WO2011105732A2

WO2011105732A2 - Method and kit for detecting egfr mutation by using pna-based real-time pcr clamping

Info

Publication number: WO2011105732A2
Application number: PCT/KR2011/001157
Authority: WO
Inventors: 박희경; 최재진; 조민혜
Original assignee: 주식회사 파나진
Priority date: 2010-02-26
Filing date: 2011-02-22
Publication date: 2011-09-01
Also published as: WO2011105732A3; KR101819938B1; KR20110098440A

Abstract

The present invention relates to a method for selectively detecting only a mutant by inhibiting the amplification of wild type by using a peptide nucleic acid (PNA) probe which specifically binds to wild type of in frame deletion or substitution portions at exon 18, 19, 20 or 21 where an EGFR mutation gene exists, and a kit for using the method. It is possible to rapidly and accurately examine tumors of prostate cancer, breast cancer, colon cancer, pancreatic cancer, ovarian cancer, spleen cancer, testicular cancer, thymus cancer, lung cancer and the like in the early stages by using the present invention, thereby enabling effective treatment due to cancer diagnosis at an early stage.

Description

Specification

Title of the Invention: Real-time P C R clamping based on P N A

E G F R mutation detection methods and kits

[1] The present invention is a real-time PCR based on PNA (Peptide Nucleic Acid, hereinafter 'PNA')

A method and kit for detecting EGFR gene mutations using clamping, and more particularly, in frame deletion at mutant axons 18, 19, 20 or 21 in the kinase domains of EGFR listed in Table 1 below. Or PNA probes that specifically bind to the wild type for detection of substitution

It relates to a method for selectively detecting only a small amount of a mutant form by inhibition and a kit for use in the method.

Background

[2] Lung cancer, one of the leading causes of cancer-related death, is epithelial cell carcinoma.

A type of cancer is a disease characterized by abnormally accelerated growth of epithelial cells. Prostate cancer, breast cancer, colon cancer, pancreatic cancer, ovarian cancer, spleen cancer, testicular cancer, thymic cancer, etc. are included in the epithelial cell cancer. Accelerated growth of epithelial cells may initially lead to tumorigenesis and metastasis to other organ sites.

[3] Five years of lung cancer despite many efforts to diagnose and treat lung cancer

Survival rate improved by only 3% from 12% in the 70s to the recent 15%. Lung cancer is the second most common form of prostate cancer in men and second only in breast cancer in women. Cancer that begins in the lungs is divided into two major types, depending on how the cancer cells look on the microscope

It is divided into non-small cell lung cancer and small cell lung cancer. About 75% of all lung cancers are classified as non-small cell lung cancer (NSCLC) (eg adenocarcinoma), and the remaining 25% are small cell lung cancer. Most lung carcinomas have a poor prognosis because they are difficult to detect early and are usually diagnosed in advanced conditions. In patients with lung cancer, chemotherapy offers benefits in terms of survival, but with significant side effects, the need for therapeutic agents that specifically target significant genetic damage involved in tumor growth is emphasized [Schiller JH et al., N Engl. J. Med., 346: 92-98, 2002.

[4] Epidermal growth factor receptors play an important role in the cancer process

Receptor; "EGFR") is bound to the membrane with a mass of 170 kilodaltons (kDa)

It is a protein and is expressed on the surface of epithelial cells. EGFR is a member of the family of receptor family members of the protein tyrosine kinase, a class of cell cycle regulators (WJ GuUick et al., 1986, Cancer Res., 46: 285-292). EGFR is activated when its ligand (EGF or TGF-α) binds to the extracellular domain, and as a result, the intracellular tyrosine kinase domain of the receptor causes autophosphorylation [S. Cohen et al., 1980, J. Biol. Chem., 255: 4834-4842; AB Schreiber et al., 1983, J. Biol. Chem.,

258: 846-853.

[5] Epidermal growth factor receptor (EGFR) is a member of the HER kinase axis and is the target of choice for the development of several different cancer therapies. EGFR tyrosine kinase inhibitors (EGFR-TKIs) are one of these therapies, and activation of the EGFR pathway requires the reversible phosphorylation of tyrosine residues. As a result, EGFR-TKIs block cell surface receptors that are responsible for triggering or maintaining the signaling pathways of cells that cause tumor cells to grow and differentiate. These tyrosine kinase inhibitors are known to interfere with the EGFR kinase domain, named HER-1.

Quinazolines and pyridopyrimidines, and

Three types of compounds are known, pyrrolopyrimidines. As two of the more advanced compounds in clinical development

Gefitinib (Compound ZD1839 developed by AstraZeneca UK Ltd.);

Available under the trade name IRESSA; With less than "Lesa")

Erlotinib (compound OSI774 developed by Genentech, Inc. and OSI Pharmaceuticals, Inc .; available under the trade name TARCEVA; hereafter "Taceba"), both of which show encouraging clinical results. Conventional cancer treatment methods using this resana thaceba are daily oral administration of each compound in an amount of no greater than 500 mg. The company was approved in May 2003 for the treatment of patients with advanced non-small cell lung cancer, the first of these products to enter the US market. This resa is an orally active quinazoline that works by directly inhibiting the phosphorylation of tyrosine kinases on EGFR molecules. It acts competitively on the binding site of adenosine triphosphate (ATP), which leads to inhibition of the HER-kinase axis.

[6] However, these compounds have limitations in that the patient may initially react but may be resistant or may not show measurable response to EGFR-TKI at first. That is, only 10-15% of advanced non-small cell lung cancer patients respond to EGFR kinase inhibitors. Thus, understanding the molecular mechanisms for this resa and Tarceva will probably be an essential requirement for maximizing the effectiveness of such treatments in targeted therapies. ^'

[7] This lesa-like tyrosine kinase inhibitor (TKI) therapy has been found in most patients.

Not effective Previous studies have found that the presence of somatic mutations in the kinase domain of EGFR significantly increases the sensitivity of EGFR to TKIs such as Lesa or Tarceva. With these somatic mutations

For patients, treatment with current TKIs, such as Lesa, will be more effective. [8] To date, screening for EGFR mutations has been based on direct sequence analysis or single-strand conformation polymorphism analysis. The screening method through nucleic acid amplification is a method of detecting mutations through a base thermal analysis step, which takes a long time, is cumbersome and expensive. In addition, since clinical samples have very few mutations compared to wild type, it is very important to detect a small amount of mutations, and the above method has low detection sensitivity, making it difficult to detect very small mutations [ Chung et al., Clin Endocrinol. 65: 660-666, 2006; Trovisco et al., J Pathol. 202: 247-251, 2004.

[9] Mutation with primers specific for the mutation to increase sensitivity

Allele specific PCR method to selectively amplify [Rhodes et al., Diagn mol pathol. 6 (l): 49-57, 1997], for the selective detection of mutations only using critical denaturation temperature (T _c ).

Cold-PCR method [Zuo et al., Modern Pathol. 22: 1023-1031, 2009, and the like. In addition, a scorpion real-time allele specific PCR (DxS 'scorpions and ARMS) method of selectively detecting mutations using scorpion probes is also used [Mark et al. , Journal of Thoracic Oncology 4 (12): 1466-1472, 2009]. This technique can be applied to various diagnosis easily and quickly, and it is a good technique for diagnosis and analysis of mutation of cancer-related genes [Bernard et al., Clinical Chemistry 48 (8): 1 178-1 185, 2002 ]. However, the above method requires the use of both probes and primers at the site of mutation to detect mutations.

There is a need for multiple reactions to detect mutations [Rhodes et al., Diagn mol pathol. 6 (l): 49-57, 1997, Zuo et al., Modern Pathol. 22: 1023-1031, 2009.

[10] Pyrosequencing method analyzes 96 samples

It can be analyzed for 4 hours including the polymerase chain reaction step, and can be analyzed simply by the purification and the electron binding step without the fluorescence amplification step required by the direct sequencing method. It is reported that the assay has the advantage of identifying the amount of the mutant inherent because it is semi-quantitatively analyzed for identifying heat [Agaton et al., Gene. 289: 3-39, 2002; Kim et al., Diagn Mol Pathol. 17: 118-125, 2008. However, the pyrosequencing method has a disadvantage of requiring expensive analysis costs because it requires expensive equipment.

[11] Recently, a technique for selectively detecting a mutant type, unlike the above method, uses a PNA probe that specifically binds to a wild type to inhibit amplification of a large amount of wild type. Clamping techniques have been developed. PNA was first reported in 1991 as analogous DNA with nucleic acid bases linked by peptide bonds rather than phosphate bonds [Nielsen et al., Science, 254: 1497-1500, 1991]. PNAs are synthesized by chemical methods and are not found in nature. PNAs form hybridized strands by hybridization with complementary base sequences of natural nucleic acids. PNA / DNA strands can be formed with the same number of nucleotide groups. PNA / RNA strands are more stable than DNA / DNA strands. The basic skeleton of PNA is

N- (2-aminoethyl) glycine is most commonly linked repeatedly by amide bonds, in which case the backbone of the peptide nucleic acid is electrically neutral, unlike the base skeleton of a negatively charged natural nucleic acid. The four nucleobases present occupy a space similar to the nucleotide groups of DNA, and the distances between the nucleotide groups are nearly the same as those of natural nucleic acids. PNA is not only chemically more stable than natural nucleic acid but also biologically stable because it is not degraded by nuclease or protease. Since PNA is also electrically neutral, the stability of PNA / DNA and PNA / RNA double strands is not affected by salt concentration. Because of these properties, PNA can recognize complementary nucleotide sequences better than natural nucleic acids and can therefore be used for diagnostic or other biological and medical purposes. The PNA clamping technique takes advantage of the above-described advantages of PNA so that when the PNA probe is fully bound, the amplification reaction does not occur because the amplification reaction does not occur and if there is a point mutation, the amplification reaction occurs. As a method of utilizing the principle, it is widely used to detect a very small amount of mutations compared to wild type quickly and accurately.

[12] The EGFR mutation detection technique using PNA includes a technique of detecting PNA using a gene scan or Taqman probe [US 2010/0009360 A1, Jan. 14, 2010]. Provides only examples using 17mer of EGFR gene heavy loss 19 deletion, 15mer of axon 21 L858R mutation, 14mer PNA probe of exon 20 T790M mutation, and the method using gene scan or Taqman probe to distinguish mutations. In addition to clamping probes, it contains a large number of probes with donor fluorophores and acceptors that can detect fluorescence for measuring the melting curve, which increases the cost of analysis and requires expensive equipment. There is a problem.

Detailed description of the invention

Technical task

[13] The present inventors have to use a long (15 to 30mer, especially 16 to 27mer) PNA clamping probe to detect variants with only amplification cycle differences with their livestock, making them easier to detect than variants using gene scan or taqman probes. In addition, it completely reduces the amplification of a large amount of wild-type, thereby increasing the detection sensitivity of the variant.

Improves rapid and accurate sensitivity to very small amounts of mixed mutations The present invention was completed by developing an EGFR mutation detection technique using detectable PNA-based real-time PCR clamping.

[14] An object of the present invention is to provide a method for detecting EGFR mutation using PNA-based real-time PCR clamping.

[15] Another object of the present invention is EGFR using PNA-based real time PCR clamping

To provide a detection kit for use in a method of detecting mutations. Challenge solution

[16] The first aspect of the present invention

[17] (1) Axon 18 wild type codon 719. Axon 19 wild type codons 746 to 749, axon 20 wild type codons 767 to 771, exon 20 wild type codon 768, exon 20 wild type codon 790, exon of EGFR (Epidermal Growth Factor Receptor) gene A set of clamping primers to amplify a site comprising 21 nucleotides of wild type codon 858 or 861, and a PPT (Peptide Nucleic Acid) clamping probe having a length of 15 to 30mer that completely binds to the wild type gene recited at each of the codon sites Performing real-time polymerase chain reaction (PCR) on the EGFR gene in the presence of;

[2] (2) analyzing the gene amplification by the real-time PCR to determine the presence or absence of mutation of the EGFR gene;

[19] The present invention relates to a method for detecting a kinase domain mutation of an EGFR gene. [20] The second aspect of the present invention

[21] any one of the PNA clamping probes selected from SEQ ID NOs: 1 to 91

It relates to a kit for use in a method for detecting a kinase domain mutation of the EGFR gene comprising:

Effects of the Invention

[22] The PNA probe according to the present invention is very useful for biological enzymes and physical elements.

It is expected to be very easy to use in mass analysis and clinician because it is very simple and easy to detect and detects EGFR gene mutations in a short time with very high sensitivity and specificity.

[23] In addition, the EGFR gene mutation detection method according to the present invention can quickly and accurately examine tumors such as prostate cancer, breast cancer, colon cancer, pancreatic cancer, ovarian cancer, spleen cancer, testicular cancer, thymic cancer and lung cancer. It will enable efficient treatment due to early cancer diagnosis.

Brief description of the drawings

[24] Figure 1 shows the screening of probes for detecting EGFR axon 18 codon 719 mutations.

In accordance with the present invention, the PNA probes of SEQ ID NOs: 6 to 10 are graphs comparing detection sensitivity (: _t ) according to probes. [25] (G719A; mutant clone substituted with cytosine at axon 18 codon 719 guanine, G19S: mutant clone standard substituted with adenine at exon 18 codon 719 guanine, G19S: mutant clone substituted with thymine at axon 18 codon 719 guanine Standards)

[26] Figure 2 shows the selection of a probe for detecting an EGFR axon 19 gene deletion.

It is a graph comparing the detection sensitivity (Δ¾) according to the probe using the PNA probe of SEQ ID NO: 11 and 20 to 26 of the invention,

[27] (E1918; axon 19 codon 746-750 missing mutant clone, E1919; exon 19 codon

746-751 mutant clone deleted with ΑΑΤ inserted, Ε1920; Exon 19 codon 746-752 deleted mutant clone, E1921; Axon 19 codon 746-751 deleted mutant clone, E1922; Exon 19 codon 746-752 deleted mutant clone, E1923; Exon 19 codon 746-750 mutant clone with missing and inserted Τ, Ε1924; Exon 19 codon 746-750 deleted mutant clone, E1925; Exon 19 codon 746-752 deleted mutant clone, E1926; Mutant clones with exon 19 codon 747-750 deleted and GC inserted, E1927; Exon 19 codon

747-751 deleted mutant clone with GCA inserted, E1928; Axon 19 codon 747-749 deleted mutant clone, E1929; Exon 19 codon 747-751 deleted mutant clone, E1930; Axon 19 codon 747-752 deleted mutant clone, E1931; Mutant clones lacking axon 19 codon 747-749 and replacing TTAAGAGAAG with C, E1932; Mutant clone deleted from exon 19 codon 747-753 and inserted CA, E1933; Exon 19 codon 747-751 deleted mutant clone, E1934; Axon 19 codon 747-753 deleted mutant clone, E1935; Axon 19 codon 747-751 deleted mutant clone, E1936; Exon 19 codon 747-751 deleted and C inserted mutant clone)

3 shows EGFR exon 20 2307_2308 CCAGCGTGG gene (a), EGFR axon 20

2307_2308 CCAGCGTGG gene (b) and EGFR axon 20 2319_2320 In the selection of probes to detect the insertion of CAC gene (c), the sequence of SEQ ID NOS 35 to 37 of the present invention. PNA probe, a graph comparing the detection sensitivity (AC _t ) according to the probe using the PNA probe of SEQ ID NO: 42 to 46 and the PNA probe of SEQ ID NO: 55 to 59,

4 is a graph comparing detection sensitivity (AC _t ) according to probes using PNA probes of SEQ ID NOs: 61 and 62 in the selection of probes for detecting EGFR axon 20 codon 768 mutations. ;

5 is a graph comparing detection sensitivity (AC _t ) according to a probe using a PNA probe of SEQ ID NOs: 69 to 74 in the selection of a probe for detecting an EGFR exon 20 codon 790 mutation. ;

[31] Figure 6 shows EGFR exon 21 codon 858 mutation (a) and EGFR exon 21 codon 861

In the selection of the detection probe for the mutation (b), SEQ ID NOs: 89 to 91 of the present invention

A graph comparing the detection sensitivity (AC _t ) of the PNA probes;

7 is a real-time PCR curve image (a) showing the detection sensitivity according to the deletion mutation concentration of the EGFR exon 19 gene and EGFR axon 19 gene by real-time PCR using the PNA probe of SEQ ID NO: 20 of the present invention Inclusion of deletion mutations It is a graph comparing detection sensitivity (b) according to the concentration,

8 shows the detection sensitivity according to the EGFR axon 20 codon 790 mutation concentration.

Shown is a graph comparing the detection sensitivity (b) according to the inclusion concentration of the EGFR exon 20 codon 790 mutation by real-time PCR using a real-time PCR curve image (a) and a PNA probe of SEQ ID NO: 74 of the present invention,

9 shows detection sensitivity according to EGFR exon 21 codon 858 mutation concentration.

This shows a comparison of detection sensitivity (b) according to the inclusion concentration of the EGFR axon 21 codon 858 mutation by real-time PCR using a real-time PCR curve image (a) and a PNA probe of SEQ ID NO: 90 of the present invention.

[35] Figure 10 shows a PNA probe of the prior art for cell lines with EGFR mutations.

[36] Detection sensitivity according to EGFR mutation concentration (ΔΟ is compared using a PNA probe of SEQ ID NO: 20 (a), SEQ ID NO: 90 (b) and SEQ ID NO: 74 (c) of the present invention). Form for

[37] Hereinafter, the present invention will be described in detail.

[38] The present invention uses PNA-based real-time PCR clamping to detect kinase domain mutations of the EGFR gene.

[39] Fabrication of ¾ of 1-P A Large Probes

[40] PNA clamping probes were designed and constructed for the detection of in frame deletions or substitutions in kinase domains of EGFR listed in Table 1 in exon 18, 19, 20 or 21.

[41] [Table 1]

[42] The PNA probes of the present invention are perfectly matched with mutations of EGFR axons 18 19, 20 and 21 and perfectly matched to wild-type gene sequences where deletions, insertions and substitutions of genes occur. , Preferably 15 to 30, more preferably 16 to 27 sequences.

[43] The PNA probe of the present invention is preferably designed so that mutations of EGFR axons 18, 19, 20, and 21, and regions in which deletions and substitutions of genes occur are located in the center of the probes and the sequences thereof have sequences of wild-type genes. Do. For example, the PNA probe of the present invention may be any one of SEQ ID NOs 1 to 91 shown in Table 2 below. It can be composed of sequence sequences. PNA probe sequences within the range that can be easily modified by those skilled in the art from the base sequence using the common knowledge should be considered to be within the scope of the present invention, the present invention as a PNA probe having a length of 16mer or more As long as it is possible to effectively detect mutants of EGFR axons 18, 19, 20 or 21, and deletions, insertions and substitutions of genes using only PNA clamping real-time PCR according to the present invention, the scope of the present invention. It is included in.

Specifically, SEQ ID Nos. 1 to 10 are probes for completely binding with wild type of codon 719 of EGFR exon 18 to inhibit wild type amplification and to detect mutations. The mutation in the detected exon 18 was substituted with guanine at nucleotide 2155 with thymine or adenine, with wild type glycine at codon 719 with cysteine or serine and guanine at nucleotide 2156.

Substituted with cytosine, the wild type glycine of codon 719 is substituted with alanine. SEQ ID NOS: 1 to 10 are designed to specifically localize to the 2146-2166 base, including codon 719 of EGFR axon 18. SEQ ID NOs: 11-26 are probes for completely binding with the wild type of the codons 746-759 portion of EGFR axon 19 to inhibit wild type amplification and detect mutations. Gene mutations present in the axon 19 of the EGFR include the deletion of codons 746 to 759, including the deletion of 9, 12, 15, 18 nucleotides in nucleotides 2235 to 2258, or at the same time as the deletion of the nucleotides do. SEQ ID NOS: 11-26 are designed to specifically localize to bases 2233-2260 including the codons 746-759 of EGFR axon 19. SEQ ID NOs: 27-59 are probes for completely binding with wild type of codons 767-7 of EGFR axon 20 to inhibit wild type amplification and detect mutations. The gene mutation present in the EGFR exon 20 includes the insertion of CCAGCGTGG between nucleotides 2307 and nucleotides 2308, insertion of cytosine, adenine and cytosine (CAC) between nucleotides 2319 and nucleotides 2320 (2319_2320 ins CAC), and Guanine, guanine, and between nucleotide 2310 and nucleotide 2311

Thymine (GGT) is inserted. SEQ ID NOs: 27-59 are specific for bases 2292-2330 comprising the codons 767-7 of EGFR axon 20

It is designed to be popular. SEQ ID NOs: 60-65 are probes for completely binding to the wild type of codon 768 of EGFR exon 20 to inhibit amplification of the wild type and to detect mutations. The mutation present in the EGFR exon 20 is a guanine of nucleotide 2303 is substituted with thymine. As a result of this substitution, an amino acid is substituted, and the wild-type serine of amino acid 768 is replaced with isoleucine. SEQ ID NOs: 60-65 are designed to specifically localize to the 2292-2315th base, including codon 768 of EGFR axon 20. SEQ ID NOs 66-78 perfectly bind the wild type of codon 790 of EGFR axon 20 to inhibit wild type amplification and Probe for detection. Mutations in codon 790 of EGFR axon 20 include the substitution of thymine for cytosine at nucleotide 2369, which replaces the amino acid, replacing the threonine, a wild type of amino acid 790, with methionine. SEQ ID NOs 66-78 are designed to specifically localize to 2359-2380th base, including codon 790 of EGFR axon 20. SEQ ID NOs: 79-91 are probes that bind perfectly with the wild types of codons 858 and 861 of EGFR axon 21 to inhibit amplification of the wild type and detect mutations. Substitution of the gene includes mutations in axon 21 of EGFR including substitution of at least one amino acid, including substitution of thymine of nucleotide 2573 with guanine. As a result of this substitution, the wild type leucine of amino acid 858 is replaced with arginine. The substitution at axon 21 also includes the substitution of thymine at nucleotide 2582 with adenine, and as a result of this substitution, the wild type leucine of amino acid 861 is replaced with glutamine. SEQ ID NOs: 79-91 are designed to specifically localize to bases 2567-2589 including codons 858 and 861 of EGFR exon 21.

[Table 2]

Other sequence number Name sequence (5 '3') Mer number

1 E18CS-21-1 AAAGTGCTGGGCTCCGGTGCG 21

2 E18CS-20-1 AAGTGCTGGGC CCGGTGCG 20

3 E18CS-20-2 AMGTGCTGGGCTCCGGTGC 20

4 E18CS-19-1 AAGTGCTGGGCTCCGGTGC 19

5 E18CS-18-1 GTGCTGGGCTCCGGTGCG 18 Axon 18 G719X

6 E18CAS-21-1 CGCACCGGAGCCCAGCACTTT 21

7 E18CAS-20-1 CGCACCGGAGCCCAGCAQT 20

8 E18CAS-20-2 GCACCGGAGCCCAGCAC TT 20

9 E18CAS-19-1 GCACCGGAGCCCAGCACTT 19

10 E18CAS-18-1 CGCACCGGAGCCCAGCAC 18

11 E19CAS— 24-1 AGATGTTGaTCTCTTMlTCCTT 24

12 E19CAS— 23-1 AGATGTTGCTTCTCITAATTCa 23

13 E19CAS-23-2 GATGTTGCTrCTC TAATTCCTT 23

14 E19CAS-22-1 GATGT GCTTCTCrTAAnCCT 22

15 E19AS-REF AGATCTTGC TCTCnM 18

16 E19CAS-19-1 TGTTGCI CTOTAATTCC 19

17 E19CAS-18-1 TGTTGCTTCTCTTAATTC 18 Axon 19 Defect 18 E19CAS-20-2 ATGTTGOTCTCTTAATTCC 20 and Substitution 19 E19CAS-20-1 TGTTGCTTCTCTTMTTCCT 20

20 E19CAS-24-2 GATGTTGCTTCTCTTAATTCCTTG 24

21 E19CAS-24-3 ATGTTGCTTCTCrTAATTCCTTGA 24

22 E19CAS-25-1 GATGnGCTTCTCrrAAnCCITGA 25

23 E19CAS-25-2 AGATGnGCTTCTCTTAATTCCTTG 25

24 E19CAS-26-1 AGATGTTGCTTCTCTTAATTCCTTGA 26

25 E19CAS-26-2 GATGTTGOTCTOTAA TCCTTGAT 26

26 E19CAS-27-1 AGATGnGCTTCTCTTAAnCCTTGAT 27 [46] Target sequence number Name sequence (5 '―>3') Mer number

27 E20CS-21-1 ATGGCCAGCGTGGACAACCCC 21

28 E20CS-21-2 TGGCCAGCGTGGACAACCCCC 21

29 E20CS-20-1 TGGCCAGCGTGGACAACCCC 20

30 E20CS-20-2 ATGGCCAGCGTGGACMCCC 20

31 E20CAS-21-1 GGGCTTGTCCACGCTGGCCAT 21

32 E20CAS-21-2 GGGGGnGTCCACGCTGGCCA 21

33 E20CAS-20-1 GGGGTTGTCCACGCTGGCCA 20

34 E20CAS-20-2 GGGTTGTCCACGCTGGCCAT 20

35 E20CS-17 ATGCCCAGCGTGGACAA 17

36 E20CS-18 ATGCCCAGCGTGGACMC 18

37 E20CS-19 GATGCCCAGCGTGGACAAC 19

38 E20CAS-17 TTGTCCACGCTGGCCAT 17

39 E20CAS-18 GTTGTCCACGCTGGCCAT 18

40 E20CAS-19 GTTGTCCACGCTGGCCATC 19

41 E2017CS-21 GCCAGCGTGGACAACCCCCAC 21

42 E2017CS-19 CAGCGTGGACAACCTCCAC 19 Axon 20 Insertion 43 E2017CS-18 AGCGTGGACAACCTCCAC 18

44 E2017CAS-21 TGGTGGTTGTCCACGCTGGC 20

45 E2017CAS-19 GGTGGTTGTCCACGCTGGC 19

46 E2017CAS-18 GGTGGTTGTCCACGCTGG 18

47 E2016CS— 21-1 ACMCCCCCACGTGTGCCGCC 21

48 E2016CS— 21-2 CAACCCCCACGTGTGCCGCCT 21

49 E2016CS— 20-1 CAACCCCCACGTGTGCCGCC 20

50 E2016CS-19-1 MCCCCCACGTGTGCCGCC 19

51 ^'' E2016CS-21-3 ACAACCTCCACGTGTGCCGCC 21

52 E2016CS-21-4 CMCCTCCACGTGTGCCGCCT 21

53 E2016CS-20-2 CAACCTCCAC6TGTGCCGCC 20

54 E2016CS-19-2 ^• MCCTCCACGTGTGCCGCC 19

55 E2016CS-18-1 AACCTCCACGTGTGCCGC 18

56 E2016CS-18-2 ACCTCCACGTGTGCCGCT 18

57 E2016CS-17-1 ACCTCCACGTGTGCCGT 17

58 E2016CS-17-2 AACCTCCACGTGTGCCG 17

59 E2016CS-16-1 ACCTCCACGTGTGCCG 16 Other sequence number name sequence (5 '——->3') Mer number

60 S768ICS-21 GTGATGCCCAGCGTGGACAAC 21

61 S768ICS-20 TGATGCCCAGCGTGGACAAC 20

62 S768ICS-19 TGATGCCCAGCGTGGACAA 19 Axon 20 S768I

63 S7681CAS-21 GTTGTCCACGCTGGCCATCAC 21

64 S768ICAS-20 GTTGTCCACGCTGGCCATCA 20

65 S768ICAS-19 TTGTCCACGCTGGCCATCA 19

66 T790 CS-21-1 CAGCTCA CACGCAGCTCATG 21

67 T790MCS-20-1 CAGCTCATCACGCAGCTCAT 20

68 T790 CS-20-2 AGCTCATCACGCAGCTCATG 20

69 T790MCS-19-1 AGCTCATCACGCAGCTCAT 19

70 T790MCS-19-2 GCTCATCACGCAGCTCATG 19

71 T790MCS-19-3 CAGCTCATCACGCAGCTCA 19 Axon 20 T790 72 T790MCS-18-1 AGCTCATCACGCAGC CA 18

73 T790 CS-18-2 GCTCATCACGCAGCTCAT 18

74 T790MCS-17-1 GCTCATCACGCAGCTCA 17

75 T790MCAS-21-1 CATGAGCTGCGTGATGAGCTG 21

76 T790MCAS-20-1 ATGAGCTGCGTGATGAGCTG 20

77 T790MCAS-20-2 CATGAGCTGCGTGATGAGCT 20

78 T790MCAS-19-1 ATGAGC GCGTGATGAGCT 19

79 E2 ICS— 22-1 TOGGCTGGCCAAACTGCTGGG 22

80 E2 ICS— 21-1 rrGGGCTGGCCAAACTGCTGG 21

81 E21CS-21-2 TGGGCTGGCCWACTGCTGGG 21

82 E2 ICS— 20-1 TGGGCTGGCCAAACTGCTGG 20

83 E21CS-20-2 TTGGGCTGGCCAMCTGCTG 20

84 E21CAS-22-1 CCCAGCAGTTTGGCCAGCCCAA 22 Axon 21 L858R,

85 E21CAS-21-1 CCAGCAGTTTGGCCAGCCCAA 21

L861Q

86 E21CAS— 21-2 CCCAGCAGTTTGGCCAGCCCA 21

87 E21CAS-20-1 CCAGCAGTTTGGCCAGCCCA 20

88 E21CAS-20-2 CAGCAGTTTGGCCAGCCCAA 20

89 E21CAS-19-1 CAGCAGTTTGGCCAGCCCA 19

90 E21CAS— 19-2 AGCAGTTTGGCCAGCCCAA 19

91 E21CAS-19-3 CCAGCAGTTTGGCCAGCCC 19 Representative of the probes of SEQ ID NOs 6 to 10 by applying the probes of SEQ ID NO: 6 to 10 to confirm the effect of inhibiting the amplification of the wild type of codon 719 of axon 18 and detecting the mutation, SEQ ID NO: 8 All of the probes 10 to 10 showed excellent effects, and in particular, the probes of SEQ ID NO: 8 were found to show better effects (see FIG. 1). Codons 746-759 of axon 19 by applying the probes of SEQ ID NOs: 11 and 20-26 As a result of inhibiting wild-type amplification and detecting mutations with gene deletions, it was confirmed that the probes of SEQ ID NOs: 1 and 20 showed excellent effects, and in particular, the probes of SEQ ID NO: 20 showed better effects ( 2)

[50] As a result of confirming the effect of inhibiting the amplification of codons 767 to 771 wild type of axon 20 and detecting mutations with gene insertion by applying the probes of SEQ ID NOs: 35 to 37, 42 to 46, and 55 to 59 Probes 35, 42, 43, 55 and 58 showed an excellent effect, in particular, it was confirmed that the probes of SEQ ID NO: 35, 43, 58 shows a better effect (see Fig. 3).

[51] As a result of applying the probes of SEQ ID NOs 61 and 62, the effect of inhibiting the amplification of the wild type of the codon 768 of exon 20 and detecting the mutation showed that both probes showed an excellent effect. It was confirmed to exhibit a better effect (see FIG. 4).

[52] a wild type of codon 790 of exon 20 by applying a probe of SEQ ID NOs: 69-74

As a result of inhibiting amplification and detecting mutations, it was confirmed that the probes of SEQ ID NOs: 72 to 74 all exhibited excellent effects, and in particular, the probes of SEQ ID NO: 74 showed better effects (see FIG. 5).

[53] Codons 858 and 861 of exon 21 by applying a probe of SEQ ID NOs: 89 to 91

As a result of inhibiting the amplification of the wild type and detecting the mutation, it was confirmed that all of the probes of SEQ ID NOs: 89 to 91 showed excellent effects, and in particular, the probes of SEQ ID NO: 90 showed better effects (see FIG. 6).

The PNA probe of the present invention may include a hydrophilic functional group at the N-terminus or C-terminus to increase reaction efficiency and solubility. For example, a hydrophilic linker or a hydrophilic amino acid at the N-terminus or C-terminus, Or one to several amine groups [7 Chem Technol Biotechnol 81: 892-899, 2006; Tetrahedron Lett 39: 7255-7258, 1998; Proc Natl Acad Sci USA 99: 5953-5958, 2002; Anal Chem 69: 5200-5202, 1997]. As a specific example, a PNA probe having one lysine attached to the N-terminus is used.

Used.

[55] The PNA oligomer used in the present invention is a PNA monomer protected by Bts (Benzothiazolesulfonyl) group according to the method of Korean Patent No. 464,261, or known

Fmoc (9-flourenylmethloxycarbonyl) or can be synthesized using the t-Boc PNA monomer protected with a (t-butoxycarbonyl) [Dueholm et al., J 6> rg ί ■ / Iem. 59 (19): 5767-5773, 1994; Christensen J peptide Sci 1 (3): 175-183, 1995; Thomson et al., Tetrahedron 51 (22): 6179-6194, 1995].

[56]

[57] 2. Design and Fabrication of EGFR User Clamping Primer

[58] In the present invention, the term "EGFR gene clamping primer" refers to suppression of amplification of wild-type genes that are perfectly bound to PNA probes, and to perfection with ΡΝΑ probes. It refers to a CR primer that amplifies a mutant gene that is not bound (ie, a mismatch is present).

The clamping primer of the present invention is not particularly limited, but in order to detect mutations with higher sensitivity and specificity, a portion of the clamping primer overlaps the PNA probe in one direction and the other in the other direction based on the PNA clamping probe. Including the site to be detected, it is preferable to devise in consideration of the size of the PCR amplification product. In addition, considering 7 ^ with the PNA probe, the length is between 17mer and 30mer, especially between 17mer and 24mer, and it is preferable to design lower than the T _m of the PNA probe. In order to maximize diagnostic sensitivity and specificity, it is desirable to design to include just before the base of the mutation in the PNA clamping probe sequence that complementarily binds to the wild type. According to a specific example, the clamping primers of 17mer to 30mer, especially 17mer to 24mer, were designed to include PNA probes of column numbers 1 to 91 and 3 to 12 base sequences.

The forward primer of SEQ ID NO: 103 illustrated in the present invention is designed to specifically recognize the upstream partial base of codon 719 of the EGFR gene axon 18 of SEQ ID NOs: 1-10. The reverse primer of SEQ ID NO: 102 in combination with the forward primer of SEQ ID NO: 103 exemplified in the present invention is designed to specifically recognize the 64th to 83rd bases of the 18 region of the EGFR gene intron. The forward and reverse primers of SEQ ID NOs: 106 to 1 10 are designed to specifically recognize upstream partial bases of the deletion of the EGFR gene exon 19 of SEQ ID NOs: 11 to 26.

The reverse primer of SEQ ID NO: 105 in combination with the forward primers of SEQ ID NOs: 106 to 109 exemplified in the present invention is designed to specifically recognize the 56th to 75th base of the 19 region of the EGFR gene intron. In addition, the forward primer of SEQ ID NO: 104 in combination with the reverse primer of SEQ ID NO: 110 was designed to specifically recognize the 7th to 26th bases of the 19 site of the EGFR gene intron. The forward primers of SEQ ID NOs 114-120 are designed to specifically recognize the gene insertion of the EGFR gene exon 20 of SEQ ID NOs 27-78 and the upstream partial bases of codons 768, 790.

The reverse primer of SEQ ID NO: 113 in combination with the forward primers of SEQ ID NOs: 114 to 120 illustrated in the present invention is designed to specifically recognize the 119th to 138th bases of the 20 region of the EGFR gene exon. The forward primers of SEQ ID NOs: 122 and 123 are designed to specifically recognize the upstream partial bases of gene codons 858 and 861 of the EGFR gene axon 21 of SEQ ID NOs: 79-91.

[63] combined with the forward primers of SEQ ID NOs: 1.22 and 123 exemplified herein

The reverse primer of SEQ ID NO: 121 is designed to specifically recognize the 16th to 35th bases of the 21 region of the EGFR gene intron. The length of the primer is between 17mer and 30mer, in particular between 17mer and 24mer, respectively. It is designed to be 50 bp to 500 bp in size.

On the other hand, the forward primers of SEQ ID NOs: 95 and 101, 104, and 111 provided in the present invention for gene identification by sequencing of axons 18 and 19 of the EGFR gene are -159 of the EGFR gene intron 18 site. To -139th base, 9-28th base of 18-axon 18, 7-26th base of 19-axon 19, and -197--178th base of 19 intron 19 sites, and the primer The reverse primer in combination with was designed to specifically recognize the 165th to 184th base of the 18 region of the EGFR gene intron at SEQ ID NO. 96, and the primer length was designed to be between 17mer and 30mer, especially between 17mer and 24mer. These primers were designed to be combined so that the size of the amplification product was 400 bp to 1500 bp.

[65] For the identification of genes by sequencing of exon 20 of the EGFR gene, the forward primers of SEQ ID NOs: 97 and 1 12 provided in the present invention are -200 to -181 bases of the EGFR gene intron 20 region. And it is designed to specifically recognize the -95 to -77th base of the intron 20 site, the reverse primer in combination with the primer is specifically SEQ ID NO: 98 to 170 to 189 base of the intron 20 site of the EGFR gene It was designed to recognize and the primer length was designed between 17mer and 30mer, especially between 17mer and 24mer. These primers were designed to be combined so that the size of the amplification product was 300 bp to 700 bp.

[66] In order to identify genes by sequencing the axon 21 of the EGFR gene, the forward primer of SEQ ID NO: 99 provided in the present invention specifically targets the -28 to -9th bases of the intron 21 region of the EGFR gene. It was designed to recognize, and the reverse primer in combination with the primer to specifically recognize the 259 to 278 base of the 21 region of the EGFR gene intron at SEQ ID NO: 100

The length of the primer is designed to be between 17mer and 30mer, especially between 17mer and 24mer. These primers were designed to be combined so that the size of the amplification product was 300 bp to 700 bp. The properties of each primer are summarized in Table 3 below.

[Table 3]

[68] 3. PNA-based examination RGFR rounding detection using PCR clamping

[69] The kinase domain mutation detection method of the EGFR gene according to the present invention

(1) Axon 18 wild type codon 코 9, exon 19 wild type codons 746 to 749, axon 20 wild type codon 767 to 771, axon 20 wild type codon 768, axon 20 wild type codon 790, axon A set of clamping primers to amplify a site comprising 21 nucleotides of wild type codon 858 or 861, and 15 to 15 completely binding to a wild type gene floating at each of said codon sites Performing real-time polymerase chain reaction (PCR) on the EGFR gene in the presence of a Peptide Nucleic Acid (PNA) clamping probe having a length of 30mer;

(2) analyzing the gene amplification by the real-time PCR to determine the presence or absence of a mutation or concentration of the EGFR gene;

[72] The EGFR gene of step (1) of the present invention is extracted from the sample

Preparation ᅳ There is no particular limitation on nucleic acid extraction in the present invention, any nucleic acid extraction method can be used in general, using a commercially available nucleic acid extraction kit to extract DNA from the patient's blood or tumor samples to prepare.

[73] The kinase domain mutation of the EGFR gene of the present invention is a substitution of axon 18 G719X;

Deletion or deletion and substitution of axon 19; Insertion of exon 20, substitution of S768I or T790M; Axon 21 L858R or L861Q substitution;

In the present invention, the PNA clamping probe of step (1) is 16 to 27mer

It consists of a base sequence of length, and includes any one selected from column numbers 1 to 91.

[75] The EGFR gene clamping primer set of step (1) of the present invention is forward

A primer comprising at least one primer selected from SEQ ID NOs: 103, 106-109, 114-120, 122, and 123, preferably selected from SEQ ID NOs: 103, 108, 115, 118-120, and 122 It is any one or more primers, and includes the primer of SEQ ID NO: 110 as the reverse primer.

The PNA clamping probe of step (1) of the present invention includes an N-terminal or C-terminal hydrophilic functional group, and the PNA clamping probe in the reaction product of real-time PCR clamping has a final concentration of 1 to 1000 nM. desirable.

The present invention detects mutations in the EGFR gene using a real-time PCR clamping method. In the real-time PCR clamping method, the amount of initial sample in which exponential amplification occurs is represented by the number of cycles (hereinafter referred to as the cycle threshold) at which an exponential increase in fluorescence is detected. Can be analyzed in real time. After the electrophoresis, the step of measuring the intensity with an image analyzer is omitted, and the method of amplifying the amplification product can be quickly and easily diagnosed by automating and quantifying.

In the present invention, the fluorescence is detected by using an intercalator method. In this method, a fluorescent label binds to the amplified double-stranded DNA to emit fluorescence. The amount of produced is measured.

In the present invention, a DNA-binding fluorophore used in a real-time gene detection method is used as a fluorescent material to identify a gene amplification product, and there is no particular limitation on the type thereof. For example, in addition to SYBR Green I, Evergreen, EtBr, BEBO, YO-PRO-1, TO-PRO-3, LC Green, SYTO-9, SYTO-13, SYTO-16 , SYTO-60, SYTO-62, SYTO-64, SYTO-82, POPO-3, TOTO-3, BOBO-3, SYTOX Orange, can be used (Gi / i et al, Nucleic Acids Res. 35 (19): el27, 2007; Bengtsson et al, Nucleic Acids Res. 31 (8): e45; Wittwer et al, Clinical Chemistry 49 (6): 853-860, 2003).

In the present invention, by analyzing the gene amplification by real-time PCR clamping to determine the presence or absence of the mutation of the EGFR gene, it is possible to confirm the presence or absence of the mutation of the EGFR gene by comparing the amplified C _t value. With wild-type genes

When a PNA probe designed to hybridize hybridizes to an EGFR mutant codon gene site and inhibits amplification, the amplification is inhibited, resulting in high C _t value.

[81] The presence or absence of the mutation and its concentration from the AC _t value obtained by

Check it.

[82] [Equation _υ

AC _t = C _t obtained from a positive control sample value - C _t value obtained from the sample of unknown

The higher the mutant gene is included, the lower the value of C _t , and therefore the greater the value of AC _t .

[84] The present invention uses real-time PCR and PNA-based real-time PCR clamping

Prostate cancer, breast cancer, colon cancer, pancreatic cancer, ovarian cancer, spleen cancer, testicular cancer, thymic cancer,

It can be used to treat or diagnose one or more cancers selected from lung cancer, and can be very useful for studying the mechanisms involved in the EGFR signaling system. It can also be effectively applied to studies that require large sample analysis, such as population-based studies.

Hereinafter, the present invention will be described in more detail with reference to Examples, which are intended to aid the understanding of the present invention but are not intended to limit the scope of the present invention in any way.

[86]

Example 1 Synthesis of PNA Probes to Suppress Mutation of EGFR Axons 18, 19, 20, and 21 and Wild-type Amplification of Deletion, Insertion, and Substitution of Genes

91 PNA probes that perfectly bind to the exon 18, 19, 20 and 21 mutations of the EGFR gene and the wild type of deletion, insertion and substitution of the gene were constructed as shown in Table 2 above. Probes that fully bind the wild type of each codon are designed so that the base sequence of mutation occurs in the middle of the probe for effective isolation from the mutation. PNA probes were synthesized according to the method described in Korean Patent No. 464261 [Lee et al, Org Lett, 9: 3291-3293, 2007].

[89]

[90] Example 2 Synthesis of primers for amplifying target nucleic acids of deletions, insertions and substitutions of mutations and genes of EGFR axons 18, 19, 20 and 21

[91] Deletion, insertion and substitution of EGFR axons 18, 19, 20 and 21 mutations and genes

Axons 18, 19, 20, and 21 of the EGFR gene for amplification and clamping PCR of target nucleic acids The site was analyzed to prepare primers. The primers include a set of primers consisting of SEQ ID NOs: 95 and 96 for identifying wild type and mutant genes of EGFR axons 18 and 19 and a set of primers consisting of SEQ ID NOs: 101 and 102 for identifying genes of codon 719 of exon 18. A set of primers consisting of SEQ ID NO: 105 in combination with SEQ ID NOs: 104 and 111, and EGFR axon 18 codons 719 and axons of SEQ ID NOs: 103 and SEQ ID NOs: 106-109 to identify the genetic defect of Axon 19; Clamping primers of the 19 gene deletion were synthesized, and the reverse primers used for clamping the axon 18 codon 719 were used in the same manner as the reverse primer of SEQ ID NO: 102 designed to identify the EGFR exon 18 codon 719 gene. The reverse primer used for clamping of the The designed reverse primers of SEQ ID NO: 105 were used identically.

[92] Gene Insertion of EGFR Exon 20 and Wild-type and Mutations of Codons 768 and 790

One set of primers consisting of SEQ ID NOs: 97 and 98 and one set of primers consisting of SEQ ID NOs: 112 and 113, gene insertion of EGFR axon 20 of SEQ ID NOs 114-120 and codons 768 and 790 to identify the gene Clamping primer

The reverse primers used for the gene insertion of EGFR exon 20 and clamping codons 768 and 790 are identical to the reverse primers of SEQ ID NO: 113 designed to identify the gene insertion of EGFR axon EGFR axon 20 and codons 768 and 790 genes. Used.

[93] Clamping of codons 858 and 861 of EGFR exon 21 of SEQ ID NOs: 122 and 123 and a set of primers to identify wild type and mutant genes of codons 858 and 861 of EGFR exon 21 Primers were synthesized, and primers of SEQ ID NO: 122 were synthesized as reverse primers used for codons 858 and 861 clamping of EGFR exon 21. The sequence of the used primer is as shown in Table 3 above. Primers were synthesized by ^ Bionia (Korea).

[94]

[95] [Example 3] Mutant weaning and cloning for preparing target nucleic acids of EGFR axons 18, 19, 20 and 21

[0096] Using human whole DNA, one set of SEQ ID Nos. 95 and 96, one set of 97 and 98, and one set of 99 and 100 were used to amplify genes of EGFR exons 18, 19, 20 and 21. The amplified nucleic acid was ligated into pGEM-T easy vector (promega, USA) and transformed into E. Coli] M 109 cells to obtain a large amount of DNA. In order to secure a clone with a mutant gene, a primer for mutation was prepared using a normal clone prepared by the above method, and site-specific mutagenesis was made.

Kits (Stratagene, USA) were used to obtain clones with the variant genes.

The obtained clone was confirmed by its sequence analysis for its mutation.

[97] Example 4 Nucleic Acid Extraction from Wild and Mutant Cell Lines of EGFR Axons 18, 19, 20, and 21

[99] Deletion, Insertion, and Replacement of EGFR Exons 18, 19, 20, and 21 Mutations and Genes

In order to secure target nucleic acids of wild type and mutant, cell lines were distributed from the US Standard Cell Line Bank and the Korea Cell Line Bank. The wild-type cell line A549 (genomic DNA) human lung cancer cell line [KCLB10185, Korea Cell Line Bank (KCLB), Seoul, South Korea] was distributed and the mutant cell lines shown in Table 4 are the Korea Cell Line Bank and

It was sold by the American Standard Cell Line Bank.

[Table 4]

[101] The distributed cell line was RPMI1640 (Hyclone, Thermo scientific, USA) and 10% heat-inactivated fetal bovine serum (FBS, Hyclone, Thermo scientific, USA) and IX

Penicillin-streptomycin (Welgene, Korea) was added to the culture medium was maintained in 37 ° C, 5% carbon dioxide (C0 ₂ ) using a medium. The cultured cell line was extracted with DNA using a High Pure PCR Template Preparation Kit (Roche, USA) to obtain a target nucleic acid. The obtained nucleic acid was quantified using a nanodrop spectrophotometer (ND 2000C, Thermo Scientific, USA) and stored at -20 ^° C.

[102] The total DNA isolated from the human cell lines thus received were respectively set of the primer sets of SEQ ID NOs: 95 and 96 and the primer sets of SEQ ID NOs: 97 and 98, listed in Table 3, SEQ ID NOs: 99 and 100. A primer set was applied to amplify the genes of the EGFR axons 18, 19, 20 and 21 portions. The amplified PCR product was purified using Labopass ™ PCR purification kit (Cosmogenetech, Korea) and analyzed for sequencing to confirm genotype. Wild type and mutant cell lines confirmed genotype was used as a sample of the real-time PCR clamping method using the PNA probe of the present invention.

[103]

[Example 5] Establishment of Real-Time PCR Clamping Method Using PNA Probe for EGFR Exon 15 Codon 600

[105] Real time PCR clamping using the DNA extracted from the clone in Example 3 and the DNA extracted from the cell line in Example 4 under the following conditions to establish a PNA-based real-time PCR clamping method and the optimal PNA probe Was selected.

[106] 1 μί of DNA solution 1 extracted from clone or template DNA solution extracted from cell line (50 ng // ^), 1 forward clamping primer shown in Table 2 (10 pmole // O 1 βί, reverse Primer of (lO pmole /) 1 ≠, one of the probes shown in Table 2 above Clamping probe (100 nM) 1 f, 2X IQ Sybr Green Supermix (Bio-Rad, USA) 10 μΐ, distilled water 6 [i Real-time PCR machine, CFX96TM Real-Time PCR System, Bio-RAD After 3 minutes at 95 ° C, repeated 40 cycles of 95 ° C 30 seconds, 70 ° C 20 seconds, 63 ° C 30 seconds, 72 ° C 30 seconds. Measurements were taken at 72 ⁰ C polymerization reaction steps. The results are shown in Figures 1-6.

[107]

Example 6 EGFR Gene Utilization Using PNA-based Real-Time PCR Clamping

Mutation Detection Limit Measurement

[109] The real time PCR clamping method established in Example 5 should be used.

Mutations in the genes were made to contain 50 ng, 20 ng, 10 ng, 5 ng, and 1 ng, respectively, and the correlation between the Ct values according to the concentration of the mutant genes was analyzed to confirm the detection limit of the mutant.

The results are shown in Figs. 7-9. As shown in Figs. 7-9, the higher the concentration of the relative mutant gene in the solution, the more consistently the Q value representing the number of fluctuations of the fluorescence reaching the threshold value decreases uniformly. It was found that there is a correlation between the concentration of the mutant gene and the Q value.

[111]

[112] [Comparative Example 1] Comparison with Conventional Techniques for Detection of EGFR Mutations

[113] In order to compare the PNA probe disclosed in US Patent Publication No. 2010/0009360 with the PNA probe according to the present invention, the EGFR axon 19 gene deletion and exon 20 of codon 790, exon, as shown in Table 5 below. PNA probes for the wild type of the mutant of codon 858 of 21 were constructed.

[Table 5]

[115] Real-time PCR clamping was performed using the probe of the U.S. Patent Publication and the probe according to the present invention to determine whether the mutation was detected.

The results are shown in FIG. 10. As can be seen from a of FIG. 10, when using the probe of US Patent Publication No. 92, there was no difference in the α value due to the presence of mutations or increase in concentration ( In other words, it was difficult to detect mutations due to the small Δα value, and the Ct value was not only reduced significantly due to the presence of the mutant when using the ΡΝΑ probe according to the present invention (that is, the Δα value cycle). This constant reduction enabled effective detection of mutations.

[117] In addition, as can be seen in the results of FIG.

When using the SEQ ID NO: 94 probe, the α value may be increased depending on the presence of mutation or increase in concentration. Compared to the fact that it was difficult to detect mutants because there was no difference (that is, the Δα value is small), the α value due to the presence of the mutant when using the ΡΝΑ probe according to the present invention. As the concentration of increased, the α value decreased constantly, and the mutation could be effectively detected.

[118] Finally, as can be seen from c.

SEQ ID NO: 93 Probe The detection sensitivity is similar to the ΡΝΑ probe according to the present invention, but the mutant detection of the present invention exhibits a slightly higher Δα value, and is mixed at a rate of 1% using the ΡΝΑ probe according to the present invention. The presence of mutations could be detected.

Sequence List Free Text

[119] SEQ ID NO: 1 shows a PNA clamping probe for detection of mutants o of the present invention.

The base sequence of E18CS-21-1.

[120] SEQ ID NO: 2 is a PNA clamping probe for detection of mutations of the present invention.

The base sequence of E18CS-20-1.

[121] SEQ ID NO: 3 shows a PNA clamping probe for detection of mutants o of the present invention.

Base sequence of E18CS-20-2.

[122] SEQ ID NO: 4 shows a PNA clamping probe for detection of mutants o of the present invention.

Base sequence of E18CS-19-1.

[123] SEQ ID NO: 5 shows a PNA clamping probe for the detection of mutants o of the present invention.

The base sequence of E18CS-18-1.

[124] SEQ ID NO: 6 is a PNA clamping probe for detection of mutations of the present invention.

The base sequence of E18CAS-21-1.

[125] SEQ ID NO: 7 shows a PNA clamping probe for detection of mutants o of the present invention.

The base sequence of E18CAS-2 ()-1.

[126] SEQ ID NO: 8 shows a PNA clamping probe for detection of mutations of the present invention.

Base sequence of E18CAS-21-2.

[127] SEQ ID NO: 9 shows a PNA clamping probe for detecting mutation ⁰ of the present invention.

The base sequence of E18CAS-19-1.

[128] SEQ ID NO: 10 shows a PNA clamping probe for mutation detection of the present invention.

The base sequence of E18CAS-18-1.

[129] SEQ ID NO: 11 shows a PNA clamping probe for mutation detection of the present invention.

The base sequence of E19CAS-24-1.

[130] SEQ ID NO: 12 shows a PNA clamping probe for mutation detection of the present invention.

The base sequence of E19CAS-23-1.

[131] SEQ ID NO: 13 shows a PNA clamping probe for detecting mutations of the present invention.

The base sequence of E19CAS-23-2.

[132] SEQ ID NO: 14 shows a PNA clamping probe for mutation detection of the present invention. Base sequence of EI9CAS-22-1.

[133] SEQ ID NO: 15 shows the ΡΝΑ clamping probe for the detection of a mutation of the present invention.

Base sequence of E19AS-REF.

[134] SEQ ID NO: 16 shows a ΡΝΑ clamping probe for detecting a mutation of the present invention.

The base sequence of E19CAS-19-1.

[135] SEQ ID NO 17 shows a ΡΝΑ clamping probe for detection of mutations of the present invention.

The base sequence of E19CAS-18-1.

[136] SEQ ID NO: 18 shows a ΡΝΑ clamping probe for detection of mutations of the present invention.

The base sequence of E19CAS-20-2.

[137] SEQ ID NO: 19 shows a ΡΝΑ clamping probe for the detection of a mutation of the present invention.

The base sequence of E19CAS-20-1.

[138] SEQ ID NO. 20 mutation in eunbon invention ο ^'ΡΝΑ clamping probe for detecting

The base sequence of E19CAS-24-2.

[139] SEQ ID NO. 21 mutation in eunbon invention ο ^'ΡΝΑ clamping probe for detecting

The base sequence of E19CAS-24-3.

[140] SEQ ID NO: 22 shows a ΡΝΑ clamping probe for detecting a mutation of the present invention.

The base sequence of E19CAS-25-1.

[141] SEQ ID NO: 23 shows a ΡΝΑ clamping probe for detecting mutations of the present invention.

The base sequence of E19CAS-25-2.

[142] SEQ ID NO: 24 shows the ΡΝΑ clamping probe for detecting mutations of the present invention.

The base sequence of E19CAS-26-1.

[143] SEQ ID NO: 25 shows a ΡΝΑ clamping probe for detecting mutations of the present invention.

The base sequence of E19CAS-26-2.

[144] SEQ ID NO: 26 shows a ΡΝΑ clamping probe for detecting mutations of the present invention.

The base sequence of E19CAS-27-1.

[145] SEQ ID NO: 27 shows the ΡΝΑ clamping probe for detecting mutations of the present invention.

The base sequence of E20CS-21-1.

[146] SEQ ID NO: 28 shows the ΡΝΑ clamping probe for detecting mutations of the present invention.

Base sequence of E20CS-21-2.

[147] SEQ ID NO: 29 shows a ΡΝΑ clamping probe for detecting mutations of the present invention.

Base sequence of E20CS-20-1.

[148] SEQ ID NO: 30 shows the ΡΝΑ clamping probe for detecting mutations of the present invention.

Base sequence of E20CS-21-2.

[149] SEQ ID NO: 31 shows the ΡΝΑ clamping probe for detecting mutations of the present invention.

The base sequence of E20CAS-21-1.

[150] SEQ ID NO: 32 shows the ΡΝΑ clamping probe for detecting mutations of the present invention.

Base sequence of E20CAS-21-2.

[151] SEQ ID NO: 33 shows the ΡΝΑ clamping probe for detecting mutations of the present invention. Base sequence of E20CAS-20-1.

[152] SEQ ID NO: 34 shows a PNA clamping probe for detecting mutation 0 of the present invention.

Base sequence of E20CAS-20-2.

[153] SEQ ID NO: 35 shows a PNA clamping probe for detection of a mutation of the present invention.

The base sequence of E20CS-17.

[154] SEQ ID NO: 36 shows a PNA clamping probe for detecting mutation 0 of the present invention.

Base sequence of E20CS-18.

[155] SEQ ID NO: 37 shows a PNA clamping probe for detecting a mutation of the present invention.

Base sequence of E20CS-19.

[156] SEQ ID NO: 38 shows a mutant o of the present invention: PNA clamping probe for detection.

The base sequence of E20CAS-17.

[157] SEQ ID NO: 39 shows a PNA clamping probe for mutant detection of the present invention.

The base sequence of E20CAS-18.

[158] SEQ ID NO: 40 shows a PNA clamping probe for detecting mutations of the present invention.

Base sequence of E20CAS-19.

[159] SEQ ID NO: 41 is a PNA clamping probe for mutant detection of the present invention.

The base sequence of E2017CS-21.

[160] SEQ ID NO: 42 shows a PNA clamping probe for mutant detection of the present invention.

The base sequence of E2017CS-19.

[161] SEQ ID NO: 43 shows a PNA clamping probe for detecting mutations of the present invention.

Base sequence of E2017CS-18.

[162] SEQ ID NO: 44 shows a PNA clamping probe for detecting mutations of the present invention.

The base sequence of E2017CAS-21.

[163] SEQ ID NO: 45 shows a PNA clamping probe for mutant detection of the present invention.

The base sequence of E2017CAS-19.

[164] SEQ ID NO: 46 shows a PNA clamping probe for mutant detection of the present invention.

The base sequence of E2017CAS-18.

[165] SEQ ID NO: 47 shows a PNA clamping probe for mutant detection of the present invention.

The base sequence of E2016CS-21-1.

[166] SEQ ID NO: 48 shows PNA clamping probe for mutation detection of the present invention.

The base sequence of E2016CS-21-2.

[167] SEQ ID NO: 49 is a PNA clamping probe for mutant detection of the present invention.

Base sequence of E2016CS-20-1.

[168] Sequence Listing 50 shows PNA clamping probes for detecting mutations of the present invention.

The base sequence of E2016CS-19-1.

[169] SEQ ID NO: 51 shows a PNA clamping probe for detecting mutations of the present invention.

The base sequence of E2016CS-21-3.

[170], SEQ ID NO: 52 shows a PNA clamping probe for detecting mutations of the present invention. The base sequence of E2016CS-21-4.

[171] SEQ ID NO: 53 shows a PNA clamping probe for detecting mutation 0 of the present invention.

The base sequence of E2016CS-20-2.

172] SEQ ID NO: 54 shows a PNA clamping probe for detecting a mutation of the present invention.

The base sequence of E2016CS-19-2.

SEQ ID NO: 55 shows a PNA clamping probe for detection of mutations of the present invention.

The base sequence of E2016CS-18-I.

SEQ ID NO: 56 shows a PNA clamping probe for detecting a mutation of the present invention.

The base sequence of E2016CS-18-2.

: 175; SEQ ID NO. 57 mutation in eunbon invention ο ^'PNA clamping probe for detecting

The base sequence of E2016CS-17-4.

SEQ ID NO: 58 shows a PNA clamping probe for the detection of a mutation of the present invention.

The base sequence of E2016CS-17-2.

SEQ ID NO: 59 shows a PNA clamping probe for detecting a mutation of the present invention.

The base sequence of E2016CS-16-1.

178] SEQ ID NO: 60 is a PNA clamping probe for mutant detection of the present invention.

Base sequence of S768ICS-21.

179] SEQ ID NO: 6 shows a PNA clamping probe for mutation detection of the present invention.

Base sequence of S768ICS-20.

SEQ ID NO: 62 shows a PNA clamping probe for mutant detection of the present invention.

Base sequence of S768ICS-19.

181] SEQ ID NO: 63 shows a PNA clamping probe for mutant detection of the present invention.

The base sequence of S768ICAS-21.

182] SEQ ID NO: 64 is a PNA clamping probe for mutant detection of the present invention.

Base sequence of S768ICAS-20.

183] SEQ ID NO: 65 shows a PNA clamping probe for mutant detection of the present invention.

The base sequence of S768ICAS-19.

184] SEQ ID NO: 66 is a PNA clamping probe for mutation detection of the present invention.

The base sequence of T79 () MCS-21-1.

185] SEQ ID NO: 67 shows a PNA clamping probe for detecting a mutation of the present invention.

The base sequence of T790MCS-20-1.

186] SEQ ID NO: 68 is a PNA clamping probe for mutant detection of the present invention.

Base sequence of T790MCS-20-2.

187] SEQ ID NO: 69 is a PNA clamping probe for mutant detection of the present invention.

The base sequence of T790MCS-19-1.

188] SEQ ID NO: 70 is a PNA clamping probe for mutation detection of the present invention.

The base sequence of T790MCS-19-2.

189] Sequence Listing is a PNA Clamping Probe for Mutation Detection of the Invention The base sequence of T790MCS-19-3.

[190] SEQ ID NO: 72 is a PNA clamping probe for detection of mutation 0 of the present invention.

The base sequence of T790MCS-18-1.

[191] SEQ ID NO: 73 is a PNA clamping probe for detection of mutation 0 of the present invention.

The base sequence of T790MCS-18-2.

[192] SEQ ID NO: 74 is a PNA clamping probe for detecting mutation 0 of the present invention.

The base sequence of T790MCS-17-1.

[193] SEQ ID NO: 75 shows a PNA clamping probe for detecting mutation 0 of the present invention.

The base sequence of T790MCAS-21-1.

[194] SEQ ID NO: 76 shows a PNA clamping probe for the detection of a mutation ^' of the present invention.

The base sequence of T790MCAS-20-1.

[195] Seo ^ List 77 shows PNA clamping probes for detecting mutations of the present invention.

Base sequence of T790MCAS-20-2.

[196] SEQ ID NO: 78 shows a PNA clamping probe for the detection of mutants of the present invention.

The base sequence of T790MCAS-19-1.

[197] SEQ ID NO 79 shows a PNA clamping probe for detecting mutations of the present invention.

The base sequence of E21CS-22-1.

[198] SEQ ID NO: 80 shows a PNA clamping probe for mutant detection of the present invention.

E21CS—Based on 21-1.

[199] SEQ ID NO: 81 is a PNA clamping probe for mutant detection of the present invention.

The base sequence of E21CS-22-2.

[200] SEQ ID NO: 82 is a PNA clamping probe for mutant detection of the present invention.

The base sequence of E21CS-20-1.

[201] SEQ ID NO: 83 shows a PNA clamping probe for detecting a mutation of the present invention.

The base sequence of E21CS-20-2.

[202] SEQ ID NO: 84 shows a PNA clamping probe for mutant detection of the present invention.

The base sequence of E21CAS-22-1.

[203] SEQ ID NO: 85 is a PNA clamping probe for mutant detection of the present invention.

The base sequence of E21CAS-21-1.

[204] SEQ ID NO: 86 shows a PNA clamping probe for detecting a mutation of the present invention.

The base sequence of E21CAS-22-2.

[205] SEQ ID NO: 87 is a PNA clamping probe for mutant detection of the present invention.

The base sequence of E21CAS-20-1.

[206] SEQ ID NO: 88 shows a PNA clamping probe for mutant detection of the present invention.

The base sequence of E21CAS-20-2.

[207] SEQ ID NO: 89 shows a PNA clamping probe for mutant detection of the present invention.

The base sequence of E21CAS-19-1.

[208] SEQ ID NO: 90 shows a PNA clamping probe for detecting mutations of the present invention. Nucleotide sequence of E21CAS-19-2.

[209] SEQ ID NO: 91 shows PNA clamping probe for detecting mutations of the present invention.

The base sequence of E21CAS-19-3.

SEQ ID NO: 92 is a base sequence of E19-patent of Comparative Example 1 according to the present invention.

SEQ ID NO: 93 is a nucleotide sequence of T790M-patent of Comparative Example 1 according to the present invention.

SEQ ID NO: 94 is the base sequence of L858R-patent of Comparative Example 1 according to the present invention.

[213] SEQ ID NO: 95 shows the EGFR gene clamping primer of the present invention.

Nucleotide sequence of EGFR-exonl8 / 19-F-1.

[214] Sequence Listing 96 differs from the sequencing sequence of the EGFR gene clamping primer EGFR-exonl8 / 19-R of the present invention.

SEQ ID NO: 97 is the nucleotide sequence of the EGFR gene clamping primer EGFR-exon20-F of the present invention.

[216] Sequence Listing 98 differs from the base sequence of the EGFR gene clamping primer EGFR-exon20-R of the present invention.

SEQ ID NO: 99 is the nucleotide sequence of the EGFR gene clamping primer EGFR-exon21-F of the present invention.

SEQ ID NO: 100 is the base sequence of the EGFR gene clamping primer EGFR-exon21-R of the present invention.

[219] SEQ ID NO: 1 shows the EGFR gene clamping primer E18-B-F of the present invention.

Sequence.

SEQ ID NO: 102 shows the sequence of the EGFR gene clamping primer E18-B-R of the present invention.

Sequence.

SEQ ID NO: 103 is the base sequence of the EGFR gene clamping primer E18 damping of the present invention.

[222] SEQ ID NO: 104 of the EGFR gene clamping primer E19-B-F of the present invention.

Sequence.

SEQ ID NO: 105 shows the sequence of the EGFR gene clamping primer E19-B-R of the present invention.

Sequence.

SEQ ID NO: 106 is the base sequence of the EGFR gene clamping primer E19 clamping F ′ of the present invention.

SEQ ID NO: 107 is a base sequence of the EGFR gene clamping primer E19 clamping F-1 of the present invention.

SEQ ID NO: 108 is the base sequence of the EGFR gene clamping primer E19 clamping F-2 of the present invention.

SEQ ID NO: 109 is the base sequence of the EGFR gene clamping primer E19 clamping F-3 of the present invention.

SEQ ID NO: 110 is a nucleotide sequence of the EGFR gene clamping primer E19 clamping R of the present invention. SEQ ID NO: 111 is the base sequence of the EGFR gene clamping primer E19 clamping F of the present invention.

SEQ ID NO: 112 shows the sequence of the EGFR gene clamping primer E20-B-F of the present invention.

It is fever.

[231] SEQ ID NO: 113 is a fragment of the EGFR gene clamping primer E20-B-R of the present invention.

Sequence.

SEQ ID NO: 114 is a nucleotide sequence of the EGFR gene clamping primer E20 clamping F of the present invention.

SEQ ID NO: 115 is a nucleotide sequence of the EGFR gene clamping primer E20 clamping F-1 of the present invention.

SEQ ID NO: 116 is a nucleotide sequence of the EGFR gene clamping primer E2016 clamping F of the present invention.

SEQ ID NO: 117 is a base sequence of the EGFR gene clamping primer E2016 clamping F-1 of the present invention.

[236] Sequence Listing 118 differs from the sequencing sequence of the EGFR gene clamping primer T79 () M clamping F of the present invention.

SEQ ID NO: 119 is a nucleotide sequence of the EGFR gene clamping primer E2016 clamping F-2 of the present invention.

SEQ ID NO: 120 is a nucleotide sequence of the EGFR gene clamping primer E2017 clamping F of the present invention.

[239] SEQ ID NO: 121 shows the sequence of the EGFR gene clamping primer E21-B-R of the present invention.

Sequence.

SEQ ID NO: 122 is the base sequence of the EGFR gene clamping primer E21 clamping F of the present invention.

[241] Sequence Listing 123 is based on the base sequence of the EGFR gene clamping primer E21 clamping F-1 of the present invention.

Claims

Claim

(1) Exon 18 wild type codon 719, exon 19 wild type codons 746 to 749, exon 20 wild type codons 767 to 771, axon 20 wild type codon 768, exon 20 wild type codon 790, axon 21 wild type codon 858 or 861

In the presence of a set of clamping primers to amplify a site containing nucleotides and a PNA (Peptide Nucleic Acid) clamping probe having a length of 15 to 30mer that completely binds to the wild-type gene floating on each codon site. Performing real-time polymerase chain reaction (PCR) on the cells;

(2) analyzing gene amplification by real-time PCR to determine the presence or absence of mutation or concentration of EGFR gene;

A kinase domain mutation detection method of the EGFR gene, comprising the step.

The method of claim 1,

The mutation detection of the EGFR gene is a kinase domain mutation detection method of the EGFR gene, characterized in that the determination of the presence or concentration of the EGFR gene mutation by measuring the Q (cycle threshold) value of real-time PCR.

The method of claim 1 or 2,

Kinase domain mutations in the EGFR gene include substitution of axon 18 G719X; Deletion or deletion and substitution of axon 19; Insertion of axon 20, substitution of S768I or T790M; Axon 21 L858R or L861Q substitution; kinase domain mutation detection method of the EGFR gene, characterized in that at least one selected from.

The kinase domain mutation detection method according to claim 1 or 2, wherein the PNA clamping probe of step (1) consists of a sequence of 16 to 27mer in length.

The method of claim 4,

The PNA clamping probe of step 0) is any one selected from SEQ ID NOs: 1 to 91. Kinase domain mutation detection method of the EGFR gene.

The method according to claim 1 or 2,

The EGFR gene clamping primer set of step (1) is EGFR gene exon 18 wild type codon 719, axon 19 wild type codon 746 to 749, exon 20 wild type codon 767 to 771, exon 20 wild type codon 768, Exon 20 wild type codon 790, exon 21 wild type codon 858 or 861

A method for detecting a kinase domain mutation of an EGFR gene, comprising a forward primer that specifically binds to an upstream portion.

7. The method of claim 6,

The EGFR gene clamping primer set includes a kinase domain mutation detection method of the EGFR gene, characterized in that it comprises any one or more primers selected from SEQ ID NO: 103, 106 to 109, 114 to 120, 122 and 123 as a forward primer.

8. The method of claim 7, wherein

The EGFR gene clamping primer set comprises a primer of SEQ ID NO: 110 as a reverse primer kinase domain mutation detection method of the EGFR gene.

[Claim 9] The method according to claim 1 or 2,

The method of detecting kinase domain mutation of EGFR gene, characterized in that the mutation detection of the EGFR gene is characterized by analyzing gene amplification using an intercalating fluorescent material.

10. The method of claim 9,

The DNA intercalating fluorescent material is Cyber Green I, Evergreen, Ethidium Bromide (EtBr), BEBO, YO-PRO-1, TO-PRO-3, LC Green, SYTO-9, SYTO-13, SYTO-16 Detection of kinase domain mutations in EGFR genes, characterized by one or more selected from the group consisting of SYTO-60, SYTO-62, SYTO-64, SYTO-82, POPO-3, TOTO-3, BOBO-3 and SYTOX Orange Way .

[Claim 11] The method according to claim 1 or 2,

The detection of mutations in the EGFR gene is for use in the treatment or diagnosis of one or more cancers selected from prostate cancer, breast cancer, colon cancer, pancreatic cancer, ovarian cancer, spleen cancer, testicular cancer, thymic cancer and lung cancer. Method for Detecting Kinase Domain Mutations in.

[Claim 12] Any one PNA clamping selected from SEQ ID NOs: 1 to 91

A kit for use in a kinase domain mutation detection method of the EGFR gene according to claim 5 comprising a probe.