protein responsive promoters that can be used include K and T kininogen (Kageyama et al., (1987) J. Biol. Chem., 262,2345-2351 ), c-fos, TNF-alpha, C- reactive protein (Arcone, et al., (1988) Nucl.
- MV Immunodeficiency Virus
- Moloney virus Moloney virus
- ALV Epstein Barr virus
- Rous Sarcoma virus human actin
- myosin myosin
- hemoglobin and creatine.
- Promoters are selected such that they are functional in the desired cells or tissue.
- this list of promoters should not be construed to be exhaustive or limiting; other promoters that are used in conjunction with the promoters and methods disclosed herein. 2. Enhancers
- Enhancers are genetic elements that increase transcription from a promoter located at a distant position on the same molecule of DNA. Early examples include the enhancers associated with immunoglobulin and T cell receptors that both flank the coding sequence and occur within several introns. Many viral promoters, such as CMV, SV40, and retroviral LTRs are closely associated with enhancer activity and are often treated like single elements. Enhancers are organized much like promoters. That is, they are composed of many individual elements, each of which binds to one or more transcriptional proteins. The basic distinction between enhancers and promoters is operational. An enhancer region as a whole stimulates transcription at a distance and often independent of orientation; this need not be true of a promoter region or its component elements. On the other hand, a promoter has one or more elements that direct initiation of RNA synthesis at a particular site and in a particular orientation, whereas enhancers lack these specificities.
- LCRs locus-control regions
- Any promoter/enhancer combination (as per the Eukaryotic Promoter Data Base EPDB) can be used to drive expression of the gene, although many will restrict expression to a particular tissue type or subset of tissues, (reviewed in, for example, Kutzler, M.A., and Weiner, D.B., 2008. Nature Reviews Genetics 9:776-88). Examples include, but are not limited to, enhancers from the human actin, myosin, hemoglobin, muscle creatine kinase, sequences, and from viruses CMV, RSV, and EBV. Appropriate enhancers may be selected for particular applications. Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided, either as part of the delivery complex or as an additional genetic expression construct.
- polyadenylation signals Where a cDNA insert is employed, one will typically desire to include a polyadenylation signal to effect proper polyadenylation of the gene transcript.
- the nature of the polyadenylation signal is not believed to be crucial to the successful practice of the present methods, and any such sequence is employed such as human or bovine growth hormone and SV40 polyadenylation signals and LTR polyadenylation signals.
- One non-limiting example is the SV40 polyadenylation signal present in the pCEP3 plasmid (Invitrogen, Carlsbad, California).
- a terminator also contemplated as an element of the expression cassette. These elements can serve to enhance message levels and to minimize read through from the cassette into other sequences.
- Termination or poly(A) signal sequences may be, for example, positioned about 1 1-30 nucleotides downstream from a conserved sequence (AAUAAA) at the 3' end of the mRNA. (Montgomery, D.L., et al., 1993. DNA Cell Biol. 12:777-83; Kutzler, M.A., and Weiner, D.B., 2008. Nature Rev. Gen. 9:776-88).
- AAUAAA conserved sequence
- a specific initiation signal also may be required for efficient translation of coding sequences.
- Exogenous translational control signals including the ATG initiation codon, may need to be provided.
- the initiation codon is placed in-frame with the reading frame of the desired coding sequence to ensure translation of the entire insert.
- the exogenous translational control signals and initiation codons can be either natural or synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements.
- IRES internal ribosome entry sites
- IRES elements are able to bypass the ribosome-scanning model of 5' methylated cap-dependent translation and begin translation at internal sites (Pelletier and Sonenberg, Nature, 334:320-325, 1988). IRES elements from two members of the picornavirus family (polio and encephalomyocarditis) have been discussed (Pelletier and
- IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating
- each open reading frame is accessible to ribosomes for efficient translation.
- Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message (see U.S. Patent Nos. 5,925,565 and
- Protein production may also be increased by optimizing the codons in the transgene. Species specific codon changes may be used to increase protein production. Also, codons may be optimized to produce an optimized RNA, which may result in more efficient translation. By optimizing the codons to be incorporated in the RNA, elements such as those that result in a secondary structure that causes instability, secondary mRNA structures that can, for example, inhibit ribosomal binding, or cryptic sequences that can inhibit nuclear export of mRNA can be removed. (Kutzler, M.A., and Weiner, D.B., 2008. Nature Rev. Gen. 9:776-88; Yan., J. et al., 2007. Mol. Ther.
- Leader sequences may be added to enhance the stability of mRNA and result in more efficient translation.
- the leader sequence is usually involved in targeting the mRNA to the endoplasmic reticulum. Examples include, the signal sequence for the HIV-1 envelope glycoprotein (Env), which delays its own cleavage, and the IgE gene leader sequence (Kutzler, M.A., and Weiner, D.B., 2008. Nature Rev. Gen. 9:776-88; Li, V., et al., 2000. Virology 272:417-28; Xu, Z.L., et al. 2001 . Gene 272:149-56; Malin, A.S., et al., 2000. Microbes Infect.
- the IgE leader may be used to enhance insertion into the endoplasmic reticulum (Tepler, I, et al. (1989) J. Biol. Chem. 264:5912).
- Expression of the transgenes may be optimized and/or controlled by the selection of appropriate methods for optimizing expression. These methods include, for example, optimizing promoters, delivery methods, and gene sequences, (for example, as presented in Laddy, D.J., et al., 2008. PLoS.ONE 3 e2517; Kutzler, M.A., and Weiner, D.B., 2008. Nature Rev. Gen. 9:776-88).
- nucleic acid generally refers to a molecule (one, two or more strands) of DNA, RNA or a derivative or analog thereof, comprising a nucleobase.
- a nucleobase includes, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., an adenine "A,” a guanine “G,” a thymine “T” or a cytosine “C”) or RNA (e.g., an A, a G, an uracil "U” or a C).
- nucleic acid encompasses the terms “oligonucleotide” and “polynucleotide,” each as a subgenus of the term “nucleic acid.” Nucleic acids may be, be at least, be at most, or be about 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91
- Nucleic acids herein provided may have regions of identity or complementarity to another nucleic acid. It is contemplated that the region of complementarity or identity can be at least 5 contiguous residues, though it is specifically contemplated that the region is, is at least, is at most, or is about 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91
- hybridization As used herein, “hybridization”, “hybridizes” or “capable of hybridizing” is understood to mean forming a double or triple stranded molecule or a molecule with partial double or triple stranded nature.
- anneal as used herein is synonymous with “hybridize.”
- hybridization “hybridize(s)” or “capable of hybridizing” encompasses the terms “stringent condition(s)” or “high stringency” and the terms “low stringency” or “low stringency condition(s).”
- stringent condition(s) or “high stringency” are those conditions that allow hybridization between or within one or more nucleic acid strand(s) containing complementary sequence(s), but preclude hybridization of random sequences. Stringent conditions tolerate little, if any, mismatch between a nucleic acid and a target strand. Such conditions are known, and are often used for applications requiring high selectivity. Non-limiting applications include isolating a nucleic acid, such as a gene or a nucleic acid segment thereof, or detecting at least one specific mRNA transcript or a nucleic acid segment thereof, and the like.
- Stringent conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.5 M NaCI at temperatures of about 42 degrees C to about 70 degrees C. It is understood that the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleobase content of the target sequence(s), the charge composition of the nucleic acid(s), and the presence or
- low stringency or “low stringency conditions”
- non-limiting examples of low stringency include hybridization performed at about 0.15 M to about 0.9 M NaCI at a temperature range of about 20 degrees C. to about 50 degrees C.
- the low or high stringency conditions may be further modified to suit a particular application.
- any of the modifications discussed below may be applied to a nucleic acid.
- modifications include alterations to the RNA or DNA backbone, sugar or base, and various combinations thereof. Any suitable number of backbone linkages, sugars and/or bases in a nucleic acid can be modified (e.g., independently about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, up to 100%).
- An unmodified nucleoside is any one of the bases adenine, cytosine, guanine, thymine, or uracil joined to the V carbon of beta-D-ribo-furanose.
- a modified base is a nucleotide base other than adenine, guanine, cytosine and uracil at a 1 ' position.
- modified bases include inosine, purine, pyridin-4-one, pyridin-2- one, phenyl, pSEQdouracil, 2, 4, 6-trimethoxy benzene, 3-methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e. g., 5-methylcytidine), 5-alkyluridines (e. g., ribothymidine), 5- halouridine (e.
- modified bases include nitropyrrolyl (e.g., 3-nitropyrrolyl), nitroindolyl (e.g., 4-, 5-, 6-nitroindolyl), hypoxanthinyl, isoinosinyl, 2-aza-inosinyl, 7-deaza-inosinyl, nitroimidazolyl, nitropyrazolyl, nitrobenzimidazolyl, nitroindazolyl, aminoindolyl, pyrrolopyrimidinyl, difluorotolyl, 4-fluoro-6-methylbenzimidazole, 4- methylbenzimidazole, 3-methyl isocarbostyrilyl, 5-methyl isocarbostyrilyl, 3-methyl-7-propynyl isocarbostyrily
- a nucleid acid may comprise modified nucleic acid molecules, with phosphate backbone modifications.
- backbone modifications include phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, morpholino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and/or alkylsilyl modifications.
- a ribose sugar moiety that naturally occurs in a nucleoside is replaced with a hexose sugar, polycyclic heteroalkyi ring, or cyclohexenyl group.
- the hexose sugar is an allose, altrose, glucose, mannose, gulose, idose, galactose, talose, or a derivative thereof.
- the hexose may be a D-hexose, glucose, or mannose.
- the polycyclic heteroalkyi group may be a bicyclic ring containing one oxygen atom in the ring. In certain instances, the polycyclic heteroalkyi group is a
- bicyclo[2.2.1 ]heptane a bicyclo[3.2.1]octane, or a bicyclo[3.3.1 ]nonane.
- Nitropyrrolyl and nitroindolyl nucleobases are members of a class of compounds known as universal bases. Universal bases are those compounds that can replace any of the four naturally occurring bases without substantially affecting the melting behavior or activity of the
- oligonucleotide duplexes containing 3-nitropyrrolyl nucleobases may be stabilized solely by stacking interactions.
- the absence of significant hydrogen-bonding interactions with nitropyrrolyl nucleobases obviates the specificity for a specific complementary base.
- 4-, 5- and 6-nitroindolyl display very little specificity for the four natural bases. Procedures for the preparation of 1 -(2'-0-methyl-.beta.-D-ribofuranosyl)-5-nitroindole are discussed in Gaubert, G.; Wengel, J.
- Difluorotolyl is a non-natural nucleobase that functions as a universal base.
- Difluorotolyl is an isostere of the natural nucleobase thymine. But unlike thymine, difluorotolyl shows no appreciable selectivity for any of the natural bases.
- Other aromatic compounds that function as universal bases are 4-fluoro-6-methylbenzimidazole and 4-methylbenzimidazole.
- the relatively hydrophobic isocarbostyrilyl derivatives 3-methyl isocarbostyrilyl, 5-methyl isocarbostyrilyl, and 3- methyl-7-propynyl isocarbostyrilyl are universal bases which cause only slight destabilization of oligonucleotide duplexes compared to the oligonucleotide sequence containing only natural bases.
- nucleobases include 7-azaindolyl, 6-methyl-7-azaindolyl, imidizopyridinyl, 9- methyl-imidizopyridinyl, pyrrolopyrizinyl, isocarbostyrilyl, 7-propynyl isocarbostyrilyl, propynyl-7- azaindolyl, 2,4,5-trimethylphenyl, 4-methylindolyl, 4,6-dimethylindolyl, phenyl, napthalenyl, anthracenyl, phenanthracenyl, pyrenyl, stilbenyl, tetracenyl, pentacenyl, and structural derivates thereof.
- cross-linking agents may be used to add further stability or irreversibility to the reaction.
- cross-linking agents include, for example, 1 , 1 -bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N-hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid, homobifunctional imidoesters, including disuccinimidyl esters such as 3,3'-dithiobis(succinimidylpropionate), bifunctional maleimides such as bis-N- maleimido-1 ,8-octane and agents such as methyl-3-[(p-azidophenyl) dithio]propioimidate.
- a nucleotide analog may also include a "locked" nucleic acid.
- Certain compositions can be used to essentially “anchor” or “lock” an endogenous nucleic acid into a particular structure.
- Anchoring sequences serve to prevent disassociation of a nucleic acid complex, and thus not only can prevent copying but may also enable labeling, modification, and/or cloning of the endogeneous sequence.
- the locked structure may regulate gene expression (i.e. inhibit or enhance transcription or replication), or can be used as a stable structure that can be used to label or otherwise modify the endogenous nucleic acid sequence, or can be used to isolate the endogenous sequence, i.e. for cloning.
- Nucleic acid molecules need not be limited to those molecules containing only RNA or DNA, but further encompass chemically-modified nucleotides and non-nucleotides.
- the percent of non- nucleotides or modified nucleotides may be from 1 % to 100% (e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95%).
- a nucleic acid is provided for use as a control or standard in an assay, or therapeutic, for example.
- a nucleic acid may be made by any technique known in the art, such as for example, chemical synthesis, enzymatic production or biological production.
- Nucleic acids may be recovered or isolated from a biological sample. The nucleic acid may be recombinant or it may be natural or endogenous to the cell (produced from the cell's genome). It is contemplated that a biological sample may be treated in a way so as to enhance the recovery of small nucleic acid molecules. Generally, methods may involve lysing cells with a solution having guanidinium and a detergent.
- Nucleic acid synthesis may also be performed according to standard methods.
- Non-limiting examples of a synthetic nucleic acid include a nucleic acid made by in vitro chemical synthesis using phosphotriester, phosphite, or phosphoramidite chemistry and solid phase techniques or via deoxynucleoside H-phosphonate intermediates.
- a synthetic nucleic acid e.g., a synthetic oligonucleotide
- Various different mechanisms of oligonucleotide synthesis have been disclosed elsewhere.
- Nucleic acids may be isolated using known techniques. In particular embodiments, methods for isolating small nucleic acid molecules, and/or isolating RNA molecules can be employed.
- Chromatography is a process used to separate or isolate nucleic acids from protein or from other nucleic acids. Such methods can involve electrophoresis with a gel matrix, filter columns, alcohol precipitation, and/or other chromatography. If a nucleic acid from cells is to be used or evaluated, methods generally involve lysing the cells with a chaotropic (e.g., guanidinium isothiocyanate) and/or detergent (e.g., N-lauroyl sarcosine) prior to implementing processes for isolating particular populations of RNA.
- a chaotropic e.g., guanidinium isothiocyanate
- detergent e.g., N-lauroyl sarcosine
- Methods may involve the use of organic solvents and/or alcohol to isolate nucleic acids.
- the amount of alcohol added to a cell lysate achieves an alcohol concentration of about 55% to 60%. While different alcohols can be employed, ethanol works well.
- a solid support may be any structure, and it includes beads, filters, and columns, which may include a mineral or polymer support with electronegative groups. A glass fiber filter or column is effective for such isolation procedures.
- a nucleic acid isolation processes may sometimes include: a) lysing cells in the sample with a lysing solution comprising guanidinium, where a lysate with a concentration of at least about 1 M guanidinium is produced; b) extracting nucleic acid molecules from the lysate with an extraction solution comprising phenol; c) adding to the lysate an alcohol solution for form a lysate/alcohol mixture, wherein the concentration of alcohol in the mixture is between about 35% to about 70%; d) applying the lysate/alcohol mixture to a solid support; e) eluting the nucleic acid molecules from the solid support with an ionic solution; and, f) capturing the nucleic acid molecules.
- the sample may be dried down and resuspended in a liquid and volume appropriate for subsequent manipulation.
- a transformed cell comprising an expression vector is generated by introducing into the cell the expression vector.
- Suitable methods for polynucleotide delivery for transformation of an organelle, a cell, a tissue or an organism for use with the current methods include virtually any method by which a polynucleotide (e.g., DNA) can be introduced into an organelle, a cell, a tissue or an organism.
- a polynucleotide e.g., DNA
- a host cell can, and has been, used as a recipient for vectors.
- Host cells may be derived from prokaryotes or eukaryotes, depending upon whether the desired result is replication of the vector or expression of part or all of the vector-encoded polynucleotide sequences. Numerous cell lines and cultures are available for use as a host cell, and they can be obtained through the American Type Culture Collection (ATCC), which is an organization that serves as an archive for living cultures and genetic materials.
- ATCC American Type Culture Collection
- the host cell is a dendritic cell, which is an antigen-presenting cell.
- An appropriate host may be determined. Generally this is based on the vector backbone and the desired result.
- a plasmid or cosmid for example, can be introduced into a prokaryote host cell for replication of many vectors.
- Bacterial cells used as host cells for vector replication and/or expression include DH5alpha, JM109, and KC8, as well as a number of commercially available bacterial hosts such as SURE® Competent Cells and SOLOPACK Gold Cells (STRATAGENE®, La Jolla, CA).
- bacterial cells such as E. coli LE392 could be used as host cells for phage viruses.
- Eukaryotic cells that can be used as host cells include, but are not limited to yeast, insects and mammals.
- Examples of mammalian eukaryotic host cells for replication and/or expression of a vector include, but are not limited to, HeLa, NIH3T3, Jurkat, 293, COS, CHO, Saos, and PC12.
- Examples of yeast strains include, but are not limited to, YPH499, YPH500 and YPH501.
- Nucleic acid vaccines may include, for example, non-viral DNA vectors, "naked" DNA and RNA, and viral vectors. Methods of transforming cells with these vaccines, and for optimizing the expression of genes included in these vaccines are known and are also discussed herein.
- Any appropriate method may be used to transfect or transform the antigen presenting cells, or to administer the nucleotide sequences or compositions of the present methods.
- Certain examples are presented herein, and further include methods such as delivery using cationic polymers, lipid like molecules, and certain commercial products such as, for example, IN-VIVO-JET PEL
- an antigen presenting cell or a nucleic acid or viral vector may be delivered to an organelle, a cell, a tissue or an organism via one or more injections (i.e., a needle injection), such as, for example, subcutaneous, intradermal, intramuscular, intravenous, intraprotatic, intratumor, intrintraperitoneal, etc.
- injections i.e., a needle injection
- Methods of injection include, foe example, injection of a composition comprising a saline solution.
- Further embodiments include the introduction of a polynucleotide by direct microinjection.
- the amount of the expression vector used may vary upon the nature of the antigen as well as the organelle, cell, tissue or organism used.
- Intradermal, intranodal, or intralymphatic injections are some of the more commonly used methods of DC administration. Intradermal injection is characterized by a low rate of absorption into the bloodstream but rapid uptake into the lymphatic system. The presence of large numbers of Langerhans dendritic cells in the dermis will transport intact as well as processed antigen to draining lymph nodes. Proper site preparation is necessary to perform this correctly (i.e., hair is clipped in order to observe proper needle placement). Intranodal injection allows for direct delivery of antigen to lymphoid tissues. Intralymphatic injection allows direct administration of DCs.
- a polynucleotide is introduced into an organelle, a cell, a tissue or an organism via electroporation.
- Electroporation involves the exposure of a suspension of cells and DNA to a high-voltage electric discharge.
- certain cell wall- degrading enzymes such as pectin-degrading enzymes, are employed to render the target recipient cells more susceptible to transformation by electroporation than untreated cells (U.S. Patent No. 5,384,253, incorporated herein by reference).
- a polynucleotide is introduced to the cells using calcium phosphate precipitation.
- Human KB cells have been transfected with adenovirus 5 DNA (Graham and van der Eb, (1973) Virology, 52,456-467) using this technique.
- mouse L(A9), mouse C127, CHO, CV-1 , BHK, NIH3T3 and HeLa cells were transfected with a neomycin marker gene (Chen and Okayama, Mol. Cell Biol., 7(8):2745-2752, 1987), and rat hepatocytes were transfected with a variety of marker genes (Rippe et al., Mol. Cell Biol., 10:689-695, 1990). 5.
- a polynucleotide is delivered into a cell using DEAE-dextran followed by polyethylene glycol.
- reporter plasmids were introduced into mouse myeloma and erythroleukemia cells (Gopal, T.V., Mol Cell Biol. 1985 May;5(5):1 188-90).
- Sonication Loading Additional embodiments include the introduction of a polynucleotide by direct sonic loading. LTK- fibroblasts have been transfected with the thymidine kinase gene by sonication loading
- a polynucleotide may be entrapped in a lipid complex such as, for example, a liposome.
- Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, (1991 ) In: Liver Diseases, Targeted Diagnosis and Therapy Using Specific Receptors and Ligands. pp. 87-104).
- a polynucleotide may be delivered to a target cell via receptor-mediated delivery vehicles.
- receptor-mediated delivery vehicles take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis that will be occurring in a target cell. In view of the cell type-specific distribution of various receptors, this delivery method adds another degree of specificity.
- Certain receptor-mediated gene targeting vehicles comprise a cell receptor-specific ligand and a polynucleotide-binding agent. Others comprise a cell receptor-specific ligand to which the polynucleotide to be delivered has been operatively attached.
- ligands have been used for receptor-mediated gene transfer (Wu and Wu, (1987) J. Biol. Chem., 262,4429-4432; Wagner et al., Proc. Natl. Acad. Sci. USA, 87(9):3410-3414, 1990; Perales et al., Proc. Natl. Acad. Sci. USA, 91 :4086-4090, 1994; Myers, EPO 0273085), which establishes the operability of the technique.
- a ligand is chosen to correspond to a receptor specifically expressed on the target cell population.
- polynucleotide-targeting vehicle may comprise a specific binding ligand in combination with a liposome.
- the polynucleotide(s) to be delivered are housed within the liposome and the specific binding ligand is functionally incorporated into the liposome membrane.
- the liposome will thus specifically bind to the receptor(s) of a target cell and deliver the contents to a cell.
- the polynucleotide delivery vehicle component of a targeted delivery vehicle may be a liposome itself, which may, for example, comprise one or more lipids or glycoproteins that direct cell-specific binding.
- lipids or glycoproteins that direct cell-specific binding.
- lactosyl-ceramide, a galactose-terminal asialoganglioside have been incorporated into liposomes and observed an increase in the uptake of the insulin gene by hepatocytes (Nicolau et al., (1987) Methods Enzymol., 149, 157-176). It is contemplated that the tissue-specific transforming constructs may be specifically delivered into a target cell in a similar manner.
- Microprojectile bombardment techniques can be used to introduce a polynucleotide into at least one, organelle, cell, tissue or organism (U.S. Patent No. 5,550,318; U.S. Patent No. 5,538,880; U.S. Patent No. 5,610,042; and PCT Application WO 94/09699; each of which is incorporated herein by reference). This method depends on the ability to accelerate DNA-coated
- microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et al., (1987) Nature, 327,70-73).
- microprojectile bombardment techniques known in the art, many of which are applicable to the present methods.
- one or more particles may be coated with at least one polynucleotide and delivered into cells by a propelling force.
- Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force (Yang et al., (1990) Proc. Nat'l Acad. Sci. USA, 87,9568-9572).
- microprojectiles used have consisted of biologically inert substances such as tungsten or gold particles or beads.
- Exemplary particles include those comprised of tungsten, platinum, and, in certain examples, gold, including, for example, nanoparticles. It is contemplated that in some instances DNA precipitation onto metal particles would not be necessary for DNA delivery to a recipient cell using microprojectile bombardment. However, it is contemplated that particles may contain DNA rather than be coated with DNA. DNA-coated particles may increase the level of DNA delivery via particle bombardment but are not, in and of themselves, necessary.
- any viral vector suitable for administering nucleotide sequences, or compositions comprising nucleotide sequences, to a cell or to a subject, such that the cell or cells in the subject may express the genes encoded by the nucleotide sequences may be employed in the present methods.
- a transgene is incorporated into a viral particle to mediate gene transfer to a cell.
- the virus simply will be exposed to the appropriate host cell under physiologic conditions, permitting uptake of the virus.
- the present methods are advantageously employed using a variety of viral vectors, as discussed below.
- Adenovirus is particularly suitable for use as a gene transfer vector because of its mid-sized DNA genome, ease of manipulation, high titer, wide target-cell range, and high infectivity.
- the roughly 36 kb viral genome is bounded by 100-200 base pair (bp) inverted terminal repeats (ITR), in which are contained cis-acting elements necessary for viral DNA replication and packaging.
- ITR inverted terminal repeats
- the early (E) and late (L) regions of the genome that contain different transcription units are divided by the onset of viral DNA replication.
- the E1 region encodes proteins responsible for the regulation of transcription of the viral genome and a few cellular genes.
- the expression of the E2 region (E2A and E2B) results in the synthesis of the proteins for viral DNA replication. These proteins are involved in DNA replication, late gene expression, and host cell shut off (Renan, M. J. (1990) Radiother Oncol., 19, 197-218).
- the products of the late genes (L1 , L2, L3, L4 and L5), including the majority of the viral capsid proteins, are expressed only after significant processing of a single primary transcript issued by the major late promoter (MLP).
- MLP located at 16.8 map units
- TL tripartite leader
- adenovirus In order for adenovirus to be optimized for gene therapy, it is necessary to maximize the carrying capacity so that large segments of DNA can be included. It also is very desirable to reduce the toxicity and immunologic reaction associated with certain adenoviral products.
- the two goals are, to an extent, coterminous in that elimination of adenoviral genes serves both ends. By practice of the present methods, it is possible to achieve both these goals while retaining the ability to manipulate the therapeutic constructs with relative ease.
- ITR inverted terminal repeats
- Plasmids containing ITR's can replicate in the presence of a non-defective adenovirus (Hay, R.T., et al., J Mol Biol. 1984 Jun 5;175(4):493-510). Therefore, inclusion of these elements in an adenoviral vector may permits replication.
- the packaging signal for viral encapsulation is localized between 194-385 bp (0.5-1 .1 map units) at the left end of the viral genome ( Hearing et al., J.
- adenoviral genome can be incorporated into the genome of mammalian cells and the genes encoded thereby expressed. These cell lines are capable of supporting the replication of an adenoviral vector that is deficient in the adenoviral function encoded by the cell line.
- helping vectors e.g., wild-type virus or conditionally defective mutants.
- Replication-deficient adenoviral vectors can be complemented, in trans, by helper virus. This observation alone does not permit isolation of the replication-deficient vectors, however, since the presence of helper virus, needed to provide replicative functions, would contaminate any preparation.
- an additional element was needed that would add specificity to the replication and/or packaging of the replication-deficient vector. That element derives from the packaging function of adenovirus.
- the mutations are point mutations or deletions.
- helper viruses with low efficiency packaging When helper viruses with low efficiency packaging are grown in helper cells, the virus is packaged, albeit at reduced rates compared to wild-type virus, thereby permitting propagation of the helper.
- helper viruses When these helper viruses are grown in cells along with virus that contains wild-type packaging signals, however, the wild-type packaging signals are recognized preferentially over the mutated versions. Given a limiting amount of packaging factor, the virus containing the wild-type signals is packaged selectively when compared to the helpers. If the preference is great enough, stocks approaching homogeneity may be achieved.
- the receptor-binding fiber sequences can often be substituted between adenoviral isolates.
- the Coxsackie- adenovirus receptor (CAR) ligand found in adenovirus 5 can be substituted for the CD46-binding fiber sequence from adenovirus 35, making a virus with greatly improved binding affinity for human hematopoietic cells.
- CAR Coxsackie- adenovirus receptor
- Ad5f35 has been the basis for several clinically developed viral isolates.
- various biochemical methods exist to modify the fiber to allow re-targeting of the virus to target cells, such as dendritic cells.
- Methods include use of bifunctional antibodies (with one end binding the CAR ligand and one end binding the target sequence), and metabolic biotinylation of the fiber to permit association with customized avidin- based chimeric ligands.
- ligands e.g. anti-CD205 by
- heterobifunctional linkers e.g. PEG-containing
- the retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells by a process of reverse-transcription (Coffin, (1990) In: Virology, ed., New York: Raven Press, pp. 1437-1500).
- the resulting DNA then stably integrates into cellular chromosomes as a provirus and directs synthesis of viral proteins.
- the integration results in the retention of the viral gene sequences in the recipient cell and its descendants.
- the retroviral genome contains three genes - gag, pol and env - that code for capsid proteins, polymerase enzyme, and envelope components, respectively.
- LTR long terminal repeat
- a nucleic acid encoding a promoter is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective.
- a packaging cell line containing the gag, pol and env genes but without the LTR and psi components is constructed (Mann et al., (1983) Cell, 33, 153-159).
- a recombinant plasmid containing a human cDNA, together with the retroviral LTR and psi sequences is introduced into this cell line (by calcium phosphate precipitation for example), the psi sequence allows the RNA transcript of the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture media (Nicolas, J.F., and Rubenstein, J.L.R., (1988) In: Vectors: a Survey of Molecular Cloning Vectors and Their Uses, Rodriquez and Denhardt, Eds.). Nicolas and Rubenstein; Temin et al., (1986) In: Gene Transfer, Kucherlapati (ed.), New York: Plenum Press, pp.
- Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression of many types of retroviruses require the division of host cells (Paskind et al., (1975) Virology, 67,242-248). An approach designed to allow specific targeting of retrovirus vectors recently was developed based on the chemical modification of a retrovirus by the chemical addition of galactose residues to the viral envelope. This modification could permit the specific infection of cells such as hepatocytes via asialoglycoprotein receptors, may this be desired.
- Adeno-associated Virus AAV utilizes a linear, single-stranded DNA of about 4700 base pairs. Inverted terminal repeats flank the genome. Two genes are present within the genome, giving rise to a number of distinct gene products. The first, the cap gene, produces three different virion proteins (VP), designated VP-1 , VP-2 and VP-3. The second, the rep gene, encodes four non-structural proteins (NS). One or more of these rep gene products is responsible for transactivating AAV transcription.
- VP virion proteins
- NS non-structural proteins
- the three promoters in AAV are designated by their location, in map units, in the genome. These are, from left to right, p5, p19 and p40. Transcription gives rise to six transcripts, two initiated at each of three promoters, with one of each pair being spliced.
- the splice site derived from map units 42-46, is the same for each transcript.
- the four non-structural proteins apparently are derived from the longer of the transcripts, and three virion proteins all arise from the smallest transcript.
- AAV is not associated with any pathologic state in humans. Interestingly, for efficient replication, AAV requires "helping" functions from viruses such as herpes simplex virus I and II,
- the terminal repeats of the AAV vector can be obtained by restriction endonuclease digestion of AAV or a plasmid such as p201 , which contains a modified AAV genome (Samulski et al., J. Virol., 61 :3096-3101 (1987)), or by other methods, including but not limited to chemical or enzymatic synthesis of the terminal repeats based upon the published sequence of AAV. It can be
- AAV-based vectors have proven to be safe and effective vehicles for gene delivery in vitro, and these vectors are being developed and tested in pre-clinical and clinical stages for a wide range of applications in potential gene therapy, both ex vivo and in vivo (Carter and Flotte, (1995) Ann. N.Y. Acad. Sci., 770; 79-90; Chatteijee, et al., (1995) Ann. N.Y. Acad.
- AAV-mediated efficient gene transfer and expression in the lung has led to clinical trials for the treatment of cystic fibrosis (Carter and Flotte, 1995; Flotte et al., Proc. Nat'l Acad. Sci. USA, 90, 10613-10617, (1993)).
- Vectors derived from viruses such as vaccinia virus ( Ridgeway, (1988) In: Vectors: A survey of molecular cloning vectors and their uses, pp. 467-492; Baichwal and Sugden, (1986) In, Gene Transfer, pp. 1 17-148; Coupar et al., Gene, 68:1 -10, 1988) canary poxvirus, and herpes viruses are employed. These viruses offer several features for use in gene transfer into various mammalian cells.
- the nucleic acid encoding the transgene are positioned and expressed at different sites.
- the nucleic acid encoding the transgene is stably integrated into the genome of the cell. This integration is in the cognate location and orientation via homologous recombination (gene replacement) or it is integrated in a random, non-specific location (gene augmentation).
- the nucleic acid is stably maintained in the cell as a separate, episomal segment of DNA. Such nucleic acid segments or "episomes" encode sequences sufficient to permit maintenance and replication independent of or in synchronization with the host cell cycle. How the expression construct is delivered to a cell and where in the cell the nucleic acid remains is dependent on the type of expression construct employed.
- a DC activation strategy is contemplated, that incorporates the
- This DC activation system can be used in conjunction with or without standard vaccines to enhance the immune response since it replaces the requirement for CD4+ T cell help during APC activation (Bennett, S. R., et al., . Nature, 1998, Jun. 4. 393: p. 478-80; Ridge, J. P., D. R. F, and P. Nature, 1998, Jun. 4. 393: p. 474-8; Schoenberger, S. P., et al., Nature,
- the DC activation is via CD40 activation.
- DC activation via endogenous CD40/CD40L interactions may be subject to downregulation due to negative feedback, leading rapidly to the "IL-12 burn-out effect”.
- an alternatively spliced isoform of CD40 (type II) is produced as a secretable factor (Tone, M., et al., Proc Natl Acad Sci U S A, 2001. 98(4): p. 1751-1756).
- Type II CD40 may act as a dominant negative receptor, downregulating signaling through CD40L and potentially limiting the potency of the immune response generated.
- the present methods co-opt the natural regulation of CD40 by creating an inducible form of CD40 (iCD40), lacking the extracellular domain and activated instead by synthetic dimerizing ligands (Spencer, D. M., et al., Science, 1993. 262: p. 1019-1024) through a technology termed chemically induced dimerization (CID).
- iCD40 inducible form of CD40
- CID chemically induced dimerization
- the expression vector encodes a co-stimulatory polypeptide, such as iCD40.
- the antigen-presenting cells are in an animal, such as human, non-human primate, cow, horse, pig, sheep, goat, dog, cat, or rodent.
- the subject may be, for example, an animal, such as a mammal, for example, a human, non-human primate, cow, horse, pig, sheep, goat, dog, cat, or rodent.
- the subject may be, for example, human, for example, a patient suffering from an infectious disease, and/or a subject that is immunocompromised, or is suffering from a hyperproliferative disease.
- the expression construct and/or expression vector can be utilized as a composition or substance that activates antigen-presenting cells.
- a composition that "activates antigen-presenting cells” or “enhances the activity antigen-presenting cells” refers to the ability to stimulate one or more activities associated with antigen-presenting cells.
- a composition, such as the expression construct or vector of the present methods can stimulate upregulation of co-stimulatory molecules on antigen-presenting cells, induce nuclear translocation of NF-kappaB in antigen-presenting cells, activate toll- like receptors in antigen-presenting cells, or other activities involving cytokines or chemokines.
- the expression construct, expression vector and/or transduced antigen-presenting cells can enhance or contribute to the effectiveness of a vaccine by, for example, enhancing the expression construct, expression vector and/or transduced antigen-presenting cells
- the antigen-presenting cell is also contacted with an antigen. Often, the antigen-presenting cell is contacted with the antigen ex vivo. Sometimes, the antigen-presenting cell is contacted with the antigen in vivo.
- the antigen-presenting cell is in a subject and an immune response is generated against the antigen.
- the immune response is a cytotoxic T-lymphocyte (CTL) immune response.
- CTL cytotoxic T-lymphocyte
- the immune response is generated against a tumor antigen.
- the antigen-presenting cell is activated without the addition of an adjuvant.
- the antigen-presenting cell is transduced with the nucleic acid ex vivo and administered to the subject by intradermal administration. In some embodiments, the antigen-presenting cell is transduced with the nucleic acid ex vivo and administered to the subject by subcutaneous administration. Sometimes, the antigen-presenting cell is transduced with the nucleic acid ex vivo. Sometimes, the antigen-presenting cell is transduced with the nucleic acid in vivo.
- the antigen-presenting cell can be transduced ex vivo or in vivo with a nucleic acid that encodes the chimeric protein.
- the antigen-presenting cell may be sensitized to the antigen at the same time the antigen-presenting cell is contacted with the multimeric ligand, or the antigen-presenting cell can be pre-sensitized to the antigen before the antigen-presenting cell is contacted with the multimerization ligand.
- the antigen-presenting cell is contacted with the antigen ex vivo.
- the antigen-presenting cell is transduced with the nucleic acid ex vivo and administered to the subject by intradermal administration, and sometimes the antigen-presenting cell is transduced with the nucleic acid ex vivo and administered to the subject by subcutaneous administration.
- the antigen may be a tumor antigen, and the CTL immune response can induced by migration of the antigen-presenting cell to a draining lymph node.
- a tumor antigen is any antigen such as, for example, a peptide or polypeptide, that triggers an immune response in a host.
- the tumor antigen may be a tumor- associated antigen, that is associated with a neoplastic tumor cell.
- an immunocompromised individual or subject is a subject that has a reduced or weakened immune response.
- Such individuals may also include a subject that has undergone chemotherapy or any other therapy resulting in a weakened immune system, a transplant recipient, a subject currently taking immunosuppressants, an aging individual, or any individual that has a reduced and/or impaired CD4 T helper cells. It is contemplated that the present methods can be utilized to enhance the amount and/or activity of CD4 T helper cells in an immunocompromised subject.
- the cells prior to administering the transduced antigen-presenting cell, are challenged with antigens (also referred herein as "target antigens").
- antigens also referred herein as "target antigens”
- the transduced, loaded antigen-presenting cells are administered to the subject parenterally, intradermally, intranodally, or intralymphatically. Additional parenteral routes include, but are not limited to subcutaneous, intramuscular, intraperitoneal, intravenous, intraarterial, intramyocardial, transendocardial, transepicardial, intrathecal, intraprotatic, intratumor, and infusion techniques.
- the target antigen is an antigen or immunological epitope on the antigen, which is crucial in immune recognition and ultimate elimination or control of the disease-causing agent or disease state in a mammal.
- the immune recognition may be cellular and/or humoral. In the case of intracellular pathogens and cancer, immune recognition may, for example, be a T lymphocyte response.
- the target antigen may be derived or isolated from, for example, a pathogenic microorganism such as viruses including HIV, (Korber et al, eds HIV Molecular Immunology Database, Los Alamos National Laboratory, Los Alamos, N. Mex. 1977) influenza, Herpes simplex, human papilloma virus (U.S. Pat. No. 5,719,054), Hepatitis B (U.S. Pat. No. 5,780,036), Hepatitis C (U.S. Pat. No.
- viruses including HIV, (Korber et al, eds HIV Molecular Immunology Database, Los Alamos National Laboratory, Los Alamos, N. Mex. 1977) influenza, Herpes simplex, human papilloma virus (U.S. Pat. No. 5,719,054), Hepatitis B (U.S. Pat. No. 5,780,036), Hepatitis C (U.S. Pat. No.
- Target antigen may be derived or isolated from pathogenic bacteria such as, for example, from Chlamydia (U.S. Pat. No. 5,869,608), Mycobacteria, Legionella, Meningiococcus, Group A Streptococcus, Salmonella, Listeria,
- Hemophilus influenzae U.S. Pat. No. 5,955,596 and the like.
- Target antigen may be derived or isolated from, for example, pathogenic yeast including
- Target antigen may be derived or isolated from, for example, a pathogenic protozoan and pathogenic parasites including but not limited to Pneumocystis carinii, Trypanosoma, Leishmania (U.S. Pat. No. 5,965,242), Plasmodium (U.S. Pat. No. 5,589,343) and Toxoplasma gondii.
- Target antigen includes an antigen associated with a preneoplastic or hyperplastic state.
- Target antigen may also be associated with, or causative of cancer.
- Such target antigen may be, for example, tumor specific antigen, tumor associated antigen (TAA) or tissue specific antigen, epitope thereof, and epitope agonist thereof.
- TAA tumor associated antigen
- target antigens include but are not limited to
- carcinoembryonic antigen CEA
- epitopes thereof such as CAP-1 , CAP-1-6D and the like (GenBank Accession No. M29540), MART-1 (Kawakarni et al, J. Exp. Med. 180:347-352, 1994), MAGE-1 (U.S. Pat. No. 5,750,395), MAGE-3, GAGE (U.S. Pat. No. 5,648,226), GP-100
- TAAs may be identified, isolated and cloned by methods known in the art such as those disclosed in U.S. Pat. No.
- Target antigen may also include one or more growth factors and splice variants of each.
- An antigen may be expressed more frequently in cancer cells than in non-cancer cells.
- the antigen may result from contacting the modified dendritic cell with a prostate specific membrane antigen, for example, a prostate specific membrane antigen (PSMA) or fragment thereof.
- PSMA prostate specific membrane antigen
- Prostate antigen is a recombinant protein consisting of the extracellular portion of PSMA antigen.
- PSMA is a ⁇ 100 kDa (84kDa before glycosylation, ⁇ 180kDa as dimer) type II membrane protein with neuropeptidase and folate hydrolase activities, but the true function of PSMA is currently unclear.
- Carter RE et al., Proc Natl Acad Sci U S A. 93: 749-53, 1996; Israeli RS, et al., Cancer Res. 53: 227-30, 1993; Pinto JT, et al., Clin Cancer Res. 2: 1445-51 , 1996.
- PSMA is expressed as a cytoplasmic protein
- the alternatively-spliced transmembrane form is the predominate form on the apical surface of neoplastic prostate cells.
- PSMA is internalized following cross-linking and has been used to internalize bound antibody or ligand complexed with radionucleotides or viruses and other complex
- PSMA is not found in the vascular endothelial cells of corresponding benign tissue, de la Taille A, et al., Cancer Detect Prev. 24: 579-88, 2000.
- ⁇ 50% (8 of 18) of bone metastases (with 7 of 8 lymph node metastases) expressed PSMA the more sensitive reagent, 177Lu-radiolabeled MoAb J591 , targeted to the ectodomain of PSMA, could target all known sites of bone and soft tissue metastasis in 30 of 30 patients, suggesting near universal expression in advanced prostate disease.
- Bander NH et al., J Clin Oncol. 23: 4591 -601 , 2005.
- a prostate specific antigen, or PSA is meant to include any antigen that can induce an immune response, such as, for example, a cytotoxic T lymphocyte response, against a PSA, for example, a PSMA, and may be specifically recognized by any anti-PSA antibody.
- PSAs used in the present method are capable of being used to load the antigen presenting cell, as assayed using conventional methods.
- "prostate specific antigen" or "PSA” may, for example, refer to a protein having the wild type amino acid sequence of a PSA, or a polypeptide that includes a portion of the a PSA protein,
- a prostate specific membrane antigen, or PSMA is meant to include any antigen that can induce an immune response, such as, for example, a cytotoxic T lymphocyte response, against PSMA, and may be specifically recognized by an anti-PSMA antibody.
- PSMAs used in the present method are capable of being used to load the antigen presenting cell, as assayed using conventional methods.
- "prostate specific membrane antigen" or "PSMA” may, for example, refer to a protein having the wild type amino acid sequence of PSMA, or a polypeptide that includes a portion of the PSMA protein, such as one encoded by SEQ ID NO: 3, or a portion of the nucleotide sequence of SEQ ID NO:3, or having the polypeptide of SEQ ID NO: 4, or a portion thereof.
- the term may also refer to, for example, a peptide having an amino acid sequence of a portion of SEQ ID NO: 4, or any peptide that may induce an immune response against PSMA. Also included are variants of any of the foregoing, including, for example, those having
- Proteins, polypeptides, and peptides having differential post- translational processing, such as differences in glycosylation, from the wild type PSMA may also be used in the present methods.
- various sugar molecules that are capable of inducing an immune response against PSMA are also contemplated.
- a PSA for example, a PSMA, polypeptide may be used to load the modified antigen presenting cell.
- the modified antigen presenting cell is contacted with a PSMA polypeptide fragment having the amino acid sequence of SEQ ID NO: 4 (e.g., encoded by the nucleotide sequence of SEQ ID NO: 3), or a fragment thereof.
- the PSA for example, PSMA polypeptide fragment does not include the signal peptide sequence.
- the modified antigen presenting cell is contacted with a PSA, for example, PSMA polypeptide fragment comprising substitutions or deletions of amino acids in the polypeptide, and the fragment is sufficient to load antigen presenting cells.
- a prostate specific protein antigen, or s PSPA also referred to in this specification as a prostate specific antigen, or a PSA, is meant to include any antigen that can induce an immune response, such as, for example, a cytotoxic T lymphocyte response, against a prostate specific protein antigen. This includes, for example, a prostate specific protein antigen or Prostate Specific Antigen.
- PSPAs used in the present method are capable of being used to load the antigen presenting cell, as assayed using conventional methods.
- Prostate Specific Antigen, or PSA may, for example, refer to a protein having the wild type amino acid sequence of a PSA, or a polypeptide that includes a portion of the PSA protein,
- a prostate specific membrane antigen, or PSMA is meant to include any antigen that can induce an immune response, such as, for example, a cytotoxic T lymphocyte response, against PSMA, and may be specifically recognized by an anti-PSMA antibody.
- PSMAs used in the present method are capable of being used to load the antigen presenting cell, as assayed using conventional methods.
- "prostate specific membrane antigen" or "PSMA” may, for example, refer to a protein having the wild type amino acid sequence of PSMA, or a polypeptide that includes a portion of the PSMA protein, such as one encoded by SEQ ID NO: 3, or a portion of the nucleotide sequence of SEQ ID NO:3, or having the polypeptide of SEQ ID NO: 4, or a portion thereof.
- the term may also refer to, for example, a peptide having an amino acid sequence of a portion of SEQ ID NO: 4, or any peptide that may induce an immune response against PSMA. Also included are variants of any of the foregoing, including, for example, those having
- Proteins, polypeptides, and peptides having differential post- translational processing, such as differences in glycosylation, from the wild type PSMA may also be used in the present methods.
- various sugar molecules that are capable of inducing an immune response against PSMA are also contemplated.
- a PSPA for example, a PSMA, polypeptide may be used to load the modified antigen presenting cell.
- the modified antigen presenting cell is contacted with a PSMA polypeptide fragment having the amino acid sequence of SEQ ID NO: 4 (e.g., encoded by the nucleotide sequence of SEQ ID NO: 3), or a fragment thereof.
- the PSA for example, PSMA polypeptide fragment does not include the signal peptide sequence.
- the modified antigen presenting cell is contacted with a PSPA, for example, PSMA polypeptide fragment comprising substitutions or deletions of amino acids in the polypeptide, and the fragment is sufficient to load antigen presenting cells.
- a tumor antigen is any antigen such as, for example, a peptide or polypeptide, that triggers an immune response in a host against a tumor.
- the tumor antigen may be a tumor-associated antigen, that is associated with a neoplastic tumor cell.
- a prostate cancer antigen, or PCA is any antigen such as, for example, a peptide or polypeptide, that triggers an immune response in a host against a prostate cancer tumor.
- a prostate cancer antigen may, or may not, be specific to prostate cancer tumors.
- a prostate cancer antigen may also trigger immune responses against other types of tumors or neoplastic cells.
- a prostate cancer antigen includes, for example, prostate specific protein antigens, prostate specific antigens, and prostate specific membrane antigens.
- the antigen presenting cell may be contacted with tumor antigen, such as PSA, for example, PSMA polypeptide, by various methods, including, for example, pulsing immature DCs with unfractionated tumor lysates, MHC-eluted peptides, tumor-derived heat shock proteins (HSPs), tumor associated antigens (TAAs (peptides or proteins)), or transfecting DCs with bulk tumor mRNA, or mRNA coding for TAAs (reviewed in Gilboa, E. & Vieweg, J., Immunol Rev 199, 251 -63 (2004); Gilboa, E, Nat Rev Cancer 4, 401 -1 1 (2004)).
- PSA tumor antigen
- a gene encoding a target antigen or immunological epitope thereof of interest is isolated from the genomic DNA.
- the desired gene may be isolated from cDNA copies of the genome. If restriction maps of the genome are available, the DNA fragment that contains the gene of interest is cleaved by restriction endonuclease digestion by routine methods. In instances where the desired gene has been previously cloned, the genes may be readily obtained from the available clones. Alternatively, if the DNA sequence of the gene is known, the gene can be synthesized by any of the conventional techniques for synthesis of deoxyribonucleic acids.
- Genes encoding an antigen of interest can be amplified, for example, by cloning the gene into a bacterial host.
- various prokaryotic cloning vectors can be used. Examples are plasmids pBR322, pUC and pEMBL.
- the genes encoding at least one target antigen or immunological epitope thereof can be prepared for insertion into the plasmid vectors designed for recombination with a virus by standard techniques.
- the cloned genes can be excised from the prokaryotic cloning vector by restriction enzyme digestion. In most cases, the excised fragment will contain the entire coding region of the gene.
- the DNA fragment carrying the cloned gene can be modified as needed, for example, to make the ends of the fragment compatible with the insertion sites of the DNA vectors used for recombination with a virus, then purified prior to insertion into the vectors at restriction endonuclease cleavage sites (cloning sites).
- Antigen loading of antigen presenting cells may be achieved, for example, by contacting antigen presenting cells, such as, for example, dendritic cells or progenitor cells with an antigen, for example, by incubating the cells with the antigen. Loading may also be achieved, for example, by incubating DNA (naked or within a plasmid vector) or RNA that code for the antigen; or with antigen-expressing recombinant bacterium or viruses (e.g., vaccinia, fowlpox, adenovirus or lentivirus vectors).
- antigen presenting cells such as, for example, dendritic cells or progenitor cells
- Loading may also be achieved, for example, by incubating DNA (naked or within a plasmid vector) or RNA that code for the antigen; or with antigen-expressing recombinant bacterium or viruses (e.g., vaccinia, fowlpox, adenovirus or
- the antigen Prior to loading, the antigen may be covalently conjugated to an immunological partner that provides T cell help (e.g., a carrier molecule). Alternatively, a dendritic cell may be pulsed with a non-conjugated immunological partner, separately or in the presence of the polypeptide.
- Antigens from cells or MHC molecules may be obtained by acid-elution or other methods (see Zitvogel L, et al., J Exp Med 1996. 183:87- 97).
- the antigen presenting cells may be transduced or transfected with the chimeric protein- encoding nucleotide sequence according to the present methods either before, after, or at the same time as the cells are loaded with antigen. In particular embodiments, antigen loading is subsequent to transduction or transfection.
- the transduced antigen-presenting cell is transfected with tumor cell mRNA.
- the transduced transfected antigen-presenting cell is administered to an animal to effect cytotoxic T lymphocytes and natural killer cell anti-tumor antigen immune response and regulated using dimeric FK506 and dimeric FK506 analogs.
- the tumor cell mRNA may be, for example, mRNA from a prostate tumor cell.
- the transduced antigen-presenting cell may be loaded by pulsing with tumor cell lysates.
- the pulsed transduced antigen-presenting cells are administered to an animal to effect cytotoxic T lymphocytes and natural killer cell anti-tumor antigen immune response and regulated using dimeric FK506 and dimeric FK506 analogs.
- the tumor cell lysate may be, for example, a prostate tumor cell lysate.
- T-lymphocytes may be activated by contact with the antigen-presenting cell that comprises the expression vector discussed herein, where the antigen-presenting cell has been challenged, transfected, pulsed, or electrofused with an antigen.
- T cells express a unique antigen binding receptor on their membrane (T-cell receptor), which can only recognize antigen in association with major histocompatibility complex (MHC) molecules on the surface of other cells.
- MHC major histocompatibility complex
- T helper cells and T cytotoxic cells are primarily distinguished by their display of the membrane bound glycoproteins CD4 and CD8, respectively.
- T helper cells secret various lymphokines, that are crucial for the activation of B cells, T cytotoxic cells, macrophages and other cells of the immune system.
- a naive CD8 T cell that recognizes an antigen-MHC complex proliferates and differentiates into an effector cell called a cytotoxic CD8 T lymphocyte (CTL).
- CTLs eliminate cells of the body displaying antigen, such as virus-infected cells and tumor cells, by producing substances that result in cell lysis.
- CTL activity can be assessed by methods discussed herein, for example.
- CTLs may be assessed in freshly isolated peripheral blood mononuclear cells (PBMC), in a
- phytohaemaglutinin-stimulated IL-2 expanded cell line established from PBMC (Bernard et al., AIDS, 12(16):2125-2139, 1998) or by T cells isolated from a previously immunized subject and restimulated for 6 days with DC infected with an adenovirus vector containing antigen using standard 4 hour 51 Cr release microtoxicity assays.
- One type of assay uses cloned T-cells.
- the fluorophore used is the non-toxic molecule AlamarBlue (Nociari et al., J. Immunol. Methods, 213(2): 157-167, 1998).
- the AlamarBlue is fluorescently quenched (i.e., low quantum yield) until mitochondrial reduction occurs, which then results in a dramatic increase in the AlamarBlue fluorescence intensity (i.e., increase in the quantum yield).
- This assay is reported to be extremely sensitive, specific and requires a significantly lower number of effector cells than the standard 51 Cr release assay.
- NKs natural killer cells
- infected cells are usually destroyed by T cells alerted by foreign particles bound to the cell surface MHC.
- virus-infected cells signal infection by expressing viral proteins that are recognized by antibodies. These cells can be killed by NKs.
- tumor cells if the tumor cells lose expression of MHC I molecules, then it may be susceptible to NKs.
- compositions expression constructs, expression vectors, fused proteins, transduced cells, activated DCs, transduced and loaded DCs— in a form appropriate for the intended application.
- this will entail preparing compositions that are essentially free of pyrogens, as well as other impurities that could be harmful to humans or animals.
- Aqueous compositions comprise an effective amount of the vector to cells, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium. Such compositions also are referred to as inocula.
- pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutically active substances is known. Except insofar as any conventional media or agent is incompatible with the vectors or cells, its use in therapeutic compositions is contemplated. Supplementary active ingredients also can be incorporated into the compositions.
- the active compositions may include classic pharmaceutical preparations. Administration of these compositions will be via any common route so long as the target tissue is available via that route. This includes, for example, oral, nasal, buccal, rectal, vaginal or topical. Alternatively,
- administration may be by orthotopic, intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection.
- Such compositions would normally be administered as pharmaceutically acceptable compositions, discussed herein.
- the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
- the form is sterile and is be fluid to the extent that easy syringability exists. It is stable under the conditions of manufacture and storage and is preserved against the contaminating action of microorganisms, such as bacteria and fungi.
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils.
- the proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
- a coating such as lecithin
- surfactants for example, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium sulfate, sodium stearate, and gelatin.
- the compositions may be incorporated with excipients and used in the form of non-ingestible mouthwashes and dentifrices.
- a mouthwash may be prepared incorporating the active ingredient in the required amount in an appropriate solvent, such as a sodium borate solution (Dobell's Solution).
- the active ingredient may be incorporated into an antiseptic wash containing sodium borate, glycerin and potassium bicarbonate.
- the active ingredient also may be dispersed in dentifrices, including, for example: gels, pastes, powders and slurries.
- the active ingredient may be added in a therapeutically effective amount to a paste dentifrice that may include, for example, water, binders, abrasives, flavoring agents, foaming agents, and humectants.
- compositions may be formulated in a neutral or salt form.
- Pharmaceutically-acceptable salts include, for example, the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like.
- solutions Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
- the formulations are easily administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like.
- the solution may be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose.
- aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
- sterile aqueous media can be employed.
- one dosage could be dissolved in 1 ml of isotonic NaCI solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences” 15th Edition, pages 1035-1038 and 1570- 1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations may meet sterility, pyrogenicity, and general safety and purity standards as required by FDA Office of Biologies standards.
- the administration schedule may be determined as appropriate for the patient and may, for example, comprise a dosing schedule where the cells are administered at week 0, followed by induction by administration of the chemical inducer of dimerization, followed by administration of additional cells and inducer at 2 week intervals thereafter for a total of, for example, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, or 30 weeks.
- dosing schedules include, for example, a schedule where one dose of the cells and one dose of the inducer are administered.
- the schedule may comprise
- administering the cells and the inducer are administered at week 0, followed by the administration of additional cells and inducer at 4 week intervals, for a total of, for example, 4, 8, 12, 16, 20, 24, 28, or 32 weeks.
- Administration of a dose of cells may occur in one session, or in more than one session, but the term dose may refer to the total amount of cells administered before administration of the ligand.
- the method may further include additional leukaphereses to obtain more cells to be used in treatment.
- the present methods also encompass methods of treatment or prevention of a disease caused by pathogenic microorganisms and/or a hyperproliferative disease.
- Diseases may be treated or prevented include diseases caused by viruses, bacteria, yeast, parasites, protozoa, cancer cells and the like.
- the pharmaceutical composition (transduced DCs, expression vector, expression construct, etc.) may be used as a generalized immune enhancer (DC activating composition or system) and as such has utility in treating diseases.
- Exemplary diseases that can be treated and/or prevented include, but are not limited, to infections of viral etiology such as HIV, influenza, Herpes, viral hepatitis, Epstein Bar, polio, viral encephalitis, measles, chicken pox, Papilloma virus etc.; or infections of bacterial etiology such as pneumonia, tuberculosis, syphilis, etc.; or infections of parasitic etiology such as malaria, trypanosomiasis, leishmaniasis, trichomoniasis, amoebiasis, etc.
- viral etiology such as HIV, influenza, Herpes, viral hepatitis, Epstein Bar, polio, viral encephalitis, measles, chicken pox, Papilloma virus etc.
- infections of bacterial etiology such as pneumonia, tuberculosis, syphilis, etc.
- infections of parasitic etiology such as malaria, try
- Preneoplastic or hyperplastic states which may be treated or prevented using the pharmaceutical composition include but are not limited to preneoplastic or hyperplastic states such as colon polyps, Crohn's disease, ulcerative colitis, breast lesions and the like.
- Cancers including solid tumors, which may be treated using the pharmaceutical composition include, but are not limited to primary or metastatic melanoma, adenocarcinoma, squamous cell carcinoma, adenosquamous cell carcinoma, thymoma, lymphoma, sarcoma, lung cancer, liver cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, leukemias, uterine cancer, breast cancer, prostate cancer, ovarian cancer, pancreatic cancer, colon cancer, multiple myeloma,
- neuroblastoma NPC, bladder cancer, cervical cancer and the like.
- hyperproliferative diseases including solid tumors, that may be treated using DC activation system presented herein include, but are not limited to rheumatoid arthritis, inflammatory bowel disease, osteoarthritis, leiomyomas, adenomas, lipomas, hemangiomas, fibromas, vascular occlusion, restenosis, atherosclerosis, pre-neoplastic lesions (such as adenomatous hyperplasia and prostatic intraepithelial neoplasia), carcinoma in situ, oral hairy leukoplakia, or psoriasis.
- rheumatoid arthritis inflammatory bowel disease, osteoarthritis, leiomyomas, adenomas, lipomas, hemangiomas, fibromas, vascular occlusion, restenosis, atherosclerosis, pre-neoplastic lesions (such as adenomatous hyperplasia and prostatic intraepithelial neoplasia), carcinoma in
- the administration of the pharmaceutical composition may be for either “prophylactic” or “therapeutic” purpose.
- the pharmaceutical composition is provided in advance of any symptom.
- the prophylactic administration of pharmaceutical composition serves to prevent or ameliorate any subsequent infection or disease.
- the pharmaceutical composition is provided at or after the onset of a symptom of infection or disease.
- the compositions presented herein may be provided either prior to the anticipated exposure to a disease-causing agent or disease state or after the initiation of the infection or disease.
- Solid tumors from any tissue or organ may be treated using the present methods, including, for example, any tumor expressing PSA, for example, PSMA, in the vasculature, for example, solid tumors present in, for example, lungs, bone, liver, prostate, or brain, and also, for example, in breast, ovary, bowel, testes, colon, pancreas, kidney, bladder, neuroendocrine system, soft tissue, boney mass, and lymphatic system.
- Other solid tumors that may be treated include, for example, glioblastoma, and malignant myeloma.
- unit dose refers to physically discrete units suitable as unitary dosages for mammals, each unit containing a predetermined quantity of pharmaceutical composition calculated to produce the desired immunogenic effect in association with the required diluent.
- the specifications for the unit dose of an inoculum are dictated by and are dependent upon the unique characteristics of the pharmaceutical composition and the particular immunologic effect to be achieved.
- an effective amount of the pharmaceutical composition would be the amount that achieves this selected result of enhancing the immune response, and such an amount could be determined.
- an effective amount of for treating an immune system deficiency could be that amount necessary to cause activation of the immune system, resulting in the development of an antigen specific immune response upon exposure to antigen.
- the term is also synonymous with "sufficient amount.”
- the effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular composition being administered, the size of the subject, and/or the severity of the disease or condition. One can empirically determine the effective amount of a particular composition presented herein without necessitating undue experimentation. A. Genetic Based Therapies
- a cell is provided with an expression construct capable of providing a co- stimulatory polypeptide, such as CD40 to the cell, such as an antigen-presenting cell and activating CD40.
- a co- stimulatory polypeptide such as CD40
- the expression vectors may be viral vectors, such as adenovirus, adeno-associated virus, herpes virus, vaccinia virus and retrovirus.
- the vector may be a lysosomal-encapsulated expression vector. Gene delivery may be performed in both in vivo and ex vivo situations. For viral vectors, one generally will prepare a viral vector stock.
- the multimeric ligand such as, for example, AP1903, may be delivered, for example at doses of about 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, or 10 mg/kg subject weight.
- transduced antigen-presenting cells Another therapy that is contemplated is the administration of transduced antigen-presenting cells.
- the antigen-presenting cells may be transduced in vitro.
- Formulation as a pharmaceutically acceptable composition is discussed herein.
- the transduced antigen-presenting cells may be, for example, transfected with target antigen nucleic acids, such as mRNA or DNA or proteins; pulsed with cell lysates, proteins or nucleic acids; or electrofused with cells.
- target antigen nucleic acids such as mRNA or DNA or proteins
- the cells, proteins, cell lysates, or nucleic acid may derive from cells, such as tumor cells or other pathogenic microorganism, for example, viruses, bacteria, protozoa, etc.
- anti-cancer agents may be used in combination with the present methods.
- An "anti-cancer" agent is capable of negatively affecting cancer in a subject, for example, by killing one or more cancer cells, inducing apoptosis in one or more cancer cells, reducing the growth rate of one or more cancer cells, reducing the incidence or number of metastases, reducing a tumor's size, inhibiting a tumor's growth, reducing the blood supply to a tumor or one or more cancer cells, promoting an immune response against one or more cancer cells or a tumor, preventing or inhibiting the progression of a cancer, or increasing the lifespan of a subject with a cancer.
- Anticancer agents include, for example, chemotherapy agents (chemotherapy), radiotherapy agents (radiotherapy), a surgical procedure (surgery), immune therapy agents (immunotherapy), genetic therapy agents (gene therapy), hormonal therapy, other biological agents (biotherapy) and/or alternative therapies.
- antibiotics include, but are not limited to, amikacin, aminoglycosides (e.g., gentamycin), amoxicillin, amphotericin B, ampicillin, antimonials, atovaquone sodium stibogluconate, azithromycin, capreomycin, cefotaxime, cefoxitin, ceftriaxone, chloramphenicol, clarithromycin, clindamycin, clofazimine, cycloserine, dapsone, doxycycline, ethambutol, ethionamide, fluconazole, fluoroquinolones, isoniazid, itraconazole, kanamycin, ketoconazole, minocycline, ofloxacin), para-aminosalicylic acid, pentamidine, polymixin definsins, prothionamide, pyrazinamide, pyrimethamine sulfadiazine, quinolones
- ciprofloxacin ciprofloxacin
- rifabutin rifampin
- sparfloxacin streptomycin
- sulfonamides tetracyclines
- thiacetazone trimethaprim-sulfamethoxazole, viomycin or combinations thereof.
- Such an agent would be provided in a combined amount with the expression vector effective to kill or inhibit proliferation of a cancer cell and/or microorganism.
- This process may involve contacting the cell(s) with an agent(s) and the pharmaceutical composition at the same time or within a period of time wherein separate administration of the pharmaceutical composition and an agent to a cell, tissue or organism produces a desired therapeutic benefit.
- This may be achieved by contacting the cell, tissue or organism with a single composition or pharmacological formulation that includes both the pharmaceutical composition and one or more agents, or by contacting the cell with two or more distinct compositions or formulations, wherein one composition includes the pharmaceutical composition and the other includes one or more agents.
- contacted and “exposed,” when applied to a cell, tissue or organism are used herein to describe the process by which the pharmaceutical composition and/or another agent, such as for example a chemotherapeutic or radiotherapeutic agent, are delivered to a target cell, tissue or organism or are placed in direct juxtaposition with the target cell, tissue or organism.
- the pharmaceutical composition and/or additional agent(s) are delivered to one or more cells in a combined amount effective to kill the cell(s) or prevent them from dividing.
- the administration of the pharmaceutical composition may precede, be co-current with and/or follow the other agent(s) by intervals ranging from minutes to weeks.
- the pharmaceutical composition and other agent(s) are applied separately to a cell, tissue or organism, one would generally ensure that a significant period of time did not expire between the times of each delivery, such that the pharmaceutical composition and agent(s) would still be able to exert an advantageously combined effect on the cell, tissue or organism.
- one or more agents may be administered within of from substantially simultaneously, about 1 minute, to about 24 hours to about 7 days to about 1 to about 8 weeks or more, and any range derivable therein, prior to and/or after administering the expression vector. Yet further, various combination regimens of the pharmaceutical composition presented herein and one or more agents may be employed.
- the chemotherapeutic agent may be Taxotere (docetaxel), or another taxane, such as, for example, cabazitaxel.
- the chemotherapeutic may be administered either before, during, or after treatment with the activated dendritic cell and inducer.
- the chemotherapeutic may be administered about 1 year, 1 1 , 10, 9, 8, 7, 6, 5, or 4 months, or 18, 17, 16, 15, 14, 13, 12,1 1 , 10, 9, 8, 7, 6, 5, 4, 3, 2, weeks or 1 week prior to administering the first dose of activated dendritic cells.
- the chemotherapeutic may be administered about 1 week or 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, or 18 weeks or 4, 5, 6, 7, 8, 9, 10, or 1 1 months or 1 year after administering the first dose of activated dendritic cells.
- Administration of a chemotherapeutic agent may comprise the administration of more than one chemotherapeutic agent.
- cisplatin may be administered in addition to Taxotere or other taxane, such as, for example, cabazitaxel.
- Treatment for solid tumor cancers may be optimized by determining the concentration of IL-6, IL6-sR, or VCAM-1 during the course of treatment.
- IL-6 refers to interleukin 6.
- IL-6sR refers to the IL-6 soluble receptor, the levels of which often correlate closely with levels of IL-6.
- VCAM-1 refers to vascular cell adhesion molecule.
- Different patients having different stages or types of cancer, may react differently to various therapies.
- the response to treatment may be monitored by following the IL-6, IL-6sR, or VCAM-1 concentrations or levels in various body fluids or tissues.
- the determination of the concentration, level, or amount of a polypeptide, such as, IL-6, IL-6sR, or VCAM-1 may include detection of the full length polypeptide, or a fragment or variant thereof.
- the fragment or variant may be sufficient to be detected by, for example, immunological methods, mass spectrometry, nucleic acid hybridization, and the like.
- Optimizing treatment for individual patients may help to avoid side effects as a result of overdosing, may help to determine when the treatment is ineffective and to change the course of treatment, or may help to determine when doses may be increased.
- Technology discussed herein optimizes therapeutic methods for treating solid tumor cancers by allowing a clinician to track a biomarker, such as, for example, IL-6, IL-6sR, or VCAM-1 , and determine whether a subsequent dose of a drug or vaccine for administration to a subject may be maintained, reduced or increased, and to determine the timing for the subsequent dose.
- a biomarker such as, for example, IL-6, IL-6sR, or VCAM-1
- Treatment for solid tumor cancers may also be optimized by determining the concentration of urokinase-type plasminogen activator receptor (uPAR), hepatocyte growth factor (HGF), epidermal growth factor (EGF), or vascular endothelial growth factor (VEGF) during the course of treatment.
- uPAR urokinase-type plasminogen activator receptor
- HGF hepatocyte growth factor
- EGF epidermal growth factor
- VEGF vascular endothelial growth factor
- Figure 54 depicts the levels of uPAR, HGF, EGF, and VEGF over the course of treatment for subject 1003.
- Subject 1003 shows systemic perturbation of hypoxic factors in serum, which may indicate a positive response to treatment. Without limiting the interpretation of this observation, this may indicate the secretion of hypoxic factors by tumors in response to treatment.
- the response to treatment may be monitored, for example, by following the uPAR, HGF, EGF, or VEGF concentrations or levels in various body fluids or tissues.
- concentration, level, or amount of a polypeptide such as, uPAR, HGF, EGF, or VEGF may include detection of the full length polypeptide, or a fragment or variant thereof.
- the fragment or variant may be sufficient to be detected by, for example, immunological methods, mass spectrometry, nucleic acid hybridization, and the like.
- Optimizing treatment for individual patients may help to avoid side effects as a result of overdosing, may help to determine when the treatment is ineffective and to change the course of treatment, or may help to determine when doses may be increased.
- Technology discussed herein optimizes therapeutic methods for treating solid tumor cancers by allowing a clinician to track a biomarker, such as, for example, uPAR, HGF, EGF, or VEGF, and determine whether a subsequent dose of a drug or vaccine for administration to a subject may be maintained, reduced or increased, and to determine the timing for the subsequent dose.
- a biomarker such as, for example, uPAR, HGF, EGF, or VEGF
- biomarkers changes during the course of treatment of solid tumors.
- Predetermined target levels of such biomarkers, or biomarker thresholds may be identified in normal subject, are provided, which allow a clinician to determine whether a subsequent dose of a drug administered to a subject in need thereof, such as a subject with a solid tumor, such as, for example, a prostate tumor, may be increased, decreased or maintained.
- a clinician can make such a determination based on whether the presence, absence or amount of a biomarker is below, above or about the same as a biomarker threshold, respectively, in certain embodiments.
- determining that an over-represented biomarker level is significantly reduced and/or that an under-represented biomarker level is significantly increased after drug treatment or vaccination provides an indication to a clinician that an administered drug is exerting a therapeutic effect.
- level is meant the concentration of the biomarker in a fluid or tissue, or the absolute amount in a tissue. Based on such a biomarker determination, a clinician could make a decision to maintain a subsequent dose of the drug or raise or lower the subsequent dose, including modifying the timing of administration.
- drug includes traditional pharmaceuticals, such as small molecules, as well as biologies, such as nucleic acids, antibodies, proteins, polypeptides, modified cells and the like.
- determining that an over-represented biomarker level is not significantly reduced and/or that an under-represented biomarker level is not significantly increased provides an indication to a clinician that an administered drug is not significantly exerting a therapeutic effect. Based on such a biomarker determination, a clinician could make a decision to increase a subsequent dose of the drug.
- methods provided herein optimize therapeutic approaches as they provide the clinician with the ability to "dial in” an efficacious dosage of a drug and minimize side effects.
- methods provided herein allow a clinician to "dial up" the dose of a drug to an therapeutically efficacious level, where the dialed up dosage is below a toxic threshold level.
- treatment methods discussed herein enhance efficacy and reduce the likelihood of toxic side effects.
- Cytokines are a large and diverse family of polypeptide regulators produced widely throughout the body by cells of diverse origin. Cytokines are small secreted proteins, including peptides and glycoproteins, which mediate and regulate immunity, inflammation, and hematopoiesis. They are produced de novo in response to an immune stimulus. Cytokines generally (although not always) act over short distances and short time spans and at low concentration. They generally act by binding to specific membrane receptors, which then signal the cell via second messengers, often tyrosine kinases, to alter cell behavior (e.g., gene expression). Responses to cytokines include, for example, increasing or decreasing expression of membrane proteins (including cytokine receptors), proliferation, and secretion of effector molecules.
- cytokine is a general description of a large family of proteins and glycoproteins. Other names include lymphokine (cytokines made by lymphocytes), monokine (cytokines made by monocytes), chemokine (cytokines with chemotactic activities), and interleukin (cytokines made by one leukocyte and acting on other leukocytes). Cytokines may act on cells that secrete them (autocrine action), on nearby cells (paracrine action), or in some instances on distant cells
- cytokines include, without limitation, interleukins (e.g., IL-1 , IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-1 1 , IL-12, IL-13, IL-14, IL-15, IL-16, IL-1 , IL-18 and the like), interferons (e.g., IFN-beta, IFN-gamma and the like), tumor necrosis factors (e.g., TNF-alpha, TNF-beta and the like), lymphokines, monokines and chemokines; growth factors (e.g., transforming growth factors (e.g., TGF-alpha, TGF-beta and the like)); colony-stimulating factors (e.g.
- interleukins e.g., IL-1 , IL-2, IL-3, IL-4, IL-5, IL-6, IL-7,
- GM-CSF granulocyte colony-simulating factor
- G-CSF granulocyte colony-simulating factor
- a cytokine often acts via a cell-surface receptor counterpart. Subsequent cascades of intracellular signaling then alter cell functions. This signaling may include upregulation and/or downregulation of several genes and their transcription factors, resulting in the production of other cytokines, an increase in the number of surface receptors for other molecules, or the suppression of their own effect by feedback inhibition.
- VCAM-1 vascular cell adhesion molecule-1 , also called CD106
- CD106 contains six or seven immunoglobulin domains and is expressed on both large and small vessels only after the endothelial cells are stimulated by cytokines. Thus, VCAM-1 expression is a marker for cytokine expression.
- Cytokines may be detected as full-length (e.g., whole) proteins, polypeptides, metabolites, messenger RNA (mRNA), complementary DNA (cDNA), and various intermediate products and fragments of the foregoing (e.g., cleavage products (e.g., peptides, mRNA fragments)).
- IL-6 protein may be detected as the complete, full-length molecule or as any fragment large enough to provide varying levels of positive identification.
- Such a fragment may comprise amino acids numbering less than 10, from 10 to 20, from 20 to 50, from 50 to 100, from 100 to 150, from 150 to 200 and above.
- VCAM-1 protein can be detected as the complete, full- length amino acid molecule or as any fragment large enough to provide varying levels of positive identification.
- a fragment may comprise amino acids numbering less than 10, from 10 to 20, from 20 to 50, from 50 to 100, from 100 to 150 and above.
- cytokine mRNA may be detected by targeting a complete sequence or any sufficient fragment for specific detection.
- a mRNA fragment may include fewer than 10 nucleotides or any larger number.
- a fragment may comprise the 3' end of the mRNA strand with any portion of the strand, the 5' end with any portion of the strand, and any center portion of the strand.
- amino acid and nucleic acid sequences for IL-6, IL-6sR, and VCAM-1 are provided as SEQ ID NOs: 1 1 -16.
- Detection may be performed using any suitable method, including, without limitation, mass spectrometry (e.g., matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS), electrospray mass spectrometry (ES-MS)), electrophoresis (e.g., capillary electrophoresis), high performance liquid chromatography (HPLC), nucleic acid affinity (e.g., hybridization), amplification and detection (e.g., real-time or reverse-transcriptase polymerase chain reaction (RT-PCR)), and antibody assays (e.g., antibody array, enzyme-linked immunosorbant assay (ELISA)).
- mass spectrometry e.g., matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS), electrospray mass spectrometry (ES-MS)
- electrophoresis e.g., capillary electrophoresis
- HPLC high performance liquid chromatography
- IL-6 and other cytokine assays include, for example, those provided by Millipore, Inc., (Milliplex Human Cytokine/Chemokine Panel).
- IL6-sR assays include, for example, those provided by Invitrogen, Inc. (Soluble IL-6R: (Invitrogen Luminex® Bead-based assay)).
- VCAM-1 assays include, for example, those provided by R & D Systems ((CD106) ELISA development Kit, DuoSet from R&D Systems (#DY809)). Sources of Biomarkers
- the presence, absence or amount of a biomarker can be determined within a subject (e.g., in situ) or outside a subject (e.g., ex vivo). In some embodiments, presence, absence or amount of a biomarker can be determined in cells (e.g., differentiated cells, stem cells), and in certain embodiments, presence, absence or amount of a biomarker can be determined in a substantially cell-free medium (e.g., in vitro).
- the term "identifying the presence, absence or amount of a biomarker in a subject" as used herein refers to any method known in the art for assessing the biomarker and inferring the presence, absence or amount in the subject (e.g., in situ, ex vivo or in vitro methods).
- a fluid or tissue sample often is obtained from a subject for determining presence, absence or amount of biomarker ex vivo.
- Non-limiting parts of the body from which a tissue sample may be obtained include leg, arm, abdomen, upper back, lower back, chest, hand, finger, fingernail, foot, toe, toenail, neck, rectum, nose, throat, mouth, scalp, face, spine, throat, heart, lung, breast, kidney, liver, intestine, colon, pancreas, bladder, cervix, testes, muscle, skin, hair, tumor or area surrounding a tumor, and the like, in some embodiments.
- a tissue sample can be obtained by any suitable method known in the art, including, without limitation, biopsy (e.g., shave, punch, incisional, excisional, curettage, fine needle aspirate, scoop, scallop, core needle, vacuum assisted, open surgical biopsies) and the like, in certain embodiments.
- biopsy e.g., shave, punch, incisional, excisional, curettage, fine needle aspirate, scoop, scallop, core needle, vacuum assisted, open surgical biopsies
- Examples of a fluid that can be obtained from a subject includes, without limitation, blood, cerebrospinal fluid, spinal fluid, lavage fluid (e.g., bronchoalveolar, gastric, peritoneal, ductal, ear, arthroscopic), urine, interstitial fluid, feces, sputum, saliva, nasal mucous, prostate fluid, lavage, semen, lymphatic fluid, bile, tears, sweat, breast milk, breast fluid, fluid from region of inflammation, fluid from region of muscle wasting and the like, in some embodiments.
- lavage fluid e.g., bronchoalveolar, gastric, peritoneal, ductal, ear, arthroscopic
- a sample from a subject may be processed prior to determining presence, absence or amount of a biomarker.
- a blood sample from a subject may be processed to yield a certain fraction, including without limitation, plasma, serum, buffy coat, red blood cell layer and the like, and biomarker presence, absence or amount can be determined in the fraction.
- a tissue sample e.g., tumor biopsy sample
- an agent that visualizes a biomarker e.g., antibody
- a tissue sample can be exposed to one or more of the following non-limiting conditions: washing, exposure to high salt or low salt solution (e.g., hypertonic, hypotonic, isotonic solution), exposure to shearing conditions (e.g., sonication, press (e.g., French press)), mincing, centrifugation, separation of cells, separation of tissue and the like.
- high salt or low salt solution e.g., hypertonic, hypotonic, isotonic solution
- shearing conditions e.g., sonication, press (e.g., French press)
- mincing e.g., centrifugation, separation of cells, separation of tissue and the like.
- a biomarker can be separated from tissue and the presence, absence or amount determined in vitro.
- a sample also may be stored for a period of time prior to determining the presence, absence or amount of a biomarker (e.g., a sample may be frozen, cryopreserved, maintained in a preservation medium (e.g., formaldehyde)).
- a preservation medium e.g., formaldehyde
- a sample can be obtained from a subject at any suitable time of collection after a drug is delivered to the subject.
- a sample may be collected within about one hour after a drug is delivered to a subject (e.g., within about 5, 10, 15, 20, 25, 30, 35, 40, 45, 55 or 60 minutes of delivering a drug), within about one day after a drug is delivered to a subject (e.g., within about 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23 or 24 hours of delivering a drug) or within about two weeks after a drug is delivered to a subject (e.g., within about 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13 or 14 days of delivering the drug).
- a collection may be made on a specified schedule including hourly, daily, semi-weekly, weekly, bi-weekly, monthly, bi-monthly, quarterly, and yearly, and the like, for example. If a drug is administered continuously over a time period (e.g., infusion), the delay may be determined from the first moment of drug is introduced to the subject, from the time the drug administration ceases, or a point in-between (e.g.,
- the presence, absence or amount of one or more biomarkers may be determined by any suitable method known in the art, and non-limiting determination methods are discussed herein.
- Determining the presence, absence or amount of a biomarker sometimes comprises use of a biological assay.
- a biological assay one or more signals detected in the assay can be converted to the presence, absence or amount of a biomarker. Converting a signal detected in the assay can comprise, for example, use of a standard curve, one or more standards (e.g., internal, external), a chart, a computer program that converts a signal to a presence, absence or amount of biomarker, and the like, and combinations of the foregoing.
- Biomarker detected in an assay can be full-length biomarker, a biomarker fragment, an altered or modified biomarker (e.g., biomarker derivative, biomarker metabolite), or sum of two or more of the foregoing, for example.
- Modified biomarkers often have substantial sequence identity to a biomarker discussed herein. For example, percent identity between a modified biomarker and a biomarker discussed herein may be in the range of 15- 20%, 20-30%, 31 -40%, 41-50%, 51 -60%, 61 -70%, 71-80%, 81 -90% and 91 -100%, (e.g.
- a modified biomarker often has a sequence (e.g., amino acid sequence or nucleotide sequence) that is 90% or more identical to a sequence of a biomarker discussed herein. Percent sequence identity can be determined using
- Detection of biomarkers may be performed using any suitable method known in the art, including, without limitation, mass spectrometry, antibody assay (e.g., ELISA), nucleic acid affinity, microarray hybridization, Northern blot, reverse PCR and RT-PCR. For example, RNA purity and
- RNA quality may be assessed using methods known in the art (e.g., Agilent 2100 Bioanalyzer; RNA 6000 Nano LabChip® and the like).
- An indication for adjusting or maintaining a subsequent drug dose can be based on the presence or absence of a biomarker. For example, when (i) low sensitivity determinations of biomarker levels are available, (ii) biomarker levels shift sharply in response to a drug, (iii) low levels or high levels of biomarker are present, and/or (iv) a drug is not appreciably toxic at levels of
- presence or absence of a biomarker can be sufficient for generating an indication of adjusting or maintaining a subsequent drug dose.
- An indication for adjusting or maintaining a subsequent drug dose often is based on the amount or level of a biomarker.
- An amount of a biomarker can be a mean, median, nominal, range, interval, maximum, minimum, or relative amount, in some embodiments.
- An amount of a biomarker can be expressed with or without a measurement error window in certain embodiments.
- An amount of a biomarker in some embodiments can be expressed as a biomarker concentration, biomarker weight per unit weight, biomarker weight per unit volume, biomarker moles, biomarker moles per unit volume, biomarker moles per unit weight, biomarker weight per unit cells, biomarker volume per unit cells, biomarker moles per unit cells and the like. Weight can be expressed as
- unit weight can be weight of subject or weight of sample from subject
- unit volume can be volume of sample from the subject (e.g., blood sample volume)
- unit cells can be per one cell or per a certain number of cells (e.g., micrograms of biomarker per 1000 cells).
- an amount of biomarker determined from one tissue or fluid can be correlated to an amount of biomarker in another fluid or tissue, as known in the art.
- An indication for adjusting or maintaining a subsequent drug dose often is generated by comparing a determined level of biomarker in a subject to a predetermined level of biomarker.
- predetermined level of biomarker sometimes is linked to a therapeutic or efficacious amount of drug in a subject, sometimes is linked to a toxic level of a drug, sometimes is linked to presence of a condition, sometimes is linked to a treatment midpoint and sometimes is linked to a treatment endpoint, in certain embodiments.
- a predetermined level of a biomarker sometimes includes time as an element, and in some embodiments, a threshold is a time-dependent signature.
- an IL-6 or IL6-sR level of about 8-fold more than a normal level, or greater (e.g.
- IL-6 or IL-6sR level less than about 8-fold more than a normal level may indicate that the dosage may be maintained or decreased in a subsequent administration.
- a VCAM-1 level of about 8 fold more than a normal level, or greater e.g. e.g.
- a VCAM-1 level less than about 8-fold more than a normal level (e.g. about 7, 6, 5,
- a normal level of IL- 6, IL-6sR, or VCAM-1 may be assessed in a subject not diagnosed with a solid tumor or the type of solid tumor under treatment in a patient.
- a perturbation in the concentration of an individual secreted factor such as, for example, GM-CSF, MIP-1 alpha, MIP-1 beta, MCP-1 , IFN-gamma, RANTES, EGF or HGF, or a perturbation in the mean
- concentration of a panel of secreted factors such as two or more of the markers selected from the group consisting of GM-CSF, MIP-1 alpha, MIP-1 beta, MCP-1 , IFN-gamma, RANTES, EGF and HGF.
- This perturbation may, for example, consist of an increase, or decrease, in the concentration of an individual secreted factor by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% or an increase or decrease in the mean relative change in serum concentration of a panel of secreted factors by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%.
- This increase may, or may not, be followed by a return to baseline serum concentrations before the next administration.
- the increase or decrease in the mean relative change in serum concentration may involve, for example, weighting the relative value of each of the factors in the panel. Also, the increase or decrease may involve, for example, weighting the relative value of each of the time points of collected data. The weighted value for each time point, or each factor may vary, depending on the state or the extent of the cancer, metastasis, or tumor burden.
- An indication for adjusting or maintaining the drug dose may include a perturbation in the concentration of an individual secreted factor or the mean concentration of a panel of secreted factors, after 1 , 2, 3, 4,
- Some treatment methods comprise (i) administering a drug to a subject in one or more administrations (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses), (ii) determining the presence, absence or amount of a biomarker in or from the subject after (i), (iii) providing an indication of increasing, decreasing or maintaining a subsequent dose of the drug for administration to the subject, and (iv) optionally administering the subsequent dose to the subject, where the subsequent dose is increased, decreased or maintained relative to the earlier dose(s) in (i).
- administrations e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses
- presence, absence or amount of a biomarker is determined after each dose of drug has been administered to the subject, and sometimes presence, absence or amount of a biomarker is not determined after each dose of the drug has been administered (e.g., a biomarker is assessed after one or more of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth or tenth dose, but not assessed every time after each dose is administered).
- An indication for adjusting a subsequent drug dose can be considered a need to increase or a need to decrease a subsequent drug dose.
- An indication for adjusting or maintaining a biomarker can be considered a need to increase or a need to decrease a subsequent drug dose.
- subsequent drug dose can be considered by a clinician, and the clinician may act on the indication in certain embodiments.
- a clinician may opt not to act on an indication.
- a clinician can opt to adjust or not adjust a subsequent drug dose based on the indication provided.
- An indication of adjusting or maintaining a subsequent drug dose, and/or the subsequent drug dosage can be provided in any convenient manner.
- An indication may be provided in tabular form (e.g., in a physical or electronic medium) in some embodiments.
- a biomarker threshold may be provided in a table, and a clinician may compare the presence, absence or amount of the biomarker determined for a subject to the threshold. The clinician then can identify from the table an indication for subsequent drug dose.
- an indication can be presented (e.g., displayed) by a computer after the presence, absence or amount of a biomarker is provided to computer (e.g., entered into memory on the computer).
- presence, absence or amount of a biomarker determined for a subject can be provided to a computer (e.g., entered into computer memory by a user or transmitted to a computer via a remote device in a computer network), and software in the computer can generate an indication for adjusting or maintaining a subsequent drug dose, and/or provide the subsequent drug dose amount.
- a subsequent dose can be determined based on certain factors other than biomarker presence, absence or amount, such as weight of the subject, one or more metabolite levels for the subject (e.g., metabolite levels pertaining to liver function) and the like, for example.
- a clinician may administer the subsequent dose or provide instructions to adjust the dose to another person or entity.
- the term "clinician" as used herein refers to a decision maker, and a clinician is a medical professional in certain embodiments.
- a decision maker can be a computer or a displayed computer program output in some embodiments, and a health service provider may act on the indication or subsequent drug dose displayed by the computer.
- a decision maker may administer the subsequent dose directly (e.g., infuse the subsequent dose into the subject) or remotely (e.g., pump parameters may be changed remotely by a decision maker).
- a subject can be prescreened to determine whether or not the presence, absence or amount of a particular biomarker may be determined.
- prescreens include identifying the presence or absence of a genetic marker (e.g., polymorphism, particular nucleotide sequence); identifying the presence, absence or amount of a particular metabolite.
- a prescreen result can be used by a clinician in combination with the presence, absence or amount of a biomarker to determine whether a subsequent drug dose may be adjusted or maintained.
- an antibody or small molecule is provided for use as a control or standard in an assay, or a therapeutic, for example.
- an antibody or other small molecule configured to bind to a cytokine or cytokine receptor, including without limitation IL-6, IL- 6sR, and alter the action of the cytokine, or it may be configured to bind to VCAM-1.
- an antibody or other small molecule may bind to an mRNA structure encoding for a cytokine or receptor.
- small molecule as used herein means an organic molecule of approximately 800 or fewer Daltons. In certain embodiments small molecules may diffuse across cell membranes to reach intercellular sites of action. In some embodiments a small molecule binds with high affinity to a biopolymer such as protein, nucleic acid, or polysaccharide and may sometimes alter the activity or function of the biopolymer. In various embodiments small molecules may be natural (such as secondary metabolites) or artificial (such as antiviral drugs); they may have a beneficial effect against a disease (such as drugs) or may be detrimental (such as teratogens and carcinogens).
- small molecules may include ribo- or deoxyribonucleotides, amino acids, monosaccharides and small oligomers such as dinucleotides, peptides such as the antioxidant glutathione, and disaccharides such as sucrose.
- antibody as used herein is to be understood as meaning a gamma globulin protein found in blood or other bodily fluids of vertebrates, and used by the immune system to identify and neutralize foreign objects, such as bacteria and viruses.
- Antibodies typically include basic structural units of two large heavy chains and two small light chains.
- polyclonal antibodies raised to a particular protein polymorphic variants, alleles, orthologs, and conservatively modified variants, or splice variants, or portions thereof, can be selected to obtain only those polyclonal antibodies that are specifically immunoreactive with GM-CSF, TNF-alpha or NF-kappa-B modulating protein and not with other proteins. This selection may be achieved by subtracting out antibodies that cross-react with other molecules.
- an effective amount of an activated cell is defined as that amount sufficient to detectably and repeatedly to achieve the stated desired result, for example, to ameliorate, reduce, minimize or limit the extent of the disease or its symptoms. Other more rigorous definitions may apply, including elimination, eradication or cure of disease. In some embodiments there may be a step of monitoring the biomarkers to evaluate the effectiveness of treatment and to control toxicity.
- NA-6-Mel, T2, SK-Mel-37 and LNCaP cell lines were purchased from the American Type Culture Collection (ATCC) (Manassas, VA). HLA-A2-restricted peptides MAGE-3 p271-279
- FLWGPRALV influenza matrix (IM) p58-66
- GILGFVFTL influenza matrix p58-66
- SLYNTVATL HIV-1 gag p77-85
- the human CD40 cytoplasmic domain was Pfu I polymerase (Stratagene, La Jolla, California) amplified from human monocyte-derived DC cDNA using an Xho l-flanked 5' primer (5hCD40X), 5'- atatactcgagaaaaggtggccaagaagccaacc-3', and a Sal l-flanked 3' primer (3hCD40S), 5'- atatagtcgactcactgtctctcctgcactgagatg-3'.
- the PCR fragment was subcloned into Sal l-digested pSH1/M-FvFvls-E15 and sequenced to create pSH1/M-FvFvls-CD40-E.
- Inducible CD40 was subsequently subcloned into a non-replicating E1 , E3-deleted Ad5/f35-based vector expressing the transgene under a cytomegalovirus early/immediate promoter.
- the iCD40-encoding sequence was confirmed by restriction digest and sequencing. Amplification, purification, and titration of all adenoviruses were carried out in the Viral Vector Core Facility of Baylor College of Medicine. Western blot
- Total cellular extracts were prepared with RIPA buffer containing a protease inhibitor cocktail (Sigma-Aldrich, St. Louis, MO) and quantitated using a detergent-compatible protein concentration assay (Bio-Rad, Hercules, CA). 10-15 micrograms of total protein were routinely separated on 12% SDS-PAGE gels, and proteins were transferred to nitrocellulose membranes (Bio-Rad). Blots were hybridized with goat anti-CD40 (T-20, Santa Cruz Biotechnology, Santa Cruz, CA) and mouse anti- alpha-tubulin (Santa Cruz Biotechnology) Abs followed by donkey anti-goat and goat anti-mouse IgG-HRP (Santa Cruz Biotechnology), respectively. Blots were developed using the SuperSignal West Dura Stable substrate system (Pierce, Rockford, Illinois). Generation and stimulation of human DCs
- PBMCs Peripheral blood mononuclear cells from healthy donors were isolated by density centrifugation of heparinized blood on Lymphoprep (Nycomed, Oslo, Norway). PBMCs were washed with PBS, resuspended in CellGenix DC medium (Freiburg, Germany) and allowed to adhere in culture plates for 2 h at 37 degrees C and 5% C02. Nonadherent cells were removed by extensive washings, and adherent monocytes were cultured for 5 days in the presence of 500 U/ml hlL-4 and 800 U/ml hGM-CSF (R&D Systems, Minneapolis, MN).
- imDCs immature DCs
- the imDCs were CD14neg and contained ⁇ 3% of
- CD3+ T CD19+ B, and CD16+ NK cells.
- adenoviruses 10,000 viral particle (vp)/cell (-160 MOI) for 90 min at 37 degrees C and 5% C0 2 .
- DCs were stimulated with MPL, FSL-1 , Pam3CSK4 (InvivoGen, San Diego, CA), LPS (Sigma-Aldrich, St.
- AP20187 kind gift from ARIAD Pharmaceuticals, Cambridge, MA
- maturation cocktail containing 10 ng/ml TNF-alpha, 10 ng/ml IL-1 beta, 150 ng/ml IL-6 (R&D Systems, Minneapolis, MN) and 1 microgram/ml of PGE2 (Cayman Chemicals, Ann Arbor, Ml).
- DCs were pulsed with 50 micrograms/ml of PSMA polypeptide or MAGE 3 peptide 24 hours before and after adenoviral transduction.
- DCs from HLA-A2-positive healthy volunteers were pulsed with MAGE-3 A2.1 peptide (residues 271-279; FLWGPRALV) on day 4 of culture, followed by transduction with Ad-iCD40 and stimulation with various stimuli on day 5.
- Autologous T cells were purified from PBMCs by negative selection (Miltenyi Biotec, Auburn, CA) and mixed with DCs at DC:T cell ratio 1 :3. Cells were incubated in complete RPMI with 20 U/ml hlL-2 (R&D Systems) and 25 micrograms/ml of MAGE 3 A2.1 peptide. T cells were restimulated at day 7 and assayed at day 14 of culture.
- Antigen recognition was assessed using target cells labeled with Chromium-51 (Amersham) for 1 hour at 37 °C and washed three times. Labeled target cells (5000 cells in 50 microliters) were then added to effector cells (100 microliters) at the indicated effector: target cell ratios in V-bottom microwell plates at the indicated concentrations. Supernatants were harvested after 6-h incubation at 37 °C, and chromium release was measured using MicroBeta Trilux counter (Perkin-Elmer Inc, Torrance CA). Assays involving LNCaP cells were run for 18 hours. The percentage of specific lysis was calculated as: 100 * [(experimental - spontaneous release)/(maximum - spontaneous release)].
- HLA-A2 tetramers assembled with MAGE-3.A2 peptide were obtained from Baylor College of Medicine Tetramer Core Facility (Houston, TX). Presensitized CD8+ T cells in 50 ⁇ of PBS containing 0.5% FCS were stained with PE-labeled tetramer for 15 min on ice before addition of FITC-CD8 mAb (BD Biosciences). After washing, results were analyzed by flow cytometry.
- Naive CD4+CD45RA+ T-cells from HLA-DR1 1.5-positive donors were isolated by negative selection using naive CD4+ T cell isolation kit (Miltenyi Biotec, Auburn, CA). T cells were stimulated with autologous DCs pulsed with tetanus toxoid (5 FU/ml) and stimulated with various stimuli at a stimulator to responder ratio of 1 :10.
- T cells were restimulated with autologous DCs pulsed with the HLA- DR1 1.5-restricted helper peptide TTp30 and transduced with adenovector Ad-iCD40.
- Cells were stained with PE-anti-CD4 Ab (BD Biosciences), fixed and permeabilized using BD Cytofix/Cytoperm kit (BD Biosciences), then stained with hlFN-gamma mAb (eBioscience, San Diego, CA) and analyzed by flow cytometry.
- Supernatants were analyzed using human TH1/TH2 BD Cytometric Bead Array Flex Set on BD FACSArray Bioanalyzer (BD Biosciences). PSMA protein purification
- the baculovirus transfer vector, pAcGP67A (BD Biosciences) containing the cDNA of extracellular portion of PSMA (residues 44-750) was kindly provided by Dr Pamela J. Bjorkman (Howard Hughes Medical Institute, California Institute of Technology, Pasadena, CA). PSMA was fused with a hydrophobic secretion signal, Factor Xa cleavage site, and N-terminal 6x-His affinity tag. High titer baculovirus was produced by the Baculovirus/Monoclonal antibody core facility of Baylor College of Medicine.
- PSMA protein was produced in High 5 cells infected with recombinant virus, and protein was purified from cell supernatants using Ni-NTA affinity columns (Qiagen, Chatsworth, CA) as previously discussed (Cisco RM, Abdel-Wahab Z, Dannull J, et al. Induction of human dendritic cell maturation using transfection with RNA encoding a dominant positive toll-like receptor 4. J Immunol. 2004; 172:7162-7168). After purification the -100 kDa solitary band of PSMA polypeptide protein was detected by silver staining of acrylamide gels.
- SEAP Secreted alkaline phosphatase
- Reporters assays were conducted in human Jurkat-TAg (T cells) or 293 (kidney embryonic epithelial) cells or murine RAW264.7 (macrophage) cells.
- Jurkat-TAg cells (107) in log-phase growth were electroporated (950 mF, 250 V) with 2 mg expression plasmid and 2 mg of reporter plasmid NF-kB-SEAP or IFNb-TA-SEAP (see above).
- 293 or RAW264.7 cells ⁇ 2 x 10 5 cells per 35-mm dish
- transformed cells were stimulated with CID. After an additional 20 h, supernatants were assayed for SEAP activity as discussed previously (Spencer, D. M., et al., Science 262, 1019-1024 (1993)).
- Jurkat-TAg and RAW264.7 cells were grown in RPMI 1640 medium, 10% fetal bovine serum (FBS), 10 mM HEPES (pH 7.I4), penicillin (100 U/ml) and streptomycin (100 mg/ml). 293 cells were grown in Dulbecco's modified Eagle's medium, 10% FBS, and pen-strep. Data analysis
- Results are expressed as the mean ⁇ standard error. Sample size was determined with a power of 0.8, with a one-sided alpha-level of 0.05. Differences between experimental groups were determined by the Student t test.
- iCD40 recombinant CD40 receptor
- CD1 1 c+ CD1 1 c+
- FKBP12(V 36 ) Figure 1 B.
- M myristoylation-targeting domain
- E HA epitope
- Figure 1 C Figure 1 C showed that increasing levels of AP20187 resulted in significant upregulation of NF B transcriptional activity compared to the control vector, M-FvFvls- E, lacking CD40 sequence.
- iCD40 membrane-proximal version of iCD40, M-CD40-FvFvls-E, was less responsive to AP20187 in this assay system
- the M-FvFvlsCD40-E construct was used in further studies, and heretofore referred to as "iCD40". This decision was reinforced by the crystallographic structure of the CD40 cytoplasmic tail, which reveals a hairpin conformation that could be deleteriously altered by the fusion of a heterologous protein to its carboxyl-terminus (Ni 2000). The data also showed high drug dose suppression over 100 nM, likely due to the saturation of drug binding domains. This same phenomenon has been observed in other cell types expressing limiting levels of the iCD40 receptor. These results suggested that iCD40 was capable of inducing CID-dependent nuclear translocation of the NF B transcription factor..
- Inducible iMyD88 Human TIR-containing inducible PRR adapter MyD88 ( ⁇ 900-bp) was PCR- amplified from 293 cDNA using Xhol/Sall-linkered primers 5MyD88S (5'- acatcaactcgagatggctgcaggaggtcccgg-3') and 3MyD88S (5'-actcatagtcgaccagggacaaggccttggcaag- 3') and subcloned into the Xhol and Sail sites of pSH1/M-Fv'-Fvls-E (Xie, X. et al., Cancer Res 61 , 6795-804.
- the human CD40 cytoplasmic signaling domain was cloned downstream of a myristoylation- targeting domain and two tandem domains (from human FKBP12(V 36 ), designated as "Fv"'), which bind dimerizing drug AP20187 (Clackson T, et al., Proc Natl Acad Sci U S A. 1998;95:10437- 10442).
- Immature DCs expressed endogenous CD40, which was induced by LPS and CD40L.
- Transduction of Ad-iCD40 led to expression of the distinctly sized iCD40, which did not interfere with endogenous CD40 expression.
- TLR-4 signaling mediated by LPS or its derivative MPL is a potent inducer of DC maturation (Ismaili J, et al., J Immunol. 2002; 168:926-932; Cisco RM, et al., J Immunol. 2004;172:7162-7168; De Becker G, Moulin V, Pajak B, et al.
- the adjuvant monophosphoryl lipid A increases the function of antigen- presenting cells. Int Immunol. 2000; 12:807-815; Granucci F, et al., Microbes Infect. 1999; 1 :1079- 1084).
- a set of constructs was designed to express inducible receptors, including a truncated version of MyD88, lacking the TIR domain.
- 293 cells were cotransfected with a NF-kappaB reporter and the SEAP reporter assay was performed essentially as discussed in Spencer, D.M., et al., Science 262, 1019-1024 (1993).
- the vector originally designed was pBJ5-M-MyD88L-Fv'Fvls- E.
- pShuttleX-M-MyD88L-Fv'Fvls was used to make the adenovirus. Both of these vectors were tested in SEAP assays. After 24 hours, AP20187 was added, and after 20 additional hours, the cell supernatant was tested for SEAP activity.
- Graphics relating to these chimeric constructs and activation are provided in Figures 3 and 4. The results are shown in Figure 5.
- Control Transfected with NF-kappaB reporter only.
- TLR4on pShuttleX-CD4/TLR4-L3-E : CD4/TLR4L3-E is a constitutive version of TLR4 that contains the extracellular domain of mouse CD4 in tandem with the transmembrane and cytoplasmic domains of human TLR4 (as discussed in Medzhitov R, et al, Nature. 1997 Jul).
- iMyD88 contains M-MyD88L-Fv'Fvls-E
- iCD40 contains M-Fv'-Fvls-CD40-E
- iCD40T contains M-Fv'-Fv'-Fvls-CD40-E - iCD40T contains an extra Fv' (FKBP with wobble at the valine)
- iMyD88:CD40 contains M-MyD88L-CD40-Fv'Fvls-E
- iMyD88:CD40T contains M-MyD88LCD40-Fv'Fv'Fvls-E - contains an extra Fv' compared to iMyD88:CD40.
- Example 4 Inducible CD40, CD40-MyD88, CD40-RIG-1, and CD40:NOD2
- the following constructs were designed and assayed in the NF-kappaB reporter system. 293 cells were cotransfected with a NFkappaB reporter and one of the constructs. After 24 hours, AP20187 was added, and after an additional 3 hours ( Figure 6) or 22 hours ( Figure 7), the cell supernatant was tested for SEAP activity. About 20-24 hours after transfection, the cells were treated with dimer drug AP20187. About 20-24 hours following treatment with dimer drug, cells were treated with SEAP substrate 4-methylumbelliferyl phosphate (MUP). Following an overnight incubation (anywhere from 16-22 hrs), the SEAP counts were recorded on a FLUOStar OPTIMA machine.
- MUP 4-methylumbelliferyl phosphate
- MyD88LFv'FvlsCD40 was made in pBJ5 backbone with the myristoylation sequence upstream from MyD88L
- Fv'FvlsCD40MyD88L was made in pBJ5 backbone with the myristoylation sequence upstream from Fv'.
- MyD88LCD40Fv'Fvls was made in 2 vector backbone (pBJ5) with the myristoylation sequence upstream from the MyD88L.
- CD40Fv'FvlsMyD88L was made in pBJ5 backbone with the myristoylation sequence upstream from CD40.
- Fv'2FvlsCD40stMyD88L is a construct wherein a stop sequence after CD40 prevented MyD88L from being translated. Also named iCD40T'.
- Fv'2Fvls includes 2 copies of Fv', separated by a gtcgag sequence.
- Fv'FvlsMyD88L was made in pBJ5 backbone with the myristoylation sequence upstream from the Fv'.
- Fv'FvlsCD40 is available in pBJ5 and pShuttleX
- CD40Fv'Fvls is available in pBJ5 backbone with the myristoylation sequence upstream from the CD40.
- MFv'Fvls is available in pBJ5 backbone with the myristoylation sequence indicated by the M.
- Fv"FvlsNOD2 pBJ5-Sn-Fv'Fvls-NOD2-E in pBJ5 backbone with no myristoylation sequence, contains 2 FKBPs followed by 2 CARD domains of NOD2 and the HA epitope.
- Fv'FvlsRIG-1 pBJ5-Sn-Fv'Fvls-RIG-l-E in pBJ5 backbone with no myristoylation sequence, contains 2 FKBPs followed by 2 CARD domains of RIG-I and the HA epitope.
- L3 indicates three 6 amino acid linkers, having the DNA sequence:
- E is an HA epitope
- Recombinant adenovirus was obtained using methods essentially as discussed in He, T.C., et al. (1998) Proc. Natl. Acad. Sci. USA 95(5):2509-14.
- Bone marrow-derived dendritic cells were plated at 0.25 x 10 6 cells per well of a 48-well plate after washing twice with serum-free RPMI media with antibiotic. Cells were transduced with 6 microliters crude virus lysate in 125 microliters serum-free media. 2 hours later, 375 microliters of serum-supplemented RPMI was added to each well of the 48-well plate. 48 hours later, supernatants were harvested and analyzed using a mouse IL-12p70 ELISA kit (BD OptEIA (BD Biosciences, New Jersey). Duplicate assays were conducted for each sample, either with or without the addition of 100 nM AP21087.
- BD OptEIA mouse IL-12p70 ELISA kit
- CD40-L is CD40 ligand, a TNF family member that binds to the CD40 receptor.
- LPS is lipopolysaccharide.
- Figure 10 results of a repeat of the assay are shown in Figure 1 1 , crude adenoviral lysate was added at 6.2 microliters per 0.25 million cells.
- Figure 12 shows the results of an additional assay, where more viral lysate, 12.5 microliters per 0.25 million cells was used to infect the BMDCs.
- Example 7 IL-12p70 Expression in MyD88L-Adenoviral Transduced Human Monocyte-Derived Dendritic Cells
- Immature human monocyte-derived dendritic cells were plated at 0.25 x 10 6 cells per well of a 48-well plate after washing twice with serum-free RPMI media with antibiotic. Cells were transduced with different multiplicity of infections (MOI) of adenovirus AD5-iMyD88.CD40 and stimulated with 100 nM dimer drug AP20187. The virus used was an optimized version of the viral lysate used in the previous examples. 48 hours later, supernatants were harvested and assayed in an IL12p70 ELISA assay. Figure 16 depicts the results of this titration.
- MOI multiplicity of infections
- Immature human moDCs were plated at 0.25 x 10 6 cells per well of a 48-well plate after washing twice with serum-free RPMI media with antibiotic. Cells were then transduced with either Ad5f35- iCD40 (10,000 VP/cell); Ad5-iMyD88.CD40 (100 MOI); Ad5.iMyD88 (100 MOI) or Ad5-TLR4on (100 MOI) and stimulated with 1 microgram/milliliter LPS where indicated and 100 nM dimer drug AP20187 where indicated in Figure 17. 48 hours later, supernatants were harvested and assayed in an IL12p70 ELISA assay.
- Ad5f35-iCD40 was produced using pShuttleX-ihCD40 (also known as M-Fv'-Fvls-hCD40;
- MyD88 as indicated in Figures 16 and 17, is the same truncated version of MyD88 as the version indicated as MyD88L herein.
- Ad5.iMyD88 was produced using pShuttleX-MyD88L-Fv'Fvls-E.
- the adenovirus indicated as Ad5- iMyD88.Cd40 was produced using pShuttleX-MyD88LCD40-Fv'Fvls-E.
- the adenovirus indicated as Ad5-TLR40n was produced using pShuttleX-CD4/TLR4-L3-E.
- a plasmid vector is constructed comprising the iMyD88-CD40 sequence operably linked to the Fv'Fvls sequence, such as, for example, the pShuttleX-MyD88LCD40-Fv'Fvls-E
- the plasmid construct also includes the following regulatory elements operably linked to the MyD88ICD40-Fv'Fvls-E sequence: promoter, initiation codon, stop codon, polyadenylation signal.
- the vector may also comprise an enhancer sequence.
- the MyD88L, CD40, and FvFvls sequences may also be modified using synthetic techniques known in the art to include optimized codons.
- Immature human monocyte-derived dendritic cells are plated at 0.25 x 10 6 cells per well of a 48-well plate after washing twice with serum-free RPMI media with antibiotic.
- Cells are transduced with the plasmid vector using any appropriate method, such as, for example, nucleofection using AMAXA kits, electroporation, calcium phosphate, DEAE-dextran, sonication loading, liposome-mediated transfection, receptor mediated transfection, or microprojectile bombardment.
- DNA vaccines are discussed in, for example, U.S. Patent Publication 20080274140, published November 6, 2008.
- the iMyD88-CD40 sequence operably linked to the Fv'Fvls sequence is inserted into a DNA vaccine vector, which also comprises, for example, regulatory elements necessary for expression of the iMyD88-Cd40 Fv'Fvls chimeric protein in the host tissue.
- regulatory elements include, but are not limited to, promoter, initiation codon, stop codon, polyadenylation signal, and enhancer, and the codons coding for the chimeric protein may be optimized.
- Example 9 Evaluation of CD40 and MyD88CD40 Transformed Dendritic Cells in Vivo Using a Mouse Tumor Model Bone marrow dendritic cells were transduced using adenoviral vectors as presented in the examples herein. These transduced BMDCs were tested for their ability to inhibit tumor growth in a EG.7-OVA model.
- EG.7-OVA cells (5x10 5 cells/100 ml) were inoculated into the right flank of C57BL/6 female mice.
- BMDCs of all groups were pulsed with 50 microgram/ml of ovalbumin protein and activated as described above. Approximately 7 days after tumor cell inoculation, BMDCs were thawed and injected subcutaneously into the hind foot-pads of mice.
- Table 1 presents the experimental design, which includes non-transduced dendritic cells (groups 1 and 2), dendritic cells transduced with a control adenovirus vector (group 3), dendritic cells transduced with a CD40 cytoplasmic region encoding vector (group 4), dendritic cells transduced with a truncated MyD88 vector (groups 5 and 6), and dendritic cells transduced with the chimeric CD40-truncated MyD88 vector (groups 7 and 8).
- the cells were stimulated with AP-1903, LPS, or CD40 ligand as indicated.
- FIG. 18 shows a chart of tumor growth inhibition observed in the transduced mice. Inoculation of the MyD88 transduced and AP1903 treated dendritic cells resulted in a cure rate of 1/6, while inoculation of the MyD88-CD40 transduced dendritic cells without AP1903 resulted in a cure rate of 4/6, indicating a potential dimerizer-independent effect.
- the asterix indicates a comparison of
- Figure 19 also provides photographs of representative vaccinated mice.
- Figure 20 presents an analysis of the enhanced frequency of Ag-Specific CD8+ T cell induction in mice treated with iMyD88-CD40 transduced dendritic cells.
- Peripheral bone marrow cells from treated mice were harvested ten days after vaccination on day 7.
- the PBMCs were stained with anti-mCD8-FITC and H2-Kb-SIINFEKL-tetramer-PE and analyzed by flow cytometry.
- Figure 21 presents the enhanced frequency of Ag-specific CD8+ T cell and CD4+ TH1 cells induced in mice after treatment iMyD88-CD40-transduced dendritic cells.
- Three mice of all experimental groups were sacrificed 18 days after the vaccination.
- Splenocytes of three mice per group were "pooled” together and analyzed by IFN-gamma ELISPOT assay.
- Millipore MultiScreen- HA plates were coated with 10 micrograms/ml anti-mouse IFN-gamma AN 18 antibody (Mabtech AB, Inc., Nacka, Sweden). Splenocytes were added and cultured for 20 hours at 37 degrees C in 5% C02 in complete ELISpot medium (RPMI, 10% FBS, penicillin, streptomycin).
- Splenocytes were incubated with 2 micrograms/ml OT-1 (SIINFEKL), OT-2 (ISQAVHAAHAEINEAGR) or TRP-2 peptide (control non-targeted peptide).
- OT-1 SIINFEKL
- OT-2 ISQAVHAAHAEINEAGR
- TRP-2 peptide control non-targeted peptide.
- R4-6A2 biotinylated monoclonal antibody to mouse IFN-gamma
- Figure 22 presents a schematic and the results of an in vivo cytotoxic lymphocyte assay. Eighteen days after DC vaccinations an in vivo CTL assay was performed. Syngeneic naive splenocytes were used as in vivo target cells. They were labeled by incubation for 10 minutes at 37 degrees C with either 6 micromolar CFSE (CFSEhi cells) or 0.6 micromolar CFSE in CTL medium (CFSElo cells). CFSEhi cells were pulsed with OT-1 SIINFEKL peptide, and CFSElo cells were incubated with control TRP2 peptide.
- CFSEhi cells 6 micromolar CFSE
- CFSElo cells 0.6 micromolar CFSE in CTL medium
- FIG. 23 is a chart presenting the enhanced CTL activity induced by iMyD88-CD40-transduced dendritic cells in the inoculated mice.
- Figure 24 shows the raw CTL histograms for select samples, indicating the enhanced in vivo CTL activity induced by the iMyD88-CD40 transduced dendritic cells.
- Figure 25 presents the results of intracellular staining for IL-4 producing TH2 cells in the mice vaccinated with the transduced cells.
- Splenocytes of mice (pooled cells from three mice) were reconstituted with 2 micrograms/ml of OT-2 peptide. Cells were incubated for 6 hours with 10 micrograms/ml of brefeldin A to suppress secretion. Then cells were fixed and permealized and analyzed by intracelllular staining with anti-mlL-4-APC and anti-mCD4-FITC.
- the adenoviral vector comprising the iCD40-MyD88 sequence was again evaluated for its ability to inhibit tumor growth in a mouse model.
- drug-dependent tumor growth inhibition was measured after inoculation with dendritic cells modified with the inducible CD40- truncated MyD88 vector (Ad-iCD40.MyD88).
- Bone marrow-derived dendritic cells from C57BL/6 mice were pulsed with 10 micrograms/ml of ovalbumin and transduced with 20,000 viral particles/cell (VP/c) of the adenovirus constructs Ad5-iCD40.MyD88, Ad5-iMyD88 or Ad5-Luc (control).
- BMDCs of AP1903 groups were treated in vitro with 50 nM AP1903. The next day, after cellular vaccinations, mice of AP1903 groups were treated by intraperitoneal injection with 5mg/kg AP1903. The results are shown in Figure 26B.
- Figure 26C depicts relative IL-12p70 levels produced following overnight culture of the various vaccine cells prior to cryopreservation. IL- 12p70 was assayed by ELISA assay.
- BMDCs peripheral blood mononuclear cells
- Figure 27B shows the results of an in vivo CTL assay that was performed in mice vaccinated with BMDCs as described above.
- splenocytes from syngeneic C57BL/6 mice were pulsed with either TRP-2 control peptide, SVYDFFVWL, or target peptide, SINFEKL target, and were used as in vivo targets.
- Half of the splenocytes were labeled with 6 micromolar CFSE (CFSEhi cells) or 0.6 micromolar
- CFSE CFSEIo cells
- CFSEhi cells were pulsed with OT-1 (SIINFEKL) peptide and CFSEIo cells were incubated with control TRP-2 (SVYDFFVWL) peptide .
- TRP-2 SVYDFFVWL
- a mixture of 4 x10 6 CFSEhi plus 4 x10 6 CFSEIo cells was injected intravenously through the tail vein. The next day, splenocytes were collected and single-cell suspensions were analyzed for detection and quantification of CFSE- labeled cells.
- Figures 27C and 27D show the results of an IFN-gamma assay.
- PBMCs Peripheral blood mononuclear cells from E.G7-OVA-bearing mice treated as described in Figure 26, were analyzed in IFN-gamma ELISpot assays with 1 microgram/ml of SIINFEKL peptide (OT-1 ), ISQAVHAAHAEINEAGR (OT-2) and TRP-2 (irrelevant H2-Kb-restricted) peptides.
- OT-1 SIINFEKL peptide
- OT-2 IFN-gamma-producing lymphocytes
- TRP-2 irrelevant H2-Kb-restricted
- Figure 28 presents the results of a natural killer cell assay performed using the splenocytes from mice treated as indicated in this example.
- Splenocytes obtained from mice (3 per group) were used as effectors (E).
- Yac-1 cells were labeled with 51 Cr and used as targets (T).
- the EL-4 cell line was used as an irrelevant control.
- Figure 29 presents the results of an assay for detection of antigen-specific cytotoxic lymphocytes.
- Splenocytes obtained from mice (3 per group) were used as effectors.
- EG.7-Ova cells were labeled with 51 Cr and used as targets (T).
- T targets
- the EL-4 cell line was used as an irrelevant control.
- Figure 30 presents the results of the activation of human cells transduced with the inducible CD40- truncated MyD88 (iCD40.MyDD) adenovirus vector.
- Dendritic cells day 5 of culture
- HLA-A2+ donors were purified by the plastic-adhesion method and transduced with
- T cells were assayed in standard IFN-gamma ELISpot assay.
- Cells were pulsed with 1 micrograms/ml of MAGE-3 or irrelevant HLA-A2-restricted PSMA polypeptide (PSMA-P2). Experiments were performed in triplicate.
- Figures 31 and 32 present the results of a cell migration assay.
- mBMDCs were transduced with 10,000 VP/cell of Ad5.Luciferase or Ad5.iMyD88.CD40 in the presence of Gene Jammer
- SEQ ID NO: 1 nucleic acid sequence encoding human CD40; Genbank accession no. NM_001250; cytoplasmic region indicated in bold).
- SEQ ID NO: 3 nucleotide sequence encoding PSMA
- SEQ ID NO: 4 PSMA amino acid sequence
- SEQ ID NO: 7 nucleotide sequence of Fv'Fvls with Xhol/Sall linkers, (wobbled codons lowercase in Fv')) ctcgagGGcGTcCAaGTcGAaACcATtagtCCcGGcGAtGGcaGaACaTTtCCtAAaaGgGGaCAaACaTGt GTcGTcCAtTAtACaGGcATGtTgGAgGAcGGcAAaAAgGTgGAcagtagtaGaGAtcGcAAtAAaCCtTTc AAaTTcATGtTgGGaAAaCAaGAaGTcATtaGgGGaTGGGAgGAgGGcGTgGCtCAaATGtccGTcGGc CAacGcGCtAAgCTcACcATcagcCCcGAcTAcGCaTAcGGcGCtACcGGaCAtCCcGGaATtATtCCcGGaATtATtCCcGGa
- SEQ ID NO: 14 (IL-6 amino acid sequence)
- IL-6sR is derived from IL-6R sequence. atgctggccgtcggctgcgcgctgctggctgccctgctggccgcgggagcggcgctggccccaaggcgctgccctgcgcaggagg tggcgaccagtctgccaggagacagcgtgactctgacctgcccgggggtagagccggaagacaatgccactgttca ctgggtgctcaggaagccggctgcaggctcccaccccagcagatgggctggcatgggaaggaggctgctgctgaggtcggtgcagctcccaccccagcagatgggctggcatgggaaggaggctgctgctgaggtcggtgcagctc cacgactctggaa
- IL-6sR amino acid sequence is derived from IL-6R sequence.
- Example 11 Clinical Treatment of Patients with Dendritic Cells Transfected with iCD40
- BPX-101 is produced from a single leukapheresis product by elutriation, differentiation of monocytes into DCs, transduction with Ad5f35-inducible human (ih)-CD40, brief treatment with lipopolysaccharide, and antigen loading with a form of PSMA polypeptide (Prostate Specific Membrane Antigen).
- BPX-101 was administered
- Ad35 adenovirus serotype 35
- Ad5f35 virus contains an engineered gene consisting of the Ad5 fiber tail domain and the Ad35 fiber shaft and knob domains.
- the Ad5f35 virus has an efficient tropism for cells of hematopoietic origin, as it utilizes ubiquitously expressed CD46 as a receptor for entry into host cells (Crawford, E.D. et al., [erratum appears in N Engl J Med 1989 Nov 16;321 (20):1420]. New England Journal of Medicine 321 , 419-24 (1989)).
- the Ad5f35-ihCD40 encodes a single transgene comprising multiple components:
- CMV cytomegalovirus
- the N-terminal myristoylated membrane localization domain of c-Src (14 a. a.) is used to localize the iCD40 receptor to intracellular membranes.
- sequence from c-Src was originally designed as a PCR oligonucleotide containing
- FKBP12(V36) The human 12 kDa FK506-binding protein with an F36 to V substitution, the complete mature coding sequence (amino acids 1 -107), provides a binding site for synthetic dimerizer drug AP1903 (Jemal, A. et al., CA Cancer J. Clinic. 58, 71-96 (2008); Scher, H.I. and Kelly, W.K., Journal of Clinical Oncology 1 1 , 1566-72 (1993)). Two tandem copies of the protein are included in the construct so that higher-order oligomers are induced upon cross-linking by AP1903; the activation of CD40 normally requires formation of receptor trimers.
- F36V-FKBP is a codon-wobbled version of F36V-FKBP. It encodes the identical polypeptide sequence as F36V-FKPB but has only 62% homology at the nucleotide level.
- F36V-FKBP was designed to reduce recombination in retroviral vectors (Schellhammer, P.F. et al., J. Urol. 157, 1731-5 (1997)).
- F36V-FKBP was constructed by a PCR assembly procedure. The transgene contains one copy of F36V-FKBP linked directly to one copy of F36V- FKBP.
- CD40 The CD40 receptor cDNA sequence encodes the entire 62 amino acid cytoplasmic domain of the human CD40 gene (188 a. a.). This region includes multiple binding sites for TNF receptor associated factors 2, 3 and 6 (TRAFs 2, 3 and 6), which are adapter proteins that bridge receptors of the TNF family to downstream signaling molecules, such as NF- ⁇ (Small, E.J. & Vogelzang, N.J., Journal of Clinical Oncology 15, 382-8 (1997); Scher, TNF receptor associated factors 2, 3 and 6), which are adapter proteins that bridge receptors of the TNF family to downstream signaling molecules, such as NF- ⁇ (Small, E.J. & Vogelzang, N.J., Journal of Clinical Oncology 15, 382-8 (1997); Scher,
- Ad5f35-based vector in the vector core facility at the Center for Cell and Gene Therapy
- Figure 44 presents a map of a CD40 expression vector
- Figure 33 presents a map of the plasmid Ad5f35ihCD40.
- PSMA protein The extracellular domain of PSMA protein is used to pulse MoDCs. Initially, most of the
- PSMA clone ID 520715 extracellular portion of PSMA was PCR-amplified from PSMA clone ID 520715
- cDNA from human LNCaP cells was PCR-amplified to get 408-bp fragment, containing
- PSMA 3' end of PSMA (-residues 620-750). This fragment was subcloned to get full-length, pAcGP67.XPSMAx18, which was sequenced throughout the open-reading frame.
- the plasmid pAcGP67.XPSMAx18 was cotransfected with
- BD BaculoGoldTM DNA (BD Pharmingen) into Sf9 insect cells (Invitrogen, 1 1496-015).
- the viral stock was harvested and subjected to two rounds of plaque purification.
- plaque was chosen and expanded rendering the P1 viral stock, which was amplified to
- the PSMA expressing Baculovirus stock was used to infect serum-free cultures of expressSf+ (Protein Sciences Corp.) cells in Wave Bioreactors. Once expressed, and subject to post-translational modification, the amino acid sequence no longer includes the signal peptide sequence.
- the supernatant was harvested and clarified, then concentrated by tangential ultrafiltration (UF) and diafiltered into the loading buffer for the column to be used in the following step, filtered through a 0.2 ⁇ membrane and purified by Nickel affinity chromatography.
- the eluted PSMA was collected and buffer exchanged into PBS. This material was nano filtered, sterile filtered and aliquoted into vials at a concentration of approximately 0.4 mg/mL and stored at -80 °C.
- LPS is a TLR-4 ligand and a critical component for the full functional activation of BPGMAX- CD1 .
- LPS from Salmonella typhosa (Sigma-Aldrich) is purified by gel-filtration
- Donor mononuclear cells are obtained by apheresis and dendritic cell precursors are selected by elutriation.
- MoDCs are generated by stimulation of precursor cells in culture with 800 U/mL human GM-CSF and 500 U/mL human IL-4 for in serum-free CellGenix
- Immature DCs are harvested and pulsed with PSMA protein (-10 Mg/mL) and then transduced with Ad5f35-ihCD40 and activated with LPS and AP1903 dimerizer. drug. Thereafter, mature MoDCs are extensively washed, harvested and cryopreserved as the final product, BPX-101 .
- BPX-101 drug substance includes endotoxin quantitation as an evaluation of
- the drug product vaccine, BPX-101 is directly and immediately prepared by
- HSA preservative
- DMSO Cryoserve-Dimethyl Sulfoxide
- PlasmaLyte and submitting the final cell suspension to a controlled freezing procedure PlasmaLyte and submitting the final cell suspension to a controlled freezing procedure.
- the first step of the formulation of the fully activated cell preparation is adjusting the concentration to achieve the target dose (4, 12.5 or 40 x 106 viable cells/mL) based on the total cell counts and viability data (Drug substance release tests) by adding PlasmaLyte-A containing 3% HSA.
- the cell preparation is then cooled down to 1- 6°C
- PBMCs peripheral blood mononuclear cells
- lymphoblastoid cell lines Prior to the leukapheresis procedure, ⁇ 5 ml. of blood is drawn for use for establishment of lymphoblastoid cell lines (LCLs).
- LCLs lymphoblastoid cell lines
- the patient may be instructed to eat calcium-rich foods the morning of the leukapheresis appointment. Following leukapheresis, the product is transported to the cell processing center. BPX-101 is prepared from the leukapheresis product and subsequently released for administration approximately 4 weeks following the leukapheresis procedure.
- BPX-101 is comprised of antigen-presenting cells (APCs), transduced with Ad5f35-ihCD40 and antigen-loaded with 10 micrograms/ml PA001 (PSMA) containing the extracellular domain of human prostate-specific membrane antigen (PSMA), and then activated with 100 nM AP1903 dimerizer drug and 250 ng/ml lipopolysaccharide (LPS).
- APCs antigen-presenting cells
- PSMA micrograms/ml PA001
- PSMA human prostate-specific membrane antigen
- LPS lipopolysaccharide
- PA001-loaded genetically-modified monocyte-derived DCs (MoDCs, the biologically active component of BPX-101 ) are diluted with PlasmaLyte-A/HSA/DMSO to achieve individual target doses of 4, 12.5 or 40 x 10 6 viable MoDCs, divided into 5 or 8 aliquots of 200 ⁇ _ each (concentrations of 0.8, 2.5 and 3.1 x 10 6 cells per 200 ⁇ _ aliquot, respectively).
- BPX-101 is subsequently released for administration approximately 4 weeks following the leukapheresis procedure. Quality control testing of the cell product is performed prior to its release (i.e., viability, sterility, endotoxins, contaminants).
- BPX-101 is comprised of matured, antigen-expressing DCs derived from monocytes collected during an out-patient leukapheresis procedure. By the end of a six day process conducted in a central GMP processing facility, these cells have been transduced with an adenovector encoding iCD40, incubated with recombinant PSMA, and pre-activated with AP1903 and LPS. The resulting vaccine cells are washed and cryopreserved in individual doses (sufficient for about one year of treatment). Each dosing event consists of BPX-101 vaccine administration via multiple intradermal injections, followed 24 hours later by AP1903 administration via intravenous infusion
- BPX-101 is thawed immediately prior to use in a 35-39°C water bath, then stored at 2-8°C, and administered as soon as possible after thawing.
- Treatment begins at 4 x 10 6 cells (Cohort 1 ), then 12.5 x 10 6 cells (Cohort 2), and then 25 x 10 6 cells (Cohort 3) every other week.
- BPX-101 is administered as a 1 ml. total dose for Cohort 1 and 2 and as a 1.6 ml. total dose for Cohort 3, in 200 ⁇ _ increments in the dorsal forearm, upper arm and upper leg, alternating between upper arm and dorsal forearm, and between sides with each vaccine booster for Cohort 1 and 2; and in the dorsal forearm, upper arm and upper leg alternating between sides with each vaccine booster for Cohort 3.
- Each injection is administered at least 2 cm apart.
- At least two injections are given in each location; i.e., 4 injections in one location and 1 injection in another location is not acceptable.
- the vaccine is administered at 3 angles at each injection site to ensure maximum volume acceptance.
- Each injection site may be circled and numbered with an indelible marker. Injections are given at a minimum of 2 cm apart. Injections are given in the same location at one visit, alternating to another location at the next visit. Patients are observed for 30 minutes following the injections for untoward adverse effects.
- AP1903 API is manufactured by Alphora Research Inc. and AP1903 Drug Product for Injection is made by Formatech Inc. It is formulated as a 5 mg/mL solution of AP1903 in a 25% solution of the non-ionic solubilizer Solutol HS 15 (250 mg/mL, BASF). At room temperature, this formulation is a clear, slightly yellow solution. Upon refrigeration, this formulation undergoes a reversible phase transition, resulting in a milky solution. This phase transition is reversed upon re-warming to room temperature. The fill is 2.33 mL in a 3 mL glass vial (-10 mg AP1903 for Injection total per vial).
- AP1903 is removed from the refrigerator the night before the patient is dosed and stored at a temperature of approximately 21 °C overnight, so that the solution is clear prior to dilution.
- the solution is prepared within 30 minutes of the start of the infusion in glass or polyethylene bottles or non-DEHP bags and stored at approximately 21 °C prior to dosing.
- All study medication is maintained at a temperature between 2 degrees C and 8 degrees C, protected from excessive light and heat, and stored in a locked area with restricted access.
- AP1903 for Injection (0.4 mg/kg) via IV infusion over 2 hours, using a non-DEHP, non-ethylene oxide sterilized infusion set.
- the dose of AP1903 is calculated individually for all patients, and is not be recalculated unless body weight fluctuates by ⁇ 10%.
- the calculated dose is diluted in 100 mL in 0.9% normal saline before infusion.
- Week 1 is defined as the week of the first vaccination with BPX-101 .
- BPX-101 is administered in a total of 5 x 200 ⁇ _ ID injections for a total vaccination dose level of 4 or 12.5 x 10 6 cells, or in a total of 8 x 200 ⁇ _ ID injections for a maximum total vaccination dose level of 25 x 10 6 cells.
- the maximum dose was chosen as the highest level of DCs that could be obtained from a standard ⁇ 12L leukapheresis, which can generate up to 5.4 x 10 8 DCs following elutriation of apheresis product and GM-CSF/IL-4-mediated differentiation of monocyte precursors.
- the maximum dose chosen for the study (-0.53 x 10 6 cells/kg) is approximately 240-fold below the highest dose of modified DCs, used in the murine pharmacology models (80 x 10 6 cells/kg).
- AP1903 plasma levels were directly proportional to dose, with mean Cmax values ranging from approximately 10 - 1275 ng/mL over the 0.01 - 1.0 mg/kg dose range.
- blood concentrations demonstrated a rapid distribution phase, with plasma levels reduced to approximately 18, 7, and 1 % of maximal concentration at 0.5, 2 and 10 hours post- dose, respectively.
- AP1903 for Injection was shown to be safe and well tolerated at all dose levels and demonstrated a favorable pharmacokinetic profile, luliucci JD, et al., J Clin Pharmacol. 41 : 870-9, 2001 .
- the fixed dose of AP1903 for Injection used in this study is 0.4 mg/kg intravenously infused over 2 hours.
- the amount of AP1903 needed in vitro for effective signaling of cells is 10 - 100 nM (1600 Da MW). This equates to 16 - 160 ⁇ g/l or -0.016 - 1 .6 mg/kg (1 .6 - 160 Mg/kg).
- Doses up to 1 mg/kg were well-tolerated in the Phase I study of AP 1903 described above. Therefore, 0.4 mg/kg may be a safe and effective dose of AP1903 for this Phase I study in combination with BPX-101.
- Cohort 1 BPX-101 , 4 x 10 6 cells in 1.0 ml_ Cohort 2: BPX-101 , 12.5 x 10 6 cells in 1 .0 ml_ Cohort 3: BPX-101 , 25 x 10 6 cells in 1 .6 ml_
- BPX-101 therapeutic vaccine is administered at doses of 4 or 12.5 x 10 6 cells in 5 ID injections, or 25 x 10 6 cells in 8 I D injections.
- Cytokine/Chemokine Panel kit (Millipore, Inc), which includes analytes for GM-CSF, IFN- ⁇ , IL-10, IL-12 (p70), IL-1 a, IL- ⁇ ⁇ , IL-2, IL-4, IL-5, IL-6, IP-10 (CXCL10), MCP-1 , MIP-1 a, ⁇ -1 ⁇ , RANTES, and TNF-a. Data was analyzed using Bio-Plex software (Bio-Rad Laboratories, Inc). All markers falling at least partially inside the standard range (3.2— 10,000 pg/mL) are included in each chart.
- IFN-gamma Interferon Gamma
- IFN-gamma-producing T cells Serial levels of IFN-gamma-producing T cells is determined by ELISpot assay. Descriptive analysis is used to summarize IFN-gamma-producing T cell data. These analyses are based on the following measures: change from baseline at each assessment time, average area under the curve minus baseline (AAUCMB) at each assessment time, AAUCMB for the first 6 vaccinations, AAUCMB for all assessments, the maximum value following the first 6 vaccinations and among all assessments, and the time to maximum value.
- AAUCMB average area under the curve minus baseline
- IFN-gamma-producing T cells Statistical modeling is performed to assess the dependence between IFN-gamma-producing T cells and objective response rate.
- a Cox proportional hazard regression model is used to assess this dependence.
- An "event" is the initial achievement of a confirmed CR or PR, and time to this event is measured from the first dose of study drug.
- IFN-gamma-producing cell data used in this analysis is limited to those values collected after initiation of study treatment and no later than the last valid assessment of objective response rate; in the event of a response, only cell data up to and inclusive of the date of the event is used.
- the model is parameterized to include terms for dose, baseline IFN-gamma cell level, and a time-dependent covariate for IFN-gamma-producing cell level.
- a CTL response may be determined by conventional methods.
- autologous LCLs pulsed with PSMA polypeptide is used as APCs in cytotoxicity assays, as well as in the assays requiring T cell re-stimulation in vitro.
- LCLs is established for each patient by exogenous virus transformation of peripheral B cells by using Epstein Barr Virus-containing supernatants produced by the B95-8 cell line.
- LCLs are maintained in RPMI 1640, 10% FBS. LCL generation requires 5 ml of blood obtained at the time of enrollment into the clinical trial.
- CTL response as calculated by percent specific lysis, is determined at each study time point and compared to baseline levels. Analysis of these data is based on descriptive statistics and is summarized at each assessment time. Depending on the extent of non-missing, exploratory analyses to assess the dependency of objective response rate on CTL response is made in a manner similar to that proposed for the IFN-gamma-producing cell data.
- HLA-A2+ patients are included in this optional assay.
- LNCaP cells HLA- A2+/PSMA+
- SK-Mel-37 cells A2+/PSMA-
- PSMA antigen recognition is assessed using target cells labeled with 51 Cr (Amersham) for 1 hour at 37°C and washed three times.
- Labeled target cells (5000 cells in 50 ⁇ _) is added to effector CD8+ cells (100 ⁇ _) at the 5:1 , 10:1 , 25:1 , and 50:1 effectontarget cell ratios.
- Chromium release is measured in supernatants harvested after 4 hours incubation at 37°C. The percentage of specific lysis is calculated as: 100x [(experimental - spontaneous release)/(maximum - spontaneous release)].
- T cells were expanded from a single injection site biopsy (6 mm), collected 1 week after the third vaccination. After 4 weeks of culture in IL-2-containing media, flow cytometry revealed -30 to 60% CD4+ T cells and 2-10% CD8+ T cells.
- Antigen-specific responses were analyzed at various ratios of T cells and autologous, EBV-transformed lymphoblastoid cell lines (LCLs) as antigen presenting cells in the presence of (a) PSMA or (b) ovalbumin (control) protein (10 mg/ml) or (c) Ad5f35-empty adenovirus (500 viral particles (VP)/LCL).
- LCLs lymphoblastoid cell lines
- BPX-101 from each donor is co-cultured with autologous T cells (at DC: T cell ratio 1 :10) for 7 days and (re-stimulated at day 8 with BPX-101 ). Supernatants are harvested and analyzed by BD
- Th1/Th2 cytokines such as (IL-2, IFN- gamma, TNF-alpha, IL-4, IL-5, IL-6, and IL-10) on Luminex 100 IS (Bio-Rad Laboratories).
- Peripheral blood leukocytes are incubated for 24 hours with BPX-101 and stained with a panel of antibodies specific for T cell type (CD4 [helper] or CD8 [cytotoxic]) and activation state (CD25 [early activation and TREG subset], CD45R0 [activation and memory subset], and CD69 [early activation]) prior to flow cytometry analysis.
- T cell type CD4 [helper] or CD8 [cytotoxic]
- activation state CD25 [early activation and TREG subset], CD45R0 [activation and memory subset], and CD69 [early activation]
- Measures to be evaluated include actual and change from baseline in the following T cell types: CD4 (helper), CD8 (cytotoxic) and activation state (CD25 [early activation and TREG subset], CD45R0 [activation and memory subset], and CD69 [early activation]).
- Natural Killer (NK) cell activity in the peripheral blood of patients is determined by a simple NK cell assay.
- Patient leukocytes are cultured at different dilutions for 2-4 hours with universal NK target, K562 cells.
- the extent of K562 killing is then determined by the loss of propidium iodide exclusion using a flow cytometer.
- injection-site erythema (if any) will also be determined as a direct measurement of the diameter of inflamed tissue.
- a punch biopsy is scheduled to occur 2-3 days after the 4th vaccination, to be taken from whichever site shows the most inflammation. If no or little ( ⁇ 1 cm) inflammation is observed a biopsy is taken from any one of the injection sites.
- Infiltration of lymphocytes is determined by histology and immunohistochemistry. The obtained biopsy is split into two approximately equal sections. One part is cryopreserved for immunohistochemistry using anti-CD8, anti-granzyme B, and other possible markers. The second part is cut into small pieces and placed in culture with RPMI 1640, 10% FBS. Leukocytes emigrating from these tissue pieces is cultured with IL-2.
- T cells are tested for production of Th1/Th2 cytokines upon stimulation with autologous APCs.
- Regular weekly blood draws from each patient were evaluated in a broad panel of serum cytokines/chemokines.
- 4 of 6 subjects (including #1003 (Panel A), #1004 (Panel C), #1005 and #1006) demonstrated systemic up-regulation of IFN- ⁇ , GM-CSF, RANTES, ⁇ -1 ⁇ , ⁇ -1 ⁇ and MCP-1 one week after each vaccination.
- TNF-a and IP-10 are detect-able in all subjects but show minimal dose-related change in any subject.
- Dose-related cytokine changes were quantified by calculating the unweighted mean change in cytokine level after each dose, for all cytokines and all six doses. This analysis confirms that with a mean post-dose change of -2% and -6%, respectively, neither #1001 nor #1002 exhibited a consistent pattern of serum changes. Also, 3 of 3 subjects in the mid dose cohort exhibited significant increases in serum cytokines 1 week after each dose (mean change range +42% to +72%). In addition, subject 1003 exhibited dramatic serum cytokine perturbation (mean change +283%).
- IFN- ⁇ and GM-CSF levels followed a similar pattern; GM-CSF spiked from undetectable baseline levels to 22.0, 16.2, 9.9, and 1 1.7 pg/ml one week after vaccination #s 1 , 2, 3, and 5, respectively, and returned to undetectable levels the following week.
- the dose- related changes in a panel of secreted factors are shown in Figures 45-50. This panel includes GM-CSF, MIP-1 alpha, MIP-1 beta, MCP-1 , IFN-gamma, RANTES, EGF and HGF.
- Pharmacokinetic Endpoints Mean plasma concentrations of AP1903 are determined at each time point. Because plasma concentrations of AP1903 are determined at a limited number of time points during the study, a determination of pharmacokinetic parameters will not be possible. Biomarker Endpoints
- PSA response proportion of patients achieving a ⁇ 30% and a ⁇ 50% reduction
- PSA dynamics change in velocity and doubling time
- PSA dynamics are summarized using descriptive statistics.
- post-treatment PSA doubling time is compared to pre- treatment PSA doubling time; the proportion of patients experiencing a ⁇ 25% increase in PSA doubling time (change in PSA slope/PSA velocity) is tabulated.
- the first PSA increase that is a ⁇ 25% increase and ⁇ 2 ng/mL absolute increase in PSA level from the nadir value is documented on at least one additional determination at least 3 weeks apart. Once confirmed, the date of the first PSA fitting this progression criteria becomes the date of PSA progression.
- the last PSA level measured before initiation of study treatment is defined as the initial PSA.
- the final PSA value is the last level measured following the initiation of study treatment and before the time point of interest.
- PSA doubling time is assessed prior to therapy as well as at all times after the initiation of therapy. An additional analysis is performed using the time at which patients are considered to have PSA progression.
- PSA Velocity and Slope The pre-treatment annual PSA velocity (the rate of change in PSA per year) and slope are calculated by simple linear regression from 3 or more PSA measurements before therapy on trial. PSA measurements with complete dates aroused to determine the pre- treatment PSA velocity and slope. Post-treatment PSA velocity during the first 3 months of the study is computed using linear regressions (for patients with two or more PSA measurements in addition to the baseline measurement) and by the ratio of change in the logarithm of PSA (for patients with only one PSA value in addition to the baseline measurement). The slope of the resulting line of best fit is used to determine the PSA velocity and is used to evaluate PSA velocity and slope is assessed prior to therapy as well as at 3 months after the initiation of therapy..
- CTCs Circulating Tumor Cells
- Intact (and apoptotic) CTCs are concentrated from fresh peripheral blood of PCa patients and analyzed for the presence of epithelial cells using the CellSearch technique for immunomagnetic capture of EpCAM+ cells followed by immunostaining for nucleated CD45 negative and cytokeratin (8,18, 19) positive cells.
- CellSearch technique for immunomagnetic capture of EpCAM+ cells followed by immunostaining for nucleated CD45 negative and cytokeratin (8,18, 19) positive cells.
- Typically, fewer than 5 CTCs/10 ml. blood sample are found in healthy volunteers and > 5 are found in PCa patients.
- the CellSearch method has been used successfully in diagnosing breast cancer occurrence and progression. (Scher HI, et al., J Clin Oncol. 2008 Mar 1 ; 26(7):1 148-59). It is FDA approved for breast cancer and more recently for prostate cancer, and is available commercially through Quest Diagnostics.
- the assay for PCa is basically identical to breast cancer as they are both EpC
- TTR and duration of response are calculated only for those patients who have a CR or PR.
- TTR reflects the difference (in days) between the first date of study drug administration and the first date at which objective response criteria are met.
- Duration of response reflects the difference (in days) between the first date at which response criteria are met and the first date of meeting objective criteria for disease progression or death, whichever event is earlier. Patients not meeting progression criteria may have their event times censored at the last date at which a valid assessment confirmed lack of disease progression.
- PFS is estimated for both the FAS and PPS patient populations.
- OS is calculated as the difference between the first date that study drug was received and the date of death. Patients who have not died as of the last follow-up may have their times censored on the last known date of contact. OS is summarized for the FAS population; patients lacking survival data beyond the start of treatment will have their observations censored on Day 1 .
- Choi's GIST criteria (Appendix D) is used as a second criteria for response.
- the proportion of patients experiencing an objective response (CR or PR) is summarized.
- GM-CSF Granulocyte-macrophage colony stimulating factor HBsAg Hepatitis B surface antigen
- Results Of 6 subjects enrolled to date, 3 of 3 in the low dose cohort and 2 of 3 in the mid dose cohort completed at least 12 weeks of therapy (median 26, range 12-36), and 4 remain on study with stable disease with no dose limiting toxicity observed.
- One patient in the mid dose cohort developed impending spinal cord compression due to disease progression and was taken off study at Week 7, after 4 doses were administered, and a second patient was deemed to have disease progression at the end of the acute phase of treatment and was taken off study.
- the patients were assessed for radiologic, biochemical, immunologic, and symptomatic changes, as summarized in Figure 34, according to the methods of the clinical protocol.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Chemical & Material Sciences (AREA)
- Epidemiology (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Cell Biology (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Urology & Nephrology (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2011239569A AU2011239569B2 (en) | 2010-04-16 | 2011-04-14 | Method for treating solid tumors |
| EP11769619.5A EP2558109A4 (en) | 2010-04-16 | 2011-04-14 | METHOD FOR TREATING HARD TUMORS |
| CA2795947A CA2795947A1 (en) | 2010-04-16 | 2011-04-14 | Method for treating solid tumors |
| JP2013505156A JP5975983B2 (ja) | 2010-04-16 | 2011-04-14 | 固形腫瘍を処置するための方法 |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US32512710P | 2010-04-16 | 2010-04-16 | |
| US61/325,127 | 2010-04-16 | ||
| US35176010P | 2010-06-04 | 2010-06-04 | |
| US61/351,760 | 2010-06-04 | ||
| US201161442582P | 2011-02-14 | 2011-02-14 | |
| US61/442,582 | 2011-02-14 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2011130566A2 true WO2011130566A2 (en) | 2011-10-20 |
| WO2011130566A3 WO2011130566A3 (en) | 2011-12-29 |
Family
ID=44799326
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2011/032572 Ceased WO2011130566A2 (en) | 2010-04-16 | 2011-04-14 | Method for treating solid tumors |
Country Status (6)
| Country | Link |
|---|---|
| US (2) | US20110287038A1 (https=) |
| EP (1) | EP2558109A4 (https=) |
| JP (2) | JP5975983B2 (https=) |
| AU (1) | AU2011239569B2 (https=) |
| CA (1) | CA2795947A1 (https=) |
| WO (1) | WO2011130566A2 (https=) |
Cited By (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013082249A3 (en) * | 2011-11-29 | 2013-10-10 | Genentech, Inc. | Compositions and methods for prostate cancer analysis |
| US8691210B2 (en) | 2006-10-19 | 2014-04-08 | David M Spencer | Methods and compositions for generating an immune response by inducing CD40 and pattern recognition receptors and adaptors thereof |
| US8771671B2 (en) | 2003-02-18 | 2014-07-08 | Baylor College Of Medicine | Induced activation in dendritic cells |
| US8927592B2 (en) | 2009-10-29 | 2015-01-06 | Aventis Pharma Sa | Antitumoral use of cabazitaxel |
| WO2014151960A3 (en) * | 2013-03-14 | 2015-02-05 | Bellicum Pharmaceuticals, Inc. | Methods for controlling t cell proliferation |
| US9089520B2 (en) | 2010-05-21 | 2015-07-28 | Baylor College Of Medicine | Methods for inducing selective apoptosis |
| WO2016036746A1 (en) | 2014-09-02 | 2016-03-10 | Bellicum Pharmaceuticals, Inc. | Costimulation of chimeric antigen receptors by myd88 and cd40 polypeptides |
| US9315559B2 (en) | 2008-09-22 | 2016-04-19 | Baylor College Of Medicine | Methods and compositions for generating an immune response by inducing CD40 and pattern recognition receptor adapters |
| JP2016516057A (ja) * | 2013-03-15 | 2016-06-02 | ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア | 低酸素誘導因子−1アルファを有する組成物および当該組成物を用いる方法 |
| JP2016516723A (ja) * | 2013-03-15 | 2016-06-09 | ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア | ガンワクチン及びそれを用いた治療方法 |
| US9434935B2 (en) | 2013-03-10 | 2016-09-06 | Bellicum Pharmaceuticals, Inc. | Modified caspase polypeptides and uses thereof |
| EP3104866A4 (en) * | 2014-02-14 | 2017-08-02 | Bellicum Pharmaceuticals, Inc. | Methods for activating t cells using an inducible chimeric polypeptide |
| US9913882B2 (en) | 2013-06-05 | 2018-03-13 | Bellicum Pharmaceuticals, Inc. | Methods for inducing partial apoptosis using caspase polypeptides |
| WO2018208849A1 (en) | 2017-05-09 | 2018-11-15 | Bellicum Pharmaceuticals, Inc. | Methods to augment or alter signal transduction |
| CN105452900B (zh) * | 2013-07-03 | 2018-12-14 | 三菱重工机械系统株式会社 | 车载器以及欺骗检测方法 |
| US10189880B2 (en) | 2014-11-03 | 2019-01-29 | Leiden University Medical Center | T cell receptors directed against Bob1 and uses thereof |
| WO2019113509A2 (en) | 2017-12-08 | 2019-06-13 | Bellicum Pharmaceuticals, Inc. | Methods for enhancing and maintaining car-t cell efficacy |
| WO2019126344A1 (en) | 2017-12-20 | 2019-06-27 | Bellicum Pharmaceuticals, Inc. | Multimeric piperidine derivatives |
| EP3608408A1 (en) * | 2014-12-15 | 2020-02-12 | Bellicum Pharmaceuticals, Inc. | Methods for controlled activation or elimination of therapeutic cells |
| US20220000921A1 (en) * | 2018-11-20 | 2022-01-06 | Innovative Cellular Therapeutics Holdings, Ltd. | Modified Cell Expressing Therapeutic Agent and Uses thereof |
| US11312939B2 (en) | 2020-06-04 | 2022-04-26 | Carisma Therapeutics Inc. | Constructs for chimeric antigen receptors |
| US12570711B2 (en) | 2017-09-27 | 2026-03-10 | Angeles Therapeutics, Inc. | Platforms for co-stimulation, novel car designs and other enhancements for adoptive cellular therapy |
Families Citing this family (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2013204922B2 (en) | 2012-12-20 | 2015-05-14 | Celgene Corporation | Chimeric antigen receptors |
| JP6493692B2 (ja) | 2013-03-15 | 2019-04-10 | セルジーン コーポレイション | 修飾されたtリンパ球 |
| EP2940136A1 (en) * | 2014-04-30 | 2015-11-04 | QIAGEN GmbH | Method for isolating poly(A) nucleic acids |
| US10975137B2 (en) * | 2014-11-06 | 2021-04-13 | University Of Maryland, Baltimore | CD8a and t cell receptor variants and methods of using same in modulating immune cell responses |
| US20170151281A1 (en) | 2015-02-19 | 2017-06-01 | Batu Biologics, Inc. | Chimeric antigen receptor dendritic cell (car-dc) for treatment of cancer |
| WO2017015553A1 (en) * | 2015-07-22 | 2017-01-26 | University Of Washington | Compositions and methods for producing pro-inflammatory macrophages |
| IL315940A (en) | 2015-07-28 | 2024-11-01 | Univ Pennsylvania | Altered monocytes/macrophages expressing chimeric antigen receptors and their uses |
| US11266726B2 (en) * | 2015-10-30 | 2022-03-08 | The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Compositions and methods for the treatment of HER2-expressing solid tumors |
| JP6904667B2 (ja) | 2016-06-14 | 2021-07-21 | 日本光電工業株式会社 | バイトブロック及びガスセンサキット |
| WO2018077385A1 (en) * | 2016-10-25 | 2018-05-03 | Biontech Rna Pharmaceuticals Gmbh | Dose determination for immunotherapeutic agents |
| EP3675902A4 (en) * | 2017-08-28 | 2021-06-23 | Board of Trustees of Michigan State University | Compositions and methods of treating cancer and infections using bacteriophage and its mutants |
| CN114981409A (zh) | 2019-09-03 | 2022-08-30 | 美洛德生物医药公司 | 用于基因组整合的方法和组合物 |
| WO2021119538A1 (en) * | 2019-12-11 | 2021-06-17 | Myeloid Therapeutics, Inc. | Therapeutic cell compositions and methods for manufacture and uses thereof |
| US10980836B1 (en) | 2019-12-11 | 2021-04-20 | Myeloid Therapeutics, Inc. | Therapeutic cell compositions and methods of manufacturing and use thereof |
| WO2021142305A2 (en) * | 2020-01-10 | 2021-07-15 | Coimmune, Inc. | Methods of treating tumors |
| JP7735291B2 (ja) | 2020-02-21 | 2025-09-08 | エーアールエス ファーマシューティカルズ、インコーポレイテッド | ネクチン-4抗体コンジュゲートおよびその使用 |
| JP2023532304A (ja) | 2020-07-01 | 2023-07-27 | エーアールエス ファーマシューティカルズ オペレーションズ,インク. | 抗asgr1抗体コンジュゲートおよびその使用 |
| EP4240367A4 (en) | 2020-11-04 | 2024-10-16 | Myeloid Therapeutics, Inc. | MODIFIED CHIMERIC FUSION PROTEIN COMPOSITIONS AND METHODS OF USE THEREOF |
| WO2022197949A2 (en) | 2021-03-17 | 2022-09-22 | Myeloid Therapeutics, Inc. | Engineered chimeric fusion protein compositions and methods of use thereof |
| BR112023023642A2 (pt) | 2021-05-11 | 2024-01-30 | Myeloid Therapeutics Inc | Métodos e composições para integração genômica |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050215472A1 (en) * | 2001-10-23 | 2005-09-29 | Psma Development Company, Llc | PSMA formulations and uses thereof |
| WO2004073641A2 (en) * | 2003-02-18 | 2004-09-02 | Kevin Slawin | Induced activation in dendritic cells |
| DE602004025726D1 (de) * | 2003-11-14 | 2010-04-08 | Genvec Inc | Pharmazeutische verbindung zur behandlung von lokal fortgeschrittenem primär inoperablen pankreaskarzinom (lapc). |
| CA3058450A1 (en) * | 2006-10-19 | 2008-04-24 | Baylor College Of Medicine | Generating an immune response by inducing cd40 and pattern recognition receptors |
| CN101888856B (zh) * | 2007-11-07 | 2014-08-27 | 塞尔德克斯医疗公司 | 结合人树突和上皮细胞205(dec-205)的抗体 |
| WO2009111507A1 (en) * | 2008-03-03 | 2009-09-11 | Dyax Corp. | Metalloproteinase 12 binding proteins |
| WO2009151503A2 (en) * | 2008-04-10 | 2009-12-17 | University Of Florida Research Foundation, Inc. | Compositions and methods for the treatment of a neoplasia |
| CA2738031C (en) * | 2008-09-22 | 2022-11-29 | Baylor College Of Medicine | Methods and compositions for generating an immune response by inducing cd40 and pattern recognition receptor adapters |
-
2011
- 2011-04-14 US US13/087,329 patent/US20110287038A1/en not_active Abandoned
- 2011-04-14 CA CA2795947A patent/CA2795947A1/en not_active Abandoned
- 2011-04-14 AU AU2011239569A patent/AU2011239569B2/en not_active Ceased
- 2011-04-14 JP JP2013505156A patent/JP5975983B2/ja not_active Expired - Fee Related
- 2011-04-14 WO PCT/US2011/032572 patent/WO2011130566A2/en not_active Ceased
- 2011-04-14 EP EP11769619.5A patent/EP2558109A4/en not_active Withdrawn
-
2013
- 2013-03-06 US US13/786,652 patent/US20140023647A1/en not_active Abandoned
-
2016
- 2016-03-24 JP JP2016060361A patent/JP2016117770A/ja not_active Withdrawn
Non-Patent Citations (1)
| Title |
|---|
| See references of EP2558109A4 * |
Cited By (48)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8771671B2 (en) | 2003-02-18 | 2014-07-08 | Baylor College Of Medicine | Induced activation in dendritic cells |
| US10420824B2 (en) | 2003-02-18 | 2019-09-24 | Baylor College Of Medicine | Induced activation in dendritic cells |
| US9572835B2 (en) | 2003-02-18 | 2017-02-21 | Baylor College Of Medicine | Induced activation in dendritic cells |
| US8999949B2 (en) | 2003-02-18 | 2015-04-07 | Baylor College Of Medicine | Induced activation in dendritic cells |
| US8691210B2 (en) | 2006-10-19 | 2014-04-08 | David M Spencer | Methods and compositions for generating an immune response by inducing CD40 and pattern recognition receptors and adaptors thereof |
| US9315559B2 (en) | 2008-09-22 | 2016-04-19 | Baylor College Of Medicine | Methods and compositions for generating an immune response by inducing CD40 and pattern recognition receptor adapters |
| US9976122B2 (en) | 2008-09-22 | 2018-05-22 | Baylor College Of Medicine | Methods and compositions for generating an immune response by inducing CD40 and pattern recognition receptor adapters |
| US9428569B2 (en) | 2008-09-22 | 2016-08-30 | Baylor College Of Medicine | Methods and compositions for generating an immune response by inducing CD40 and pattern recognition receptor adapters |
| US12453712B2 (en) | 2009-10-29 | 2025-10-28 | Sanofi Mature Ip | Antitumoral use of cabazitaxel |
| US8927592B2 (en) | 2009-10-29 | 2015-01-06 | Aventis Pharma Sa | Antitumoral use of cabazitaxel |
| US10583110B2 (en) | 2009-10-29 | 2020-03-10 | Sanofi Mature Ip | Antitumoral use of cabazitaxel |
| US10716777B2 (en) | 2009-10-29 | 2020-07-21 | Sanofi Mature Ip | Antitumoral use of cabazitaxel |
| US11077176B2 (en) | 2010-05-21 | 2021-08-03 | Baylor College Of Medicine | Methods for inducing selective apoptosis |
| US9393292B2 (en) | 2010-05-21 | 2016-07-19 | Baylor College Of Medicine | Methods for inducing selective apoptosis |
| US9089520B2 (en) | 2010-05-21 | 2015-07-28 | Baylor College Of Medicine | Methods for inducing selective apoptosis |
| WO2013082249A3 (en) * | 2011-11-29 | 2013-10-10 | Genentech, Inc. | Compositions and methods for prostate cancer analysis |
| KR101951514B1 (ko) | 2011-11-29 | 2019-02-22 | 제넨테크, 인크. | 전립선암 분석을 위한 조성물 및 방법 |
| US9632091B2 (en) | 2011-11-29 | 2017-04-25 | Genentech, Inc. | Compositions and methods for prostate cancer analysis |
| KR20140100544A (ko) * | 2011-11-29 | 2014-08-14 | 제넨테크, 인크. | 전립선암 분석을 위한 조성물 및 방법 |
| US9932572B2 (en) | 2013-03-10 | 2018-04-03 | Bellicum Pharmaceuticals, Inc. | Modified Caspase polypeptides and uses thereof |
| US9434935B2 (en) | 2013-03-10 | 2016-09-06 | Bellicum Pharmaceuticals, Inc. | Modified caspase polypeptides and uses thereof |
| WO2014151960A3 (en) * | 2013-03-14 | 2015-02-05 | Bellicum Pharmaceuticals, Inc. | Methods for controlling t cell proliferation |
| US9944690B2 (en) | 2013-03-14 | 2018-04-17 | Bellicum Pharmaceuticals, Inc. | Methods for controlling T cell proliferation |
| JP2016519068A (ja) * | 2013-03-14 | 2016-06-30 | ベリカム ファーマシューティカルズ, インコーポレイテッド | T細胞増殖をコントロールするための方法 |
| JP2019031511A (ja) * | 2013-03-15 | 2019-02-28 | ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア | 低酸素誘導因子−1アルファを有する組成物および当該組成物を用いる方法 |
| US10155795B2 (en) | 2013-03-15 | 2018-12-18 | The Trustees Of The University Of Pennsylvania | Compositions comprising hypoxia inducible factor-1 alpha and methods of using the same |
| JP2021100944A (ja) * | 2013-03-15 | 2021-07-08 | ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア | ガンワクチン及びそれを用いた治療方法 |
| JP2016516723A (ja) * | 2013-03-15 | 2016-06-09 | ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア | ガンワクチン及びそれを用いた治療方法 |
| JP2016516057A (ja) * | 2013-03-15 | 2016-06-02 | ザ トラスティーズ オブ ザ ユニバーシティ オブ ペンシルバニア | 低酸素誘導因子−1アルファを有する組成物および当該組成物を用いる方法 |
| US11419925B2 (en) | 2013-03-15 | 2022-08-23 | The Trustees Of The University Of Pennsylvania | Cancer vaccines and methods of treatment using the same |
| US10525110B2 (en) | 2013-06-05 | 2020-01-07 | Bellicum Pharmaceuticals, Inc. | Methods for inducing partial apoptosis using caspase polypeptides |
| US9913882B2 (en) | 2013-06-05 | 2018-03-13 | Bellicum Pharmaceuticals, Inc. | Methods for inducing partial apoptosis using caspase polypeptides |
| CN105452900B (zh) * | 2013-07-03 | 2018-12-14 | 三菱重工机械系统株式会社 | 车载器以及欺骗检测方法 |
| US10934346B2 (en) | 2014-02-14 | 2021-03-02 | Bellicum Pharmaceuticals, Inc. | Modified T cell comprising a polynucleotide encoding an inducible stimulating molecule comprising MyD88, CD40 and FKBP12 |
| EP3104866A4 (en) * | 2014-02-14 | 2017-08-02 | Bellicum Pharmaceuticals, Inc. | Methods for activating t cells using an inducible chimeric polypeptide |
| WO2016036746A1 (en) | 2014-09-02 | 2016-03-10 | Bellicum Pharmaceuticals, Inc. | Costimulation of chimeric antigen receptors by myd88 and cd40 polypeptides |
| US10888608B2 (en) | 2014-09-02 | 2021-01-12 | Bellicum Pharmaceuticals, Inc. | Costimulation of chimeric antigen receptors by MyD88 and CD40 polypeptides |
| US10918705B2 (en) | 2014-09-02 | 2021-02-16 | Bellicum Pharmaceutics, Inc. | Costimulation of chimeric antigen receptors by MYD88 and CD40 polypeptides |
| US10189880B2 (en) | 2014-11-03 | 2019-01-29 | Leiden University Medical Center | T cell receptors directed against Bob1 and uses thereof |
| EP3608408A1 (en) * | 2014-12-15 | 2020-02-12 | Bellicum Pharmaceuticals, Inc. | Methods for controlled activation or elimination of therapeutic cells |
| WO2018208849A1 (en) | 2017-05-09 | 2018-11-15 | Bellicum Pharmaceuticals, Inc. | Methods to augment or alter signal transduction |
| US12570711B2 (en) | 2017-09-27 | 2026-03-10 | Angeles Therapeutics, Inc. | Platforms for co-stimulation, novel car designs and other enhancements for adoptive cellular therapy |
| WO2019113509A2 (en) | 2017-12-08 | 2019-06-13 | Bellicum Pharmaceuticals, Inc. | Methods for enhancing and maintaining car-t cell efficacy |
| WO2019126344A1 (en) | 2017-12-20 | 2019-06-27 | Bellicum Pharmaceuticals, Inc. | Multimeric piperidine derivatives |
| US20220000921A1 (en) * | 2018-11-20 | 2022-01-06 | Innovative Cellular Therapeutics Holdings, Ltd. | Modified Cell Expressing Therapeutic Agent and Uses thereof |
| US11312939B2 (en) | 2020-06-04 | 2022-04-26 | Carisma Therapeutics Inc. | Constructs for chimeric antigen receptors |
| US11739297B2 (en) | 2020-06-04 | 2023-08-29 | Carisma Therapeutics Inc. | Method of increasing tumor killing activity of macrophages or monocytes comprising chimeric antigen receptor |
| US12600796B2 (en) | 2020-06-04 | 2026-04-14 | Carisma Therapeutics Inc. | Constructs for chimeric antigen receptors |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2558109A4 (en) | 2014-09-24 |
| AU2011239569A1 (en) | 2012-10-25 |
| JP2016117770A (ja) | 2016-06-30 |
| WO2011130566A3 (en) | 2011-12-29 |
| JP5975983B2 (ja) | 2016-08-23 |
| EP2558109A2 (en) | 2013-02-20 |
| US20110287038A1 (en) | 2011-11-24 |
| CA2795947A1 (en) | 2011-10-20 |
| AU2011239569B2 (en) | 2014-07-24 |
| US20140023647A1 (en) | 2014-01-23 |
| JP2013525305A (ja) | 2013-06-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2011239569B2 (en) | Method for treating solid tumors | |
| US20240124552A1 (en) | Methods and compositions for generating an immune response by inducing cd40 and pattern recognition receptor adapters | |
| JP2024056940A (ja) | 誘導可能なキメラポリペプチドを使用して細胞を活性化するための方法 | |
| EP3189148B1 (en) | Costimulation of chimeric antigen receptors by myd88 and cd40 polypeptides | |
| EP3268014B1 (en) | T-cell receptors directed against the preferentially expressed antigen of melanoma and uses thereof | |
| EP2968502B1 (en) | Methods for controlling t cell proliferation | |
| WO2018208849A1 (en) | Methods to augment or alter signal transduction | |
| AU2014253529A1 (en) | Method for treating solid tumors | |
| HK1245637A1 (en) | Methods and compositions for generating an immune response by inducing cd40 and pattern recognition receptor adapters | |
| HK1249424B (en) | T-cell receptors directed against the preferentially expressed antigen of melanoma and uses thereof | |
| HK1159160B (en) | Methods and compositions for generating an immune response by inducing cd40 and pattern recognition receptor adapters | |
| HK1159160A (en) | Methods and compositions for generating an immune response by inducing cd40 and pattern recognition receptor adapters |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 11769619 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2795947 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2013505156 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2011239569 Country of ref document: AU Date of ref document: 20110414 Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2011769619 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011769619 Country of ref document: EP |