KR20120088891A - Methods and kits for the detection of BCR-ABL fusion gene mutant using PNA mediated Real-time PCR clamping - Google Patents

Methods and kits for the detection of BCR-ABL fusion gene mutant using PNA mediated Real-time PCR clamping Download PDF

Info

Publication number
KR20120088891A
KR20120088891A KR1020100112072A KR20100112072A KR20120088891A KR 20120088891 A KR20120088891 A KR 20120088891A KR 1020100112072 A KR1020100112072 A KR 1020100112072A KR 20100112072 A KR20100112072 A KR 20100112072A KR 20120088891 A KR20120088891 A KR 20120088891A
Authority
KR
South Korea
Prior art keywords
bcr
fusion gene
abl
gene
abl fusion
Prior art date
Application number
KR1020100112072A
Other languages
Korean (ko)
Other versions
KR101875199B1 (en
Inventor
박희경
최재진
김현선
장민정
Original Assignee
주식회사 파나진
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 파나진 filed Critical 주식회사 파나진
Priority to KR1020100112072A priority Critical patent/KR101875199B1/en
Priority to PCT/KR2011/008056 priority patent/WO2012064035A2/en
Publication of KR20120088891A publication Critical patent/KR20120088891A/en
Application granted granted Critical
Publication of KR101875199B1 publication Critical patent/KR101875199B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/107—Modifications characterised by incorporating a peptide nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Abstract

PURPOSE: A method for BCR-ABL fusion gene mutant is provided to suppress amplification of wild type gene and to selectively detect only mutant. CONSTITUTION: A method for BCR-ABL fusion gene mutant comprises: a step of performing real-time PCR of the fusion gene under the presence of a BCR-ABL fusion gene clamping primer set for amplifying exon 6 position of ABL gene and a PNA clamping probe which completely binds with a wild type of exon 6 codon 315 of ABL gene; and a step of analyzing gene amplification by real-time PCR to determine presence or concentration of codon 315 mutant. The PNA clamping probe has 15-30 mer bases. The detection metho is used for diagnosing leukemia.

Description

ＰＮＡ 기반의 실시간 ＰＣＲ 클램핑을 이용한 ＢＣＲ-ＡＢＬ 융합 유전자의 돌연변이 검출 방법 및 키트{Methods and kits for the detection of BCR-ABL fusion gene mutant using PNA mediated Real-time PCR clamping}Method and kits for the detection of BCR-ABL fusion gene mutant using PNA mediated Real-time PCR clamping} using PNA-based real-time PCR clamping

본 발명은 펩티드 핵산(Peptide Nucleic Acid, 이하 'PNA'라 함) 프로브를 이용한 BCR-ABL 융합 유전자의 돌연변이 검출에 관한 것으로서, 보다 상세하게는, BCR-ABL 융합 유전자 중 ABL 유전자 엑손 6 코돈 315의 돌연변이 검출을 위하여 야생형에 특이적으로 결합하는 PNA 프로브가 야생형의 증폭을 억제함으로써 소량의 돌연변이형만을 높은 민감도로 검출하는 방법 및 상기 방법에 사용하기 위한 키트에 관한 것이다.The present invention relates to the detection of mutations in the BCR-ABL fusion gene using a peptide nucleic acid (Peptide Nucleic Acid) probe, and more specifically, to the ABL gene exon 6 codon 315 in the BCR-ABL fusion gene. A PNA probe that specifically binds a wild type for mutation detection relates to a method for detecting only a small amount of mutant with high sensitivity by inhibiting amplification of the wild type and a kit for use in the method.

암의 발생에 암유전자(oncogene) 및 종양억제유전자(tumor suppressor gene)의 돌연변이가 관여한다는 사실이 알려지면서 여러 암유전자 및 종양억제유전자의 돌연변이를 검출하는 연구가 다양하게 진행되고 있다. 이에 따라, 암의 발생 및 약물의 예후판단에 관여하는 많은 돌연변이가 발견되고 있다.Since the oncogene and tumor suppressor gene mutations are known to be involved in the development of cancer, various studies have been conducted to detect mutations of various oncogenes and tumor suppressor genes. Accordingly, many mutations have been found that are involved in the development of cancer and prognosis of drugs.

BCR-ABL은 다른 염색체에 존재하는 유전자가 융합된 유전자로서, 타이로신 키나제(tyrosine kinase) 유전자의 일종이다. 즉, 22번 염색체 장완부위에 존재하는 BCR 유전자와 9번 염색체의 장완부위에 존재하는 ABL 유전자가 서로 전좌되면서 22번 염색체 장완부위에 ABL 유전자가 융합된 유전자로서, BCR-ABL 융합 유전자가 존재하는 염색체를 '필라델피아 염색체'라고 부른다(Nowell PC et al., Science 1960;132:1497, Rowley JD et al., Nature 1973;243:293). 필라델피아 염색체는 만성 골수성 백혈병(chronic myeloid leukemia, CML) 환자의 90% 이상에서 나타나고 있으며, 다른 골수성 백혈병에서도 발견된다는 보고가 있다. 필라델피아 염색체, 즉 BCR-ABL 융합 유전자가 만성 골수성 백혈병의 발생 및 진행과 관련되어 있다는 연구결과는 수차례 보고된 바 있다. 이러한 결과를 바탕으로 BCR-ABL 융합 유전자의 발현을 억제하여 만성 골수성 백혈병의 진행을 막는 표적치료가 수행되고 있다. 표적 치료제로서는 이마티닙(Imatinib, Gleevec)이 대표적으로, 이 약제의 원리는 BCR-ABL 유전자의 발현으로 생성되는 BCR-ABL 타이로신 키나제의 활성화를 주도하는 ATP와의 결합을 억제함으로써 BCR-ABL 타이로신 키나제 활성을 억제하여 결국 BCR-ABL 타이로신 키나제에 의한 신호전달 경로로 암세포 성장을 일으키는 시스템을 막는 것이다. 이때 BCR-ABL 유전자의 키나제 도메인 부위의 돌연변이는 약제내성을 야기한다(Druker BJ et al., Nat Med. 1996;2:561-6). c-ABL 키나제 도메인의 ATP-결합 포겟에서 트레오닌(threonine)의 이소류신(isoleucine)으로의 단일 아미노산 치환(Thr315Ile, T315I)이 이마티닙에 대한 후천적 내성과 관련이 있는 것으로 제안되었다(Gorre ME et al., Science 2001;293:876-80). 따라서 BCR-ABL 유전자의 키나제 도메인 부위에서의 돌연변이, 특히 T315I의 검출은 이를 표적으로 치료하는 데 있어서 치료효과를 예측할 수 있는 중요한 지표이며, 좋은 예후에 결정적인 역할을 할 수 있다.BCR-ABL is a gene in which genes present in other chromosomes are fused and is a type of tyrosine kinase gene. That is, the BCR gene in the long arm region of chromosome 22 and the ABL gene in the long arm region of chromosome 9 are translocated with each other, and the ABL gene is fused to the long arm region of chromosome 22, and the BCR-ABL fusion gene is present. Chromosomes are called 'Philadelphia chromosomes' (Nowell PC et al., Science 1960; 132: 1497, Rowley JD et al., Nature 1973; 243: 293). The Philadelphia chromosome is present in more than 90% of patients with chronic myeloid leukemia (CML) and has been reported to be found in other myeloid leukemias. Several studies have reported that the Philadelphia chromosome, BCR-ABL fusion gene, is associated with the development and progression of chronic myeloid leukemia. On the basis of these results, targeted therapies for preventing the development of chronic myeloid leukemia by inhibiting the expression of the BCR-ABL fusion gene have been performed. Imatinib (Gleevec) is a targeted therapeutic agent, and the principle of this agent is to inhibit BCR-ABL tyrosine kinase activity by inhibiting binding to ATP, which leads to activation of BCR-ABL tyrosine kinase produced by expression of the BCR-ABL gene. It inhibits the system that eventually causes cancer cell growth by signaling pathways by BCR-ABL tyrosine kinase. Mutations in the kinase domain region of the BCR-ABL gene then lead to drug resistance (Druker BJ et al., Nat Med. 1996; 2: 561-6). Single amino acid substitutions (Thr315Ile, T315I) of threonine to isoleucine in the ATP-binding fork of the c-ABL kinase domain have been suggested to be associated with acquired resistance to imatinib (Gorre ME et al., Science 2001; 293: 876-80). Therefore, the detection of mutations in the kinase domain region of the BCR-ABL gene, in particular T315I, is an important indicator for predicting the therapeutic effect in treating this target and may play a decisive role in a good prognosis.

BCR-ABL 돌연변이의 검출 방법으로는 중합효소연쇄반응(polymerase chain reaction, PCR) 후 염기서열분석을 통한 변이 검출 방법, 야생형과 돌연변이 유전자의 3차원적인 구조(conformation) 차이에 따른 전기영동상 이동 거리의 변화를 통해 검출하는 방법인 중합효소연쇄반응-단일쇄 형태구조 다형성(Polymerase chain reaction-single strand conformational polymorphism; PCR-SSCP) 방법 등이 사용되어 왔다(EI-Habr EA et al., Clin Neuropathol. 2010;29(4):239-45). 그러나 상기 방법들은 PCR 이후 제한효소로 절단하는 과정 및 전기영동의 과정, 염기서열분석의 단계를 거쳐 돌연변이를 검출하는 방법이므로 반응시간이 오래 소요되고 번거로우며 많은 비용이 소요된다. 또한 임상 시료내에는 돌연변이가 야생형에 비해 아주 극소량 존재하는 경우가 많기 때문에, 소량의 돌연변이를 검출하는 것이 매우 중요함에도 불구하고, 상기의 방법은 낮은 검출 민감도를 가지므로 극소량의 돌연변이 검출이 어렵다(EI-Habr EA et al., Clin Neuropathol. 2010;29(4):239-45).The detection method of BCR-ABL mutation is a mutation detection method through sequencing after polymerase chain reaction (PCR), and the electrophoretic movement distance according to the three-dimensional conformation difference between wild type and mutant genes. Polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP) methods have been used (EI-Habr EA et al., Clin Neuropathol. 2010). 29 (4): 239-45. However, the above method is a method of detecting mutations through a process of cleavage with restriction enzymes after PCR, electrophoresis, sequencing, and thus, a reaction time is long, cumbersome and expensive. In addition, since very few mutations are present in clinical samples compared to wild-type, although the detection of a small amount of mutations is very important, the above method has low detection sensitivity, making it difficult to detect very small amounts of mutations. Habr EA et al., Clin Neuropathol. 2010; 29 (4): 239-45).

민감도를 증가시키기 위해 야생형과 돌연변이간의 용융온도 차이를 이용하여 돌연변이만을 선택적으로 검출하는 고감도 용융온도분석(high-resolution melting curve analysis, HRMA) 방법, 스코피언(scorpion) 프로브를 이용하여 돌연변이를 선택적으로 검출하는 스코피언 실시간 대립형질 특이적 PCR(scorpion Real-time allele specific PCR)(DxS' scorpions® and ARMS®) 방법 등이 사용되고 있다(Simi L et al., Am J Clin Pathol. 2008;130(2):247-53, Board RE et al., Clin Chem. 2008;54(4):757-60). 이러한 기술은 쉽고 빠르게 다양한 진단에 적용이 가능하며, 암 관련 유전자의 변이 진단 및 분석을 위해 좋은 기술이 되고 있다(Bernard PS et al., Clin Chem. 2002;48(8):1178-85). 그러나 상기한 방법은 돌연변이를 검출하기 위하여 돌연변이가 발생하는 부위에 각각 프로브나 프라이머를 모두 사용해야 하기 때문에 하나의 돌연변이를 검출하기 위하여 여러 반응이 요구되는 번거로움이 있다(Simi L et al., Am J Clin Pathol. 2008;130(2):247-53, Board RE et al., Clin Chem. 2008;54(4):757-60).High-resolution melting to selectively detect mutations only by using melting temperature differences between wild-type and mutations to increase sensitivity curve analysis, HRMA, scorpion real-time allele specific PCR (DxS'scorpions® and ARMS®) methods to selectively detect mutations using scorpion probes (Simi L et al., Am J Clin Pathol. 2008; 130 (2): 247-53, Board RE et al., Clin Chem. 2008; 54 (4): 757-60). This technique can be easily and quickly applied to various diagnostics, and has become a good technique for diagnosing and analyzing mutations of cancer-related genes (Bernard PS et al., Clin Chem. 2002; 48 (8): 1178-85). However, the above-described method is cumbersome in that several reactions are required to detect a mutation because each probe or primer must be used at each site where the mutation occurs to detect a mutation (Simi L et al., Am J). Clin Pathol. 2008; 130 (2): 247-53, Board RE et al., Clin Chem. 2008; 54 (4): 757-60).

최근에는 돌연변이형을 선택적으로 검출하는 기술로 상기한 방법과는 달리 야생형에 특이적으로 결합하는 PNA 프로브를 이용하여 다량 존재하는 야생형의 증폭을 억제하는 방법으로 돌연변이를 선택적으로 검출하는 PNA 클램핑(clamping) 기술이 개발되었다. PNA는 핵산염기가 인산 결합이 아니라 펩티드 결합으로 연결된 유사 DNA로 1991년에 처음 보고되었다(Nielsen PE et al., Science 1991;254(5037):1497-500). PNA는 화학적인 방법으로 합성되고 자연계에서는 발견되지 않는다. PNA는 상보적인 염기 서열의 천연 핵산과 혼성화(hybridization) 반응을 일으켜서 겹가닥을 형성한다. 핵산 염기의 수가 같은 경우 PNA/DNA 겹가닥은 DNA/DNA 겹가닥보다, PNA/RNA 겹가닥은 DNA/RNA 겹가닥보다 안정하다. PNA의 기본 골격으로는 N-(2-아미노에틸)글리신이 아미드 결합에 의해 반복적으로 연결된 것이 가장 흔히 쓰이고, 이 경우 펩티드 핵산의 기본 골격(backbone)은 음전하를 띠는 천연 핵산의 기본 골격과 달리 전기적으로 중성이다. PNA에 존재하는 4개의 핵산 염기(nucleobase)는 DNA의 핵산 염기와 비슷한 공간을 차지하고 핵산 염기 사이의 거리도 천연 핵산의 경우와 거의 같다. PNA는 화학적으로 천연 핵산보다 안정할 뿐 아니라 핵산분해효소(nuclease)나 단백질분해효소(protease)에 의해 분해되지 않아 생물학적으로도 안정하다. PNA는 또한 전기적으로 중성이기 때문에 PNA/DNA, PNA/RNA 겹가닥의 안정성은 염 농도에 영향을 받지 않는다. 이러한 성질 때문에 PNA는 상보적인 핵산 염기 서열을 천연 핵산보다 더 잘 인식할 수 있어서 진단 또는 다른 생물학적, 의학적 목적으로 응용된다. PNA 클램핑 기술은 상기한 PNA의 장점을 이용하여 PNA 프로브가 완벽하게 결합되면 효소 등이 인지하지 못하여 증폭반응이 일어나지 않고, 점 돌연변이가 있는 경우에는 PNA 프로브가 완벽하게 결합하지 못하기 때문에 증폭반응이 일어나게 되는 원리를 이용하는 방법으로, 야생형에 비해 극소량 존재하는 돌연변이를 빠르고 정확하게 검출할 수 있어 많이 이용되고 있다(Oh JE et al. J Mol Diagn. 2010;12(4):418-24.)Recently, a technique for selectively detecting a mutant type, unlike the method described above, uses a PNA probe that specifically binds to a wild type to inhibit amplification of a large amount of wild type. Technology has been developed. PNA was first reported in 1991 as analogous DNA with nucleic acid bases linked by peptide bonds rather than phosphate bonds (Nielsen PE et al., Science 1991; 254 (5037): 1497-500). PNA is synthesized chemically and is not found in nature. PNAs hybridize with native nucleic acids of complementary base sequences to form double strands. PNA / DNA strands are more stable than DNA / DNA strands and PNA / RNA strands are more stable than DNA / RNA strands when the number of nucleic acid bases is the same. As the basic skeleton of PNA, N- (2-aminoethyl) glycine is most commonly used by amide bonds. In this case, the backbone of peptide nucleic acid is different from that of negatively charged natural nucleic acid. It is electrically neutral. The four nucleic acid bases present in the PNA occupy a similar space as the nucleic acid bases of DNA and the distances between the nucleic acid bases are almost the same as those of natural nucleic acids. PNA is not only chemically stable than natural nucleic acids, but also biologically stable because it is not degraded by nucleases or proteases. Since PNA is also electrically neutral, the stability of PNA / DNA, PNA / RNA double strands is not affected by salt concentration. Because of this property, PNAs can recognize complementary nucleic acid sequences better than natural nucleic acids and are therefore used for diagnostic or other biological and medical purposes. The PNA clamping technique uses the advantages of the above-described PNA, so that when the PNA probe is completely bound, the amplification reaction does not occur because the enzyme is not recognized, and in the case of a point mutation, the amplification reaction cannot be perfectly bound. As a method using the principle that occurs, it is widely used because it can quickly and accurately detect a very small amount of mutations compared to wild type (Oh JE et al. J Mol Diagn. 2010; 12 (4): 418-24.)

문헌 [Kreuzer KA et al., Ann Hematol., 2003;82(5):284-9]에 c-ABL cDNA의 엑손 4 내지 6 부위를 증폭시키는 프라이머 세트(ABLx4 F, ABLx56 FM, ABLx6 R)와 야생형(T315, Y253E255)과 완벽하게 결합하는 PNA 프로브(STI-T315, Y253E255) 존재 하에 실시간 PCR을 수행하고, 얻어진 PCR 산물에 대해 용융곡선 분석(DNA melting analysis)을 수행하여 BCR-ABL 돌연변이를 검출하는 방법이 보고되어 있다. 이 방법은 증폭반응의 사이클 수가 아닌 용융곡선의 차이로 돌연변이형을 구별하는 것으로서, 야생형 서열에 상보적인 PNA 클램핑 프로브 이외에 용융곡선을 측정하기 위한 형광을 검출할 수 있는 공여체 형광물질(donor fluorophore)이 부착되어 있고 야생형 서열에 상보적인 프로브(앵커 프로브)와 수용체 형광물질(acceptor fluorophore)이 부착되어 있고 돌연변이형 서열에 상보적인 프로브(센서 프로브)를 필요로 한다(프라이머들 및 프로브들의 종류 및 위치를 나타낸 도 6 참조). 따라서, 상기 방법은 다량의 형광 표지된 프로브를 이용하여 검출하게 되므로 분석 비용이 높아지는 문제점이 발생한다. 또한, 상기 문헌은 PNA 프로브와 함께 5'-말단에 LC 레드 640으로 표지된 앵커 프로브와 3'-말단에 LC 레드 705로 표지된 센서 프로브를 이용하는 방법만을 개시하고 있을 뿐, PNA 프로브만을 이용한 ABL 유전자의 돌연변이 검출에 대해서는 어떠한 교시나 암시도 하지 않았다. 또한, 야생형인 T315와 완벽하게 결합하는 PNA 클램핑 프로브로서 특정 서열(TTCTATATCATCACTGAGTT; 서열번호 15)의 20mer만을 개시하고 있을 뿐, 다른 길이나 서열의 PNA 클램핑 프로브는 전혀 기재하고 있지 않다.Kreuzer KA et al., Ann Hematol., 2003; 82 (5): 284-9 and a set of primers (ABLx4 F, ABLx56 FM, ABLx6 R) that amplify the exon 4-6 sites of c-ABL cDNA; Real-time PCR is performed in the presence of PNA probes (STI-T315, Y253E255) that fully binds to the wild type (T315, Y253E255), and a melting curve analysis is performed on the obtained PCR product to detect BCR-ABL mutations. How to do is reported. This method distinguishes mutants by differences in melting curves rather than by cycle number of amplification reactions. In addition to PNA clamping probes complementary to wild-type sequences, donor fluorophores capable of detecting fluorescence for measuring melting curves are provided. A probe (anchor probe) and an receptor fluorophore attached and complementary to the wild type sequence are required and a probe (sensor probe) complementary to the mutant sequence is required (types and positions of primers and probes 6 shown). Therefore, since the method detects using a large amount of fluorescently labeled probes, an analysis cost increases. In addition, the document only discloses a method using an anchor probe labeled LC red 640 at the 5'-end and a sensor probe labeled LC red 705 at the 3'-end together with a PNA probe. No teaching or suggestion was made for the detection of mutations in the gene. In addition, only 20mer of a specific sequence (TTCTATATCATCACTGAGTT; SEQ ID NO: 15) is disclosed as a PNA clamping probe that perfectly binds to wild type T315, but does not describe PNA clamping probes of different lengths or sequences at all.

본 발명자들은 BCR-ABL 융합 유전자에 대하여, PNA 클램핑 프로브를 이용하여 야생형과의 증폭 사이클 차이만으로 변이형을 검출함으로써 용융곡선의 차이를 이용한 변이형 검출 기술보다 간편할 뿐만 아니라, 다량의 야생형의 증폭을 완벽하게 저해하여 변이형의 검출 민감도를 향상시킴으로써 극소량 섞여있는 돌연변이를 높은 민감도로 신속?정확하게 검출할 수 있는, PNA 기반의 실시간 PCR 클램핑을 이용한 BCR-ABL 융합 유전자 돌연변이 검출 기술을 완성하였다.The inventors of the BCR-ABL fusion gene, by using a PNA clamping probe to detect the mutant only by the difference in the amplification cycle with the wild type, it is simpler than the mutant detection technology using the difference in the melting curve, amplification of a large amount of wild type By completely inhibiting the antimicrobial, the BCR-ABL fusion gene mutation detection technology using PNA-based real-time PCR clamping was able to detect very small amounts of mixed mutations quickly and accurately by improving the detection sensitivity of the variants.

본 발명의 목적은 PNA 기반의 실시간 PCR 클램핑을 이용한 BCR-ABL 융합 유전자의 돌연변이 검출 방법을 제공하기 위한 것이다.An object of the present invention is to provide a method for detecting mutations in the BCR-ABL fusion gene using PNA-based real-time PCR clamping.

본 발명의 다른 목적은 PNA 기반의 실시간 PCR 클램핑을 이용한 BCR-ABL 융합 유전자의 돌연변이 검출 키트를 제공하기 위한 것이다.Another object of the present invention is to provide a mutation detection kit of the BCR-ABL fusion gene using PNA-based real-time PCR clamping.

본 발명의 일 면은One aspect of the invention

BCR-ABL 융합 유전자중 ABL 유전자의 엑손 6 부위를 증폭시키는 BCR-ABL 융합 유전자 클램핑 프라이머 세트와, BCR-ABL 융합 유전자 중 ABL 유전자 엑손 6 코돈 315의 야생형과 완전하게 결합하는 PNA(Peptide Nucleic Acid) 클램핑 프로브의 존재 하에, BCR-ABL 융합 유전자에 대해 실시간 PCR(real-time Polymerase Chain Reaction)을 수행하고;A set of BCR-ABL fusion gene clamping primers that amplify the exon 6 site of the ABL gene in the BCR-ABL fusion gene, and a PNA (Peptide Nucleic Acid) that fully binds to the wild type of ABL gene exon 6 codon 315 in the BCR-ABL fusion gene In the presence of a clamping probe, perform real-time polymerase chain reaction (PCR) on the BCR-ABL fusion gene;

상기 실시간 PCR에 의한 유전자 증폭을 분석하여 BCR-ABL 융합 유전자의 코돈 315의 돌연변이 유무 또는 농도를 결정하는:Gene amplification by the real-time PCR is analyzed to determine the presence or absence of mutation of codon 315 of the BCR-ABL fusion gene:

단계를 포함하는, BCR-ABL 융합 유전자의 돌연변이 검출 방법에 관한 것이다.It relates to a method for detecting mutations in the BCR-ABL fusion gene, comprising the step.

본 발명의 바람직한 태양에서는, 실시간 PCR의 Ct(cycle threshold)값을 측정하여 BCR-ABL 융합 유전자의 돌연변이 유무 또는 농도를 결정한다.In a preferred embodiment of the present invention, the Ct (cycle threshold) value of real-time PCR is measured to determine the presence or absence of a mutation of the BCR-ABL fusion gene.

본 발명에 사용되는 PNA 클램핑 프로브는 바람직하게는 15 내지 30mer, 보다 바람직하게는 19 내지 23mer 길이의 염기서열로 이루어지는 것일 수 있으며, 예를 들어, 서열번호 1 내지 14의 염기서열 중 어느 하나로 이루어지는 것일 수 있다.The PNA clamping probe used in the present invention may be preferably composed of 15 to 30mer, more preferably 19 to 23mer in length of the base sequence, for example, consisting of any one of the base sequence of SEQ ID NO: 1 to 14 Can be.

본 발명에 사용되는 BCR-ABL 융합 유전자 클램핑 프라이머 세트는 ABL 유전자 엑손 6 야생형 코돈 315의 상류부분에 특이적으로 결합하는 정방향 프라이머와, 그의 하류부분에 특이적으로 결합하는 역방향 프라이머를 포함하는 것일 수 있다. 예를 들어, 본 발명의 BCR-ABL 융합 유전자 클램핑 프라이머 세트는 서열번호 17의 정방향 프라이머와 서열번호 18, 19 또는 21의 역방향 프라이머로 이루어지는 것이거나, 서열번호 20의 정방향 프라이머와 서열번호 21의 역방향 프라이머로 이루어지는 것일 수 있다.The BCR-ABL fusion gene clamping primer set used in the present invention may include a forward primer specifically binding to the upstream portion of the ABL gene exon 6 wild type codon 315, and a reverse primer specifically binding to the downstream portion thereof. have. For example, the BCR-ABL fusion gene clamping primer set of the present invention consists of a forward primer of SEQ ID NO: 17 and a reverse primer of SEQ ID NO: 18, 19, or 21, or a reverse of SEQ ID NO: 20 forward primer and SEQ ID NO: 21. It may be made of a primer.

본 발명에서 사용되는 BCR-ABL 융합 유전자는 대상 검체로부터 DNA 또는 RNA를 추출하여 준비될 수 있다.The BCR-ABL fusion gene used in the present invention may be prepared by extracting DNA or RNA from a subject sample.

본 발명에서는, DNA 인터컬레이팅(intercalating) 형광물질을 사용하여 유전자 증폭을 분석하는 바, 예를 들어 SYBR 그린 I, 에버그린, 에티디움브로마이드(EtBr), BEBO, YO-PRO-1, TO-PRO-3, LC 그린, SYTO-9, SYTO-13, SYTO-16, SYTO-60, SYTO-62, SYTO-64, SYTO-82, POPO-3, TOTO-3, BOBO-3 및 SYTOX 오렌지로 구성된 그룹으로부터 선택되는 하나 이상을 사용할 수 있다. DNA 인터컬레이션(intercalation)이 가능한 형광물질은 어느 것이라도 사용가능하며 특별한 제한은 없다.In the present invention, gene amplification is analyzed using DNA intercalating fluorescent materials, for example, SYBR Green I, Evergreen, Ethidium Bromide (EtBr), BEBO, YO-PRO-1, TO-PRO -3, consisting of LC green, SYTO-9, SYTO-13, SYTO-16, SYTO-60, SYTO-62, SYTO-64, SYTO-82, POPO-3, TOTO-3, BOBO-3 and SYTOX orange One or more selected from the group can be used. Any fluorescent material capable of DNA intercalation can be used, and there is no particular limitation.

본 발명에 따른 방법은 백혈병, 특히 골수성 백혈병의 치료를 결정하거나 진단하는데 사용할 수 있다.The method according to the invention can be used to determine or diagnose the treatment of leukemia, in particular myeloid leukemia.

본 발명의 다른 면은Another aspect of the invention

서열번호 1 내지 14중 어느 하나의 PNA 클램핑 프로브:PNA clamping probe of any one of SEQ ID NOs: 1-14:

를 포함하는, 본 발명에 따른 BCR-ABL 융합 유전자의 돌연변이 검출방법에 사용하기 위한 키트에 관한 것이다.It relates to a kit for use in the mutation detection method of the BCR-ABL fusion gene according to the present invention.

본 발명에 따르면, 암 발생, 예후 및 약제내성에 관여하는 것으로 예상되는 BCR-ABL 융합 유전자의 돌연변이를 단시간 내에 우수한 민감도 및 특이도로 극소량 포함되어 있는 돌연변이까지 검출할 수 있다. 또한 프로브로 이용된 PNA 자체가 생물학적 효소 및 물리적인 요소에 매우 안정하고 검출하는 방법이 매우 간단하며 단시간 내에 검출이 이루어지므로, 대량 분석 및 임상에서 사용하기에 매우 용이할 것으로 기대된다.According to the present invention, mutations of the BCR-ABL fusion gene, which are expected to be involved in cancer development, prognosis, and drug resistance, can be detected in a short time even in a very small amount with excellent sensitivity and specificity. In addition, since the PNA itself used as a probe is very stable to biological enzymes and physical elements, and the detection method is very simple and can be detected in a short time, it is expected to be very easy to use in mass analysis and clinical use.

도 1은 본 발명에 따른 PNA 기반의 실시간 PCR 클램핑 원리를 나타낸 모식도(a: RNA를 이용한 PNA 기반의 실시간 PCR 클램핑 원리, b: DNA를 이용한 PNA 기반의 실시간 PCR 클램핑 원리)이고;
도 2는 본 발명에서 고안된 서열번호 17의 정방향 프라이머와 서열번호 18의 역방향 프라이머로 이루어지는 프라이머 세트와 서열번호 17의 정방향 프라이머와 서열번호 19의 역방향 프라이머로 이루어지는 프라이머 세트의 비교를 통해 최적의 프라이머 세트를 선별하기 위하여 프라이머에 따른 검출 민감도(ΔCt)를 비교한 그래프이며;
도 3은 BCR-ABL 돌연변이를 가진 클론을 대상으로, 본 발명에서 고안된 서열번호 1 내지 3의 PNA 프로브를 이용하여 ABL 엑손 6 코돈 315 돌연변이를 검출하는 프로브의 효과를 비교 분석하기 위하여 프로브에 따른 검출 민감도(ΔCt)를 비교한 그래프이고;
도 4는 BCR-ABL 돌연변이를 가진 세포를 대상으로, 본 발명에서 고안된 서열번호 1 내지 3의 PNA 프로브를 이용하여 ABL 엑손 6 코돈 315 돌연변이를 검출하는 프로브의 효과를 비교 분석하기 위하여 프로브에 따른 검출 민감도(ΔCt)를 비교한 그래프이며;
도 5는 BCR-ABL 돌연변이를 가진 세포를 대상으로, 본 발명에서 고안된 서열번호 3의 PNA와 종래기술의 PNA 프로브를 이용하여 BCR-ABL 돌연변이 포함 농도에 따른 검출 민감도(ΔCt)를 비교한 그래프이고;
도 6은 종래 기술에 따른 PNA 기반 PCR 클램핑을 이용한 BCR-ABL 돌연변이 검출에 사용된 프라이머들 및 프로브들의 종류 및 위치를 나타낸 모식도이다.1 is a schematic diagram showing the PNA-based real-time PCR clamping principle according to the present invention (a: PNA-based real-time PCR clamping principle using RNA, b: PNA-based real-time PCR clamping principle using DNA);
2 is an optimal primer set by comparing a primer set consisting of a forward primer of SEQ ID NO: 17 and a reverse primer of SEQ ID NO: 18 and a primer set consisting of a forward primer of SEQ ID NO: 17 and a reverse primer of SEQ ID NO: 19 designed in the present invention It is a graph comparing the detection sensitivity (ΔC t ) according to the primer to select the;
Figure 3 is a clone with a BCR-ABL mutation, the detection according to the probe to compare the effect of the probe for detecting the ABL exon 6 codon 315 mutation using the PNA probe of SEQ ID NOS: 1 to 3 designed in the present invention A graph comparing the sensitivity (ΔC t );
Figure 4 is a detection according to the probe to compare the effect of the probe for detecting the ABL exon 6 codon 315 mutation using a PNA probe of SEQ ID NOS: 1 to 3 designed in the present invention in cells with BCR-ABL mutation A graph comparing the sensitivity (ΔC t );
Figure 5 is a graph comparing the detection sensitivity (ΔC t ) according to the concentration of BCR-ABL mutations using the PNA of SEQ ID NO: 3 designed in the present invention and a conventional PNA probe in a cell having a BCR-ABL mutation ego;
Figure 6 is a schematic diagram showing the type and location of the primers and probes used for the detection of BCR-ABL mutation using PNA-based PCR clamping according to the prior art.

본 발명은 BCR-ABL 융합 유전자 중 ABL 유전자 엑손 6 코돈 315의 돌연변이, 특히 T315I 돌연변이 검출을 위하여 야생형에 특이적으로 결합하는 PNA 프로브가 야생형의 증폭을 억제함으로써 소량의 돌연변이형만을 높은 민감도로 검출하는 방법 및 상기 방법에 사용하기 위한 키트에 관한 것이다.In the present invention, a PNA probe specifically binding to a wild type for detecting a mutation of the ABL gene exon 6 codon 315, in particular, a T315I mutation in the BCR-ABL fusion gene, detects only a small amount of mutant with high sensitivity by inhibiting amplification of the wild type. A method and kit for use in the method.

도 1에 본 발명에 따른 PNA 기반의 실시간 PCR 클램핑 방법의 원리를 모식적으로 나타내었다. 도 1의 a는 RNA를 이용한 방법의 원리를, 도 1의 b는 DNA를 이용한 방법의 원리를 나타낸 것이다.
Figure 1 schematically shows the principle of the PNA-based real-time PCR clamping method according to the present invention. Figure 1a shows the principle of the method using RNA, Figure 1b shows the principle of the method using DNA.

1. One. PNAPNA 클램핑Clamping 프로브의Of the probe 설계 및 제작 Design and build

본 발명의 PNA 프로브는 돌연변이가 발생할 수 있는 ABL 유전자 엑손 6 코돈 315의 야생형 유전자 서열에 완벽하게 결합할 수 있는(perfectly matched) 것으로서, 15개 이상, 바람직하게는 15~30개, 보다 바람직하게는 17~27개, 보다 더 바람직하게는 17~24개, 가장 바람직하게는 19~23개의 염기서열로 구성되는 것을 특징으로 한다.The PNA probes of the present invention are perfectly matched to the wild type gene sequence of the ABL gene exon 6 codon 315 where mutations can occur, and are preferably 15 or more, preferably 15 to 30, more preferably It is characterized by consisting of 17 to 27, even more preferably 17 to 24, most preferably 19 to 23 base sequences.

본 발명에서, ABL 유전자 엑손 6 코돈 315의 돌연변이는 '치환', 특히 트레오닌에서 이소류신으로의 치환(T315I)을 포함하는 것이다.In the present invention, the mutation of the ABL gene exon 6 codon 315 is to include 'substitution', in particular the substitution of threonine for isoleucine (T315I).

본 발명의 PNA 프로브는, 돌연변이가 발생할 수 있는 ABL 유전자 엑손 6 코돈 315의 야생형 유전자 부위가 프로브의 가운데에 위치하도록 고안된 것이 바람직하다. 예를 들어, 본 발명의 PNA 프로브는 아래 표 1에 기재한 서열번호 1 내지 14중 어느 하나의 염기서열로 구성될 수 있다. 상기 염기서열로부터 당업자가 통상의 지식을 이용하여 용이하게 변형할 수 있는 범위 내의 PNA 프로브 서열들은 모두 본 발명의 범위 내에 속하는 것으로 보아야 할 것인바, 본 발명에 따른 PNA 기반의 실시간 PCR 클램핑을 이용하여 증폭 사이클 차이만으로 ABL 유전자 엑손 6 코돈 315 돌연변이를 효과적으로 검출할 수 있는 것인 한, 본 발명의 범위 내에 포함되는 것이다.The PNA probe of the present invention is preferably designed such that the wild type gene region of the ABL gene exon 6 codon 315 where mutations can occur is located in the center of the probe. For example, the PNA probe of the present invention may be composed of any one of SEQ ID NOs: 1 to 14 shown in Table 1 below. PNA probe sequences within the range that can be easily modified by those skilled in the art from the nucleotide sequence using conventional knowledge should be considered to be within the scope of the present invention, using the PNA-based real-time PCR clamping according to the present invention As long as the amplification cycle difference can effectively detect the ABL gene exon 6 codon 315 mutation, it is within the scope of the present invention.

구체적으로는, 서열번호 1 내지 14는 ABL 엑손 6의 야생형 코돈 315(T315)와 완벽하게 결합하여 야생형의 증폭을 저해하고 돌연변이를 검출하기 위한 프로브이다. 코돈 315에서의 치환은 뉴클레오티드 947의 시토신(C)이 티민(T)으로 치환되는 것으로, BCR-ABL 융합 단백질의 키나제 부분에 변이를 일으킨다. 서열번호 1 내지 14는 엑손 6 코돈 315의 947번째 염기에 특이적으로 혼성화되도록 고안되었다. 서열번호 15는 문헌 [Kreuzer KA et al., Ann Hematol., 2003;82(5):284-9]에 개시된 PNA 프로브로서, 본 발명에 따른 PNA 프로브와 비교하기 위하여 제작하였다.Specifically, SEQ ID NOs. 1 to 14 are probes for completely binding with wild type codon 315 (T315) of ABL exon 6 to inhibit wild type amplification and to detect mutations. Substitution at codon 315 replaces cytosine (C) of nucleotide 947 with thymine (T), resulting in a mutation in the kinase portion of the BCR-ABL fusion protein. SEQ ID NOs: 1 to 14 are designed to hybridize specifically to the 947th base of exon 6 codon 315. SEQ ID NO: 15 is the PNA probe disclosed in Kreuzer KA et al., Ann Hematol., 2003; 82 (5): 284-9, and was prepared for comparison with the PNA probe according to the present invention.

서열번호SEQ ID NO: 이름name 염기서열( 5' → 3' )Sequence (5 '→ 3') 길이Length 1One T315I-1T315I-1 ATATCATCACTGAGTTCATGATATCATCACTGAGTTCATG 2020 22 T315I-2T315I-2 TCTATATCATCACTGAGTTCATGTCTATATCATCACTGAGTTCATG 2323 33 T315I-3T315I-3 CTATATCATCACTGAGTTCATGCTATATCATCACTGAGTTCATG 2222 44 T315I-4T315I-4 TATATCATCACTGAGTTCATGTATATCATCACTGAGTTCATG 2121 55 T315I-5T315I-5 TCTTTATCATCACTGAGTTCATGTCTTTATCATCACTGAGTTCATG 2323 66 T315I-AS-1T315I-AS-1 CATGAACTCAGTGATGATATCATGAACTCAGTGATGATAT 2020 77 T315I-AS-2T315I-AS-2 CATGAACTCAGTGATGATATAGACATGAACTCAGTGATGATATAGA 2323 88 T315I-AS-3T315I-AS-3 CATGAACTCAGTGATGATATAGCATGAACTCAGTGATGATATAG 2222 99 T315I-AS-4T315I-AS-4 CATGAACTCAGTGATGATATACATGAACTCAGTGATGATATA 2121 1010 T315I-AS-5T315I-AS-5 CATGAACTCAGTGATGATATCATGAACTCAGTGATGATAT 2020 1111 T315I-AS-6T315I-AS-6 ATGAACTCAGTGATGATATATGAACTCAGTGATGATAT 1919 1212 T315I-AS-7T315I-AS-7 AACTCAGTGATGATATAGAAACTCAGTGATGATATAGA 1919 1313 T315I-ASM-2T315I-ASM-2 CTTGAACTCAGTGATGATATAGACTTGAACTCAGTGATGATATAGA 2323 1414 T315I-ASM-3T315I-ASM-3 CTTGAACTCAGTGATGATATAGCTTGAACTCAGTGATGATATAG 2222 1515 STI-T315STI-T315 TTCTATATCATCACTGAGTTTTCTATATCATCACTGAGTT 2020

본 발명의 PNA 프로브는 반응효율 및 용해도를 증가시키기 위하여 N-말단(N-terminal) 또는 C-말단(C-terminal)에 친수성 기능기를 포함할 수 있으며, 예를 들어 N-말단 또는 C-말단에 친수성 링커나 아미노산, 또는 아민기를 1개 내지 여러 개 포함할 수 있다(Shakeel et al., J Chem Technol Biotechnol., 2006;81:892-9, Gildea et al., Tetrahedron Lett., 1998;39:7255-8, Demidov et al., PNAS., 2002;99:5953-8, Wang et al., Anal Chem., 1997;69:5200-2). 구체적으로, 본 발명에서는 N-말단에 라이신(lysine)이 1개 부착되거나, N-말단과 C-말단에 라이신(lysine)이 1개씩 부착된 프로브를 사용하였다.The PNA probe of the present invention may include a hydrophilic functional group at the N-terminal or C-terminal in order to increase reaction efficiency and solubility, for example, N-terminal or C-terminal It may contain one to several hydrophilic linkers, amino acids, or amine groups (Shakeel et al., J Chem Technol Biotechnol., 2006; 81: 892-9, Gildea et al., Tetrahedron Lett., 1998; 39 : 7255-8, Demidov et al., PNAS., 2002; 99: 5953-8, Wang et al., Anal Chem., 1997; 69: 5200-2). Specifically, in the present invention, a probe in which one lysine is attached to the N-terminus or one lysine is attached to the N-terminus and the C-terminus is used.

본 발명에서 사용되는 PNA 올리고머는 한국등록특허 제464,261호의 방법에 따라 Bts(Benzothiazolesulfonyl)기로 보호된 PNA 단량체, 또는 공지의 Fmoc(9-flourenylmethloxycarbonyl) 또는 t-Boc(t-butoxycarbonyl)으로 보호된 PNA 단량체를 이용하여 합성될 수 있다(Dueholm et al., J Org chem. 1994;59(19): 5767-73, Thomson et al., Tetrahedron, 1995;51(22): 6179-94).
The PNA oligomer used in the present invention is a PNA monomer protected with Bts (Benzothiazolesulfonyl) group, or a PNA monomer protected with known Fmoc (9-flourenylmethloxycarbonyl) or t-Boc (t-butoxycarbonyl) according to the method of Korean Patent No. 464,261. (Dueholm et al., J Org chem. 1994; 59 (19): 5767-73, Thomson et al., Tetrahedron, 1995; 51 (22): 6179-94).

2. 2. BCRBCR -- ABLABL 융합 유전자  Fusion gene 클램핑Clamping 프라이머의Primer 설계 및 제작 Design and build

본 발명에서 "BCR-ABL 융합 유전자 클램핑 프라이머"라 함은 PNA 프로브와 완벽하게 결합되어 있는 야생형 유전자의 증폭은 억제하고 PNA 프로브와 완벽하게 결합되어 있지 않는(즉, 불일치 서열이 존재하는) 돌연변이 유전자를 증폭시키는 PCR 프라이머를 가리킨다.In the present invention, the "BCR-ABL fusion gene clamping primer" refers to a mutant gene that suppresses amplification of the wild-type gene that is perfectly bound to the PNA probe and that is not completely bound to the PNA probe (that is, a mismatched sequence exists). Point out the PCR primers to amplify.

본 발명의 클램핑 프라이머는 특별히 제한되는 것은 아니나, 보다 높은 민감도 및 특이도로 돌연변이를 검출하기 위해서는 PNA 클램핑 프로브를 기준으로 하여 한 방향으로는 PNA 프로브와 일부분이 겹쳐지도록 하며 다른 한 방향으로는 검출하고자 하는 부위를 포함하되 PCR 증폭산물의 크기를 고려하여 고안하는 것이 바람직하다. 또한 PNA 프로브와의 Tm을 고려하고, 길이는 17mer에서 30mer 사이이며, PNA 프로브의 Tm 보다 낮게 설계하는 것이 바람직하다. 검출 민감도 및 특이도를 극대화할 수 있도록, 야생형과 상보적으로 결합하는 PNA 클램핑 프로브 서열 중 돌연변이가 일어나는 염기 바로 앞부분을 포함하도록 설계하는 것이 바람직하다.The clamping primer of the present invention is not particularly limited, but in order to detect mutations with higher sensitivity and specificity, a portion of the clamping primer overlaps with the PNA probe in one direction and the other direction is to be detected based on the PNA clamping probe. Including the site, it is preferable to devise in consideration of the size of the PCR amplification product. In addition, considering the T m with the PNA probe, the length is between 17mer and 30mer, it is preferable to design lower than the T m of the PNA probe. In order to maximize the detection sensitivity and specificity, it is preferable to design to include the portion immediately before the base of the mutation in the PNA clamping probe sequence that binds complementarily with the wild type.

구체적인 예에 따르면, 서열번호 1 내지 14의 PNA 프로브와 5 내지 12개의 염기서열이 중첩되도록 클램핑 프라이머를 설계하였다. 본 발명에서 예시된 서열번호 17의 정방향 프라이머는 서열번호 1 내지 5의 ABL 유전자 엑손 6의 코돈 315의 상류 부분 염기를 특이적으로 인식하도록 고안되었다. 본 발명에서 예시된 서열번호 17의 정방향 프라이머와 조합되는 서열번호 18의 역방향 프라이머 및 서열번호 19의 역방향 프라이머는 각각 ABL 유전자 엑손 6 부위의 113~132번째 염기 및 135~152번째 염기를 특이적으로 인식하도록 고안되었다. 서열번호 21의 역방향 프라이머는 서열번호 6 내지 14의 ABL 유전자 엑손 6의 코돈 315의 하류 부분 염기를 특이적으로 인식하도록 고안되었다. 본 발명에서 예시된 서열번호 21의 역방향 프라이머와 조합되는 서열번호 20의 정방향 프라이머는 ABL 유전자 인트론 5 부위의 -76 ~ -52번째 염기를 특이적으로 인식하도록 고안되었다. 프라이머의 길이는 18 mer에서 25 mer 사이로, 각각 프라이머 조합에 의한 증폭산물의 크기가 50 bp 내지 500 bp가 되도록 고안되었다.According to a specific example, the clamping primers were designed to overlap the PNA probes of SEQ ID NOs: 1 to 14 and 5 to 12 base sequences. The forward primer of SEQ ID NO: 17 exemplified herein is designed to specifically recognize the upstream partial base of codon 315 of the ABL gene exon 6 of SEQ ID NOs: 1-5. The reverse primer of SEQ ID NO: 18 and the reverse primer of SEQ ID NO: 19 combined with the forward primer of SEQ ID NO: 17 illustrated in the present invention specifically target the 113-132 base and 135-152 base of the ABL gene exon 6 site, respectively. It is designed to recognize. The reverse primer of SEQ ID NO: 21 was designed to specifically recognize the downstream partial base of codon 315 of the ABL gene exon 6 of SEQ ID NOs: 6-14. The forward primer of SEQ ID NO: 20 in combination with the reverse primer of SEQ ID NO: 21 exemplified herein is designed to specifically recognize the -76--52th base of the ABL gene intron 5 site. The primers were designed to be between 18 mer and 25 mer in length, with amplification products of 50 to 500 bp in size, respectively.

한편, ABL 유전자의 엑손 6의 염기서열분석을 통한 유전자 확인을 위하여 본 발명에서 제공되는 서열번호 16의 정방향 프라이머는 ABL 유전자 엑손 5 부위의 6~26번째 염기를 특이적으로 인식하도록 고안되었고, 상기 서열번호 16의 정방향 프라이머와 조합되는 역방향 프라이머는 서열번호 19로, ABL 유전자 엑손 6 부위의 135~152번째 염기를 특이적으로 인식하도록 고안된 것이다. 이들 프라이머는 조합되어 증폭산물의 크기가 832 bp가 되도록 고안되었다. 아래 표 2에 본 발명의 구체 예에서 사용되는 프라이머에 대한 설명을 나타내었다.On the other hand, the forward primer of SEQ ID NO: 16 provided in the present invention for gene identification through sequencing of exon 6 of the ABL gene is designed to specifically recognize the 6 to 26th base of the ABL gene exon 5 site, The reverse primer combined with the forward primer of SEQ ID NO: 16 is SEQ ID NO: 19, designed to specifically recognize the 135-152th base of the ABL gene exon 6 region. These primers were designed so that the size of the amplification product was 832 bp in combination. Table 2 below shows a description of the primer used in the embodiment of the present invention.

서열번호SEQ ID NO: 부위part 위치location 이름 name 방향direction 서열(5' → 3')Sequence (5 '→ 3') 길이Length 1616 엑손 5Exon 5 6 ~ 266 to 26 SC_T315I_F3SC_T315I_F3 정방향Forward GAGATCAAACACCCTAACCTGGAGATCAAACACCCTAACCTG 2121 1717 엑손 6Exon 6 17 ~ 3617 to 36 B T315I FC B T315I FC 정방향Forward GCCCCCGTTCTATATCATCAGCCCCCGTTCTATATCATCA 2020 1818 엑손 6Exon 6 113 ~ 132113-132 B T315I R B T315I R 역방향Reverse TCTGAGTGGCCATGTACAGCTCTGAGTGGCCATGTACAGC 2020 1919 엑손 6Exon 6 135 ~ 152135 to 152 S_T315I_R3S_T315I_R3 역방향Reverse GTACTCCATGGCTGACGAGTACTCCATGGCTGACGA 1818 2020 인트론 5Intron 5 -76 ~-52-76 to -52 B T315I F-2 B T315I F-2 정방향Forward GGCTTTTTCTTTAGACAGTTGTTTGGGCTTTTTCTTTAGACAGTTGTTTG 2525 2121 엑손 6Exon 6 38 ~5638-56 F_T315I_RC3F_T315I_RC3 역방향Reverse CCCGTAGGTCATGAACTCACCCGTAGGTCATGAACTCA 1919

3. 3. PNAPNA 기반의 실시간  Based real-time PCRPCR 클램핑을Clamping 이용한  Used BCRBCR -- ABLABL 융합 유전자 돌연변이 검출 Fusion Gene Mutation Detection

본 발명에 따른 BCR-ABL 융합 유전자 돌연변이 검출방법은BCR-ABL fusion gene mutation detection method according to the invention

(a) BCR-ABL 융합 유전자 클램핑 프라이머 세트와 PNA 클램핑 프로브의 존재 하에, BCR-ABL 융합 유전자에 대해 실시간 PCR을 수행하는 단계; 및(a) performing real-time PCR on the BCR-ABL fusion gene in the presence of a set of BCR-ABL fusion gene clamping primers and a PNA clamping probe; And

(b) 상기 실시간 PCR에 의한 유전자 증폭을 분석하여 BCR-ABL 융합 유전자의 돌연변이 유무 또는 농도를 결정하는 단계:(b) analyzing the gene amplification by the real-time PCR to determine the presence or absence of the mutation of the BCR-ABL fusion gene:

를 포함한다.It includes.

단계 (a)에서 사용되는 BCR-ABL 융합 유전자는 대상 검체로부터 추출하여 준비된다. 본 발명에서는 핵산추출에 특별한 제한이 없으며, 일반적으로 사용하는 모든 핵산 추출방법을 사용할 수 있다. 추출되는 핵산은 DNA 또는 RNA, 예를 들어 mRNA일 수 있으며, 예를 들어, 시판중인 DNA 또는 RNA 추출키트를 사용하여 환자의 혈액 또는 골수성 세포로부터 DNA 또는 RNA를 추출하여 준비된다. 추출된 RNA는 통상적인 방법에 따라 cDNA를 합성하여 사용한다.The BCR-ABL fusion gene used in step (a) is prepared by extracting from the subject sample. In the present invention, nucleic acid extraction is not particularly limited, and any nucleic acid extraction method that is generally used may be used. The nucleic acid to be extracted may be DNA or RNA, for example mRNA, and is prepared by extracting DNA or RNA from a patient's blood or myeloid cells, for example using commercially available DNA or RNA extraction kits. The extracted RNA is used to synthesize cDNA according to a conventional method.

단계 (a)에서는, 실시간 PCR 방법을 이용하여 BCR-ABL 융합 유전자의 돌연변이를 검출한다. 실시간 PCR 방법은 지수적인 증폭이 일어나는 초기 시료의 양을 형광물질의 지수적 증가가 탐지되기 시작하는 사이클의 수(Cycle threshold, 이하 'Ct'라고 칭한다)로 나타내므로 보다 정확한 정량분석이 가능하며 반응을 실시간으로 분석할 수 있다. 이 방법은 전기영동하여 영상분석기로 강도를 측정하는 단계가 생략되고 증폭산물의 증폭정도를 자동화, 수치화시켜 빠르고 간편하게 검출할 수 있는 방법이다.In step (a), mutation of the BCR-ABL fusion gene is detected using a real time PCR method. Real-time PCR method provides more accurate quantitative analysis because the amount of initial sample with exponential amplification is expressed as the number of cycles (Cycle threshold, hereinafter referred to as 'C t ') where the exponential increase in fluorescence is detected. The reaction can be analyzed in real time. This method eliminates the step of measuring the intensity with an electrophoresis image analyzer, and can be detected quickly and easily by automating and quantifying the amplification degree of the amplified product.

본 발명에서 실시간 PCR 클램핑의 반응물 중 PNA 클램핑 프로브는 1 내지 1000nM의 최종농도를 갖는 것이 바람직하다.In the present invention, it is preferable that the PNA clamping probe in the reaction product of real-time PCR clamping has a final concentration of 1 to 1000 nM.

본 발명에서는 인터컬레이팅(intercalating)법을 이용하여 형광을 검출하는바, 이 방법은 증폭된 이중가닥 DNA에 형광표지가 인터컬레이션(intercalation)되어 형광을 발하게 되는데, 이 때의 형광 강도를 측정함으로써 증폭산물의 생성량을 측정하게 된다. 이로써 어느 PCR 기기에나 적용할 수 있고 프라이머를 따로 제작하지 않아도 높은 민감도 및 특이도로 BCR-ABL 융합 유전자의 돌연변이를 검출할 수 있다.In the present invention, the fluorescence is detected by using an intercalating method. In this method, the fluorescent label is intercalated on the amplified double-stranded DNA to emit fluorescence, and the fluorescence intensity is measured at this time. As a result, the amount of amplified product produced is measured. This can be applied to any PCR device, it is possible to detect mutations of the BCR-ABL fusion gene with high sensitivity and specificity without the preparation of primers separately.

본 발명에서는 유전자 증폭산물을 확인하기 위한 형광물질로서 실시간 유전자 검출방법에 사용되는 DNA-결합 형광물질(DNA-binding fluorophore)을 사용하며 그 종류에 특별한 제한은 없다. 예를 들어, SYBR 그린 I 외에 에버그린, 에티디움브로마이드(EtBr), BEBO, YO-PRO-1, TO-PRO-3, LC 그린, SYTO-9, SYTO-13, SYTO-16, SYTO-60, SYTO-62, SYTO-64, SYTO-82, POPO-3, TOTO-3, BOBO-3, SYTOX 오렌지 등을 사용할 수 있다(Gudnason H et al., Nucleic Acids Res. 2007;35(19):e127, Bengtsson M et al., Nucleic Acids Res. 2003;31(8):e45).In the present invention, a DNA-binding fluorophore used in a real-time gene detection method is used as a fluorescent material for identifying gene amplification products, and there is no particular limitation on the type thereof. For example, in addition to SYBR Green I, Evergreen, Ethidium Bromide (EtBr), BEBO, YO-PRO-1, TO-PRO-3, LC Green, SYTO-9, SYTO-13, SYTO-16, SYTO-60, SYTO-62, SYTO-64, SYTO-82, POPO-3, TOTO-3, BOBO-3, SYTOX orange and the like can be used (Gudnason H et al., Nucleic Acids Res. 2007; 35 (19): e127 Bengtsson M et al., Nucleic Acids Res. 2003; 31 (8): e45).

단계 (b)에서는, 단계 (a)의 실시간 PCR에 의한 유전자 증폭을 분석하여 BCR-ABL 융합 유전자의 돌연변이 유무 또는 농도를 결정하는 바, 증폭된 Ct값을 비교하여 BCR-ABL 융합 유전자의 돌연변이 유무를 확인할 수 있다. 야생형 유전자와 혼성화되도록 고안된 PNA 프로브가 BCR-ABL 유전자의 야생형(예: T315)에 혼성화되면 증폭이 저해되어 Ct값이 높게 나타난다. 반면 BCR-ABL 유전자에 돌연변이(예: T315I)가 발생한 경우 PNA 프로브와 혼성화되지 못하고 증폭이 일어나 Ct값이 낮게 나타나게 된다. 하기 수학식 1에 나타낸 바와 같이, 양성 대조 시료로부터 얻어진 Ct값에서 미지의 시료로부터 얻어진 Ct값을 빼어 얻어진 △Ct의 값을 확인하여 각 코돈의 돌연변이 유무를 확인할 수 있다.In step (b), the amplification of the BCR-ABL fusion gene is determined by analyzing the gene amplification by real-time PCR in step (a). The amplification of the BCR-ABL fusion gene is compared by comparing the amplified C t values. You can check the presence or absence. When a PNA probe designed to hybridize with a wild-type gene hybridizes to a wild-type (eg T315) of the BCR-ABL gene, amplification is inhibited, resulting in high C t value. On the other hand, if a mutation (eg, T315I) occurs in the BCR-ABL gene, it will not hybridize with the PNA probe and amplification will result in a low C t value. To check the value of △ C t C t obtained by subtracting the value obtained from the sample of the unknown from the C t value, obtained from a positive control sample as shown in equation (1) can be confirmed by the presence or absence of the mutation of each codon.

[수학식 1][Equation 1]

△Ct = 양성대조 시료로부터 얻어진 Ct값 - 미지의 시료로부터 얻어진 Ct값△ C t = C t obtained from a positive control sample value - C t value obtained from the sample of unknown

[양성대조 시료: 야생형 유전자 시료, 미지의 시료: 돌연변이 유무 또는 농도를 측정하고자 하는 시료][Positive control sample: wild type gene sample, unknown sample: mutation or sample to be measured]

돌연변이형 유전자가 다량 포함되어 있을수록 Ct값이 낮게 나타나게 되므로 △Ct 차이가 클수록 돌연변이가 다량 포함되어 있는 것으로 판단할 수 있다.Since the larger the mutant gene is included, the lower the C t value is. Therefore, the greater the ΔC t difference, the larger the mutation.

본 발명의 PNA 기반의 실시간 PCR 클램핑을 이용한 BCR-ABL 돌연변이 검출 방법은 백혈병, 특히 골수성 백혈병 환자의 치료 또는 진단에 이용할 수 있으며, BCR-ABL 신호 전달 체계에 관여하는 기작을 연구하는 데에도 매우 유용하게 사용될 수 있다. 또한 개체군-기초 연구와 같이 다량의 시료 분석을 요구하는 연구에도 효과적으로 적용될 수 있다.
BCR-ABL mutation detection method using PNA-based real-time PCR clamping of the present invention can be used for the treatment or diagnosis of leukemia, especially myeloid leukemia patients, and is very useful for studying the mechanism involved in the BCR-ABL signaling system. Can be used. It can also be effectively applied to studies that require large sample analysis, such as population-based studies.

이하, 본 발명을 실시예에 의해 보다 구체적으로 설명하나, 이는 본 발명의 이해를 돕기 위한 것일 뿐 본 발명의 범위를 어떤 식으로든 제한하고자 하는 것은 아니다.
Hereinafter, the present invention will be described in more detail with reference to Examples, which are intended to aid the understanding of the present invention but are not intended to limit the scope of the present invention in any way.

실시예 1: BCR-ABL 융합 유전자 중 ABL 유전자의 엑손 6에 존재하는 코돈 315 야생형의 증폭을 억제하기 위한 PNA 프로브 합성Example 1 Synthesis of PNA Probe for Inhibiting Amplification of Codon 315 Wild-type in Exon 6 of ABL Gene in BCR-ABL Fusion Gene

BCR-ABL 융합 유전자중 ABL 유전자의 엑손 6 코돈 315의 야생형(T315)과 완벽하게 결합하는 14개의 PNA 프로브를 상기 표 1에 나타낸 바와 같이 제작하였다. 각 코돈의 야생형과 완벽하게 결합하는 프로브는 돌연변이와의 효과적인 분리를 위하여 돌연변이가 일어나는 염기서열이 프로브의 중간에 위치하도록 고안하였다. 한국등록특허 제464,261호에 기재된 방법에 따라, PNA 프로브를 합성하였다(Lee H et al., Org Lett. 2007;9(17):3291-3).
Of the BCR-ABL fusion genes, 14 PNA probes that perfectly bind to the wild type (T315) of exon 6 codon 315 of the ABL gene were constructed as shown in Table 1 above. Probes that perfectly bind to the wild type of each codon are designed so that the mutant sequence is located in the middle of the probe for effective isolation from the mutation. According to the method described in Korean Patent No. 464,261, a PNA probe was synthesized (Lee H et al., Org Lett. 2007; 9 (17): 3291-3).

실시예Example 2:  2: BCRBCR -- ABLABL 융합 유전자 중  Among the fusion genes ABLABL 유전자 엑손 6의 표적핵산 증폭 및  Target nucleic acid amplification of gene exon 6 and 클램핑Clamping PCR을 위한  For PCR 프라이머primer 합성 synthesis

BCR-ABL 융합 유전자중 ABL 유전자 엑손 6의 표적핵산의 증폭 및 클램핑 PCR을 위하여 ABL 엑손 6 부위를 분석하여 프라이머를 제작하였다. ABL 엑손 6 의 야생형 및 돌연변이 유전자를 확인하기 위한 서열번호 16(정방향) 및 서열번호 19(역방향)로 이루어진 프라이머 세트와, ABL 엑손 6 코돈 315의 클램핑 프라이머로 서열번호 17의 프라이머(정방향), 및 서열번호 18 또는 21의 프라이머(역방향)로 이루어진 프라이머 세트를 합성하였다. 또한, 엑손 6 코돈 315의 클램핑에 사용된 역방향 프라이머로는 ABL 엑손 6의 유전자를 확인하기 위하여 고안된 서열번호 19의 역방향 프라이머를 동일하게 사용하였다. ABL 엑손 6 코돈 315의 또 하나의 클램핑 프라이머로서 서열번호 21의 역방향 프라이머와 조합하여 사용되는 서열번호 20의 정방향 프라이머를 합성하였다. 사용한 프라이머의 서열은 상기 표 2에 나타낸 바와 같다. 프라이머는 ㈜바이오니아(한국)에 의뢰하여 합성하였다.
Primers were prepared by analyzing the ABL exon 6 site for amplification and clamping PCR of the target nucleic acid of the ABL gene exon 6 in the BCR-ABL fusion gene. A primer set consisting of SEQ ID NO: 16 (forward) and SEQ ID NO: 19 (reverse) for identifying wild type and mutant genes of ABL exon 6, a primer of SEQ ID NO: 17 with a clamping primer of ABL exon 6 codon 315, and A primer set consisting of the primers of SEQ ID NO: 18 or 21 (reverse direction) was synthesized. In addition, as the reverse primer used for clamping the exon 6 codon 315, the reverse primer of SEQ ID NO: 19 designed to identify the gene of ABL exon 6 was used in the same manner. The forward primer of SEQ ID NO: 20 used in combination with the reverse primer of SEQ ID NO: 21 as another clamping primer of ABL exon 6 codon 315 was synthesized. The sequence of the used primer is as Table 2 above. Primer was synthesized by BIONIA (Korea).

실시예 3: BCR-ABL 융합 유전자 중 ABL 유전자 엑손 6의 표적핵산을 제조하기 위한 돌연변이유발 및 클론제조Example 3: Mutagenesis and Cloning to Produce Target Nucleic Acid of ABL Gene Exon 6 in BCR-ABL Fusion Gene

인간의 전체 DNA를 이용하여 서열번호 16 및 19의 프라이머 세트를 사용하여 ABL 엑손 6 부분의 유전자를 증폭하였다. 증폭된 핵산을 pGEM-T 이지 벡터(Promega, USA)에 결찰하고 대장균(Escherichia coli) JM 109 세포에 형질전환하여 DNA를 대량 확보하였다. 변이 유전자를 가진 클론을 확보하기 위해 상기한 방법으로 제조된 정상 클론을 이용하여 돌연변이용 프라이머를 제작하고, 부위특이적 돌연변이유발 키트(Stratagene, USA)를 사용하여 변이 유전자를 가진 클론을 확보하였다. 확보된 클론은 염기서열분석으로 그 변이 여부를 확인하였다.
The gene of the ABL exon 6 part was amplified using the primer sets of SEQ ID NOs: 16 and 19 using human whole DNA. The amplified nucleic acid was ligated into pGEM-T easy vector (Promega, USA) and Escherichia coli ) JM 109 cells were transformed to obtain a large amount of DNA. In order to obtain a clone with a mutant gene was prepared a primer for mutation using a normal clone prepared by the above-described method, using a site-specific mutagenesis kit (Stratagene, USA) to obtain a clone with a mutant gene. The clone was confirmed by sequencing the mutation.

실시예 4: BCR-ABL 융합 유전자중 ABL 유전자 엑손 6의 야생형 세포주(cell line)로부터의 핵산 추출Example 4 Nucleic Acid Extraction from Wild-Type Cell Line of ABL Gene Exon 6 in BCR-ABL Fusion Gene

BCR-ABL 융합 유전자중 ABL 유전자 엑손 6의 야생형 핵산을 확보하기 위하여, 한국세포주은행(Korean Cell Line Bank, KCLB)으로부터 세포주를 분양받았다. 야생형 세포주로 K562 인간 만성 골수성 백혈병 세포주[KCLB10243, 한국세포주은행(KCLB), 서울, 한국]를 분양 받았다. 분양 받은 세포주는 RPMI1640(Hyclone, Thermo scientific, USA) 또는 MEM(WelGENE, 한국)에 10% 열-불활성화 우태아혈청(FBS, Hyclone, Thermo scientific, USA)과 1× 페니실린-스트렙토마이신(WelGENE, 한국)이 첨가된 배지를 사용하여 37℃, 5% 이산화탄소(CO2)가 유지되는 배양기에서 배양하였다. 배양된 세포주는 고순도 PCR 주형 제조 키트(High Pure PCR Template Preparation Kit)(Roche, USA)를 사용하여 키트에서 제공한 매뉴얼에 의거하여 DNA 및 RNA를 추출하여 표적핵산을 확보하였다. 확보된 핵산은 나노드롭 스펙트로포토미터(ND 2000C, Thermo Scientific, USA)를 사용하여 정량하고 -20℃ 와 -80℃에 보관하여 사용하였다. 인간 세포주로부터 각각 분리한 DNA를 상기 표 2에 기재되어 있는 서열번호 16 및 19의 프라이머 세트를 적용하여 ABL 엑손 6의 유전자를 증폭하였다. RNA는 cDNA 합성 후 동일한 프라이머 세트를 적용하여 ABL 엑손 6의 유전자를 증폭하였다. 증폭된 PCR 산물을 Labopass™ PCR 정제 키트(코스모진텍, 한국)를 사용하여 정제한 후 염기서열분석하여 유전자형을 확인하였다. 유전자형이 확인된 야생형 세포주는 본 발명의 PNA 프로브를 이용한 실시간 PCR 방법의 검체로 사용하였다.
In order to secure wild-type nucleic acid of ABL gene exon 6 in the BCR-ABL fusion gene, a cell line was obtained from the Korean Cell Line Bank (KCLB). As a wild-type cell line, K562 human chronic myeloid leukemia cell line [KCLB10243, Korea Cell Line Bank (KCLB), Seoul, Korea] was distributed. Cell lines received were 10% heat-inactivated fetal bovine serum (FBS, Hyclone, Thermo scientific, USA) and 1 × penicillin-streptomycin (WelGENE,) in RPMI1640 (Hyclone, Thermo scientific, USA) or MEM (WelGENE, Korea). Korea) was used to culture in an incubator maintained at 37 ℃, 5% carbon dioxide (CO 2 ). The cultured cell line was extracted with DNA and RNA according to the manual provided in the kit using a high purity PCR template preparation kit (Roche, USA) to obtain target nucleic acids. The obtained nucleic acid was quantified using a nanodrop spectrophotometer (ND 2000C, Thermo Scientific, USA) and stored at -20 ° C and -80 ° C. DNAs isolated from human cell lines, respectively, were subjected to amplification of the gene of ABL exon 6 by applying the primer sets of SEQ ID NOs: 16 and 19 described in Table 2 above. RNA amplified the gene of ABL exon 6 by applying the same primer set after cDNA synthesis. The amplified PCR product was purified using Labopass ™ PCR purification kit (Cosmogenetech, Korea), and then genotyped by sequencing. Genotype confirmed wild-type cell line was used as a sample of the real-time PCR method using the PNA probe of the present invention .

실시예 5: BCR-ABL 융합 유전자중 ABL 유전자의 엑손 6 코돈 315에 대한 PNA 프로브를 이용한 실시간 PCR 클램핑 방법 확립Example 5 Establishment of Real-Time PCR Clamping Method Using PNA Probe for Exon 6 Codon 315 of ABL Gene in BCR-ABL Fusion Gene

실시예 3에서의 클론으로부터 추출된 플라스미드 DNA와 실시예 4에서의 세포주로부터 추출된 DNA 및 RNA를 대상으로 하여, 실시예 1에서 제작된 BCR-ABL 융합 유전자의 돌연변이를 검출하는 PNA 프로브들을 이용하여 하기 조건으로 실시간 PCR 클램핑을 수행하여 결과를 비교 분석함으로써 최적의 PNA 프로브를 찾고자 하였다.Using plasmid DNA extracted from the clone in Example 3 and DNA and RNA extracted from the cell line in Example 4, using PNA probes for detecting mutations in the BCR-ABL fusion gene prepared in Example 1 Real-time PCR clamping was performed under the following conditions to compare and analyze the results to find the optimal PNA probe.

클론에서 추출된 플라스미드 DNA 용액 1 ㎕ 또는 세포주에서 추출된 주형 DNA 용액(50 ng/㎕) 1 ㎕, 표 2에 나타난 1개의 클램핑 센스 프라이머(10 pmoles/㎕) 1 ㎕, 안티센스 프라이머(10 pmoles/㎕) 1 ㎕, 표 1에 나타낸 프로브 중 1개의 클램핑 프로브(100nM) 1 ㎕, 2× IQ Sybr 그린 슈퍼믹스(Bio-Rad, USA) 10 ㎕, 증류수 6 ㎕를 가하고 실시간 DNA 증폭기(Real-time PCR machine, CFX96TM Real-Time PCR System, Bio-RAD사 제품)를 이용하여 95℃에서 3분 동안 반응시킨 후 95℃ 30초 그리고 PNA가 혼성화될 수 있는 70℃에서 20초 반응을 추가하고, 63℃ 30초, 72℃ 30초 반응과정을 40회 반복하였다. 형광은 72℃ 중합반응 단계에서 측정하였다.1 μl of plasmid DNA solution extracted from clone or 1 μl of template DNA solution (50 ng / μl) extracted from cell line, 1 μl of one clamping sense primer (10 pmoles / μl) shown in Table 2, antisense primer (10 pmoles / 1 μl), 1 μl of one of the clamping probes (100 nM) of the probes shown in Table 1, 10 μl of 2 × IQ Sybr Green Supermix (Bio-Rad, USA), 6 μl of distilled water were added and a real-time DNA amplifier (Real-time) was added. PCR machine, CFX96TM Real-Time PCR System, manufactured by Bio-RAD) for 3 minutes at 95 ° C., followed by 30 seconds at 95 ° C. and 20 seconds at 70 ° C. where PNA can hybridize, 63 The reaction process was repeated 40 times at 30 ° C. and 72 ° C. for 30 seconds. Fluorescence was measured at 72 ° C. polymerization step.

상기 프로브들 중 서열번호 1 내지 3의 프로브를 적용하여 엑손 6의 코돈 315 야생형의 증폭을 저해하고 돌연변이를 검출하는 효과를 두 세트의 프라이머(서열번호 17과 18, 및 서열번호 17과 19)로 확인한 결과를 도 2에 나타내었다. 도 2에 나타난 바와 같이, 서열번호 17과 서열번호 18을 이용한 정방향 클램핑에서는 서열번호 4의 PNA 프로브가 매우 우수한 효과를 나타냈으며, 서열번호 17과 19를 이용한 정방향 클램핑에서는 서열번호 1 내지 4의 PNA 프로브가 우수한 효과를 나타내는 것으로 확인되었다.Among the probes, the effects of inhibiting the amplification of the codon 315 wild type of exon 6 and detecting a mutation by applying the probes of SEQ ID NOs: 1 to 3 were set to two sets of primers (SEQ ID NOs: 17 and 18, and SEQ ID NOs: 17 and 19). The confirmed result is shown in FIG. As shown in Figure 2, in the forward clamping using SEQ ID NO: 17 and SEQ ID NO: 18, the PNA probe of SEQ ID NO: 4 showed a very good effect, in the forward clamping using SEQ ID NO: 17 and 19 PNA of SEQ ID NO: 1 to 4 The probe was found to show excellent effects.

서열번호 1 내지 14의 프로브 중 대표적으로 서열번호 1, 2 및 3의 프로브를 적용하여 엑손 6의 코돈 315 야생형의 증폭을 저해하고 돌연변이를 검출하는 효과를 확인한 결과를 도 3에 나타내었다. 도 3에 나타난 바와 같이. 적용한 모든 프로브가 우수한 효과를 나타내며, 특히 서열번호 2의 PNA 프로브가 돌연변이를 검출하는 데 보다 우수한 효과를 나타내는 것으로 확인되었다.
Among the probes of SEQ ID NOS: 1 to 14, the results of confirming the effect of inhibiting the amplification of codon 315 wild type of exon 6 and detecting mutations by applying the probes of SEQ ID NOs: 1, 2, and 3 are shown in FIG. 3. As shown in FIG. 3. All the probes applied showed excellent effects, in particular, the PNA probe of SEQ ID NO: 2 was found to have a better effect in detecting mutations.

실시예Example 6:  6: PNAPNA 프로브를Probe 이용한 실시간  Real time using PCRPCR 클램핑Clamping 방법을 통한  Through the way BCRBCR -- ABLABL 융합 유전자의 돌연변이 검출 Mutation Detection in Fusion Genes

실시예 5에서 확립된 실시간 PCR을 이용한 방법을 사용하여 야생형 유전자에 돌연변이 유전자를 각각 100%, 50%, 10%, 5%, 1%, 0.5% 및 0.1% 포함하도록 샘플을 제작하여 돌연변이 유전자의 농도와 Ct값 사이의 상관관계를 분석하여, 돌연변이형의 검출한계를 확인하였다.Using the method using the real-time PCR established in Example 5 to prepare a sample containing the mutant gene 100%, 50%, 10%, 5%, 1%, 0.5% and 0.1% of the wild type gene, respectively The correlation between the concentration and the C t value was analyzed to confirm the detection limit of the mutant.

도 4에 ABL 엑손 6 코돈 315 돌연변이를 가진 세포주를 대상으로 서열번호 1 내지 3의 PNA 프로브를 이용하여 돌연변이 유전자의 비율에 따른 검출 민감도(ΔCt)를 비교한 결과를 나타내었다. 도 4에 나타난 바와 같이, 서열번호 2 및 3의 PNA 프로브는 0.5%의 돌연변이를 함유한 시료까지 검출 가능한 것으로 나타났다.
Figure 4 shows the results of comparing the detection sensitivity (ΔC t ) according to the ratio of the mutant gene using a PNA probe of SEQ ID NOS: 1 to 3 in a cell line having an ABL exon 6 codon 315 mutation. As shown in FIG. 4, the PNA probes of SEQ ID NOs: 2 and 3 were found to be detectable up to samples containing 0.5% mutation.

비교예Comparative example 1:  One: BCRBCR -- ABLABL 돌연변이 검출을 위한 종래기술과의 비교 Comparison with the prior art for mutation detection

문헌 [Kreuzer KA et al., Ann Hematol., 2003;82(5):284-9]에 개시된 PNA 프로브와 본 발명에 따른 PNA 프로브를 비교하기 위하여, 상기 표 1에 나타낸 서열번호 15의 PNA 프로브를 제작하였다.In order to compare the PNA probe disclosed in Kreuzer KA et al., Ann Hematol., 2003; 82 (5): 284-9 with the PNA probe according to the present invention, the PNA probe of SEQ ID NO: 15 shown in Table 1 above Was produced.

상기 선행문헌의 프로브와 본 발명에 따른 프로브를 이용한 실시간 PCR을 수행하여 돌연변이 검출 여부를 확인하였다.Real-time PCR was performed using the probes of the prior art and the probes according to the present invention to determine whether mutations were detected.

그 결과를 도 5에 나타내었다. 도 5에서 확인할 수 있는 바와 같이, 돌연변이 유전자 비율에 따른 검출 민감도를 비교한 결과, 선행문헌에 개시된 PNA 프로브는 돌연변이 유전자 비율 5%까지 검출 가능한데 비해, 본 발명에 따른 PNA 프로브는 돌연변이 유전자 비율 0.5%까지 검출 가능하여 10배 정도 높은 검출 민감도를 갖는 것으로 확인되었다.The results are shown in Fig. As can be seen in Figure 5, comparing the detection sensitivity according to the ratio of the mutant gene, the PNA probe disclosed in the prior document can detect up to 5% of the mutant gene ratio, the PNA probe according to the present invention is 0.5% of the mutant gene ratio It was detected that up to 10 times higher detection sensitivity was detected.

<110> Panagene Inc. <120> Methods and kits for the detection of BCR-ABL fusion gene mutant using PNA mediated Real-time PCR clamping <160> 21 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 1 atatcatcac tgagttcatg 20 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 2 tctatatcat cactgagttc atg 23 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 3 ctatatcatc actgagttca tg 22 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 4 tatatcatca ctgagttcat g 21 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 5 tctttatcat cactgagttc atg 23 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 6 catgaactca gtgatgatat 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 7 catgaactca gtgatgatat aga 23 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 8 catgaactca gtgatgatat ag 22 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 9 catgaactca gtgatgatat a 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 10 catgaactca gtgatgatat 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 11 atgaactcag tgatgatat 19 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 12 aactcagtga tgatataga 19 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 13 cttgaactca gtgatgatat aga 23 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 14 cttgaactca gtgatgatat ag 22 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 15 ttctatatca tcactgagtt 20 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 16 gagatcaaac accctaacct g 21 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 17 gcccccgttc tatatcatca 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 18 tctgagtggc catgtacagc 20 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 19 gtactccatg gctgacga 18 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 20 ggctttttct ttagacagtt gtttg 25 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 21 cccgtaggtc atgaactca 19 <110> Panagene Inc. Methods and kits for the detection of BCR-ABL fusion gene mutant          using PNA mediated Real-time PCR clamping <160> 21 <170> Kopatentin 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 1 atatcatcac tgagttcatg 20 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 2 tctatatcat cactgagttc atg 23 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 3 ctatatcatc actgagttca tg 22 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 4 tatatcatca ctgagttcat g 21 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 5 tctttatcat cactgagttc atg 23 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 6 catgaactca gtgatgatat 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 7 catgaactca gtgatgatat aga 23 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 8 catgaactca gtgatgatat ag 22 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 9 catgaactca gtgatgatat a 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 10 catgaactca gtgatgatat 20 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 11 atgaactcag tgatgatat 19 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 12 aactcagtga tgatataga 19 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 13 cttgaactca gtgatgatat aga 23 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 14 cttgaactca gtgatgatat ag 22 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PNA clamping probe <400> 15 ttctatatca tcactgagtt 20 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 16 gagatcaaac accctaacct g 21 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 17 gcccccgttc tatatcatca 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 18 tctgagtggc catgtacagc 20 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 19 gtactccatg gctgacga 18 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 20 ggctttttct ttagacagtt gtttg 25 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 21 cccgtaggtc atgaactca 19

Claims (12)

BCR-ABL 융합 유전자중 ABL 유전자의 엑손 6 부위를 증폭시키는 BCR-ABL 융합 유전자 클램핑 프라이머 세트와, BCR-ABL 융합 유전자중 ABL 유전자 엑손 6 코돈 315의 야생형과 완전하게 결합하는 PNA(Peptide Nucleic Acid) 클램핑 프로브의 존재 하에, BCR-ABL 융합 유전자에 대해 실시간 PCR(real-time Polymerase Chain Reaction)을 수행하고;
상기 실시간 PCR에 의한 유전자 증폭을 분석하여 BCR-ABL 융합 유전자의 코돈 315의 돌연변이 유무 또는 농도를 결정하는:
단계를 포함하는, BCR-ABL 융합 유전자의 돌연변이 검출 방법.A set of BCR-ABL fusion gene clamping primers that amplify the exon 6 site of the ABL gene in the BCR-ABL fusion gene, and a PNA (Peptide Nucleic Acid) that completely binds to the wild type of ABL gene exon 6 codon 315 in the BCR-ABL fusion gene In the presence of a clamping probe, perform real-time polymerase chain reaction (PCR) on the BCR-ABL fusion gene;
Gene amplification by the real-time PCR is analyzed to determine the presence or absence of mutation of codon 315 of the BCR-ABL fusion gene:
A method of detecting mutations in the BCR-ABL fusion gene, comprising the steps. 제1항에 있어서, 실시간 PCR의 Ct(cycle threshold)값을 측정하여 BCR-ABL 융합 유전자의 돌연변이 유무 또는 농도를 결정하는, BCR-ABL 융합 유전자의 돌연변이 검출 방법.The method of claim 1, wherein the presence or absence of a mutation of the BCR-ABL fusion gene is determined by measuring a cycle threshold (C t ) value of real-time PCR. 제1항 또는 제2항에 있어서, PNA 클램핑 프로브는 15 내지 30mer 길이의 염기서열로 이루어지는 것인, BCR-ABL 융합 유전자의 돌연변이 검출 방법.The method of claim 1 or 2, wherein the PNA clamping probe consists of 15 to 30mer long sequence, mutation detection method of the BCR-ABL fusion gene. 제3항에 있어서, PNA 클램핑 프로브는 19 내지 23mer 길이의 염기서열로 이루어지는 것인, BCR-ABL 융합 유전자의 돌연변이 검출 방법.The method of claim 3, wherein the PNA clamping probe consists of 19-23mer long nucleotide sequences, the mutation detection method of the BCR-ABL fusion gene. 제4항에 있어서, PNA 클램핑 프로브는 서열번호 1 내지 14의 염기서열 중 어느 하나로 이루어지는 것인, BCR-ABL 융합 유전자의 돌연변이 검출 방법.The method of claim 4, wherein the PNA clamping probe consists of any one of the nucleotide sequences of SEQ ID NOs: 1 to 14, mutation detection method of the BCR-ABL fusion gene. 제1항 또는 제2항에 있어서, BCR-ABL 융합 유전자 클램핑 프라이머 세트는 ABL 유전자 엑손 6 야생형 코돈 315의 상류부분에 특이적으로 결합하는 정방향 프라이머와, 그의 하류부분에 특이적으로 결합하는 역방향 프라이머를 포함하는 것인, BCR-ABL 융합 유전자의 돌연변이 검출 방법.The set of claim 1 or 2, wherein the BCR-ABL fusion gene clamping primer set comprises a forward primer that specifically binds upstream of the ABL gene exon 6 wild type codon 315, and a reverse primer that specifically binds downstream thereof. That includes, BCR-ABL fusion gene mutation detection method. 제6항에 있어서, BCR-ABL 융합 유전자 클램핑 프라이머 세트는 서열번호 17의 정방향 프라이머와 서열번호 18, 19 또는 21의 역방향 프라이머로 이루어지는 것이거나, 서열번호 20의 정방향 프라이머와 서열번호 21의 역방향 프라이머로 이루어지는 것인, BCR-ABL 융합 유전자의 돌연변이 검출 방법.The method of claim 6, wherein the BCR-ABL fusion gene clamping primer set consists of the forward primer of SEQ ID NO: 17 and the reverse primer of SEQ ID NO: 18, 19 or 21, or the forward primer of SEQ ID NO: 20 and the reverse primer of SEQ ID NO: 21 It consists of, the mutation detection method of the BCR-ABL fusion gene. 제1항 또는 제2항에 있어서, BCR-ABL 융합 유전자는 대상 검체로부터 DNA 또는 RNA를 추출하여 준비되는 것인, BCR-ABL 융합 유전자의 돌연변이 검출 방법.The method of claim 1, wherein the BCR-ABL fusion gene is prepared by extracting DNA or RNA from a subject sample. 제1항 또는 제2항에 있어서, DNA 인터컬레이팅(intercalating) 형광물질을 사용하여 유전자 증폭을 분석하는, BCR-ABL 융합 유전자의 돌연변이 검출 방법.The method for detecting mutation of a BCR-ABL fusion gene according to claim 1 or 2, wherein the gene amplification is analyzed using DNA intercalating fluorophores. 제9항에 있어서, DNA 인터컬레이팅 형광물질은 SYBR 그린 I, 에버그린, 에티디움브로마이드(EtBr), BEBO, YO-PRO-1, TO-PRO-3, LC 그린, SYTO-9, SYTO-13, SYTO-16, SYTO-60, SYTO-62, SYTO-64, SYTO-82, POPO-3, TOTO-3, BOBO-3 및 SYTOX 오렌지로 구성된 그룹으로부터 선택되는 하나 이상의 것인, BCR-ABL 융합 유전자의 돌연변이 검출 방법.10. The method of claim 9, wherein the DNA intercalating fluorescent material is SYBR Green I, Evergreen, Ethidium Bromide (EtBr), BEBO, YO-PRO-1, TO-PRO-3, LC Green, SYTO-9, SYTO-13 BCR-ABL fusion, at least one selected from the group consisting of SYTO-16, SYTO-60, SYTO-62, SYTO-64, SYTO-82, POPO-3, TOTO-3, BOBO-3 and SYTOX orange Method for detecting mutation of genes. 제1항 또는 제2항에 있어서, 백혈병의 치료를 결정하거나 진단하는데 사용하기 위한, BCR-ABL 융합 유전자의 돌연변이 검출 방법.The method of claim 1 or 2, wherein the mutation detection method of the BCR-ABL fusion gene for use in determining or diagnosing the treatment of leukemia. 서열번호 1 내지 14중 어느 하나의 PNA 클램핑 프로브:
를 포함하는, 제5항에 따른 BCR-ABL 융합 유전자의 돌연변이 검출방법에 사용하기 위한 키트.PNA clamping probe of any one of SEQ ID NOs: 1-14:
A kit for use in a method for detecting mutations in the BCR-ABL fusion gene according to claim 5.
KR1020100112072A 2010-11-11 2010-11-11 Methods and kits for the detection of BCR-ABL fusion gene mutant using PNA mediated Real-time PCR clamping KR101875199B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020100112072A KR101875199B1 (en) 2010-11-11 2010-11-11 Methods and kits for the detection of BCR-ABL fusion gene mutant using PNA mediated Real-time PCR clamping
PCT/KR2011/008056 WO2012064035A2 (en) 2010-11-11 2011-10-27 Method and kit for detecting bcr-abl fusion gene mutation using pna-based real-time pcr clamping

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020100112072A KR101875199B1 (en) 2010-11-11 2010-11-11 Methods and kits for the detection of BCR-ABL fusion gene mutant using PNA mediated Real-time PCR clamping

Publications (2)

Publication Number Publication Date
KR20120088891A true KR20120088891A (en) 2012-08-09
KR101875199B1 KR101875199B1 (en) 2018-07-06

Family

ID=46051373

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020100112072A KR101875199B1 (en) 2010-11-11 2010-11-11 Methods and kits for the detection of BCR-ABL fusion gene mutant using PNA mediated Real-time PCR clamping

Country Status (2)

Country Link
KR (1) KR101875199B1 (en)
WO (1) WO2012064035A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018199136A1 (en) * 2017-04-26 2018-11-01 大塚製薬株式会社 Method for measuring expression level of abl1 t315i mutation
JPWO2018199137A1 (en) * 2017-04-26 2020-03-12 大塚製薬株式会社 Method for detecting minor BCR-ABL1 gene

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6531312B2 (en) * 2014-10-17 2019-06-19 東洋鋼鈑株式会社 Method for detecting BCR-ABL inhibitor resistance related mutation and data acquisition method for predicting BCR-ABL inhibitor resistance using the same
CN105441568B (en) * 2016-01-06 2019-01-08 武汉海吉力生物科技有限公司 For detecting primer, probe and the kit of mankind BCR-ABL fusion T315I mutation
CN108256295B (en) * 2016-12-29 2021-10-22 安诺优达基因科技(北京)有限公司 Device for detecting gene fusion
CN107760768A (en) * 2017-11-09 2018-03-06 上海赛安生物医药科技股份有限公司 BRAF gene mutation detection architecture and its kit
CN108671958B (en) * 2018-06-06 2020-11-06 青岛科技大学 Dual-ion two-dimensional organic porous material and preparation method thereof

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018199136A1 (en) * 2017-04-26 2018-11-01 大塚製薬株式会社 Method for measuring expression level of abl1 t315i mutation
JPWO2018199137A1 (en) * 2017-04-26 2020-03-12 大塚製薬株式会社 Method for detecting minor BCR-ABL1 gene
EP3617326A4 (en) * 2017-04-26 2021-01-06 Otsuka Pharmaceutical Co., Ltd. Method for detecting minor bcr-abl1 gene

Also Published As

Publication number Publication date
KR101875199B1 (en) 2018-07-06
WO2012064035A3 (en) 2012-07-19
WO2012064035A2 (en) 2012-05-18

Similar Documents

Publication Publication Date Title
AU2007275140B2 (en) Method for the detection of EGFR mutations in blood samples
KR101875199B1 (en) Methods and kits for the detection of BCR-ABL fusion gene mutant using PNA mediated Real-time PCR clamping
KR101819938B1 (en) Methods and kits for the EGFR mutant detection using PNA mediated Real-time PCR clamping
KR20070011354A (en) Detection of strp, such as fragile x syndrome
KR101851382B1 (en) Method for inhibiting nucleic acid amplification using light and highly sensitive method for selective nucleic acid amplification
JP4216266B2 (en) High-sensitivity known mutant gene detection method and EGFR mutant gene detection method
KR20110036646A (en) Method of detecting variation and kit to be used therein
KR101953092B1 (en) Peptide nucleic acid probe for multiplex-detecting BCR/ABL negative MPN related gene mutations, composition for multiplex-detecting gene mutation there of, gene mutation detecting multiplex kit and gene mutation detecting multiplex methods
KR101825117B1 (en) Methods and kits for the BRAF mutant detection using PNA mediated Real-time PCR clamping
KR101825121B1 (en) Methods and kits for the PIK3CA mutant detection using PNA mediated Real-time PCR clamping
KR20110109627A (en) Methods and kits for genotyping of warfarin metabolism-associated genes using pna mediated real-time pcr clamping
KR20120119571A (en) Jak2 v617f mutation detection kit using methods and kits for the mutant detection using pna mediated real-time pcr clamping
KR101819937B1 (en) Methods and kits for the K-ras mutant detection using PNA mediated Real-time PCR clamping
KR101927884B1 (en) Methods and kits for genotyping of MTHFR gene using PNA mediated Real-Time PCR clamping
KR20110130638A (en) Methods and kits for analyzing methylation of gene using pna mediated real-time pcr clamping
JP6153758B2 (en) Polymorph detection probe, polymorph detection method, drug efficacy determination method, and polymorph detection kit
KR101569127B1 (en) Probe for detecting polymorphism, method of detecting polymorphism, method of evaluating drug efficacy, disease prediction method and reagent kit for detecting polymorphism
MX2015003386A (en) Method for detection of braf and pi 3k mutations.
JP4945732B2 (en) Methods for determining sensitivity to drugs
KR20130125533A (en) Methods and kits for the c-kit mutant detection using pna mediated real-time pcr clamping
KR20120127679A (en) Method and kit for detecting IDH1, IDH2 mutation using PNA mediated Real-time PCR clamping
CN110997938A (en) Method for determining expression level of ABL 1T 315I mutation
EP4317455A1 (en) Target nucleic acid amplification method using guide probe and clamping probe and composition for amplifying target nucleic acid comprising same
KR20190054585A (en) Composition and method for detecting mutation
WO2006051990A1 (en) Diagnostic method using nucleic acid amplification

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E90F Notification of reason for final refusal
E701 Decision to grant or registration of patent right