KR101875199B1 - Methods and kits for the detection of BCR-ABL fusion gene mutant using PNA mediated Real-time PCR clamping - Google Patents

Abstract

The present invention relates to a method for selectively detecting mutations by inhibiting wild-type amplification using a PNA (Peptide Nucleic Acid) probe that specifically binds to the 315 wild-type codon (T315) of ABL gene exon 6 among the BCR-ABL fusion gene And a kit for use in the method.

Description

Methods and kits for detecting mutations in the BCR-ABL fusion gene using real-time PCR clamping based on PNA [

The present invention relates to the detection of a mutation in a BCR-ABL fusion gene using a peptide nucleic acid probe (hereinafter referred to as 'PNA'), and more particularly, A PNA probe specifically binding to a wild type for mutation detection suppresses wild type amplification, thereby detecting only a small amount of mutant type with high sensitivity, and a kit for use in the method.

There have been various studies to detect mutations of various cancer genes and tumor suppressor genes, as the mutation of oncogene and tumor suppressor gene is involved in the development of cancer. Accordingly, many mutations involved in cancer development and drug prognosis determination have been found.

BCR-ABL is a gene in which genes present on other chromosomes are fused, and is a type of tyrosine kinase gene. That is, the BCR gene located in the long arm of chromosome 22 and the ABL gene located in the long arm of chromosome 9 are mutually translocated and the ABL gene is fused to the long arm of chromosome 22 and the BCR-ABL fusion gene is present (Nowell PC et al., Science 1960; 132: 1497, Rowley JD et al., Nature 1973; 243: 293). The Philadelphia chromosome is found in more than 90% of patients with chronic myeloid leukemia (CML), and is also found in other myeloid leukemias. The Philadelphia chromosome, the BCR-ABL fusion gene, has been reported several times in relation to the development and progression of chronic myelogenous leukemia. Based on these results, target therapy is being performed to inhibit the progression of chronic myelogenous leukemia by inhibiting the expression of the BCR-ABL fusion gene. As a target therapeutic agent, imatinib (Gleevec) is representative. The principle of this drug inhibits BCR-ABL tyrosine kinase activity by inhibiting binding with ATP which leads to activation of BCR-ABL tyrosine kinase produced by expression of BCR-ABL gene Inhibit the system that eventually leads to cancer cell growth by the signaling pathway by the BCR-ABL tyrosine kinase. Mutations in the kinase domain region of the BCR-ABL gene cause drug resistance (Druker BJ et al., Nat Med. 1996; 2: 561-6). A single amino acid substitution (Thr315Ile, T315I) from the ATP-binding forget of the c-ABL kinase domain to the isoleucine of threonine has been suggested to be associated with acquired resistance to imatinib (Gorre ME et al. Science 2001; 293: 876-80). Thus, mutation in the kinase domain of the BCR-ABL gene, particularly T315I, is an important predictor of therapeutic efficacy in treating this target and can play a decisive role in good prognosis.

Methods for detection of BCR-ABL mutations include polymerase chain reaction (PCR) followed by sequencing of nucleotide sequences, electrophoretic shifts according to the difference in the three-dimensional conformation of wild-type and mutant genes Polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP) has been used as a method for detection through mutation (EI-Habr EA et al., Clin Neuropathol. 2010 ; 29 (4): 239-45). However, since the above methods are a method of detecting mutations through PCR, digestion with restriction enzymes, electrophoresis, and sequence analysis, reaction time is long and troublesome and costly. Despite the fact that it is very important to detect small mutations in a clinical sample, it is difficult to detect very small amounts of mutations because of the low detection sensitivity, since mutations are often very small compared to wild type (EI -Habr EA et al., Clin Neuropathol. 2010; 29 (4): 239-45).

In order to increase the sensitivity, a high-resolution melting temperature analysis is used to selectively detect mutations using the melting temperature difference between wild type and mutation scorpion Real-time allele specific PCR (DxS 'scorpions® and ARMS®) method, which selectively detects mutations using a scorpion probe, 2008); 54 (4): 757-60). In the present study, we have investigated the effect of the antioxidant activity on the antioxidant activity of the antioxidants. This technique can be applied to various diagnoses easily and quickly, and has become a good technique for the diagnosis and analysis of mutation of cancer-related genes (Bernard PS et al., Clin Chem 2002; 48 (8): 1178-85). However, the method described above requires the use of both probes and primers at the sites where mutations occur in order to detect mutations, so that it is troublesome that multiple reactions are required to detect one mutation (Simi L et al., Am J Clin Pathol. 2008; 130 (2): 247-53, Board RE et al., Clin Chem. 2008; 54 (4): 757-60).

Recently, a technique for selectively detecting a mutant type, which is different from the above method, is a method of suppressing amplification of a wild-type wild-type using a PNA probe that specifically binds to a wild type, and a PNA clamping ) Technology was developed. PNA was first reported in 1991 as a pseudo-DNA in which the nucleic acid base is linked to the peptide bond rather than the phosphate bond (Nielsen PE et al., Science 1991; 254 (5037): 1497-500). PNAs are synthesized by chemical methods and are not found in nature. PNA forms a double strand by causing a hybridization reaction with a natural nucleic acid of a complementary base sequence. When the number of nucleic acid bases is the same, the PNA / DNA double strand is more stable than the DNA / DNA double strand, and the PNA / RNA double strand is more stable than the DNA / RNA double strand. The basic backbone of peptide nucleic acids is most often used in the case of N- (2-aminoethyl) glycine repeatedly linked by amide bonds as a basic skeleton of PNA. Unlike the basic structure of a negatively charged natural nucleic acid It is electrically neutral. The four nucleobases present in the PNA occupy a space similar to that of the DNA and the distance between the nucleotides is almost the same as that of the native nucleic acid. PNA is chemically more stable than natural nucleic acid, and biologically stable because it is not degraded by nuclease or protease. Since PNA is also electrically neutral, the stability of PNA / DNA, PNA / RNA double strands is not affected by salt concentration. Because of this property, PNAs are better able to recognize complementary nucleic acid sequences than natural nucleic acids and are therefore applicable for diagnostic or other biological and medical purposes. The PNA clamping technology utilizes the advantages of the PNA described above, so that when the PNA probe is perfectly coupled, the enzyme does not recognize the amplification reaction, and when the point mutation is present, the PNA probe does not bind perfectly, (Oh JE et al., J Mol Diagn. 2010; 12 (4): 418-24), which can be used to detect mutations that are very small compared to the wild type.

(ABLx4F, ABLx56FM, ABLx6R) that amplify the exon 4 to 6 region of the c-ABL cDNA with the Kreuzer KA et al., Ann Hematol., 2003; 82 (5): 284-9 Real-time PCR was performed in the presence of PNA probes (STI-T315, Y253E255) perfectly coupled to wild type (T315, Y253E255), and PCR analysis of the obtained PCR products was performed to detect BCR-ABL mutation Have been reported. This method distinguishes the mutation type by the difference of the melting curve, not the cycle number of the amplification reaction. In addition to the PNA clamping probe complementary to the wild-type sequence, a donor fluorophore capable of detecting fluorescence for measuring the melting curve (Probe probe) attached to a wild type sequence and a probe (sensor probe) attached to an acceptor fluorophore and complementary to a mutant sequence (type and position of primers and probes) 6). Therefore, since the above method is detected using a large number of fluorescently labeled probes, there arises a problem that the analysis cost is increased. In addition, the above document discloses only a method using an anchor probe labeled with LC Red 640 at the 5'-end with a PNA probe and a sensor probe labeled with LC Red 705 at the 3'-end, and only ABL There was no teaching or suggestion for the mutation detection of the gene. In addition, the PNA clamping probe which completely binds to the wild-type T315, discloses only 20mer of a specific sequence (TTCTATATCATCACTGAGTT; SEQ ID NO: 15), but does not describe any PNA clamping probes of different length or sequence.

The present inventors have found that a mutation type detection method using a PNA clamping probe for a BCR-ABL fusion gene is more convenient than a mutation detection method using a difference in melting curve by detecting a mutation type only by amplification cycle difference with a wild type, BCR-ABL fusion gene mutation detection technology using PNA-based real-time PCR clamping which can detect minute mutations quickly and accurately with high sensitivity by completely inhibiting the mutation-type detection sensitivity.

It is an object of the present invention to provide a mutation detection method of a BCR-ABL fusion gene using PNA-based real-time PCR clamping.

Another object of the present invention is to provide a mutation detection kit of a BCR-ABL fusion gene using real-time PCR clamping based on PNA.

One aspect of the present invention is

A BCR-ABL fusion gene clipping primer set that amplifies the exon 6 region of the ABL gene among the BCR-ABL fusion gene and a PNA (Peptide Nucleic Acid) that completely binds to the wild type of the ABL gene exon 6 codon 315 among the BCR- Real-time Polymerase Chain Reaction (PCR) on the BCR-ABL fusion gene in the presence of a clamping probe;

The gene amplification by real-time PCR is analyzed to determine the presence or concentration of codon 315 mutations in the BCR-ABL fusion gene:

To a method for detecting a mutation of a BCR-ABL fusion gene.

In a preferred embodiment of the present invention, the C _t (cycle threshold) value of the real-time PCR is measured to determine the presence or concentration of the mutation or the concentration of the BCR-ABL fusion gene.

The PNA clamping probe used in the present invention may be composed of a base sequence of preferably 15-30mer, more preferably 19-23mer, and may comprise, for example, any one of the nucleotide sequences of SEQ ID NOS: .

The BCR-ABL fusion gene cloning primer set used in the present invention may include a forward primer that specifically binds to the upstream portion of the ABL gene exon 6 wild type codon 315 and a reverse primer that specifically binds to a downstream portion thereof have. For example, the BCR-ABL fusion gene cloning primer set of the present invention comprises a forward primer of SEQ ID NO: 17 and a reverse primer of SEQ ID NO: 18, 19 or 21, or a forward primer of SEQ ID NO: 20 and a reverse primer of SEQ ID NO: May be composed of a primer.

The BCR-ABL fusion gene used in the present invention can be prepared by extracting DNA or RNA from a subject sample.

In the present invention, SYBR Green I, Evergreen, Ethidium Bromide (EtBr), BEBO, YO-PRO-1, TO-PRO -3, LC green, SYTO-9, SYTO-13, SYTO-16, SYTO-60, SYTO-62, SYTO-64, SYTO-82, POPO-3, TOTO-3, BOBO- One or more selected from the group can be used. Any fluorescent material capable of DNA intercalation can be used, and there is no particular limitation.

The method according to the present invention can be used to determine or diagnose the treatment of leukemia, particularly myeloid leukemia.

Another aspect of the present invention is

A PNA clamping probe according to any one of SEQ ID NOS: 1 to 14:

And a kit for use in a method for detecting a mutation of a BCR-ABL fusion gene according to the present invention.

According to the present invention, a mutation of the BCR-ABL fusion gene predicted to be involved in cancer development, prognosis, and drug resistance can be detected within a short time up to mutations containing excellent sensitivity and specificity. In addition, the PNA itself used as a probe is very stable to biological enzymes and physical elements and is very simple to detect. Therefore, it is expected to be very easy to use in mass analysis and clinical use since it is detected within a short time.

FIG. 1 is a schematic diagram showing a real-time PCR clamping principle based on PNA according to the present invention (a: real-time PCR clamping principle based on PNA using RNA, b: real-time PCR clamping principle based on PNA using DNA);
FIG. 2 is a graph showing the results of comparing the primer sets of SEQ ID NO. 17 with the reverse primer of SEQ ID NO. 18, the forward primer of SEQ ID NO. 17 and the reverse primer of SEQ ID NO. (? C _t ) according to the primers in order to select the primers;
FIG. 3 is a graph showing the effect of a probe for detecting ABL exon 6 codon 315 mutation using a PNA probe of SEQ ID NOS: 1 to 3 in a clone having a BCR-ABL mutation. A graph comparing the sensitivity ([Delta] _Ct );
FIG. 4 is a graph showing the effect of the probe for detecting the ABL exon 6 codon 315 mutation using the PNA probes of SEQ ID NOS: 1 to 3 in the cells of the BCR-ABL mutation, Sensitivity (? C _t );
FIG. 5 is a graph comparing the detection sensitivity (? C _t ) according to the BCR-ABL mutation-containing concentration using the PNA of SEQ ID NO: 3 and the PNA probe of the prior art, ego;
6 is a schematic diagram showing the types and positions of primers and probes used for BCR-ABL mutation detection using PNA-based PCR clamping according to the prior art.

The present invention relates to a method for detecting a mutation of the ABL gene exon 6 codon 315 among the BCR-ABL fusion gene, particularly a T315I mutation, by detecting a small amount of the mutant type with high sensitivity by inhibiting the amplification of the wild type by a PNA probe specifically binding to the wild type And a kit for use in the method.

FIG. 1 schematically shows the principle of a PNA-based real-time PCR clamping method according to the present invention. Fig. 1 (a) shows the principle of the method using RNA, and Fig. 1 (b) shows the principle of the method using DNA.

One. PNA Clamping Of the probe  Design and production

The PNA probes of the present invention are perfectly matched to the wild-type sequence of the ABL gene exon 6 codon 315 in which a mutation can occur, and are more than 15, preferably 15 to 30, 17 to 27, more preferably 17 to 24, and most preferably 19 to 23 nucleotide sequences.

In the present invention, the mutation of the ABL gene exon 6 codon 315 includes 'substitution', in particular substitution of isoleucine to threonine (T315I).

The PNA probe of the present invention is preferably designed such that the wild-type gene region of the ABL gene exon 6 codon 315 in which a mutation can occur is located in the center of the probe. For example, the PNA probe of the present invention may be composed of the nucleotide sequence of any one of SEQ ID NOS: 1 to 14 shown in Table 1 below. All of the PNA probe sequences within the range that can be easily modified by those skilled in the art from the above base sequence will be considered to be within the scope of the present invention. Using PNA-based real-time PCR clamping according to the present invention Is included within the scope of the present invention as long as the ABL gene exon 6 codon 315 mutation can be effectively detected only by the amplification cycle difference.

Specifically, SEQ ID NOS: 1 to 14 are probes for inhibiting wild-type amplification and detecting mutations by perfectly binding to wild type codon 315 (T315) of ABL exon 6. Substitution at codon 315 results in a mutation in the kinase portion of the BCR-ABL fusion protein, in which the cytosine (C) of nucleotide 947 is replaced with thymine (T). SEQ ID NOS: 1 to 14 are designed to specifically hybridize to the 947th base of exon 6 codon 315. SEQ ID NO: 15 was prepared as a PNA probe described in Kreuzer KA et al., Ann Hematol., 2003; 82 (5): 284-9, for comparison with a PNA probe according to the present invention.

SEQ ID NO: name The base sequence (5 '- > 3') Length One T315I-1 ATATCATCACTGAGTTCATG 20 2 T315I-2 TCTATATCATCACTGAGTTCATG 23 3 T315I-3 CTATATCATCACTGAGTTCATG 22 4 T315I-4 TATATCATCACTGAGTTCATG 21 5 T315I-5 TCTTTATCATCACTGAGTTCATG 23 6 T315I-AS-1 CATGAACTCAGTGATGATAT 20 7 T315I-AS-2 CATGAACTCAGTGATGATATAGA 23 8 T315I-AS-3 CATGAACTCAGTGATGATATAG 22 9 T315I-AS-4 CATGAACTCAGTGATGATATA 21 10 T315I-AS-5 CATGAACTCAGTGATGATAT 20 11 T315I-AS-6 ATGAACTCAGTGATGATAT 19 12 T315I-AS-7 AACTCAGTGATGATATAGA 19 13 T315I-ASM-2 CTTGAACTCAGTGATGATATAGA 23 14 T315I-ASM-3 CTTGAACTCAGTGATGATATAG 22 15 STI-T315 TTCTATATCATCACTGAGTT 20

The PNA probes of the present invention may include hydrophilic functional groups at the N-terminal or C-terminal to increase the reaction efficiency and solubility, for example, the N-terminal or the C-terminal (Shakeel et al., J Chem Technol Biotechnol., 2006; 81: 892-9, Gildea et al., Tetrahedron Lett., 1998; 39 : 7255-8, Demidov et al., PNAS., 2002; 99: 5953-8, Wang et al., Anal Chem., 1997; 69: 5200-2). Specifically, in the present invention, a probe having one lysine at the N-terminus or one lysine at the N-terminus and the C-terminus was used.

The PNA oligomer used in the present invention is a PNA monomer protected with a Bts (Benzothiazolesulfonyl) group according to the method of Korean Patent No. 464,261 or a PNA monomer protected with a known Fmoc (9-flourenylmethloxycarbonyl) or t-Boc (t-butoxycarbonyl) (1986), pp. 51-52 (1986)). In addition, it can be synthesized by using the method described in (Dueholm et al., J Org chem. 1994; 59 (19): 5767-73; Thomson et al., Tetrahedron, 1995; 51 (22): 6179-94).

2. BCR - ABL  Fusion gene Clamping Primer  Design and production

In the present invention, the term " BCR-ABL fusion gene clamping primer " refers to a primer that binds to a mutant gene (for example, Lt; RTI ID = 0.0 > PCR < / RTI >

The clamping primer of the present invention is not particularly limited, but in order to detect a mutation with higher sensitivity and specificity, a PNA probe is partially overlapped with the PNA probe in one direction with respect to the PNA clamping probe, But it is desirable to devise the PCR amplification product considering the size of the PCR amplification product. Also, considering the T _m with the PNA probe, the length is between 17mer and 30mer, preferably lower than the T _m of the PNA probe. In order to maximize detection sensitivity and specificity, it is desirable to design the PNA clamping probe sequence complementary to the wild type to include the immediate front of the nucleotide at which the mutation occurs.

According to a specific example, a clamping primer was designed such that the PNA probes of SEQ ID NOS: 1-14 and 5-12 nucleotide sequences overlap. The forward primer of SEQ ID NO: 17 exemplified in the present invention is designed to specifically recognize a partial base upstream of codon 315 of ABL gene exon 6 of SEQ ID NOS: 1-5. The reverse primer of SEQ. ID. NO. 18 combined with the forward primer of SEQ ID NO. 17 exemplified in the present invention and the reverse primer of SEQ ID NO. 19 are specific for the 113 to 132 base and 135 to 152 base of the ABL gene exon 6 region, respectively It is designed to recognize. The reverse primer of SEQ ID NO: 21 is designed to specifically recognize the downstream partial base of codon 315 of ABL gene exon 6 of SEQ ID NOS: 6-14. The forward primer of SEQ ID NO: 20 combined with the reverse primer of SEQ ID NO: 21 exemplified in the present invention was designed to specifically recognize the -76 to -52 base of the ABL gene intron 5 region. The length of the primers ranged from 18 mer to 25 mer, and the sizes of amplified products by primer combination were designed to be 50 bp to 500 bp, respectively.

Meanwhile, in order to identify the gene through the nucleotide sequence analysis of exon 6 of the ABL gene, the forward primer of SEQ ID NO: 16 provided in the present invention was designed to specifically recognize the 6th to 26th bases of the exon 5 region of the ABL gene, The reverse primer in combination with the forward primer of SEQ ID NO: 16 is SEQ ID NO: 19 and is designed to specifically recognize the 135th to 152nd bases of the ABL gene exon 6 region. These primers were combined and designed to amplify the amplified product to a size of 832 bp. Table 2 below describes the primers used in the specific examples of the present invention.

SEQ ID NO: part location name direction The sequence (5 '- > 3') Length 16 Exon 5 6 ~ 26 SC_T315I_F3 Forward GAGATCAAACACCCTAACCTG 21 17 Exon 6 17 ~ 36 B T315I FC Forward GCCCCCGTTCTATATCATCA 20 18 Exon 6 113-132 B T315I R Reverse TCTGAGTGGCCATGTACAGC 20 19 Exon 6 135 ~ 152 S_T315I_R3 Reverse GTACTCCATGGCTGACGA 18 20 Intron 5 -76 ~ -52 B T315I F-2 Forward GGCTTTTTCTTTAGACAGTTGTTTG 25 21 Exon 6 38 ~ 56 F_T315I_RC3 Reverse CCCGTAGGTCATGAACTCA 19

3. PNA  Based real-time PCR Clamping  Used BCR - ABL  Fusion gene mutation detection

The BCR-ABL fusion gene mutation detection method according to the present invention

(a) performing real-time PCR on a BCR-ABL fusion gene in the presence of a BCR-ABL fusion gene clamping primer set and a PNA clamping probe; And

(b) determining whether the BCR-ABL fusion gene is mutated or not by analyzing gene amplification by the real-time PCR;

.

The BCR-ABL fusion gene used in step (a) is prepared by extraction from the subject sample. In the present invention, there is no particular limitation on the extraction of the nucleic acid, and any nucleic acid extraction method generally used can be used. The nucleic acid to be extracted may be DNA or RNA, for example, mRNA, and is prepared, for example, by extracting DNA or RNA from the patient's blood or myeloid cells using a commercially available DNA or RNA extraction kit. The extracted RNA is synthesized by using a conventional method.

In step (a), a mutation of the BCR-ABL fusion gene is detected using a real-time PCR method. Real-time PCR method can provide more accurate quantitative analysis it is indicated in an exponential amplification takes place can the amount of the initial sample of the cycles for the exponential increase in the fluorescent material starts to be detected (hereinafter referred to as Cycle threshold, less than 'C _t'), and The reaction can be analyzed in real time. In this method, the step of measuring the intensity with the image analyzer is omitted, and the degree of amplification of the amplification product is automated and quantified, thereby enabling quick and easy detection.

It is preferred in the present invention that the PNA clamping probe among the reagents of the real-time PCR clamping has a final concentration of 1 to 1000 nM.

In the present invention, fluorescence is detected using an intercalating method. In this method, a fluorescence label is intercalated into an amplified double stranded DNA and fluorescence is emitted. The fluorescence intensity at this time is measured Thereby measuring the amount of amplification product produced. This allows detection of mutations in the BCR-ABL fusion gene with high sensitivity and specificity without application of any primers to any PCR instrument.

In the present invention, a DNA-binding fluorophore used in a real-time gene detection method is used as a fluorescent substance for identifying a gene amplification product, and there is no particular limitation on its kind. For example, in addition to SYBR Green I, Evergreen, Ethidium Bromide (EtBr), BEBO, YO-PRO-1, TO-PRO-3, LC Green, SYTO-9, SYTO-13, SYTO- (Gudnason H et al., Nucleic Acids Res. 2007; 35 (19): e127) can be used, such as SYTO-62, SYTO-64, SYTO-82, POPO-3, TOTO-3, BOBO- , Bengtsson M et al., Nucleic Acids Res. 2003; 31 (8): e45).

In step (b), gene amplification by real-time PCR in step (a) was analyzed to determine the presence or the concentration of a mutant BCR-ABL fusion gene or its concentration. The mutated _Ct values of the BCR- . When a PNA probe designed to hybridize with a wild-type gene hybridizes to the wild-type (eg, T315) of the BCR-ABL gene, the amplification is inhibited and the C _t value is high. On the other hand, mutations in the BCR-ABL gene (eg, T315I) are not hybridized with PNA probes, resulting in amplification and a lower C _t value. As shown in the following equation (1), the value of ΔC _t obtained by subtracting the value of C _t obtained from the unknown sample from the value of C _t obtained from the positive control sample can be checked to confirm the mutation of each codon.

[Equation 1]

C _t = C _t value obtained from the positive control sample - C _t value obtained from the unknown sample

[Positive control sample: wild-type gene sample, unknown sample: sample to be mutated or to be measured]

The larger the amount of the mutant gene, the lower the C _t value, so that the greater the difference ΔC _t , the greater the amount of mutation.

The BCR-ABL mutation detection method using the PNA-based real-time PCR clamping of the present invention can be used for the treatment or diagnosis of leukemia, especially myeloid leukemia patients, and is also very useful for studying the mechanism involved in the BCR-ABL signaling system Lt; / RTI > It can also be effectively applied to studies that require large amounts of sample analysis, such as population-based studies.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the present invention is not intended to limit the scope of the present invention in any way.

Example 1: Synthesis of PNA probes to inhibit the amplification of codon 315 wild-type present in exon 6 of ABL gene among BCR-ABL fusion genes

Fourteen PNA probes were prepared as shown in Table 1, which perfectly binds to the wild-type (T315) of the exon 6 codon 315 of the ABL gene among the BCR-ABL fusion genes. Probes that are perfectly bound to the wild type of each codon are designed so that the base sequence in which the mutation occurs is located in the middle of the probe for effective isolation from the mutation. PNA probes were synthesized according to the method described in Korean Patent No. 464,261 (Lee H et al., Org Lett. 2007; 9 (17): 3291-3).

Example  2: BCR - ABL  Among the fusion genes ABL  Amplification of the target nucleic acid of gene exon 6 Clamping  For PCR primer  synthesis

ABL gene in BCR-ABL fusion gene For the amplification and clamping of the target nucleic acid of exon 6, the ABL exon 6 region was analyzed to prepare a primer. A primer set consisting of SEQ ID NO: 16 (forward) and SEQ ID NO: 19 (reverse direction) for identifying wild type and mutant genes of ABL exon 6, a primer of SEQ ID NO: 17 as a clamping primer of ABL exon 6 codon 315 A primer set consisting of the primers of SEQ ID NO: 18 or 21 (reverse direction) was synthesized. In addition, the reverse primer of SEQ ID NO: 19 designed to identify the gene of ABL exon 6 was used as the reverse primer used for clamping the exon 6 codon 315 in the same manner. A forward primer of SEQ. ID. NO. 20 used in combination with the reverse primer of SEQ ID NO: 21 was synthesized as another clamping primer of ABL exon 6 codon 315. [ The sequences of the primers used are shown in Table 2 above. The primer was synthesized by asking Bioneer (Korea).

Example 3: Mutagenesis and cloning to produce a target nucleic acid of ABL gene exon 6 among BCR-ABL fusion genes

Using the whole human DNA, the primer set of SEQ ID NOS: 16 and 19 was used to amplify the ABL exon 6 gene. The amplified nucleic acid was ligated to pGEM-T isvector (Promega, USA) and Escherichia coli coli ) JM 109 cells to obtain a large amount of DNA. To obtain a clone having a mutation gene, a mutagenic primer was prepared using a normal clone prepared by the above method, and a clone having a mutant gene was obtained using a site-specific mutagenesis kit (Stratagene, USA). The obtained clones were identified by sequencing.

Example 4: Extraction of nucleic acid from wild-type cell line of ABL gene exon 6 among BCR-ABL fusion gene

To obtain the wild type nucleic acid of ABL gene exon 6 among the BCR-ABL fusion gene, the cell line was distributed from Korean Cell Line Bank (KCLB). K562 human chronic myelogenous leukemia cell line [KCLB10243, Korea Cell Line Bank (KCLB), Seoul, Korea] was distributed as a wild type cell line. The cells were cultured in RPMI 1640 (Hyclone, Thermo scientific, USA) or MEM (WelGENE, Korea) with 10% heat-inactivated fetal bovine serum (FBS, Hyclone, Thermo scientific, USA) and 1 × penicillin-streptomycin Korea) was used for culture in an incubator maintained at 37 ° C and 5% carbon dioxide (CO ₂ ). Using the High Pure PCR Template Preparation Kit (Roche, USA), the cultured cell line was extracted with DNA and RNA according to the manual provided in the kit to obtain the target nucleic acid. The obtained nucleic acids were quantified using a nano-drop spectrophotometer (ND 2000C, Thermo Scientific, USA) and stored at -20 ° C and -80 ° C. DNAs isolated from human cell lines were subjected to the primer set of SEQ ID NOS: 16 and 19 shown in Table 2 above to amplify the ABL exon 6 gene. After RNA synthesis, the same primer set was applied to amplify the ABL exon 6 gene. The amplified PCR product was purified using Labopass ™ PCR purification kit (Kosomjin Tech, Korea) and sequenced to confirm the genotype. The genotype-confirmed wild-type cell line was used as a sample of the real-time PCR method using the PNA probe of the present invention .

Example 5: Real-time PCR clamping method using PNA probe against exon 6 codon 315 of ABL gene among BCR-ABL fusion gene

Using the plasmid DNA extracted from the clone in Example 3 and the DNA and RNA extracted from the cell line in Example 4, PNA probes were used to detect the mutation of the BCR-ABL fusion gene prepared in Example 1 Real-time PCR clamping was performed under the following conditions, and the results were compared and analyzed to find an optimal PNA probe.

1 μl of the plasmid DNA solution extracted from the clone or 1 μl of the template DNA solution (50 ng / μl) extracted from the cell line, 1 μl of 1 clamping sense primer (10 pmoles / μl) shown in Table 2, 1 μl of the antisense primer 1 μl of the probe shown in Table 1, 1 μl of 1 clamping probe (100 nM), 10 μl of 2 × IQ Sybr Green Super Mix (Bio-Rad, USA) and 6 μl of distilled water were added thereto, The PCR reaction was carried out at 95 ° C. for 3 minutes using a PCR machine (CFX96 ™ Real-Time PCR System, Bio-RAD), followed by a 30 second reaction at 95 ° C. and a 20 second reaction at 70 ° C. at which PNA could be hybridized. C for 30 seconds, and 72 < 0 > C for 30 seconds. Fluorescence was measured at the 72 ° C polymerization stage.

The effect of inhibiting the amplification of the codon 315 wild type of exon 6 and detecting the mutation was confirmed by applying two sets of primers (SEQ ID NOs: 17 and 18, and SEQ ID NOs: 17 and 19) by applying the probes of SEQ ID NOS: The results are shown in Fig. As shown in Fig. 2, the PNA probe of SEQ ID NO: 4 showed a very excellent effect in the forward clamping using SEQ ID NO: 17 and SEQ ID NO: 18, and the PNA probe of SEQ ID NOs: 1 to 4 in the forward clamping using SEQ ID NOs: It was confirmed that the probe exhibited excellent effects.

The probes of SEQ ID NOS: 1 to 14 were applied to the probes of SEQ ID NOS: 1, 2 and 3 to inhibit the amplification of the codon 315 wild-type of exon 6 and the mutation was detected. As shown in FIG. All of the applied probes exhibited excellent effects, and in particular, the PNA probes of SEQ ID NO: 2 were found to exhibit superior effects in detecting mutations.

Example  6: PNA The probe  Real time PCR Clamping  Through the method BCR - ABL  Mutation detection of fusion gene

Using the real-time PCR method established in Example 5, a sample was prepared so as to include mutant genes in the wild type gene at 100%, 50%, 10%, 5%, 1%, 0.5% and 0.1% The correlation between the concentration and the C _t value was analyzed and the detection limit of the mutant type was confirmed.

FIG. 4 shows the results of comparing the detection sensitivity (ΔC _t ) according to the ratio of the mutant gene using the PNA probes of SEQ ID NOs: 1 to 3 in the cell line having the ABL exon 6 codon 315 mutation. As shown in Figure 4, the PNA probes of SEQ ID NOS: 2 and 3 were found to be capable of detecting up to 0.5% mutagenized samples.

Comparative Example  One: BCR - ABL  Comparison with prior art for mutation detection

To compare the PNA probes disclosed in Kreuzer KA et al., Ann Hematol., 2003; 82 (5): 284-9 with the PNA probes according to the present invention, the PNA probes of SEQ ID NO: Respectively.

Real-time PCR using the probes of the above-mentioned prior art and probes according to the present invention was performed to confirm mutation detection.

The results are shown in Fig. As can be seen from FIG. 5, the detection sensitivity according to the mutant gene ratio was compared. As a result, the PNA probes disclosed in the prior art can detect up to 5% of mutant genes, whereas the PNA probes according to the present invention have a mutant gene ratio of 0.5% And it has been confirmed that the detection sensitivity is about 10 times higher.

<110> Panagene Inc. <120> Methods and kits for the detection of BCR-ABL fusion gene mutant          using PNA mediated real-time PCR clamping <160> 21 <170> Kopatentin 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 1 atatcatcac tgagttcatg 20 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 2 tctatatcat cactgagttc atg 23 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 3 ctatatcatc actgagttca tg 22 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 4 tatatcatca ctgagttcat g 21 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 5 tctttatcat cactgagttc atg 23 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 6 catgaactca gtgatgatat 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 7 catgaactca gtgatgatat aga 23 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 8 catgaactca gtgatgatat ag 22 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 9 catgaactca gtgatgatat a 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 10 catgaactca gtgatgatat 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 11 atgaactcag tgatgatat 19 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 12 aactcagtga tgatataga 19 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 13 cttgaactca gtgatgatat aga 23 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 14 cttgaactca gtgatgatat ag 22 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 15 ttctatatca tcactgagtt 20 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 16 gagatcaaac accctaacct g 21 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 17 gcccccgttc tatatcatca 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 18 tctgagtggc catgtacagc 20 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 19 gtactccatg gctgacga 18 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 20 ggctttttct ttagacagtt gtttg 25 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 21 cccgtaggtc atgaactca 19

Claims (12)

A BCR-ABL fusion gene clamping primer set that amplifies the exon 6 region of the ABL gene among the BCR-ABL fusion gene, and a wild-type ABL gene exon 6 codon 315 of the BCR-ABL fusion gene, (PCR) for a BCR-ABL fusion gene in the presence of a PNA (Peptide Nucleic Acid) clamping probe consisting of any one of the nucleotide sequences of SEQ ID NOS: 1 to 14, );
The gene amplification by real-time PCR is analyzed to determine the presence or concentration of codon 315 mutations in the BCR-ABL fusion gene:
/ RTI &gt; of the BCR-ABL fusion gene. The method for detecting a mutation of a BCR-ABL fusion gene according to claim 1, wherein the C _t (cycle threshold) value of the real-time PCR is measured to determine the presence or concentration of a mutation in the BCR-ABL fusion gene. delete delete delete 3. The BCR-ABL fusion gene clamping primer set according to claim 1 or 2, wherein the BCR-ABL fusion gene clamping primer set comprises a forward primer that specifically binds to an upstream portion of the ABL gene exon 6 wild type codon 315 and a reverse primer Wherein the BCR-ABL fusion gene is a mutant. The method of claim 6, wherein the BCR-ABL fusion gene clamping primer set comprises a forward primer of SEQ ID NO: 17 and a reverse primer of SEQ ID NO: 18, 19 or 21, or a forward primer of SEQ ID NO: 20 and a reverse primer of SEQ ID NO: Of the BCR-ABL fusion gene. 3. The method according to claim 1 or 2, wherein the BCR-ABL fusion gene is prepared by extracting DNA or RNA from a subject sample. The method according to claim 1 or 2, wherein gene amplification is analyzed using a DNA intercalating fluorescent substance, the mutation detection method of a BCR-ABL fusion gene. 10. The method of claim 9, wherein the DNA intercalating fluorescent material is selected from the group consisting of SYBR Green I, Evergreen, Ethidium Bromide (BEBO), YO-PRO-1, TO- ABL fusion, which is at least one selected from the group consisting of SYTO-16, SYTO-60, SYTO-62, SYTO-64, SYTO-82, POPO-3, TOTO-3, BOBO- Mutation detection method of gene. 3. The method according to claim 1 or 2, for use in determining or diagnosing the treatment of leukemia, comprising detecting a mutation in a BCR-ABL fusion gene. A PNA clamping probe according to any one of SEQ ID NOS: 1 to 14:
7. A kit for use in a method for detecting a mutation of a BCR-ABL fusion gene according to claim 1.

Images