KR101825121B1 - Methods and kits for the PIK3CA mutant detection using PNA mediated Real-time PCR clamping - Google Patents

Abstract

The present invention relates to a method for selectively detecting mutations by inhibiting amplification of wild type using a PNA (Peptide Nucleic Acid) probe that specifically binds to the wild type of PIK3CA gene exon 9 or 20, and a kit for use in the method will be.

Description

Methods and kits for PIK3CA mutation detection using real-time PCR clamping based on PNA [

The present invention relates to the detection of mutations in a PIK3CA (Phosphatidylinositol 3-kinase, catalytic, alpha polypeptide) gene using a peptide nucleic acid probe (hereinafter referred to as 'PNA' Or 20, wherein the PNA probe specifically binding to the wild type inhibits the amplification of the wild type, thereby detecting only a small amount of the mutant type with high sensitivity, and a kit for use in the method.

There have been various studies to detect mutations of various cancer genes and tumor suppressor genes, as the mutation of oncogene and tumor suppressor gene is involved in the development of cancer. Accordingly, many mutations involved in cancer development and drug prognosis determination have been found. Among them, the mutation of the PIK3CA gene leads to the activation of the PI3K (phosphatidylinositol 3-kinase) protein and the PI3K activates the signal transduction system of the tyrosine kinase receptor. Activated tyrosine kinases are involved in the carcinogenesis process by interfering with the function of the protein that inhibits cell survival and cleavage and by promoting the metabolism and activating the function of proteins that help cell growth (Serena Di et al., 2009 Cancer Res. 2009 August 15: 15 (16), 5017-5019). 75% of the PIK3CA gene mutations are found as exons 9, which translate into the helical region of the PI3K protein, and as point mutations, at exon 20, which translates into the kinase region, and sporadically at many other locations (Ligresti G et al., Cell cycle 2009 May 1; 8: 9, 1352-1358). Such PIK3CA gene mutations are found in a wide variety of cancers and have been reported to occur at a rate of 25 to 40% in colon cancer, stomach cancer, lung cancer, pancreatic cancer, head squamous cell carcinoma, glioblastoma, endometrial cancer, ovarian cancer and breast cancer (Exp. Clin. Cancer Res. 2010 Apr 16; 29, 32, Kalinsky K et al., Clin Cancer 2009 Oct; 4 (10): 709-14, Ogino S et al., J Clin Oncol. 2009 Mar 20 ; 27 (9): 1477-84, Oda K et al. Cancer Res., Dec 1, 65 (23): 10669-73). PIK3CA gene mutations accelerate cancer progression and increase the frequency of metastasis, worsening the patient's prognosis. It is also involved in the signal transduction system downstream of the Human Epidermal Growth Factor (HER family) and is known to be involved in the resistance of target therapies of the HER family (Wee S et al., Cancer Res. 2009 Jun 15; 67 (12): 5851-8, Ogino S et al., J Clin Oncol. 2009 Mar 20; 27 (10): 4286-93, Guo XN et al. (9): 1477-84). According to a recent report, the prescription of Herceptin, a type of tyrosine kinase in breast cancer, which amplifies the HER2 gene, is known to improve the prognosis. However, when the mutation of PIK3CA gene is accompanied by the amplification of HER2 gene, Herceptin (O'Brien NA et al., Mol Cancer Ther. 2010 Jun; 9 (6): 1489-502). PI3K is an important factor in the development of therapeutic drugs targeting this disease, and its importance is increasing. Thus, PIK3CA mutation detection is an important predictor of therapeutic efficacy in the target treatment of human epidermal growth factor and may play a decisive role in good prognosis.

The detection methods of PIK3CA mutation include polymerase chain reaction (PCR) followed by sequencing of nucleotide sequences, variation of electrophoretic shift distance according to the difference in three-dimensional conformation of wild type and mutant gene Polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP) method (EI-Habr EA et al., Clin Neuropathol. 2010 Jul-Aug; 29 ): 239-45) have been used. However, since the above methods are a method of detecting mutations through PCR, digestion with restriction enzymes, electrophoresis, and sequence analysis, reaction time is long and troublesome and costly. Despite the fact that it is very important for clinical samples to detect small mutations, it is difficult to detect very small mutations because of the low detection sensitivity, since mutations are often very small compared to wild type.

In order to increase the sensitivity, a high-resolution melting temperature analysis is used to selectively detect mutations using the melting temperature difference between wild type and mutation scorpion Real-time allele specific PCR (DxS 'scorpions® and ARMS®) method, which selectively detects mutations using a scorpion probe, (1994), 54 (4): 757-60). In this study, we have used a single-stranded RNA polymerase from a single cell line (Simi L et al., Am J Clin Pathol. 2008 Aug; 130 (2): 247-53, Board RE et al. This technique can be easily and quickly applied to various diagnoses and is a good technique for diagnosing and analyzing the mutation of cancer-related genes (Bernard et al., Clin Chem 2002 Aug; 48 (8): 1178-85). However, the method described above requires the use of both probes and primers at the sites where mutations occur in order to detect mutations, so that it is troublesome that multiple reactions are required to detect one mutation (Simi L et al., Am J Clin Pathol. 2008 Aug; 130 (2): 247-53, Board RE et al., Clin Chem. 2008 Apr; 54 (4): 757-60).

Recently, a technique for selectively detecting a mutant type, which is different from the above method, is a method of suppressing amplification of a wild-type wild-type using a PNA probe that specifically binds to a wild type, and a PNA clamping ) Technology was developed. PNA was first reported in 1991 as a pseudo-DNA in which the nucleic acid base is linked to the peptide bond rather than the phosphate bond (Nielsen PE et al., Science 1991 Dec 6; 254 (5037): 1497-500). PNAs are synthesized by chemical methods and are not found in nature. PNA forms a double strand by causing a hybridization reaction with a natural nucleic acid of a complementary base sequence. When the number of nucleic acid bases is the same, the PNA / DNA double strand is more stable than the DNA / DNA double strand, and the PNA / RNA double strand is more stable than the DNA / RNA double strand. The basic backbone of peptide nucleic acids is most often used in the case of N- (2-aminoethyl) glycine repeatedly linked by amide bonds as a basic skeleton of PNA. Unlike the basic structure of a negatively charged natural nucleic acid It is electrically neutral. The four nucleobases present in the PNA occupy a space similar to that of the DNA and the distance between the nucleotides is almost the same as that of the native nucleic acid. PNA is chemically more stable than natural nucleic acid and biologically stable because it is not degraded by nucleases or proteases. Since PNA is also electrically neutral, the stability of PNA / DNA, PNA / RNA double strands is not affected by salt concentration. Because of this property, PNAs are better able to recognize complementary nucleic acid sequences than natural nucleic acids and are therefore applicable for diagnostic or other biological and medical purposes. The PNA clamping technology utilizes the advantages of the PNA described above, so that when the PNA probe is perfectly coupled, the enzyme does not recognize the amplification reaction, and when the point mutation is present, the PNA probe does not bind perfectly, It is a method that uses the principle that occurs, and it is widely used because it can detect a mutation which exists in a very small amount compared to a wild type, quickly and accurately.

U.S. Published Patent Application No. 2008/0176226 discloses a method of performing PCR in the presence of a primer set amplifying a selected region of a target nucleic acid and a PNA probe that completely binds to the selected region of the wild type and performing a melting curve analysis on the obtained PCR product Methods and kits for detecting mutations in a target nucleic acid are disclosed. However, the method distinguishes the mutation type by the difference in the melting curve, not the cycle number of the amplification reaction. In addition to the PNA clamping probe, a donor fluorophore and an acceptor capable of detecting fluorescence for measuring the melting curve, A probe having a probe attached thereto is required. As described above, since a large number of fluorescence-labeled probes are detected, the cost for analysis is increased. In addition, the US patent discloses a 17 mer PNA (sensor probe) labeled with fluorescein at the N-terminus and a 44 mer DNA (anchor probe) labeled with LC-Red 640 at the 3'-terminus to detect K- . However, no teaching or suggestion was made for the mutation detection of the PIK3CA gene.

The present inventors have found that by detecting a mutation type only by the amplification cycle difference with the wild type using the PNA clamping probe having a comparatively long length (for example, 15mer or more) with respect to the PIK3A gene, it is easier than the mutation type detection technique using the difference in the melting curve However, PIK3CA mutation detection technology using real-time PCR clamping based on PNA was completed, which enables rapid detection of very small amount of mutations with high sensitivity, by completely inhibiting amplification of a large number of wild-type and improving detection sensitivity of mutant type .

It is an object of the present invention to provide a PIK3CA mutation detection method using PNA-based real-time PCR clamping.

Another object of the present invention is to provide a PIK3CA mutation detection kit using PNA-based real-time PCR clamping.

One aspect of the present invention is

In the presence of a PIK3CA gene clamping primer set amplifying the exon 9 or exon 20 region of the PIK3CA gene and a PNA (Peptide Nucleic Acid) clamping probe completely binding the exon 9 of the PIK3CA gene or the exon 20 of the exon 20, Real-time polymerase chain reaction (PCR);

The gene amplification by real-time PCR is analyzed to determine the presence or concentration of mutations in the PIK3CA gene:

To a method for detecting a mutation of the PIK3CA gene.

In a preferred embodiment of the invention, the C _t (cycle threshold) value of the real-time PCR is measured to determine the presence or concentration of the PIK3CA gene mutation or its concentration.

The PNA clamping probe used in the present invention preferably has a base sequence of 15 to 30 mer, more preferably 17 to 24 mer, and may comprise, for example, any one of the nucleotide sequences of SEQ ID NOS: 1 to 31 .

The PIK3CA gene clamping primer set used in the present invention includes a forward primer that specifically binds to the upstream portion of the PIK3CA gene exon 9 wild type codon 542, 545 or 546, or the exon 20 wild type codon 1047, and a specific primer For example, the forward primer is composed of any one of SEQ ID NOS: 36, 37, 41 and 42, and the reverse primer is composed of any one of SEQ ID NOS: 33, 35 and 38 to 40 .

In the present invention, SYBR Green I, Evergreen, Ethidium Bromide (EtBr), BEBO, YO-PRO-1, TO-PRO -3, LC green, SYTO-9, SYTO-13, SYTO-16, SYTO-60, SYTO-62, SYTO-64, SYTO-82, POPO-3, TOTO-3, BOBO- One or more selected from the group can be used. Any fluorescent material capable of DNA intercalation can be used, and there is no particular limitation.

The method according to the present invention can be used to determine or diagnose the treatment of colorectal cancer, stomach cancer, lung cancer, pancreatic cancer, head squamous cell carcinoma, glioblastoma, endometrial cancer, ovarian cancer or breast cancer.

Another aspect of the present invention is

A PNA clamping probe according to any one of SEQ ID NOS: 1 to 31:

To a kit for use in a method for detecting a mutation of a PIK3CA gene according to the present invention.

According to the present invention, it is possible to detect a mutation of the PIK3CA gene, which is expected to be involved in cancer development, prognosis and drug resistance, to a mutation containing a very small amount of excellent sensitivity and specificity in a short time. In addition, the PNA itself used as a probe is very stable to biological enzymes and physical elements and is very simple to detect and is expected to be very easy to use in mass analysis and clinical use because it is detected within a short time.

1 is a schematic diagram illustrating a PNA-based PCR clamping principle;
FIG. 2 is a graph comparing detection sensitivities (? C _t ) according to probes to select probes detecting PIK3CA exon 9 codon 542 mutations using the PNA probes of SEQ ID NOS: 7 to 11 designed in the present invention;
Figure 3 compares the detection sensitivity ([Delta] _Ct ) according to the probes to select probes that detect the PIK3CA exon 9 codon 545 mutation using the PNA probes of SEQ ID NOS: 12, 13, 14, 16 and 17 designed in the present invention Graph;
FIG. 4 is a graph comparing detection sensitivities (? C _t ) according to probes to select probes that detect PIK3CA exon 20 codon 1047 mutation using the PNA probes of SEQ ID NOS: 1 to 6 designed in the present invention;
5 is a graph comparing detection sensitivities (ΔC _t ) according to sample application amounts using the PNA probes of SEQ ID NOs: 12 and 13 designed in the present invention for cell lines with a PIK3CA exon 9 codon 545 mutation;
FIG. 6 is a graph comparing detection sensitivities (ΔC _t ) according to the mutation-containing concentration using the PNA probe of SEQ ID NO: 4 designed for the cell line having the PIK3CA exon 20 codon 1047 mutation.

The present invention relates to a method for detecting only a small amount of mutant type at a high sensitivity by inhibiting amplification of a wild-type PNA probe that specifically binds to a wild type for mutation detection of exon 9 or 20 of PIK3CA gene and a kit for use in the method . Fig. 1 schematically shows the principle of the method according to the present invention. Specifically, the present invention is for mutation detection of exon 9 or 20 of the PIK3CA gene listed in Table 1 below.

Exon protein amino acid Base sequence Exon9 Helical Gly542Lys 1624 Exon9 Helical Gly545Lys 1633 Exon9 Helical Gly545Gly 1634 Exon9 Helical Gly545Asp 1635 Exon9 Helical Gln546Gly, Gln546Lys 1636 Exon9 Helical Gln546Pro, Gln546Arg 1637 Exon20 Kinase His1047Tyr 3139 Exon20 Kinase His1047Leu, His1047Arg 3140

One. PNA Clamping Of the probe  Design and production

The PNA probes of the present invention are perfectly matched to the wild-type sequence of the region where mutations (including substitution) of PIK3CA exons 9 and 20 occur, and are more than 15, preferably 15 to 30, More preferably 17 to 27 nucleotides, and most preferably 17 to 24 nucleotides. It is preferable that the PNA probe of the present invention is designed such that the wild-type gene region of the portion where the mutation (including substitution) of PIK3CA exons 9 and 20 occurs is located at the center of the probe. For example, the PNA probe of the present invention may comprise a nucleotide sequence of any one of SEQ ID NOS: 1 to 31 shown in Table 2 below. All of the PNA probe sequences within the range that can be easily modified by those skilled in the art from the above base sequence will be considered to be within the scope of the present invention. Using PNA-based real-time PCR clamping according to the present invention Are included within the scope of the present invention as long as the mutation of the PIK3CA gene exons 9 and 20 can be effectively detected only by the amplification cycle difference.

Specifically, SEQ ID NOS: 7 to 11 are probes for inhibiting wild-type amplification and detecting mutations by perfectly binding with the wild type of codon 542 of PIK3CA exon 9. Substitution at codon 542 replaces the guanine at nucleotide 1624 with adenine, displacing the wild-type glutamate at codon 542 with lysine, resulting in a mutation in the helical structural part of the PI3K protein. SEQ ID NOS: 7-11 are designed to specifically hybridize to the 1624th base comprising codon 542 of PIK3CA exon 9. SEQ ID NOS: 9 to 31 are probes for inhibiting wild-type amplification and detecting mutations by perfectly binding with the wild type of codon 545 portion of PIK3CA exon 9. The substitution at codon 545 is such that the guanine at nucleotide 1633 is replaced with adenine, so that the wild-type glutamate at codon 545 is replaced by lysine, the adenine at nucleotide 1634 is replaced by guanine, and the wild-type glutamate at codon 545 is replaced by glycine, And that the guanine of nucleotide 1635 is substituted with thymine to replace the wild-type glutamic acid of codon 545 with aspartic acid. SEQ ID NOS: 1 to 6 are designed to specifically hybridize to the 3140th base containing codon 1047 of exon 20. SEQ ID NOS: 1 to 6 are probes for inhibiting the amplification of the wild-type and detecting the mutation by perfectly binding with the wild type of codon 1047 of PIK3CA exon 20. Substitution at codon 1047 is such that the adenine of nucleotide 3140 is replaced by guanine or thymine and the wild-type histidine at codon 1047 is replaced by arginine or leucine to mutate the kinase portion of the PI3K protein.

SEQ ID NO: name The sequence (5 '- > 3') Length One H1047-1 AATTATGCACATCATGGTGGC 21 2 H1047-2 AATTATGCACATCATGGTGGCT 22 3 H1047-3 GATTCACATCATGGTGGC 18 4 H1047-4 ATTATGCACATCATGGTGGC 20 5 H1047-5 TTATGCACATCATGGTG 17 6 H1047-6 ATTCACATCATGGTGGC 17 7 E542-1 ATCCTCTCTCTGAAATCACTGA 22 8 E542-2 TCTCTGAAATCACTGAGCAG 20 9 E542_E545-1 CCTCTCTCTGAAATCACT 18 10 E542_E545-2 GATCCTCTCTCTTGAAATCACT 21 11 E542_E545-3 ATCCTCTCTCTGAAATCACTG 21 12 E545 / 546-1-as TCTTTCTCCTGCTCAGTSATTT 22 13 E545 / 546-2-as TCTTTCTCCTGCTCAGTSATTTAG 24 14 E545 / 546-3-as TTTCTCCTGCTCAGTSATTT 20 15 E545 / 546-4-s CTTAAATCACTGAGCAGGA 19 16 E545 / 546-5-s AATCACTGAGCASSAGA 17 17 E545 / 546-6-s TCTTAAATCACTGAGCAGG 19 18 E545 / 546-7-s AAATCACTGAGCAGGAGAAA 20 19 E545 / 546-8-s AAATCATTGAGCAGGAGAAA 20 20 E545 / 546-9-s AAATCACTGASCAGGAGAAA 20 21 E545 / 546-10-s AAATCACTGASCAGSAGAAA 20 22 E545 / 546-11-as TTCTCCTGCTCAGTGATTT 19 23 E545 / 546-12-as TTTCTCCTGCTCAGTGATTTTAG 23 24 E545 / 546-13-as CTTTCTCCTGCTCAGTGATTT 21 25 E545 / 546-14-as TCTTTCTCCTGCTCATTGATTT 22 26 E545 · 546-15-as AATCTTTCTCCTGCTCATTGATTT 24 27 E545 / 546-16-as TCTTTCTCCTGCTCAGTGATTT 22 28 E545 / 546-17-s AAATCACTGAGCAGGAGAAAGA 22 29 E545-1-as TTCTCCTGCGCAGTGATTT 19 30 E545-2-as TTTCTCCTGCGCAGTGATTTTAG 23 31 E545-3-as CTTTCTCCTGCGCAGTGATTT 21

The PNA probes of the present invention may comprise hydrophilic functional groups at the N-terminal or C-terminal to increase the reaction efficiency and solubility, for example, at the N-terminal or C-terminal May include one or more hydrophilic linkers, amino acids, or amine groups [Shakeel et al., J. Chem. Technol. Biotechnol., 2006, 81, 892-899; Gildea et al., Tetrahedron Lett., 1998, 39, 7255-7258; Demidov et al., PNAS, 2002, 99, 5953-5958; Wang et al., Anal. Chem., 1997, 69, 5200-5202]. Specifically, in the present invention, a probe having one lysine at the N-terminus or one lysine at the N-terminus and the C-terminus was used.

The PNA oligomer used in the present invention is a PNA monomer protected with a Bts (Benzothiazolesulfonyl) group according to the method of Korean Patent No. 464,261 or a PNA monomer protected with a known Fmoc (9-flourenylmethloxycarbonyl) or t-Boc (t-butoxycarbonyl) (2005), Thomson et al., Tetrahedron 51 (19): 5767-5773, 1994; Christensen J peptide Sci 1 (22): 6179-6194, 1995).

2. PIK3CA  gene Clamping Primer  Design and production

In the present invention, the term "PIK3CA gene clamping primer" refers to a primer for amplifying a mutant gene which suppresses the amplification of a wild-type gene perfectly bound to a PNA probe and is not perfectly bound to a PNA probe (that is, PCR primer. The clamping primer of the present invention is not particularly limited, but in order to detect a mutation with higher sensitivity and specificity, a PNA probe is partially overlapped with the PNA probe in one direction with respect to the PNA clamping probe, But it is desirable to devise the PCR amplification product considering the size of the PCR amplification product. Also, considering the T _m with the PNA probe, the length is between 17mer and 30mer, preferably lower than the T _m of the PNA probe. To maximize diagnostic sensitivity and specificity, it is desirable to design the PNA clamping probe sequence that combines complementarily with the wild type to include the immediate front of the nucleotide at which the mutation occurs. According to a specific example, a clamping primer was designed such that the PNA probes of SEQ ID NOS: 1 to 31 and 5 to 12 nucleotide sequences overlap. The forward primer of SEQ ID NO: 36 exemplified in the present invention is designed to specifically recognize the upstream partial base of codon 542 of PIK3CA gene exon 9 of SEQ ID NOS: 7-11. The reverse primer of SEQ ID NO: 33 in combination with the forward primer of SEQ ID NO: 36 exemplified in the present invention was designed to specifically recognize the 61 to 80 bases of the PIK3CA gene intron 9 region. The reverse primers of SEQ ID NOS: 39 and 40 were designed to specifically recognize the downstream partial bases of codons 545 and 546 of the PIK3CA gene exon 9 of SEQ ID NOS: 9-31. The forward primer of SEQ ID NO: 37 in combination with the reverse primers of SEQ ID NOs: 39 and 40 exemplified in the present invention was designed to specifically recognize the 32 to 59 bases of the PIK3CA gene exon 9. The forward primers of SEQ ID NOS: 41 and 42 were designed to specifically recognize upstream bases of codon 1047 of PIK3CA gene exon 20 of SEQ ID NOS: 1-6. The reverse primer of SEQ ID NO: 35 in combination with the forward primers of SEQ ID NOS: 41 and 42 exemplified in the present invention was designed to specifically recognize the 9th to 29th bases of the PIK3CA gene intron 21 region. The length of primers ranged from 20mer to 28mer so that the amplification product of the primer combination was 50bp to 500bp in size.

Meanwhile, the forward primer of SEQ ID NO: 32 provided in the present invention was designed to specifically recognize the -63 to -44 base of the PIK3CA gene intron 8 region in order to identify the gene by sequencing the exon 9 of the PIK3CA gene , And the reverse primer combined with the primer is SEQ ID NO: 33, which is designed to specifically recognize 61 to 80 bases of the PIK3CA gene intron 9 site. These primers were designed to combine to give an amplified product size of 269 bp. In order to identify the gene through sequence analysis of exon 20 of PIK3CA gene, the forward primer of SEQ ID NO: 34 provided in the present invention was designed to specifically recognize the 69th to 88th bases of PIK3CA gene exon 20 region, Is SEQ ID NO: 35 and is designed to specifically recognize the 9th to 29th bases of the PIK3CA gene intron 21 region. These primers were designed to combine to give a size of amplified product of 202 bp. The properties of each primer are summarized in Table 3 below.

order
number part location name direction The sequence (5 '- > 3') Length 32 Intron 8 -63 to -44 E542 / 545-F Forward CTGTGAATCCAGAGGGGAAA 20 33 Intron 9 61 to 80 E542, 545-R Reverse ACATGCTGAGATCAGCCAAA 20 34 Exxon 20 69 to 88 H1047-F Forward CTCAATGATGCTTGGCTCTG 20 35 Intron 21 9-29 H1047-R Reverse TCAGTTCAATGCATGCTGTTT 21 36 Exon 9 59 to 73 E542K clamp-F Forward CAATTTCTACACGAGATCCTCTCTC 25 37 Exon 9 32 ~ 59 E545F2 Forward GGGAAAATGACAAAGAACAGCTCAAAGC 28 38 Exon 9 86 ~ 109 E542 clamp-R2 Reverse AATCTTTCTCCTGCTCAGTGATTT 24 39 Exon 9 97-120 E545 clamp-R3 Reverse ACTCCATAGAAAATCTTTCTCCTG 24 40 Exon 9 99 ~ 122 E546 clamp-R4 Reverse TGACTCCATAGAAAATCTTTCTCC 24 41 Exxon 20 240 ~ 262 H1047RL clamp-F Forward CATGAAACAAATGAATGATGCAC 23 42 Exxon 20 240 ~ 261 H1047YRL clamp-F Forward CATGAAACAAATGAATGATGCA 22

3. PNA  Based real-time PCR Clamping  Used PIK3CA  Mutation detection

The PIK3CA gene mutation detection method according to the present invention

(a) performing a real-time PCR on the PIK3CA gene in the presence of a PIK3CA gene clamping primer set and a PNA clamping probe; And

(b) analyzing gene amplification by the real-time PCR to determine the presence or the concentration of mutation of PIK3CA gene;

.

The PIK3CA gene used in step (a) is prepared by extraction from the subject sample. In the present invention, there is no particular limitation on nucleic acid extraction. Any nucleic acid extraction method generally used can be used. DNA is extracted from a patient's blood or tumor sample using a commercially available nucleic acid extraction kit or the like.

In step (a), a mutation of the PIK3CA gene is detected using a real-time PCR method. Real-time PCR method can provide more accurate quantitative analysis it is indicated in an exponential amplification takes place can the amount of the initial sample of the cycles for the exponential increase in the fluorescent material starts to be detected (hereinafter referred to as Cycle threshold, less than 'C _t'), and The reaction can be analyzed in real time. This method is a method to quickly and easily diagnose the amplification product by omitting the step of measuring the intensity with the image analyzer by electrophoresis and automating and quantifying the amplification degree of the amplification product.

It is preferred in the present invention that the PNA clamping probe among the reagents of the real-time PCR clamping has a final concentration of 1 to 1000 nM.

In the present invention, fluorescence is detected using an intercalating method. In this method, a fluorescence label is intercalated into amplified double-stranded DNA and fluorescence is emitted. By measuring the fluorescence intensity at this time, And the amount of product produced is measured. This allows detection of mutations in the PIK3CA gene with high sensitivity and specificity without application of any primers to any PCR instrument.

In the present invention, a DNA-binding fluorophore used in a real-time gene detection method is used as a fluorescent substance for identifying a gene amplification product, and there is no particular limitation on its kind. For example, in addition to SYBR Green I, Evergreen, Ethidium Bromide (EtBr), BEBO, YO-PRO-1, TO-PRO-3, LC Green, SYTO-9, SYTO-13, SYTO- (Gudnason et al., Nucleic Acids Res. 2007; 35 (19): e127, 2004) can be used, such as SYTO-62, SYTO-64, SYTO-82, POPO-3, TOTO-3, BOBO- Bengtsson et al., Nucleic Acids Res 2003; 31 (8): e45; Wittwer et al., Clinical Chemistry 49 (6): 853-860).

In step (b), the presence or absence of mutation or the concentration of PIK3CA gene is analyzed by analyzing gene amplification by real-time PCR in step (a), and the presence or absence of mutation of PIK3CA gene can be confirmed by comparing amplified C _t values. When a PNA probe designed to hybridize with a wild-type gene hybridizes to the PIK3CA mutant codon gene region and inhibits amplification, the amplification is inhibited and the C _t value is high. On the other hand, mutations in the PIK3CA mutation codon region are not hybridized with the PNA probe and amplified, resulting in a lower C _t value. In C _t values obtained from a positive control sample to determine the value of C _t obtained by subtracting △ C _t values obtained from a sample of the unknown to verify the presence of each mutant codon (see equation 1).

[Equation 1]

C _t = C _t value obtained from the positive control sample - C _t value obtained from the unknown sample

[Positive control sample: wild-type gene sample]

The larger the amount of the mutant gene is, the lower the C _t value is. Therefore, it can be judged that the larger the difference ΔC _t , the larger the mutation is contained.

The PIK3CA mutation detection method using the PNA-based real-time PCR clamping of the present invention is useful for the screening of tumors such as gastric cancer, lung cancer, pancreatic cancer, squamous cell carcinoma, glioblastoma, endometrial cancer, ovarian cancer and breast cancer including colon cancer And can be very useful in studying not only tumor studies but also mechanisms involved in the PIK3CA signaling pathway. It can also be effectively applied to studies that require large amounts of sample analysis, such as population-based studies.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the present invention is not intended to limit the scope of the present invention in any way.

Example 1: Synthesis of PNA probes to suppress amplification of codons 542, 545 and 1047 wild-type present in PIK3CA exons 9 and 20

Exon 9 of the PIK3CA gene Twenty-eight PNA probes were prepared as shown in Table 2, which perfectly bind to the wild type of codons 542 and 545 and exon 20 codon 1047, respectively. Probes that are perfectly bound to the wild type of each codon are designed so that the base sequence in which the mutation occurs is located in the middle of the probe for effective isolation from the mutation. PNA probes were synthesized according to the method described in Korean Patent No. 464,261 (Lee H et al., Org Lett 2007 Aug 16; 9 (17): 3291-3).

Example 2: Primer synthesis for target nucleic acid amplification and clamping PCR of PIK3CA exons 9 and 20

For amplification and clamping PCR of the target nucleic acids of PIK3CA exons 9 and 20, exons 9 and 20 of the PIK3CA gene were analyzed to prepare primers. Primers set forth in SEQ ID NOS: 32 and 33 for identifying wild type and mutant genes of PIK3CA exon 9, and primers set forth in SEQ ID NO: 36 were synthesized as clamping primers for PIK3CA exon 9 codon 542. The reverse primer used in the clamping of exon 9 codon 542 was the same as the reverse primer of SEQ ID NO: 33 designed to identify the gene of PIK3CA exon 9. SEQ ID NOS: 39 and 40 were synthesized as clamping primers of PIK3CA exon 9 codon 545 and primers of SEQ ID NO: 37 were used as the forward primer used for clamping Exon 9 codon 545. Primers set forth in SEQ ID NOS: 34 and 35 for identifying wild-type and mutant genes of PIK3CA exon 20 and primers set forth in SEQ ID NOS: 41 and 42 were synthesized as clamping primers for exon 20 codon 1047, respectively. The reverse primer used in the clamping of exon 20 codon 1047 was the same as the reverse primer of SEQ ID NO: 35 designed to identify the gene of PIK3CA exon 20. The sequences of primers used are shown in Table 3 above. The primer was synthesized by asking Bioneer (Korea).

Example 3: Mutagenesis and cloning to produce target nucleic acids of PIK3CA exons 9 and 20

Using the whole human DNA, the primer set of SEQ ID NOS: 32 and 33 and the primer sets of SEQ ID NOs: 34 and 35 were used to amplify the PIK3CA exon 9 and 20 part gene. The amplified nucleic acid was ligated to a pGEM-T isotype vector (Promega, USA) and transformed into E. coli JM 109 cells to obtain a large amount of DNA. To obtain a clone having a mutation gene, a mutagenic primer was prepared using a normal clone prepared by the above method, and a clone having a mutant gene was obtained using a site-specific mutagenesis kit (Stratagene, USA). The obtained clones were identified by sequencing.

Example 4: Nucleic acid extraction from wild-type and mutant cell lines of PIK3CA exons 9 and 20

To obtain the wild type and mutant target nucleic acids of PIK3CA exon 9 and 20, cell lines were distributed from Korean cell line bank. HT29 (genomic DNA) human colon cancer cell line [KCLB30038, Korea Cell Line Bank (KCLB), Seoul, Korea] was distributed as a wild type cell line. The mutant cell lines shown in Table 4 below were also sold from the Korean Cell Line Bank.

KCLB No . Mutation Exon Cell name origin 30038 Wild type HT29 Colon cancer 000601 E542K Exon 9 SNU601 Gastric cancer 30022 E545K Exon 9 MCF7 Breast cancer 10247 H1047R Exxon 20 HCT116 Colon cancer

The cells were washed twice with 10% heat-inactivated fetal bovine serum (FBS, Hyclone, Thermo scientific, USA) and 1 × penicillin-streptomycin (WelGENE, Korea) in RPMI1640 (Hyclone, Thermo scientific, USA) ) Was added to the culture medium in an incubator maintained at 37 ° C and 5% carbon dioxide (CO ₂ ). The cultured cell line was extracted with a High Pure PCR Template Preparation Kit (Roche, USA) according to the manual provided in the kit to obtain a target nucleic acid. The obtained nucleic acid was quantified using a nano-drop spectrophotometer (ND 2000C, Thermo Scientific, USA) and stored at -20 ° C. The whole DNA separated from the human cell line was amplified by applying the primer sets of SEQ ID NOs: 32 and 33 and the primer sets of SEQ ID NOS: 34 and 35 described in Table 3 above to the PIK3CA exon 9 and 20 portion gene. The amplified PCR product was purified using Labopass ™ PCR purification kit (Kosomjin Tech, Korea) and sequenced to confirm the genotype. The wild-type and mutant cell lines identified as genotypes were used as a sample of a real-time PCR method using the PNA probe of the present invention .

Example  5: PIK3CA  Exon 9 for codon 542 PNA The probe  Real time PCR  Clamping method establishment

Using the plasmid DNA extracted from the clone in Example 3 and the DNA extracted from the cell line in Example 4, RT-PCR clamping was performed under the following conditions to make PNA probes for mutation of the PIK3CA gene to compare the differences To find an optimal PNA probe. 1 μl of the plasmid DNA solution extracted from the clone or 1 μl of the template DNA solution (50 ng / μl) extracted from the cell line, 1 μl of 1 clamping sense primer (10 pmole / μl) shown in Table 3, 10 μl of the antisense primer 1 μl of the probe shown in Table 2, 1 μl of 1 clamping probe (100 nM) of the probes shown in Table 2, 10 μl of 2 × IQ Sybr Green Super Mix (Bio-Rad, USA) and 6 μl of distilled water were added, The reaction was carried out at 95 ° C for 3 minutes using a CFX96 ™ Real-Time PCR System (Bio-RAD), followed by a 30 second reaction at 95 ° C and a 20 second reaction at 70 ° C where PNA could be hybridized. 30 sec, and 72 < 0 > C for 30 sec were repeated 40 times. Fluorescence was measured at the 72 ° C polymerization stage.

The effect of inhibiting the amplification of the codon 542 wild-type of exon 9 and detecting the mutation was confirmed by applying two sets of primers (SEQ ID NOS: 33 and 36, and SEQ ID NOS: 37 and 38) The results are shown in Fig. As shown in FIG. 2, all of SEQ ID NO: 7 showed excellent effects in forward clamping using SEQ ID NO: 33 and SEQ ID NO: 36, and the probes of SEQ ID NO: 8 to 10 were superior in reverse clamping using SEQ ID NOS: 37 and 38 Effect.

Among the probes of SEQ ID NOS: 9 to 31, SEQ ID NOS: 12, 13, 14, 16 and 17 were applied to inhibit the amplification of the codon 545 wild-type of exon 9 and the mutation was detected. As shown in FIG. All of the applied probes exhibit excellent effects, and in particular, the probes of SEQ ID NOs: 12 and 13 have been found to exhibit superior effects in detecting various mutations.

The effect of inhibiting the amplification of the codon 1047 wild-type of exon 20 and detecting the mutation was confirmed by applying the probes of SEQ ID NOs: 1 to 6 in FIG. As shown in Fig. 4, the probes of SEQ ID NOS: 1, 2 and 4 showed excellent effects, and in particular, the probes of SEQ ID NO: 4 showed more excellent effects.

Example 6: Mutation detection of PIK3CA gene by real-time PCR clamping method using PNA probe

5 ng, 2.5 ng, 1 ng, 0.1 ng, 0.05 ng and 0.01 ng of the mutant gene were prepared in the wild type gene using the real-time PCR method established in Example 5, The correlation between _t values was analyzed and the detection limit of the mutant type was confirmed.

FIG. 5 shows the results of comparing detection sensitivities (ΔC _t ) according to the application amounts of the PNA probes of SEQ ID NOs: 12 and 13 in a cell line having a PIK3CA exon 9 codon 545 mutation. As shown in FIG. 5, as the amount of the mutant gene increases, the C _t value indicating the number of times the fluorescence reaches the threshold value is constantly decreased (that is, the C _t value is increased), and the amount of the mutant gene and the C _t value And the correlation between the two.

FIG. 6 shows the results of comparing the detection sensitivity (ΔC _t ) according to mutation-containing concentration using a PNA probe of SEQ ID NO: 4 in a cell line having a PIK3CA exon 20 codon 1047 mutation. As shown in FIG. 6, there was a correlation between the relative concentration of the mutant gene and the C _t value, as the relative concentration of the mutant gene increased, resulting in a constant decrease in the C _t value (i.e., an increase in the ΔC _t value). In addition, it was confirmed that the presence or absence of a mutation present at 0.1% can be detected using the method of the present invention.

<110> Panagene, Inc. <120> Methods and kits for the PIK3CA mutant detection using          PNA-mediated Real-time PCR clamping <160> 42 <170> Kopatentin 1.71 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 1 aattatgcac atcatggtgg c 21 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 2 aattatgcac atcatggtgg ct 22 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 3 gattcacatc atggtggc 18 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 4 attatgcaca tcatggtggc 20 <210> 5 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 5 ttatgcacat catggtg 17 <210> 6 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 6 attcacatca tggtggc 17 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 7 atcctctctc tgaaatcact ga 22 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 8 tctctgaaat cactgagcag 20 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 9 cctctctctg aaatcact 18 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 10 gatcctctct ctgaaatcac t 21 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 11 atcctctctc tgaaatcact g 21 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 12 tctttctcct gctcagtsat tt 22 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 13 tctttctcct gctcagtsat ttag 24 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 14 tttctcctgc tcagtsattt 20 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 15 cttaaatcac tgagcagga 19 <210> 16 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 16 aatcactgag cassaga 17 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 17 tcttaaatca ctgagcagg 19 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 18 aaatcactga gcaggagaaa 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 19 aaatcattga gcaggagaaa 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 20 aaatcactga scaggagaaa 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 21 aaatcactga scagsagaaa 20 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 22 ttctcctgct cagtgattt 19 <210> 23 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 23 tttctcctgc tcagtgattt tag 23 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 24 ctttctcctg ctcagtgatt t 21 <210> 25 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 25 tctttctcct gctcattgat tt 22 <210> 26 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 26 aatctttctc ctgctcattg attt 24 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 27 tctttctcct gctcagtgat tt 22 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 28 aaatcactga gcaggagaaa ga 22 <210> 29 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 29 ttctcctgcg cagtgattt 19 <210> 30 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 30 tttctcctgc gcagtgattt tag 23 <210> 31 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 31 ctttctcctg cgcagtgatt t 21 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 32 ctgtgaatcc agaggggaaa 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 33 acatgctgag atcagccaaa 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 34 ctcaatgatg cttggctctg 20 <210> 35 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 35 tcagttcaat gcatgctgtt t 21 <210> 36 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 36 caatttctac acgagatcct ctctc 25 <210> 37 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 37 gggaaaatga caaagaacag ctcaaagc 28 <210> 38 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 38 aatctttctc ctgctcagtg attt 24 <210> 39 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 39 actccataga aaatctttct cctg 24 <210> 40 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 40 tgactccata gaaaatcttt ctcc 24 <210> 41 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 41 catgaaacaa atgaatgatg cac 23 <210> 42 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 42 catgaaacaa atgaatgatg ca 22

Claims (11)

A PIK3CA gene clamping primer set that amplifies the exon 9 or exon 20 region of the PIK3CA (phosphatidylinositol 3-kinase, catalytic, alpha polypeptide) gene, and a wild type of exon 9 or exon 20 of the PIK3CA gene, Real-time polymerase chain reaction (PCR) was performed on the PIK3CA gene in the presence of a PNA (Peptide Nucleic Acid) clamping probe consisting of any one of the nucleotide sequences of SEQ ID NOS: 1 to 31, Perform;
Gene amplification by real-time PCR is performed by analyzing gene amplification to determine the presence or level of mutation of the PIK3CA gene:
RTI ID = 0.0 &gt; PIK3CA &lt; / RTI &gt; gene. The method according to claim 1, wherein the mutation detection or the concentration of the PIK3CA gene is determined by measuring the C _t (cycle threshold) value of the real-time PCR. delete delete delete 3. The method according to claim 1 or 2, wherein the PIK3CA gene clamping primer set comprises a forward primer that specifically binds to an upstream portion of PIK3CA gene exon 9 wild type codon 542, 545 or 546, or exon 20 wild type codon 1047, A reverse primer that specifically binds to the PIK3CA gene. The mutation detection method of PIK3CA gene according to claim 6, wherein the forward primer comprises any one of SEQ ID NOS: 36, 37, 41 and 42, and the reverse primer comprises any one of SEQ ID NOS: 33, 35 and 38 to 40 . 3. The method according to claim 1 or 2, wherein gene amplification is analyzed using a DNA intercalating fluorescent substance. 9. The DNA intercalating phosphor according to claim 8, wherein the DNA intercalating phosphor is selected from the group consisting of SYBR Green I, Evergreen, Ethidium Bromide (EtBr), BEBO, YO-PRO-1, TO- Which is at least one selected from the group consisting of SYTO-13, SYTO-16, SYTO-60, SYTO-62, SYTO-64, SYTO-82, POPO-3, TOTO-3, BOBO- Mutation detection method of gene. Use of a PIK3CA gene for the determination or diagnosis of the treatment of colon cancer, stomach cancer, lung cancer, pancreatic cancer, head squamous cell carcinoma, glioblastoma, endometrial cancer, ovarian cancer or breast cancer. Mutation detection method. A PNA clamping probe according to any one of SEQ ID NOS: 1 to 31:
Or a mutation of the PIK3CA gene.

Images