WO2011093664A2 - （１ｓ,２ｓ,３ｓ,４ｓ）-５- 아미노사이클로펜탄 - １,２,３,４- 테트라올을 포함하는 항비만 조성물. - Google Patents

（１ｓ,２ｓ,３ｓ,４ｓ）-５- 아미노사이클로펜탄 - １,２,３,４- 테트라올을 포함하는 항비만 조성물. Download PDF

Info

Publication number
WO2011093664A2
WO2011093664A2 PCT/KR2011/000591 KR2011000591W WO2011093664A2 WO 2011093664 A2 WO2011093664 A2 WO 2011093664A2 KR 2011000591 W KR2011000591 W KR 2011000591W WO 2011093664 A2 WO2011093664 A2 WO 2011093664A2
Authority
WO
WIPO (PCT)
Prior art keywords
obesity
composition
formula
preventing
active ingredient
Prior art date
Application number
PCT/KR2011/000591
Other languages
English (en)
French (fr)
Other versions
WO2011093664A3 (ko
Inventor
정영훈
지옥표
오좌섭
안은경
이정아
김인수
이경일
Original Assignee
성균관대학교 산학협력단
재단법인 경기과학기술진흥원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 성균관대학교 산학협력단, 재단법인 경기과학기술진흥원 filed Critical 성균관대학교 산학협력단
Publication of WO2011093664A2 publication Critical patent/WO2011093664A2/ko
Publication of WO2011093664A3 publication Critical patent/WO2011093664A3/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/13—Amines
    • A61K31/133—Amines having hydroxy groups, e.g. sphingosine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/04—Nitro compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents

Definitions

  • the present invention relates to (1S, 2S, 3S, 4S) -5-aminocyclopentane-1,2,3,4-tetraol ((1S, 2S, 3S, 4S) -5-aminocyclopentane-1,2,3, Anti-obesity composition comprising 4-tetraol).
  • Obesity refers to a condition in which the body has an excessive amount of fat. Excessive calorie intake, endocrine disorders, lack of exercise, genetic factors, etc. Among them, the accumulation of excess energy is most directly related. Obesity is a simple (intrinsic) obesity and endocrine disease (insulin-dependent diabetes mellitus, Cushing's syndrome, ovarian insufficiency, hypothyroidism) or hypothalamic disorders (a feeling of bloat in the brain) Symptomatic obesity that causes obesity due to causes such as central disorder.
  • the hypothalamus of the human body has an intake center and the center of gravity to control the feeling of fullness, if there is any organic disorders in the appetite control by eating too much food and obesity occurs.
  • an endocrine gland in the front of the head if hormone endocrine function decreases, basal metabolism decreases and calorie consumption is reduced, resulting in obesity.
  • Obesity due to excessive secretion of corticosteroids is a representative obesity in endocrine obesity and may occur when a large amount of corticosteroids are used for a long time in the treatment of kidney or liver disease.
  • Cushing syndrome increases the secretion of corticosteroids (ACTH) to stimulate the adrenal cortex, resulting in excessive production of cortisol resulting in central fat cell proliferation.
  • lipoprotein lipase LPL is regulated by the female hormone estrogen.When secretion is reduced after menopause, subcutaneous fat synthesis is promoted, and excess secretion of insulin promotes fat production. As it accumulates, obesity is caused. Because men have a lot of LPL, abdominal obesity is caused.
  • This obesity is a stimulant to induce adult disease, metabolic disorders increase the risk of type 2 diabetes, arteriosclerosis, and puts a burden on the heart blood supply, heart disease, the remaining fat burden the liver, fatty liver, Gallstones, cirrhosis of the liver. As the weight puts stress on bones and joints, skeletal abnormalities occur, and activity slows down due to the slowing behavior, obesity becomes more severe due to lack of exercise. Causes skin eczema and a lot of sweat.
  • the Body Mass Index is a method of evaluating the degree of obesity by using height and weight.
  • the weight (kg) is the height (m) squared.
  • Divided by (BMI kg / m 2).
  • Waist measurement is a very useful indicator of the amount of abdominal fat.Body fat measurement is expressed as a percentage of fat weight in the total body weight. The normal value is 15-18% for adult men and 20-25% for women. .
  • Drugs that act on the central nervous system include drugs such as fenfluramine and dexfenfluramine that inhibit the serotonin (5HT) nervous system according to their respective mechanisms, drugs such as ephedrine and caffeine through the noradrenaline nervous system, and recently serotonin and noradrenaline nervous system.
  • Drugs such as sibutramine that act and inhibit obesity are commercially available.
  • drugs that inhibit obesity by acting on the gastrointestinal tract include orlistat, recently approved as an obesity treatment agent, which inhibits lipase produced in the pancreas and reduces fat absorption.
  • fenfluramine has been banned in recent years because of side effects such as primary pulmonary hypertension or heart valve lesions, and other drugs also have problems such as decreased blood pressure and lactic acidosis, resulting in heart failure and renal disease.
  • the patient has a problem that cannot be used.
  • adipocyte differentiation inhibitors have emerged as a method for preventing or treating obesity with low side effects.
  • Fat stored in adipocytes is used as an important energy source in the body, but as obesity progresses, not only does the adipocytes increase in number, but the synthesis of a large amount of triglycerides due to the differentiation of excessive adipocytes involves an increase in the size of the adipocytes. It is accompanied by a change in the expression of several genes. The increase in the size of fat cells is caused by synthesizing and storing surplus energy in the form of triglycerides.
  • the increase in the size of fat cells can be increased by about 20 times in diameter, and as a result, the cell volume is known to increase by several thousand times.
  • the size of adipocytes is generally controlled by diet, but the process of differentiating new adipocytes into adipocytes is not effective as dietary control. It is important to adjust. Adipocyte differentiation is promoted by stimulation of insulin, insulin like growth factor-1, growth hormone, etc., and in the process, CCAAT enhancer-binding protein (C / EBP) family, PPAR- ⁇ (peroxisome) An increase in transcription factors such as proliferator-activated receptors is observed.
  • the present inventors have an effect that (1S, 2S, 3S, 4S) -5-aminocyclopentane-1,2,3,4-tetraol, which is a known compound, inhibits the differentiation of fat precursor cells into adipocytes.
  • the present invention was completed by confirming that it can be used for the prevention or treatment of obesity.
  • Another object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of obesity.
  • Still another object of the present invention is to provide a food composition for preventing or improving obesity.
  • Still another object of the present invention is to provide a quasi-drug composition for the prevention or improvement of obesity.
  • Another object of the present invention to provide a cosmetic composition for the prevention or improvement of obesity.
  • an anti-obesity composition comprising a compound represented by the following formula (1) as an active ingredient.
  • compositions for the prevention or treatment of obesity comprising the above composition as an active ingredient.
  • a food composition for the prevention or improvement of obesity comprising the above composition as an active ingredient.
  • a quasi-drug composition for the prevention or improvement of obesity comprising the above-mentioned composition as an active ingredient.
  • a cosmetic composition for the prevention or improvement of obesity comprising the above composition as an active ingredient.
  • a method for treating obesity comprising administering to a subject having or likely to develop obesity in a pharmaceutically effective amount of the pharmaceutical composition for preventing or treating obesity described above. do.
  • composition comprising (1S, 2S, 3S, 4S) -5-aminocyclopentane-1,2,3,4-tetraol of the present invention inhibits the proliferation of adipocytes into adipocytes, and thus obesity or obesity It can be useful for the prevention or treatment of various diseases that can be caused by.
  • Figure 2 shows the effect of (1S, 2S, 3S, 4S) -5-aminocyclopentane-1,2,3,4-tetraol to inhibit the differentiation of pro-dipotent cells into adipocytes through oil red O staining and analysis. It is a photograph showing the result of microscopic observation.
  • Figure 3 is a graph measuring the cytotoxicity (cytotoxicity) of (1S, 2S, 3S, 4S) -5-aminocyclopentane-1,2,3,4-tetraol.
  • 5 is a graph showing the results of real-time PCR of C / EBPa and GLUT4.
  • Figure 6 is a graph showing the results of real-time PCR of Adiponectin and ADD1 / SREBP1c.
  • the compound of formula 1 may be not only a compound of formula 1, but also an isomer thereof, preferably an optical isomer and a pharmaceutically acceptable salt thereof.
  • the present invention provides an anti-obesity composition comprising the compound represented by the following formula (1) as an active ingredient.
  • the present invention provides a use of the compound represented by the following formula (1) to prepare an anti-obesity composition.
  • the compound of formula 1 according to the present invention can be used for the prevention or treatment of obesity because it inhibits the differentiation of adipocytes into adipocytes by inhibiting the activity of peroxisome proliferator-activated receptor (PPAR- ⁇ ).
  • PPAR- ⁇ peroxisome proliferator-activated receptor
  • Obesity may increase the likelihood of developing diabetes or hyperlipidemia, and may increase the risk of developing sexual dysfunction, arthritis, and cardiovascular disease.
  • cholelithiasis may be caused by obesity, and in some cases, cancer may also be caused.
  • the composition may be useful for preventing or treating various diseases related to obesity in addition to obesity.
  • the compound represented by Chemical Formula 1 can be synthesized by a known method. For example, a high yield of (1S, 2S, 3S, 4S) -5-aminocyclopentane-1,2,3,4-tetraol can be obtained through the synthesis procedure shown in Scheme 1 below.
  • the present invention provides a pharmaceutical composition for the prevention or treatment of obesity comprising an anti-obesity composition comprising the compound represented by the following formula (1) as an active ingredient as an active ingredient.
  • the present invention provides a use of the compound represented by the following Chemical Formula 1 as an anti-obesity agent.
  • the present invention provides a method for preventing or treating obesity, comprising administering a compound represented by the following formula (1) to a subject.
  • prevention means any action that inhibits obesity or delays the onset by administration of a composition.
  • treatment means all the actions that improve or beneficially change the symptoms caused by obesity by administration of the composition.
  • the compound represented by the formula (1) of the present invention can be used in the form of a pharmaceutically acceptable salt, as the salt is an acid addition salt formed by a pharmaceutically acceptable free acid is useful.
  • Acid addition salts include inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid and aliphatic mono and dicarboxylates, phenyl-substituted alkanoates, hydroxy alkanoates and alkanes. Obtained from non-toxic organic acids such as dioates, aromatic acids, aliphatic and aromatic sulfonic acids.
  • Such pharmaceutically nontoxic salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate chloride, bromide, and iodide.
  • the acid addition salt according to the present invention is dissolved in a conventional method, for example, the compound represented by Chemical Formula 1 in an excess of aqueous acid solution, and the salt is water-miscible organic solvent such as methanol, ethanol, acetone or aceto. It can be prepared by precipitation using nitrile.
  • the compound represented by Formula 1 of the present invention can be used to make a pharmaceutically acceptable metal salt using a base.
  • Alkali metal or alkaline earth metal salts are obtained, for example, by dissolving a compound in an excess of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and evaporating and drying the filtrate. At this time, it is pharmaceutically suitable to prepare sodium, potassium or calcium salt as the metal salt.
  • Corresponding silver salts are also obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (eg silver nitrate).
  • the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier.
  • the composition comprising a pharmaceutically acceptable carrier may be in a variety of oral or parenteral formulations. When formulated, diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, which may comprise at least one excipient such as starch, calcium carbonate, sucrose or lactose ( lactose) and gelatin. In addition to simple excipients, lubricants such as magnesium stearate, talc and the like are also used.
  • Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups, and various excipients such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin, may be used.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations, suppositories.
  • the non-aqueous solvent and the suspension solvent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used.
  • As the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • the pharmaceutical composition is any one selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, liquid solutions, emulsions, syrups, sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations and suppositories. It can have one formulation.
  • composition of the present invention is administered in a pharmaceutically effective amount.
  • the term "pharmaceutically effective amount” refers to an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level refers to the individual type and severity, age, sex, type of virus infected. , The activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of treatment, factors including the concurrent drug and other factors well known in the medical field.
  • the compositions of the present invention may be administered as individual therapeutic agents or in combination with other therapeutic agents and may be administered sequentially or simultaneously with conventional therapeutic agents. And single or multiple administrations. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, and can be easily determined by those skilled in the art.
  • composition of the present invention can be used alone or in combination with methods using surgery, hormone therapy, drug therapy and biological response modifiers for the prevention or treatment of obesity.
  • the present invention provides a method of treating obesity comprising administering the pharmaceutical composition for preventing or treating obesity in a pharmaceutically effective amount to the individual having the onset or the likelihood of obesity.
  • the term "individual” means all animals including humans who are already obese or may be obese and effectively prevents obesity by administering to a subject a composition comprising a compound represented by Formula 1 of the present invention. It can be cured.
  • the composition of the present invention can be used to treat obese humans.
  • the composition of the present invention can be administered in parallel with existing obesity treatments.
  • the route of administration of the composition may be administered via any general route as long as it can reach the desired tissue.
  • the composition of the present invention may be administered as desired, but is not limited to intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, intranasal administration, pulmonary administration, rectal administration.
  • the composition may also be administered by any device in which the active agent may migrate to the target cell.
  • the present invention provides a food composition for preventing or improving obesity comprising the above-described anti-obesity composition as an active ingredient.
  • the anti-obesity composition comprising the compound represented by Formula 1 of the present invention may be added to a food composition for preventing or improving obesity.
  • the composition may be added as it is, or used with other foods or food ingredients, and may be appropriately used according to conventional methods.
  • the mixed amount of the active ingredient can be determined suitably according to the purpose of use (prevention, health or therapeutic treatment).
  • the composition of the present invention is added in an amount of 0.01 to 10% by weight, preferably 0.05 to 1% by weight based on the raw materials.
  • the amount may be used below the above range.
  • Examples of the food to which the substance can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, ice cream, various soups, drinks, tea, drinks, Alcoholic beverages and vitamin complexes, and the like and include all of the health foods in the conventional sense.
  • the health beverage composition of the present invention may contain various flavors or natural carbohydrates, etc. as additional components, as in the general beverage.
  • the above-mentioned natural carbohydrates are glucose, monosaccharides such as fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, sugar alcohols such as xylitol, sorbitol and erythritol.
  • sweetening agent natural sweetening agents such as tautin and stevia extract, synthetic sweetening agents such as saccharin and aspartame, and the like can be used.
  • the proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 ml of the composition of the present invention.
  • the composition of the present invention includes various nutrients, vitamins, electrolytes, flavors, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, And a carbonation agent used for the carbonated beverage.
  • the composition of the present invention may contain a pulp for the production of natural fruit juices, fruit juice drinks and vegetable drinks. These components can be used independently or in combination. The proportion of such additives is not critical but is usually selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention. These components can be used independently or in combination.
  • the present invention provides a quasi-drug composition for the prevention or improvement of obesity comprising the above-described anti-obesity composition as an active ingredient.
  • the composition of the present invention can be added to the quasi-drug composition for the purpose of preventing or improving obesity.
  • the anti-obesity composition containing the compound of Formula 1 of the present invention is used as a quasi-drug additive, the composition may be added as it is or used with other quasi-drug components, and may be appropriately used according to a conventional method.
  • the mixed amount of the active ingredient may be appropriately determined depending on the purpose of use (prevention, health or therapeutic treatment).
  • the quasi-drug composition may be an antiseptic agent, a shower foam, a gagreen, a wet tissue, a detergent soap, a hand wash, a humidifier filler, a mask, an ointment, or a filter filler.
  • the present invention provides a cosmetic composition for the prevention or improvement of obesity comprising the above-described anti-obesity composition as an active ingredient.
  • the composition of the present invention may be added to the cosmetic composition for the purpose of preventing or improving obesity.
  • the anti-obesity composition comprising the compound of Formula 1 of the present invention
  • the composition may be added as it is or used with other cosmetic ingredients, and may be appropriately used according to a conventional method.
  • the mixed amount of the active ingredient may be appropriately determined depending on the purpose of use (prevention, health or therapeutic treatment).
  • the formulation of the cosmetic composition is supple cosmetics, astringent cosmetics, nourishing cosmetics, nutrition cream, massage cream, essence, eye cream, eye essence, cleansing cream, cleansing foam, cleansing water, pack, powder, body lotion, body Creams, body oils, body essences, makeup bases, foundations, hair dyes, shampoos, rinses or body cleansers.
  • 3T3-L1 adipocytes were obtained from Korea Research Institute of Bioscience and Biotechnology. 3T3-L1 is widely used in experiments to study the metabolic processes of adipocytes. As the differentiation of the cells becomes more active, fat accumulation in the adipocytes becomes more active, leading to obesity. When a substance that is thought to have an anti-obesity effect is treated to the cells, the less the differentiation of cells, the more the anti-obesity effect is considered to be a substance.
  • 3T3-L1 a mouse precursor cell
  • BCS DMEM medium 10% BCS DMEM medium
  • 3T3-L1 progenitor cells were maintained for 2 more days at the time of 100% confluency.
  • Preadipocytes induced adipocyte differentiation for 2 days with 10% FBS DMEM medium containing MDI (0.5 mM 3-isobutyl-1-methylxanthine (IBMX), 1 uM dexamethasone, 1 ug / ml insulin).
  • MDI 0.5 mM 3-isobutyl-1-methylxanthine (IBMX), 1 uM dexamethasone, 1 ug / ml insulin
  • the cells were incubated for 2 days with 10% FBS DMEM containing 1 ug / ml insulin. It was then replaced with 10% FBS DMEM culture for 4 days every 2 days. While inducing adipocyte differentiation, the (1S, 2S, 3S, 4S) -5-aminocyclopentane-1,2,3,4-tetraol samples prepared in Preparation Example 1 were prepared at concentrations of 60, 80 and 100 uM. Each culture was treated, and the degree of adipocyte differentiation was observed on day 8, when differentiation was completed.
  • Oil red O staining was performed to check the degree of fat accumulation.
  • the degree of differentiation of adipocytes induced in Example 1-2 was confirmed primarily through a microscope through oil red O staining, and the degree of adipocyte staining was measured by the amount of differentiated fat of cells at 510 nm absorbance.
  • the results are shown in FIGS. 1 and 2. From FIG. 1 and FIG. 2 gradually note from (1S, 2S, 3S, 4S) -5-aminocyclopentane-1,2,3,4-tetraol sample to 60, 80 and 100 uM It was confirmed that the inhibitory effect increased.
  • 3T3-L1 cells were aliquoted into 5 ⁇ 10 3 / well dogs in 96 well plates and incubated for one day at 37 ° C. and 5% CO 2 .
  • the (1S, 2S, 3S, 4S) -5-aminocyclopentane-1,2,3,4-tetraol samples were treated at concentrations of 20 uM, 40 uM, 60 uM, 80 uM and 100 uM, respectively
  • cytotoxicity was confirmed through MTT. It was measured at 540 nM absorbance by ELISA, the results are shown in FIG. Referring to Figure 3, it was observed that the cytotoxicity was not induced according to the concentration.
  • the pGL3-PPRE luciferase reporter gene, PPAR ⁇ and pRL-SV-40 plasmid were transfected into HEK 293T cells. After expressing the genes for one day, the cells (1S, 2S, 3S, 4S) -5-aminocyclopentane-1,2,3,4-tetraol samples 60, 80 and 100 uM and PPAR ⁇ inducer 10 uM Troglitazone Were treated together for 24 hours.
  • the amount of expression of C / EBPa and PPAR ⁇ is increased in differentiated adipocytes.
  • the expression of most adipokines is also increased.
  • Differentiation for 8 days after treatment of (1S, 2S, 3S, 4S) -5-aminocyclopentane-1,2,3,4-tetraol samples at 60, 80 and 100 uM concentrations as induction of adipocyte differentiation The expression levels of C / EBPa and PPAR ⁇ and genes involved in adipocyte differentiation (Table 1) were confirmed by real-time PCR. After 3T3-L1 cells were completely differentiated and washed with PBS twice, cell pellets were collected and RNA was separated using RNA prep kit.
  • CDNA was synthesized using 1 ug of extracted RNA, and real-time PCR was performed using SYBR green and primer. GAPDH was used as a control gene.
  • Results of expression levels of genes involved in the differentiation of C / EBPa and PPAR ⁇ and adipocytes are shown in FIGS. 5 to 8. 5 to 8, it can be seen that the expression of genes involved in C / EBPa and PPAR ⁇ and adipocyte differentiation was significantly inhibited as the concentration was increased from 0 uM to 100 uM. In particular, in the case of aP2 Even when only 60 uM treatment was confirmed that the gene expression was significantly suppressed.
  • 3T3-L1 cells were treated with (1S, 2S, 3S, 4S) -5-aminocyclopentane-1,2,3,4-tetraol samples at two-day intervals, and then the cells were treated with PBS. After washing twice, cells were lysed using RIPA buffer (50 mM Tris-HCl, pH 8.0, 150 mM sodium chloride, 1% NP-40, 0.5% sodium dexycholate, 0.1% sodium dodecyl sulfate, protease inhibitor). Protein was extracted and quantified by centrifugation at 13000 rpm for 30 minutes, and electrophoresis was performed using 8% SDS-PAGE gel.
  • RIPA buffer 50 mM Tris-HCl, pH 8.0, 150 mM sodium chloride, 1% NP-40, 0.5% sodium dexycholate, 0.1% sodium dodecyl sulfate, protease inhibitor.
  • Electrophoretic proteins were transferred to the membrane and blocked with TBST containing 5% skim milk. After reacting with the primary antibody (PPAR ⁇ , C / EBPa) and the secondary antibody, PPAR ⁇ and C / EBPa proteins were identified through ECL, and the results are shown in FIG. 9.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Child & Adolescent Psychology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

본 발명은 (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올을 포함하는 항비만 조성물에 관한 것으로, (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올이 지방전구세포에서 전구세포로의 분화를 억제하므로, 비만 또는 비만과 관련된 다양한 질환의 예방 또는 치료에 유용하게 사용될 수 있다.

Description

（１Ｓ,２Ｓ,３Ｓ,４Ｓ）-５- 아미노사이클로펜탄 - １,２,３,４- 테트라올을 포함하는 항비만 조성물.
본 발명은 (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올 ((1S,2S,3S,4S)-5-aminocyclopentane-1,2,3,4-tetraol)을 포함하는 항비만 조성물에 관한 것이다.
비만은 체내에 지방이 과잉 축적된 상태를 말하며 그 원인으로는 지나친 열량 섭취, 내분비 장애, 운동 부족, 유전적 요인 등이 있지만 그 중에서도 과잉에너지 축적이 가장 직접적으로 관계된다. 비만은 다른 특별한 원인 없이 섭취에너지에 비해 소비에너지가 적을 때 초래되는 단순성 (본태성) 비만과 내분비질환 (인슐린 의존성 당뇨병, 쿠싱 증후군, 난소 기능 부전, 갑상선 기능 저하)이나 시상하부장애 (뇌의 만복감 중추장해 시 나타난다) 등의 원인으로 인해 비만이 되는 증후성 비만이 있다.
또한, 비만의 요인 중에서 유전자가 관련된 사실은 여러 연구를 통해 알려져 있다. 비만은 잘못된 생활습관으로부터 많이 발생하지만, 식욕을 스스로의 의지로 조절할 수 없는 경우에는 유전자 등의 물질적인 근거가 있다는 연구결과가 보고되었다. 즉, 유전성 비만 마우스로부터 비만 유전자 (ob 유전자)가 발견되었다. 상기 비만 유전인자는 식욕을 억제하는 렙틴 (leptin)이라는 단백질을 만든다. 유전성 비만 마우스에서는 이 렙틴 구조에 변이가 생겨 작용이 안 되어 식욕을 억제하지 못하여 과식을 하게 되어 비만에 이르게 되는 것이다. 사람에 있어서도 일반적으로 비만자가 혈중 렙틴 농도가 상승하고 있는 데도 불구하고 식욕이 억제되지 않는 것은 렙틴에 대한 감수성이 낮기 때문이다. 병적인 비만에서는 체내에서 만들어지는 단백질 구조가 유전성 비만 마우스에 나타난 것과 매우 유사한 결과가 확인되었다. 최근에는 아드레날린 수용체에서 이상을 일으키는 유전자가 존재하고 있음을 추정하는 연구결과도 보고되었다. 지방조직의 아드레날린 수용체 특히 베타 3-수용체는 지방을 분해하고 에너지로 바꾸는데 관여하고 있는데, 여기에서 유전자의 이상이 생기면 소비에너지가 저하되어 살이 찌게 되는 것이다.
현대는 스트레스 시대라고 할 만큼 일상생활에서 압박을 많이 받고 있으며, 이러한 정신불안과 욕구 불만을 해소하기 위해 음식 섭취를 증가시키는 반면에 신체 활동은 감소하였으므로 에너지 대사에 불균형이 초래되어 비만이 될 수 있다. 피곤하거나 화가 났을 때 과식할 수 있고 어떤 문제가 발생했을 때도 음식섭취를 통해 그 문제를 보상하거나 도피하려는 경향이 있다. 이런 행동은 어렸을 때 습득된다. 즉, 음식과의 관련 여부를 떠나서 모든 생리적, 심리적 욕구를 대신 채워주기 위해 음식을 제공받아 온 아이들의 경우 이런 식으로 음식을 이용하는 것을 배우게 된다. 비만인 사람 중에는 의지력이나 자제력이 부족하여 식욕과 체중조절을 못하는 경우가 많다.
인체의 시상하부에는 섭취 중추와 만복감을 조절하는 중추가 있으며, 만약 여기에 어떠한 기질적 장애가 생기면 식욕조절을 못하게 됨으로써 음식을 과잉으로 섭취하게 되어 비만이 일어난다. 두부의 전면에 있는 내분비선인 갑상선에서 만약 호르몬 내분비기능이 저하되면 기초대사가 저하되어 열량소비가 감소되기 때문에 비만이 된다. 그러나, 비만인의 모두가 갑상선 기능에 장애가 있는 것은 아니다. 부신피질 호르몬의 과잉분비로 인한 비만은 내분비성 비만의 대표적인 비만으로 신장 또는 간 질환의 치료에 있어 다량의 부신피질 스테로이드제를 오랫동안 사용했을 때에 발생 되는 경우가 있다. 쿠싱증후군 (Cushing syndrome)은 부신피질 자극호르몬 (ACTH)분비를 상승하게 하여 부신피질을 자극함으로써 코티솔이 과잉으로 생성되어 중심부 지방세포 증식을 초래한다. 여성은 여성호르몬인 에스트로겐에 의해 지단백 분해효소 (lipoprotein lipase, LPL)가 조절되는데 폐경 이후에 분비가 감소되면 피하지방 합성이 촉진되고 인슐린의 과잉분비로 지방생성이 촉진되며, 지방 분해가 억제되어 지방이 축적되므로 비만이 유발된다. 남성은 LPL이 많기 때문에 복부 비만이 초래된다.
경제가 고도로 발달함에 따라 식생활은 윤택해지고 활동량은 줄어들고, 식습관도 서구화되면서 섭취 칼로리 과잉, 운동 부족 등으로 섭취 에너지와 소비에너지 간의 불균형으로 인해 비만이 증가하고 있다. 운동부족과 비만의 관계는 소비에너지 저하도 있지만, 그보다 에너지가 체내에서 저장되기 쉬운 대사상태로 변하는 것이 더 중요하다. 운동부족은 활동 에너지량을 감소시켜서 잉여 칼로리를 체내에 저장하게 되며 인슐린의 활동이 약해지면서 인슐린이 혈당을 내리는 작용이 감소되며, 지방 합성 작용은 감소 되지 않으므로 지방축적작용을 촉진시키는 대사상태로 변한다. 또한, 운동부족 상태에서는 기초대사도 감소 되므로 저장에너지는 더욱 증가되기 쉽다. 성장이 끝난 성인기부터는 단백질도 탄수화물도 체내에 들어온 여분의 영양은 지방형태로 몸 안에 저장된다. 이러한 과잉영양이 지방으로 변할 때 운동 부족은 지방합성효소의 작용을 상승시키게 된다.
이러한 비만은 성인병을 유발시키는 촉진제가 되며 대사 장애로서 제 2형 당뇨병, 동맥경화증의 발현 위험을 증가시키며, 심장의 혈액공급에 부담을 주게 되어 심장병에 걸리게 되며, 남은 지방은 간에 부담을 주어 지방간, 담석증, 간경변에 걸리게 된다. 몸무게가 뼈와 관절에 부담을 주어 골격이상이 생기며 행동이 둔화됨에 따라 활동력이 제한되므로 운동부족이 되어 비만이 더욱 심화되며, 특히 여성 비만은 내분비이상을 가져와 월경불순, 성욕감퇴, 출산시 합병증, 피부습진 및 많은 땀을 유발한다.
비만을 측정하는 지표로는 여러 가지가 있는데, 체질량지수 (Body Mass Index; BMI)는 키와 체중을 이용하여 비만의 정도를 평가하는 방법 중 하나로서, 체중 (㎏)을 신장 (m)의 제곱으로 나눈 값 (BMI = ㎏/㎡)이다. 허리둘레 측정은 복부 지방량을 반영하는 아주 유용한 지표이며, 체지방 측정은 전체 체중에서 지방 무게가 차지하는 백분율 (%)로 나타내고, 정상치는 성인남자의 경우 15-18 %, 여자의 경우 20-25 %이다.
이와 같이, 과도한 지방 축적은 정상적인 생리학 및 생화학적 신체기능에 영향을 미치며, 당뇨병, 고혈압, 고지혈증, 심혈관계 질환 및 암 등의 발병과도 밀접한 관련이 있다. 이러한 비만에 대해 다이어트식품 혹은 항비만 제품의 개발이 현대인의 웰빙에 대한 관심고조와 더불어 많은 연구자들에 의해 추진되고 있다. 이러한 제품개발의 단계에서 스크리닝이나 간편한 효능평가 방법으로 지방세포를 이용하거나 동물을 이용하는 방법이 있다. 더 구체적으로, 이러한 비만의 개선을 위한 기능성 소재 개발이 최근 폭넓게 연구되고 있는데, 다이어트 오일을 이용한 비만의 치료와 예방효과를 측정하는 사례도 많이 알려져 있다.
현재 비만을 치료하는 치료제로는 크게 중추 신경계에 작용하여 식욕에 영향을 주는 약제와 위장관에 작용하여 흡수를 저해하는 약물로 나누어 볼 수 있다. 중추 신경계에 작용하는 약물로는 각각의 기전에 따라 세로토닌 (5HT) 신경계를 저해하는 펜플루라민, 덱스펜플루라민 등의 약물, 노르아드레날린 신경계를 통한 에페드린 및 카페인 등의 약물 및 최근에는 세로토닌 및 노르아드레날린 신경계에 동시 작용하여 비만을 저해하는 시부트라민 등의 약물들이 시판되고 있다. 이외에도, 위장관에 작용하여 비만을 저해하는 약물로는 대표적으로 췌장에서 생성되는 리파아제를 저해하여 지방의 흡수를 줄여주는, 최근 비만 치료제로 허가된 오를리스타트 등이 있다. 그러나, 기존에 사용되어온 약물 중 펜플루라민 등은 원발성 폐고혈압이나 심장 판막 병변과 같은 부작용을 일으켜 최근에 사용이 금지되었으며, 다른 약물들도 혈압감소나 유산산혈증 등의 문제점이 발생하여 심부전, 신질환 등의 환자에는 사용하지 못하는 문제점이 있다.
이에 따라, 부작용이 작은 비만의 예방 또는 치료법으로서 지방세포 분화 억제제가 등장하게 되었다. 지방세포에 저장된 지방은 체내의 중요한 에너지원으로 사용되나, 비만이 진행됨에 따라서 지방세포는 수적 증가가 일어날 뿐만 아니라 과다한 지방세포의 분화에 의한 다량의 트리글리세라이드 합성은 지방세포의 크기증가를 포함한 형태적 변화와 여러 유전자 발현의 변화를 동반한다. 지방세포의 크기 증가는 잉여 에너지를 중성지방의 형태로 합성 및 저장함으로써 유발된다. 한편, 지방의 저장에 따라 지방세포의 크기 증가는 그 직경이 약 20배까지 늘어날 수 있으며 그 결과 세포 용적은 수천 배까지 증가되는 것으로 알려져 있다. 이러한, 지방세포의 크기는 일반적으로 식사 조절로 가능하지만 새로운 지방전구세포가 지방세포로 분화되는 과정은 식사조절로는 효과가 없기 때문에 비만의 근본적 치료 또는 억제를 제어하기 위해서는 지방세포의 분화과정을 조절하는 것이 중요하다. 지방세포 분화는 인슐린이나 인슐린 성장인자-I (insulin like growth factor-1), 성장호르몬 등의 자극에 의하여 촉진되며, 이 과정에 CCAAT enhancer-binding protein (C/EBP) family, PPAR-γ (peroxisome proliferator-activated receptor) 등의 전사인자들의 증가가 관찰된다. 이들, 전사인자들은 지방세포 조절인자와 더불어 지방세포의 분화를 촉진시키며 지방산 결합 단백질인 aP2나 지방산 생합성효소 (fatty acid synthase)와 같은 효소들의 발현량을 증가시킨다. 한편, 지방간의 진행에도 과다한 중성지방의 축적이 관여되고 있음이 보고되고 있다 [J. Clin. Invest., 98, 1575-1584 (1996)]. 최근, 지방세포의 분화를 억제하면 생성되는 지방세포의 수를 조절할 수 있으며, 그에 따라 축적되는 여분의 에너지를 배출할 수 있다는 아이디어를 바탕으로 하여 지방세포 분화를 저해하는 물질들을 탐색하고자 하는 연구가 활발히 진행되고 있다. 일반적으로 새로운 성분의 약제를 개발하기 위한 여러 가지 방법 중에서 기존 약제의 실험적 변형 또는 새로운 물질의 합성과 기능검색은 매우 많은 시간과 투자가 필요하다.
이에 본 발명자들은 기존에 공지된 화합물인 (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올이 지방전구세포에서 지방세포로의 분화를 억제하는 효과가 있음을 밝혀내고, 이를 비만의 예방 또는 치료 용도로 사용할 수 있음을 확인하여 본 발명을 완성하였다.
본 발명의 목적은 지방세포의 분화를 억제함으로써 그와 관계되는 질환의 치료에 이용할 수 있는 항비만 조성물을 제공하는 것이다.
본 발명의 다른 목적은 비만의 예방 또는 치료를 위한 약제학적 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 비만의 예방 또는 개선을 위한 식품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 비만의 예방 또는 개선을 위한 의약외품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 비만의 예방 또는 개선을 위한 화장료 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 비만의 예방 또는 치료를 위한 약제학적 조성물을 약제학적으로 유효한 양으로 비만의 발병 또는 발병 가능성이 있는 개체에게 투여하는 단계를 포함하는 비만의 치료방법을 제공하는 것이다.
상기의 목적을 달성하기 위한 본 발명의 일 양상으로서, 하기 화학식 1로 표시되는 화합물을 유효성분으로 포함하는 항비만 조성물이 제공된다.
[화학식 1]
Figure PCTKR2011000591-appb-I000001
본 발명의 또 다른 양상에 따르면, 전술한 조성물을 유효성분으로 포함하는 비만의 예방 또는 치료용 약제학적 조성물이 제공된다.
본 발명의 또 다른 양상에 따르면, 전술한 조성물을 유효성분으로 포함하는 비만의 예방 또는 개선용 식품 조성물이 제공된다.
본 발명의 또 다른 양상에 따르면, 전술한 조성물을 유효성분으로 포함하는 비만의 예방 또는 개선용 의약외품 조성물이 제공된다.
본 발명의 또 다른 양상에 따르면, 전술한 조성물을 유효성분으로 포함하는 비만의 예방 또는 개선용 화장료 조성물이 제공된다.
본 발명의 또 다른 양상에 따르면, 전술한 비만의 예방 또는 치료를 위한 약제학적 조성물을 약제학적으로 유효한 양으로 비만의 발병 또는 발병 가능성이 있는 개체에게 투여하는 단계를 포함하는 비만의 치료방법이 제공된다.
본 발명의 (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올을 포함하는 조성물은 지방전구세포가 지방세포로 분화되는 것을 억제하므로, 비만 또는 비만으로 인해 유발될 수 있는 다양한 질환의 예방이나 치료에 유용하게 사용될 수 있다.
도 1은 (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올에 의한 전구지방세포에서 지방세포로의 분화 억제 효과를 오일 레드 O 염색 및 분석을 통해 그래프로 나타낸 것이다.
도 2는 (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올에 의한 전구지방세포에서 지방세포로의 분화 억제 효과를 오일 레드 O 염색 및 분석을 통해 현미경 관찰을 한 결과를 나타낸 사진이다.
도 3은 (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올의 세포독성 (cytotoxicity) 정도를 측정한 그래프이다.
도 4는 (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올이 PPAR-γ의 전사 활성에 미치는 영향을 나타낸 그래프이다.
도 5는 C/EBPα및 GLUT4의 real-time PCR을 실시한 결과를 나타낸 그래프이다.
도 6은 Adiponectin 및 ADD1/SREBP1c의 real-time PCR을 실시한 결과를 나타낸 그래프이다.
도 7은 Resistin 및 aP2의 real-time PCR을 실시한 결과를 나타낸 그래프이다.
도 8은 PPAR-γ의 real-time PCR을 실시한 결과를 나타낸 그래프이다.
도 9는 PPARγ 및 C/EBPα의 웨스턴 블롯 분석 결과를 나타낸 것이다.
이하, 본 발명을 상세히 설명한다.
본 발명에서 화학식 1의 화합물이란, 화학식 1의 화합물뿐만아니라, 이의 이성질체, 바람직하게는 광학 이성체 및 이의 약학적으로 허용가능한 염일 수 있다.
본 발명은 하기 화학식 1로 표시되는 화합물을 유효성분으로 포함하는 항비만 조성물을 제공한다.
또한, 본 발명은 하기 화학식 1로 표시되는 화합물을 항비만 조성물을 제조하는데 사용하는 용도를 제공한다.
[화학식 1]
Figure PCTKR2011000591-appb-I000002
본 발명에 따른 화학식 1의 화합물은 PPAR-γ (peroxisome proliferator-activated receptor)의 활성을 억제함으로써 지방 전구세포가 지방세포로 분화되는 것을 억제시키므로 비만의 예방 또는 치료에 사용될 수 있다.
비만은 당뇨병이나 고지혈증의 발병 가능성을 증가시킬 수 있으며, 성기능 장애, 관절염, 심혈관계의 질환의 발병 위험 또한 커질 수 있다. 또한 비만으로 인하여 담석증이 유발될 수 있으며, 일부의 경우에는 암도 야기될 수 있는 것으로 알려져 있으므로, 상기 조성물은 비만 이외에도 비만과 관련된 다양한 질환의 예방 또는 치료에 유용하게 사용될 수 있다.
상기 화학식 1로 표시된 화합물은 공지된 방법에 의하여 합성할 수 있다. 예를 들면, 하기 반응식 1에 나타낸 합성 과정을 거쳐 높은 수율의 (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올을 수득할 수 있다.
[반응식 1]
Figure PCTKR2011000591-appb-I000003
반응 시약 및 조건: (a) NaH, DMSO, BnPPh3Cl, THF, 45 ℃; (b) (i) Dess-Martin periodinane, CH2Cl2, 0 ℃; (ii) NaHMDS, MePPh3Br, THF, 0 ℃; (c) (i) CSI, Na2CO3, toluene, 0 ℃; (ii) 25 % Na2SO3, rt; (d) 5 mol% (IMesH2)(PCy3)(Cl)2Ru=CHPh, toluene, 80 ℃: (e) cat. OsO4, 50 % NMO, 80 % acetone, rt; (f) (i) 2,2-dimethoxypropane, PPTS, CH2Cl2, rt; (ii) separation; (iii) p-TsOH, MeOH, 40 ℃; (iv) 10 % Pd/C, H2, 6n HCl, MeOH, rt; (v) DOWEX-50w X 8 (H+ form, 0.5m NH4OH as an eluent).
상기 반응식 1에서, "Bn"은 벤질기(benzyl group)를 나타내며, "Cbz"는 카복시벤질기(carboxybenzyl group)를 나타낸다.
또한, 본 발명은 하기 화학식 1로 표시되는 화합물을 유효성분으로 포함하는 항비만 조성물을 유효성분으로 포함하는 비만의 예방 또는 치료용 약제학적 조성물을 제공한다.
나아가, 본 발명은 하기 화학식 1로 표시되는 화합물을 항비만제로 사용하는 용도를 제공한다.
게다가, 본 발명은 개체에 하기 화학식 1로 표시되는 화합물을 투여하는 단계를 포함하여, 비만을 예방 또는 치료하는 방법을 제공한다.
[화학식 1]
Figure PCTKR2011000591-appb-I000004
본 발명에서 용어, "예방"이란 조성물의 투여에 의해 비만을 억제하거나 발병을 지연시키는 모든 행위를 의미한다.
본 발명에서 용어, "치료"란 조성물의 투여에 의해 비만에 의한 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
이때, 본 발명의 상기 화학식 1로 표시되는 화합물은 약학적으로 허용가능한 염의 형태로 사용될 수 있으며, 염으로는 약학적으로 허용 가능한 유리산 (free acid)에 의해 형성된 산 부가염이 유용하다. 산 부가염은 염산, 질산, 인산, 황산, 브롬화수소산, 요드화수소산, 아질산 또는 아인산과 같은 무기산류와 지방족 모노 및 디카르복실레이트, 페닐-치환된 알카노에이트, 하이드록시 알카노에이트 및 알칸디오에이트, 방향족 산류, 지방족 및 방향족 설폰산류와 같은 무독성 유기산으로부터 얻는다. 이러한 약학적으로 무독한 염류로는 설페이트, 피로설페이트, 바이설페이트, 설파이트, 바이설파이트, 니트레이트, 포스페이트, 모노하이드로겐 포스페이트, 디하이드로겐 포스페이트, 메타포스페이트, 피로포스페이트 클로라이드, 브로마이드, 아이오다이드, 플루오라이드, 아세테이트, 프로피오네이트, 데카노에이트, 카프릴레이트, 아크릴레이트, 포메이트, 이소부티레이트, 카프레이트, 헵타노에이트, 프로피올레이트, 옥살레이트, 말로네이트, 석시네이트, 수베레이트, 세바케이트, 푸마레이트, 말리에이트, 부틴-1,4-디오에이트, 헥산-1,6-디오에이트, 벤조에이트, 클로로벤조에이트, 메틸벤조에이트, 디니트로 벤조에이트, 하이드록시벤조에이트, 메톡시벤조에이트, 프탈레이트, 테레프탈레이트, 벤젠설포네이트, 톨루엔설포네이트, 클로로벤젠설포네이트, 크실렌설포네이트, 페닐아세테이트, 페닐프로피오네이트, 페닐부티레이트, 시트레이트, 락테이트, β-하이드록시부티레이트, 글리콜레이트, 말레이트, 타트레이트, 메탄설포네이트, 프로판설포네이트, 나프탈렌-1-설포네이트, 나프탈렌-2-설포네이트 또는 만델레이트를 포함한다.
본 발명에 따른 산 부가염은 통상의 방법, 예를 들면, 상기 화학식 1로 표시되는 화합물을 과량의 산 수용액 중에 용해시키고, 이 염을 수혼화성 유기 용매, 예를 들면 메탄올, 에탄올, 아세톤 또는 아세토니트릴을 사용하여 침전시켜서 제조할 수 있다.
또한, 본 발명의 상기 화학식 1로 표시되는 화합물은 염기를 사용하여 약학적으로 허용 가능한 금속염을 만들 수 있다. 알칼리 금속 또는 알칼리 토금속 염은 예를 들면 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해하고, 비용해 화합물 염을 여과하고, 여액을 증발, 건조시켜 얻는다. 이때, 금속염으로는 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하다. 또한, 이에 대응하는 은 염은 알칼리 금속 또는 알칼리 토금속 염을 적당한 은 염 (예, 질산은)과 반응시켜 얻는다.
또한, 상기 약제학적 조성물은 약학적으로 허용가능한 담체를 추가로 포함할 수 있다. 약학적으로 허용가능한 담체를 포함하는 상기 조성물은 경구 또는 비경구의 여러 가지 제형일 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형 제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형 제제는 하나 이상의 화합물에 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘, 수크로오스 (sucrose) 또는 락토오스 (lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 스테아린산 마그네슘, 탈크 등과 같은 윤활제들도 사용된다. 경구투여를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결 건조 제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌 글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테로 등이 사용될 수 있다. 좌제의 기제로는 위텝솔 (witepsol), 마크로골, 트윈 (tween) 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있다.
상기 약제학적 조성물은 정제, 환제, 산제, 과립제, 캡슐제, 현탁제, 내용액제, 유제, 시럽제, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결 건조 제제 및 좌제으로 이루어진 군으로부터 선택되는 어느 하나의 제형을 가질 수 있다.
상기 본 발명의 조성물은 약제학적으로 유효한 양으로 투여한다.
본 발명에서 용어 "약제학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 개체 종류 및 중증도, 연령, 성별, 감염된 바이러스 종류, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있다. 그리고 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 당업자에 의해 용이하게 결정될 수 있다.
본 발명의 조성물은 비만의 예방 또는 치료를 위하여 단독으로, 또는 수술, 호르몬 치료, 약물 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.
한편, 본 발명은 상기 비만의 예방 또는 치료용 약제학적 조성물을 약제학적으로 유효한 양으로 비만의 발병 또는 발병 가능성이 있는 개체에게 투여하는 단계를 포함하는 비만의 치료방법을 제공한다.
본 발명에서 용어, "개체"란 이미 비만이거나 비만에 걸릴 수 있는 인간을 포함한 모든 동물을 의미하고 본 발명의 화학식 1로 표시되는 화합물을 포함하는 조성물을 개체에게 투여함으로써, 상기 비만을 효과적으로 예방 및 치료할 수 있다. 예를 들어, 본 발명의 조성물로 비만인 인간을 치료할 수 있다. 본 발명의 조성물은 기존의 비만 치료제와 병행하여 투여할 수 있다.
상기 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 투여될 수 있다. 본 발명의 조성물은 목적하는 바에 따라 복강내 투여, 정맥내 투여, 근육내 투여, 피하 투여, 피내 투여, 경구 투여, 비내 투여, 폐내 투여, 직장내 투여될 수 있으나, 이에 제한되지는 않는다. 또한 상기 조성물은 활성 물질이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다.
아울러, 본 발명은 전술한 항비만 조성물을 유효성분으로 포함하는 비만의 예방 또는 개선용 식품 조성물을 제공한다.
즉, 본 발명의 상기 화학식 1로 표시되는 화합물을 포함하는 항비만 조성물은 비만의 예방 또는 개선용 식품 조성물에 첨가될 수 있다. 본 발명의 상기 화학식 1로 표시되는 화합물을 포함하는 항비만 조성물을 식품 첨가물로 사용할 경우, 상기 조성물은 그대로 첨가되거나 다른 식품 또는 식품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효 성분의 혼합양은 사용 목적 (예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다. 일반적으로, 식품 또는 음료의 제조 시에는 본 발명의 조성물은 원료에 대하여 0.01 ~ 10 중량%, 바람직하게는 0.05 ~ 1 중량%의 양으로 첨가된다. 그러나 건강 및 위생을 목적으로 하거나 또는 건강 조절을 목적으로 하는 장기간의 섭취의 경우에는 상기 양은 상기 범위 이하로도 사용될 수 있다.
상기 식품의 종류에는 특별한 제한은 없다. 상기 물질을 첨가할 수 있는 식품의 예로는 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 기타 면류, 껌류, 아이스크림류를 포함한 낙농제품, 각종 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제 등이 있으며, 통상적인 의미에서의 건강식품을 모두 포함한다.
본 발명의 건강음료 조성물은 통상의 음료와 같이 여러 가지 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 상술한 천연 탄수화물은 포도당, 과당과 같은 모노사카라이드, 말토스, 슈크로스와 같은 디사카라이드, 및 덱스트린, 사이클로덱스트린과 같은 폴리사카라이드, 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 감미제로서는 타우마틴, 스테비아 추출물과 같은 천연 감미제나, 사카린, 아스파르탐과 같은 합성 감미제 등을 사용할 수 있다. 상기 천연 탄수화물의 비율은 본 발명의 조성물 100 ㎖ 당 일반적으로 약 0.01 ~ 0.04 g, 바람직하게는 약 0.02 ~ 0.03 g 이다.
상기 외에 본 발명의 조성물은 여러 가지 영양제, 비타민, 전해질, 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있다. 그 밖에 본 발명의 조성물은 천연 과일쥬스, 과일쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 크게 중요하진 않지만 본 발명의 조성물 100 중량부 당 0.01 ~ 0.1 중량부의 범위에서 선택되는 것이 일반적이다. 이들 성분들은 독립적으로 또는 조합하여 사용할 수 있다.
아울러, 본 발명은 전술한 항비만 조성물을 유효성분으로 포함하는 비만의 예방 또는 개선용 의약외품 조성물을 제공한다.
즉, 본 발명의 조성물은 비만의 예방 또는 개선을 목적으로 의약외품 조성물에 첨가될 수 있다. 본 발명의 상기 화학식 1의 화합물을 포함하는 항비만 조성물을 의약외품 첨가물로 사용할 경우, 상기 조성물은 그대로 첨가되거나 다른 의약외품 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효성분의 혼합량은 사용 목적 (예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다.
바람직하게는, 상기 의약외품 조성물은 소독청경제, 샤워폼, 가그린, 물티슈, 세제비누, 핸드워시, 가습기 충진제, 마스크, 연고제 또는 필터 충진제일 수 있다.
아울러, 본 발명은 전술한 항비만 조성물을 유효성분으로 포함하는 비만의 예방 또는 개선용 화장료 조성물을 제공한다.
즉, 본 발명의 조성물은 비만의 예방 또는 개선을 목적으로 화장료 조성물에 첨가될 수 있다. 본 발명의 상기 화학식 1의 화합물을 포함하는 항비만 조성물을 화장료 첨가물로 사용할 경우, 상기 조성물은 그대로 첨가되거나 다른 화장료 성분과 함께 사용될 수 있고, 통상적인 방법에 따라 적절하게 사용될 수 있다. 유효성분의 혼합량은 사용 목적 (예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다.
바람직하게는, 상기 화장료 조성물의 제형은 유연화장수, 수렴화장수, 영양화장수, 영양크림, 마사지크림, 에센스, 아이크림, 아이에센스, 클렌징크림, 클렌징폼, 클렌징워터, 팩, 파우더, 바디로션, 바디크림, 바디오일, 바디에센스, 메이컵 베이스, 파운데이션, 염모제, 샴푸, 린스 또는 바디 세정제일 수 있다.
이하, 본 발명을 실시예 및 실험예에 의해 보다 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
제조예 1 : (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올의 제조
(가) (2R,3S,4S)-2,3,4-트리스(벤질옥시)-6-페닐헥스-5-엔-1-올 (화학식 2)의 합성
무수 DMSO (3.38 mL, 28.56 mmol)와 무수 THF (53 mL)의 혼합용액에 0 ℃, 질소충전 조건에서 NaH (1.14 g, 72.16 mmol, 60% in mineral oil)를 넣고 실온에서 1시간 동안 교반한 후, 0 ℃에서 BnPPh3Cl (11.1 g, 28.56 mmol)을 가하고 실온에서 2시간 동안 교반하였다. 0 ℃에서, (3R,4R,5R)-3,4,5-트리스(벤질옥시)테트라하이드로-2H-피란-2-올 (4.0 g, 9.52 mmol)을 상기에서 생성된 혼합액에 가하고 45 ℃에서 2시간 동안 교반하였다. 그 후, 혼합물을 냉각시키고 EtOAc (50 mL)로 희석한 다음, NH4Cl 포화수용액, brine으로 세척하였으며, 그 후에 무수 MgSO4로 건조시키고 감압농축하였다. 이로부터 얻은 잔사를 컬럼크로마토그래피를 실시하여 (2R,3S,4S)-2,3,4-트리스(벤질옥시)-6-페닐헥스-5-엔-1-올을 80 % (Z:E = 3.4:1)의 수율로 수득하였다.
[화학식 2]
Figure PCTKR2011000591-appb-I000005
R f = 0.37 (Hexane/EtOAc 3:1); [α]D 25 +39.6 (c 1.0, CHCl3); Z isomer: 1H NMR (500 MHz, CDCl3) δ 3.68 (t, 1H, J = 5.0 Hz), 3.73 (dd, 1H, J = 12.0, 5.0 Hz), 3.77 (dd, 1H, J = 12.0, 5.0 Hz), 3.94 (t, 1H, J = 5.0 Hz), 4.29 (d, 1H, J = 11.5 Hz), 4.31 (d, 1H, J = 12.0 Hz), 4.48 (d, 1H, J = 12.0 Hz), 4.56 (d, 1H, J = 11.5 Hz), 4.69 (dd, 1H, J = 10.0, 5.0 Hz), 5.81 (dd, 1H, J = 12.0, 10.0 Hz), 6.90 (d, 1H, J = 12.0 Hz), 7.14-7.40 (m, 20H); 13C NMR (125 MHz, CDCl3) δ 61.42, 70.67, 71.97, 74.19, 74.47, 79.45, 81.17, 126.89, 127.53, 127.78, 127.84, 127.93, 127.98, 128.13, 128.28, 128.51, 128.58, 128.73, 128.99, 136.81, 138.18, 138.46, 138.52; E isomer: 1H NMR (500 MHz, CDCl3) δ 3.64 (dt, 1H, J = 6.5, 4.0 Hz), 3.82 (d, 2H, J = 4.0), 3.96 (dd, 1H, J = 6.0, 4.0 Hz), 4.24 (dd, 1H, J = 7.5, 4.0Hz), 4.45 (d, 1H, J = 12.0 Hz), 4.53 (d, 1H, J = 11.5 Hz), 4.63 (d, 1H, J = 11.5 Hz), 4.70 (d, 1H, J = 12.0 Hz), 4.76 (d, 1H, J = 11.5 Hz), 4.88 (d, 1H, J = 11.5 Hz), 6.26 (dd, 1H, J = 16.0, 7.5 Hz), 6.43 (d, 1H, J = 16.0 Hz), 7.27-7.40 (m, 20H); 13C NMR (125 MHz, CDCl3) δ 61.31, 70.35, 71.86, 74.19, 74.55, 78.82, 81.01, 126.72, 127.53, 127.83, 127.91, 127.98, 128.06, 128.21, 128.34, 128.58, 128.62, 128.81, 128.99, 134.85, 136.69, 136.81, 138.29, 138.48, 138.63; HRMS (FAB) Calcd for C33H35O4 [M+H+] 495.2535, found 495.2547.
(나) (3S,4R,5R)-1-페닐헵타-1,6-디엔-3,4,5-트리일)트리스(옥시)트리스(메틸렌)트리벤젠 (화학식 3)의 합성
(2R,3S,4S)-2,3,4-트리스(벤질옥시)-6-페닐헥스-5-엔-1-올 (2.28 g, 4.61 mmol)의 무수 CH2Cl2 (18 mL) 용액에 Dess-Martin periodinane (5.87 g, 13.83 mmol)을 0 ℃에서 가하고, 실온에서 1.5시간 동안 교반하였다. 그 후 반응 혼합물을 CH2Cl2로 희석하고 NaHCO3 포화수용액, brine으로 세척한 다음 무수 MgSO4로 건조시키고 감압농축하였다. 수득한 알데하이드는 정제 과정 없이 다음 반응으로 진행시켰다. MePPh3Br (4.94 g, 13.83 mmol)의 무수 THF (15 mL) 용액에 NaHMDS (13.83 mL, 13.83 mmol)를 넣고 0 ℃에서 1시간 동안 교반한 후, 알데하이드를 0 ℃에서 천천히 가하고 실온에서 15분 동안 교반시켰다. 반응 혼합물을 EtOAc로 희석하고 H2O와 brine으로 세척한 다음 무수 MgSO4로 건조시키고 감압농축하였다. 이로부터 얻은 잔사를 컬럼크로마토그래피를 실시하여 (3S,4R,5R)-1-페닐헵타-1,6-디엔-3,4,5-트리일)트리스(옥시)트리스(메틸렌)트리벤젠을 56 % (Z:E = 3:1)의 수율로 수득하였다.
[화학식 3]
Figure PCTKR2011000591-appb-I000006
R f = 0.38 (Hexane/EtOAc 15:1); [α]D 25 -70.3 (c 1.0, CHCl3); Z isomer: 1H NMR (500 MHz, CDCl3) δ 3.87 (dd, 1H, J = 6.5 Hz), 4.04 (dd, 1H, J = 8.0, 4.0 Hz), 4.13 (d, 1H, J = 12.0 Hz), 4.22 (d, 1H, J = 12.0 Hz), 4.47 (d, 1H, J = 12.0 Hz), 4.55 (m, 2H), 4.84 (dd, 2H, J = 11.5, 11.5 Hz), 4.98 (d, 1H, J = 16.5 Hz), 5.25 (dd, 1H, J = 11.5, 10.0 Hz), 5.91-5.98 (m, 2H), 6.89 (d, 1H, J = 11.5 Hz), 7.03-7.38 (m, 20H); 13C NMR (125 MHz, CDCl3) δ 70.06, 70.37, 73.84, 74.54, 81.84, 82.76, 119.41, 127.32, 127.45, 127.48, 127.61, 127.66, 128.12, 128.29, 128.34, 128.38, 128.42, 129.30, 130.15, 134.75, 135.56, 136.95, 138.44, 139.02, 139.22; E isomer: 1H NMR (500 MHz, CDCl3) δ 3.86-3.90 (m, 1H), 4.08 (dd, 1H, J = 9.0, 4.0Hz), 4.15-4.27 (m, 2H), 4.43 (dd, 2H, J = 4.5, 11.5Hz), 4.58-4.70 (m, 2H), 4.83-4.88 (m, 2H), 5.25-5.40 (m, 2H), 7.25-7.45 (m, 20H); 13C NMR (125 MHz, CDCl3) δ 70.36, 70.93, 72.71,75.46, 80.23, 84.54, 119.22, 126.83, 127.34, 127.49, 127.65, 127.73, 127.79, 127.84, 129.23, 130.79, 133.30, 133.60, 136.01, 136.38, 136.87, 138.47,138.56, 138.75, 138.82; HRMS (FAB) Calcd for C34H35O3 [M+H+] 513.2406, found 513.2407.
(다) 벤질 (3S,4S,5R)-4,5-비스(벤질옥시)-1-페닐헵타-1,6-디엔-3-일카바메이트 (화학식 4)의 합성
(3S,4R,5R)-1-페닐헵타-1,6-디엔-3,4,5-트리일)트리스(옥시)트리스(메틸렌)트리벤젠 (3.6 g, 7.34 mmol)의 무수 THF (29 mL) 용액에 CSI (1.95 mL, 21.96 mmol)와 Na2CO3 (3.5 g, 33.03 mmol)을 넣고 0 ℃에서 24시간 동안 교반하였다. 그 반응 혼합물에 25 % Na2SO3 (10 ml)를 넣고 실온에서 24시간 동안 교반한 후, EtOAc를 넣어 희석하고 H2O와 brine으로 세척하였다. 그 다음 무수 MgSO4로 건조시키고 감압농축하였다. 이로부터 얻은 잔사를 컬럼크로마토그래피를 실시하여 벤질 (3S,4S,5R)-4,5-비스(벤질옥시)-1-페닐헵타-1,6-디엔-3-일카바메이트를 80 % (Z:E = 2.6:1, anti:syn = 18:1)의 수율로 수득하였다.
[화학식 4]
Figure PCTKR2011000591-appb-I000007
R f = 0.28 (Hexane/EtOAc 8:1); [α]D 25 -79.6 (c 0.1, CHCl3); 1H NMR (500 MHz, CDCl3) δ 3.68-3.73 (br, 0.56H), 3.80 (t, 0.72H, J = 7.0 Hz), 3.88-3.92 (m, 0.72H), 4.29 (d, 0.28H, J = 11.5 Hz), 3.39 (d, 0.72H, J = 11.5 Hz), 4.47 (d, 0.28H, J = 11.5 Hz), 4.54 (d, 0.72H, J = 11.5 Hz), 4.57 (d, 0.28H, J = 11.5 Hz), 4.61 (d, 0.72H, J = 11.5 Hz), 4.63 (d, 0.28H, J = 11.5 Hz), 4.67 (d, 0.72H, J = 11.5 Hz), 4.77 (d, 0.28H, J = 11.5 Hz), 4.89 (br, 0.28H), 5.06-5.16 (m, 2H), 5.25 (t, 0.72H, J = 8.0 Hz), 5.35-5.44 (m, 2H), 5.76 (dd, 0.72H, J = 10.5, 10.0 Hz), 5.85-5.94 (m, 1H), 6.17 (dd, 0.28H, J = 15.5, 8.0 Hz), 6.49 (d, 0.28H, J = 15.5 Hz), 6.63 (d, 0.72H, J = 10.5 Hz), 7.03-7.46 (m, 20H); 13C NMR (125 MHz, CDCl3) δ 50.32, 66.87, 70.47, 70.53, 74.49, 81.12, 81.34, 83.20, 83.50, 119.70, 120.25, 126.78, 127.53, 127.60, 127.85, 128.01, 128.15, 128.23, 128.37, 128.58, 128.65, 128.68, 128.76, 128.90, 132.74, 132.82, 136.18, 136.58, 138.25, 155.60; HRMS (FAB) C35H36NO4 [M+H+] 534.2644, found 534.2640.
(라) 벤질 (1S,4R,5S)-4,5-비스(벤질옥시)사이클로펜트-2-에닐카바메이트 (화학식 5)의 합성
벤질 (3S,4S,5R)-4,5-비스(벤질옥시)-1-페닐헵타-1,6-디엔-3-일카바메이트 (3.13 g, 5.87mmol)의 무수 톨루엔 (59 ml) 용액에 Grubbs Catalyst (0.24 g, 0.29 mmol)을 가하여 80 ℃에서 4시간 동안 교반시켰다. 그 후, 셀라이트 (Celite)를 통해 여과 및 농축시킨 다음, 컬럼크로마토그래피를 실시하여 벤질 (1S,4R,5S)-4,5-비스(벤질옥시)사이클로펜트-2-에닐카바메이트를 75 %의 수율로 수득하였다.
[화학식 5]
Figure PCTKR2011000591-appb-I000008
R f = 0.18 (Hexane/EtOAc 4:1); [α]D 25 -79.6 (c 0.1, CHCl3); 1H NMR (500 MHz, CDCl3) δ 4.02 (t, 1H, J = 5.5 Hz), 4.30 (dd, 1H, J = 5.0, 2.5 Hz), 4.64 (d, 1H, J = 12.0 Hz), 4.65 (d, 1H, J = 12.0 Hz), 4.69-4.71 (br, 1H), 4.72 (d, 1H, J = 12.0 Hz), 4.79 (d, 1H, J = 12.0 Hz), 5.12 (s, 2H), 5.29 (d, 1H, J = 9.0 Hz), 6.05 (dd, 1H, J = 6.0, 2.0 Hz), 6.09 (dd, 1H, J = 6.0, 3.0 Hz), 7.27-7.38 (m, 15H); 13C NMR (125 MHz, CDCl3) δ 54.65, 66.88, 72.31, 72.58, 78.42, 80.03, 127.86, 127.90, 128.02, 128.05, 128.22, 128.61, 128.69, 133.06, 135.08, 136.90, 138.30, 138.79, 156.36; HRMS (FAB) Calcd for C27H28NO4 [M+H+] 430.2018, found 430.2013.
(마) 벤질 (1S,2S,3R,4S,5S)-2,3-비스(벤질옥시)-4,5-디하이드록시사이클로펜틸카바메이트 (화학식 6)의 합성
벤질 (1S,4R,5S)-4,5-비스(벤질옥시)사이클로펜트-2-에닐카바메이트 (0.45g, 1.06 mmol)의 80 % 아세톤 용액에 50 % NMO(0.33 ml)와 OsO4 (1 crystal)를 가하여 실온에서 3시간 동안 교반시켰다. 그 후에 EtOAc를 넣어 희석시키고 10 % NaHSO3, Brine으로 세척한 다음, 무수 MgSO4로 건조시키고 감압농축하였다. 이로부터 얻은 잔사를 컬럼크로마토그래피를 실시하여 벤질 (1S,2S,3R,4S,5S)-2,3-비스(벤질옥시)-4,5-디하이드록시사이클로펜틸카바메이트를 82 %의 수율로 수득하였다.
[화학식 6]
Figure PCTKR2011000591-appb-I000009
R f = 0.36 (Hexane/EtOAc 1:2); [α]D 25 +7.3 (c 0.44, CHCl3); 1H NMR (500 MHz, CDCl3) δ 1.82 (br s, 1H), 3.09 (br s, 1H), 3.91-3.99 (m, 3H), 4.17 (dd, 1H, J = 5.5, 4.5 Hz), 4.23 (br d, 1H, J = 3.0 Hz), 4.52 (d, 1H, J = 12.0 Hz), 4.68 (d, 1H, J = 12.0 Hz), 4.76 (d, 1H, J = 12.0 Hz), 4.79 (d, 1H, J = 12.0 Hz), 5.14 (d, 1H, J = 12.5 Hz), 5.10 (d, 1H, J = 12.5 Hz), 5.62 (d, 1H, J = 6.0 Hz), 7.27-7.40 (m, 15H); 13C NMR (125 MHz, CDCl3) δ 58.34, 67.35, 72.63, 73.27, 73.59, 76.42, 77.58, 84.59, 127.94, 128.01, 128.21, 128.37, 128.50, 128.69, 128.76, 128.82, 136.45, 138.04, 138.29, 157.59; HRMS (FAB) Calcd for C27H30NO6 [M+H+] 464.2073, found 464.2083.
(바) (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올 (화학식 7)의 합성
벤질 (1S,2S,3R,4S,5S)-2,3-비스(벤질옥시)-4,5-디하이드록시사이클로펜틸카바메이트 (0.17 g, 0.38 mmol)의 MeOH (3 mL) 용액에 6N HCl (1.5 mL)를 가하고, 10 % Pd/C 촉매, 수소가스 조건 하에 실온에서 24시간 동안 교반시켰다. 그 후에 셀라이트로 여과시키고 농축한 다음, 이온흡착교환수지를 이용하여 크로마토그래피를 실시하여 (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올을 95 %의 수율로 수득하였다.
[화학식 7]
Figure PCTKR2011000591-appb-I000010
R f = 0.16 (CH2Cl2/MeOH 1:2); [α]D 22 +2.3 (c 1.0, MeOH); 1H NMR (500 MHz, D2O) δ 3.46 (t, 1H, J = 6.0 Hz), 3.96 (t, 1H, J = 5.0 Hz), 4.00 (dd, 1H, J = 6.5, 6.0 Hz), 4.19 (t, 1H, J = 7.0 Hz), 4.22 (dd, 1H, J = 5.5, 4.5 Hz); 13C NMR (125 MHz, D2O) δ 57.19, 67.83, 71.83, 73.85, 76.39; HRMS (FAB) Calcd for C5H12NO4 [M+H+] 150.0766, found 150.0767.
실험예 1-1 : 3T3-L1 지방전구세포의 준비
3T3-L1 지방전구세포는 한국생명공학연구원으로부터 얻어 이용하였다. 3T3-L1은 지방세포의 대사과정을 연구하는 실험에 널리 이용되는 것으로, 상기 세포의 분화가 활발할수록 지방세포 내의 지방 축적이 활발하여 비만을 유도하게 된다. 항비만 효과를 가질 것으로 생각되는 물질을 상기 세포에 처리하였을 때, 세포의 분화가 적을수록 항비만 효과가 큰 물질인 것으로 볼 수 있다.
실험예 1-2 : 3T3-L1 지방전구세포의 지방세포로의 분화 유도
마우스 전구지방세포인 3T3-L1을 10 % BCS DMEM 배지를 넣고 37 ℃, 5 % CO2 의 조건에서 배양하였다. 3T3-L1 전구지방세포를 24 well plate에 5×104/well의 세포 수로 분주한 후, 100 % confluency 시점이 되자 2일 동안 더 유지시켰다. 전구지방세포는 MDI (0.5 mM 3-isobutyl-1-methylxanthine (IBMX), 1 uM dexamethasone, 1 ug/ml 인슐린)를 포함하는 10% FBS DMEM 배지로 지방세포 분화를 2일 동안 유도하였고, 배양 48 시간 후, 1 ug/ml 인슐린이 함유된 10 % FBS DMEM으로 이틀 동안 배양하였다. 그 후 2일 마다 4일 동안 10 % FBS DMEM 배양액으로 교체하였다. 지방세포 분화를 유도하는 동안 제조예 1에서 제조한 (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올 시료를 60, 80 및 100 uM의 농도로 각 배양에 처리하였고, 분화가 완성되는 시점인 8일째에 지방세포 분화 정도를 관찰하였다.
실험예 1-3 : 오일 레드 O (Oil red O) 염색 및 분석
지방의 축적 정도를 확인하기 위해 오일레드 O 염색을 실시하였다. 상기 실시예 1-2에서 유도한 지방세포의 분화 정도를 오일 레드 O 염색을 통해 1차적으로 현미경을 통해 확인하였고, 지방세포 염색 정도는 510 nm 흡광도에서 세포의 분화 된 지방의 양을 측정하였다. 그 결과를 도 1 및 도 2에 나타내었다. 도 1 및 도 2로부터 (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올 시료를 넣지 않은 경우에서부터 60, 80 및 100 uM를 넣은 경우까지 점차 유의적으로 억제 효과가 증가하는 것을 확인할 수 있었다.
실험예 2 : 세포독성 실험
3T3-L1 세포를 96 well plate에 5×103/well 개를 분주하여 37 ℃, 5 % CO2 의 조건에서 하루 동안 배양하였다. 24 시간 후 (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올 시료를 각각 20 uM, 40 uM, 60 uM, 80 uM 및 100 uM의 농도로 처리하여 24시간 동안 배양한 후 MTT를 통해 세포독성을 확인하였다. ELISA를 통해 540 nM 흡광도에서 측정하였으며, 그 결과를 도 3에 나타내었다. 도 3을 참고하면, 농도에 따른 세포독성은 유발되지 않은 것으로 관찰되었다.
실험예 3 : PPAR-γ의 전사 활성 분석
HEK 293T cell에 pGL3-PPRE luciferase reporter 유전자와 PPARγ, pRL-SV-40 플라스미드를 트팬스펙션 (transfection) 하였다. 유전자들을 하루 동안 발현시킨 후 세포에 (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올 시료 60, 80 및 100 uM과 PPARγ 유도물질인 10 uM Troglitazone을 24시간 동안 함께 처리하였다. 그 후, (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올 시료에 의한 PPARγ의 전사 활성 정도를 luciferase 발현 강도를 통해 관찰하였으며, 그 결과를 도 4에 나타내었다. 도 4로부터 시료의 농도가 0 uM에서 100 uM이 되면서 PPAR-γ의 전사 활성이 점차적으로 감소됨을 확인할 수 있었다.
실험예 4 : Real-time PCR
지방세포로 분화 단계에서 C/EBPα와 PPARγ는 분화된 지방세포에서 발현 양이 증가한다. 대부분의 아디포카인 (adipokine)들의 발현도 증가하게 된다. 지방세포 분화 유도 방법과 같이 (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올 시료를 60, 80 및 100 uM 농도로 처리 한 후 8일 동안 분화를 시켜 C/EBPα와 PPARγ, 지방세포 분화에 관여하는 유전자들 (표 1)의 발현 정도를 Real-time PCR로 확인하였다. 분화가 완벽하게 일어난 3T3-L1 세포를 PBS로 두 번 세척한 후, cell pellet을 모아 RNA prep kit를 사용하여 RNA만 분리하였다. 추출된 RNA를 1 ug 사용하여 cDNA를 합성한 후 SYBR green과 primer를 이용하여 Real-time PCR을 수행하였으며, 대조군 유전자로는 GAPDH를 사용하였다. 각각의 C/EBPα와 PPARγ, 지방세포 분화에 관여하는 유전자들의 발현 정도의 결과를 도 5 내지 도 8에 나타내었다. 도 5 내지 도 8로부터, 대체로 0 uM에서 100 uM로 농도가 증가하면서 농도에 유의적으로 C/EBPα와 PPARγ, 지방세포 분화에 관여하는 유전자들의 발현이 억제됨을 확인할 수 있었으며, 특히 aP2의 경우에는 60 uM만 처리한 경우에도 유전자 발현이 크게 억제되었음을 확인할 수 있었다.
표 1
Gene name Forward primer Reverse primer
GAPDH GAGTCAACGGATTTGGTCGT GACAAGCTTCCCGTTCTCAG
PPARγ CGCTGATGCACTGCCTATGA AGAGGTCCACAGAGCTGATTCC
C/EBPα AGGTGCTGGAGTTGACCAGT CAGCCTAGAGATCCAGCGAC
GLUT4 CTTCTTTGAGATTGGCCCTGG AGGTGAAGATGAAGAAGCCAAGC
Adiponectin AGCCTGGAGAAGCCGCTTAT TTGCAGTAGAACTTGCCAGTGC
aP2 CATGGCCAAGCCCAACAT CGCCCAGTTTGAAGGAAATC
ADD1/SREBP1c CAAACTGCCCATCCACCGAC TGCCTCCTCCACTGCCACAA
Resistin TCAACTCCCTGTTTCCAAATGC TCTTCACGAATGTCCCACGA
실험예 5 : 웨스턴 블롯 분석 (Western blot assay)
지방세포 분화 유도 방법과 같이 3T3-L1 세포에 (1S,2S,3S,4S)-5-아미노사이클로펜탄-1,2,3,4-테트라올 시료를 이틀 간격으로 처리한 후 세포를 PBS로 두 번 세척하였으며, RIPA buffer (50 mM Tris-HCl, pH 8.0, 150 mM sodium chloride, 1 % NP-40, 0.5 % sodium dexycholate, 0.1 % sodium dodecyl sulfate, protease inhibitor)를 이용하여 세포를 용해시켰다. 13000 rpm에서 30분 동안 원심 분리하여 단백질을 추출 정량하고, 8 % SDS-PAGE gel을 이용하여 전기영동을 수행하였다. 전기영동된 protein들을 membrane에 이동시킨 후 5 % skim milk를 포함하는 TBST로 blocking 하였다. 1차 항체 (PPARγ, C/EBPα)와 2차 항체로 반응시킨 후 ECL을 통해 PPARγ 및 C/EBPα 단백질을 규명하였으며, 그 결과를 도 9에 나타내었다.

Claims (13)

  1. 하기 화학식 1로 표시되는 화합물을 유효성분으로 포함하는 항비만 조성물.
    [화학식 1]
    Figure PCTKR2011000591-appb-I000011
  2. 제1항에 있어서, 상기 조성물은 PPAR-γ (peroxisome proliferator-activated receptor)의 활성을 억제함으로써 지방 전구세포가 지방세포로 분화되는 것을 억제시키는 것을 특징으로 하는 항비만 조성물.
  3. 제1항 또는 제2항의 조성물을 유효성분으로 포함하는 비만의 예방 또는 치료용 약제학적 조성물.
  4. 제3항에 있어서, 상기 약제학적 조성물은 정제, 환제, 산제, 과립제, 캡슐제, 현탁제, 내용액제, 유제, 시럽제, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제 및 좌제으로 이루어진 군으로부터 선택되는 어느 하나의 제형을 가지는 것을 특징으로 하는 비만의 예방 또는 치료용 약제학적 조성물.
  5. 제1항 또는 제2항의 조성물을 유효성분으로 포함하는 비만의 예방 또는 개선용 식품 조성물.
  6. 제5항에 있어서, 상기 식품 조성물은 육류, 소세지, 빵, 초콜릿, 캔디류, 스넥류, 과자류, 피자, 라면, 껌류, 아이스크림류, 스프, 음료수, 차, 드링크제, 알콜 음료 및 비타민 복합제로 이루어진 군으로부터 선택되는 어느 하나임을 특징으로 하는 비만의 예방 또는 개선용 식품 조성물.
  7. 제1항 또는 제2항의 조성물을 유효성분으로 포함하는 비만의 예방 또는 개선용 의약외품 조성물.
  8. 제7항에 있어서, 상기 의약외품 조성물은 소독청결제, 샤워폼, 가그린, 물티슈, 세제비누, 핸드워시, 가습기 충진제, 마스크, 연고제 및 필터충진제로 이루어진 군으로부터 선택되는 어느 하나의 제조에 사용되는 것을 특징으로 하는 비만의 예방 또는 개선용 의약외품 조성물.
  9. 제1항 또는 제2항의 조성물을 유효성분으로 포함하는 비만의 예방 또는 개선용 화장료 조성물.
  10. 제9항에 있어서, 상기 화장료 조성물의 제형은 유연화장수, 수렴화장수, 영양화장수, 영양크림, 마사지크림, 에센스, 아이크림, 아이에센스, 클렌징크림, 클렌징폼, 클렌징워터, 팩, 파우더, 바디로션, 바디크림, 바디오일, 바디에센스, 메이컵 베이스, 파운데이션, 염모제, 샴푸, 린스 및 바디 세정제로 이루어진 군으로부터 선택되는 어느 하나의 제형을 가지는 것을 특징으로 하는 비만의 예방 또는 개선용 화장료 조성물.
  11. 하기 화학식 1로 표시되는 화합물을 항비만 조성물을 제조하는데 사용하는 용도.
    [화학식 1]
    Figure PCTKR2011000591-appb-I000012
  12. 하기 화학식 1로 표시되는 화합물을 항비만제로 사용하는 용도.
    [화학식 1]
    Figure PCTKR2011000591-appb-I000013
  13. 개체에 하기 화학식 1로 표시되는 화합물을 투여하는 단계를 포함하여, 비만을 예방 또는 치료하는 방법.
    [화학식 1]
    Figure PCTKR2011000591-appb-I000014
PCT/KR2011/000591 2010-01-27 2011-01-27 （１ｓ,２ｓ,３ｓ,４ｓ）-５- 아미노사이클로펜탄 - １,２,３,４- 테트라올을 포함하는 항비만 조성물. WO2011093664A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2010-0007547 2010-01-27
KR1020100007547A KR101074954B1 (ko) 2010-01-27 2010-01-27 （１ｓ,２ｓ,３ｓ,４ｓ）―５―아미노사이클로펜탄―１,２,３,４―테트라올을 포함하는 항비만 조성물

Publications (2)

Publication Number Publication Date
WO2011093664A2 true WO2011093664A2 (ko) 2011-08-04
WO2011093664A3 WO2011093664A3 (ko) 2012-01-05

Family

ID=44319997

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2011/000591 WO2011093664A2 (ko) 2010-01-27 2011-01-27 （１ｓ,２ｓ,３ｓ,４ｓ）-５- 아미노사이클로펜탄 - １,２,３,４- 테트라올을 포함하는 항비만 조성물.

Country Status (2)

Country Link
KR (1) KR101074954B1 (ko)
WO (1) WO2011093664A2 (ko)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5684026A (en) * 1994-11-22 1997-11-04 Seikagaku Kogyo Kabushiki Kaisha (Seikagaku Corporation) Aminocyclopentane derivative

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5684026A (en) * 1994-11-22 1997-11-04 Seikagaku Kogyo Kabushiki Kaisha (Seikagaku Corporation) Aminocyclopentane derivative

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ADAM DREWNOWSKI ET AL.: 'Effects of inhibitors of carbohydrate absorption or lipid metabolism on meal patterns of Zucker rats' PHARMACOLOGY BIO-CHEMISTRY & BEHAVIOR vol. 23, 1985, pages 811 - 821 *
LUCAS GARTENMANN DICKSON ET AL.: 'Structure-activity relationships in amino- cyclopentitol glycosidase inhibitors' ORG. BIOMOL. CHEM. vol. 2, 2004, pages 1217 - 1226 *

Also Published As

Publication number Publication date
KR101074954B1 (ko) 2011-10-18
KR20110087899A (ko) 2011-08-03
WO2011093664A3 (ko) 2012-01-05

Similar Documents

Publication Publication Date Title
WO2018194309A1 (ko) 인디루빈 유도체를 유효성분으로 포함하는 약학 조성물
WO2012165731A1 (ko) 쌀, 쌀겨 또는 왕겨 추출물의 히스타민 수용체 길항제로서의 신규 용도
WO2014058142A1 (ko) 섬쑥부쟁이 추출물을 유효성분으로 함유하는 비만 또는 대사성질환의 예방 또는 치료용 약학적 조성물
WO2013176471A1 (ko) 곰보배추의 추출물 또는 이의 분획물을 유효성분으로 포함하는, stat3 매개 질환의 예방 또는 치료용 약학적 조성물
WO2017222317A1 (ko) 이오논 또는 이의 염을 유효성분으로 함유하는 피부보습 개선, 피부각질 제거, 피부탄력 증진, 홍반 억제, 피부주름 개선 또는 피부광노화 개선 효과를 갖는 조성물
WO2017014502A1 (ko) 해당화 꽃 추출물을 유효성분으로 포함하는 il-6 매개성 질환의 예방 또는 치료용 약학적 조성물
WO2015108394A1 (ko) 히드록시 피라논 유도체 화합물을 포함하는 지방세포 분화 촉진용 화장료 조성물
WO2020040432A1 (ko) 인삼열매 추출물을 유효성분으로 함유하는 근육 질환의 예방 또는 치료용 약학적 조성물
WO2021080129A1 (ko) 하이드란제놀 또는 필로둘신을 유효성분으로 하는 피부장벽 강화 및 아토피 피부염 개선용 조성물
WO2012008788A2 (ko) 세린을 유효성분으로 함유하는 지방간 질환의 예방 및 치료용 조성물 및 이의 용도 {composition for the prevention and treatment of fatty liver diseases containing serine as an active ingredient and the use thereof}
KR20160068721A (ko) 개머루덩굴 추출물, 이의 분획물 또는 이로부터 분리된 화합물을 유효성분으로 포함하는 ｉｌ-6 매개성 질환의 예방 또는 치료용 약학적 조성물
WO2020166779A1 (ko) 하이드란제놀을 유효성분으로 하는 지방형성 억제 및 체지방 감소용 조성물
WO2013012117A1 (en) Pharmaceutical compositions for preventing or treating inflammatory diseases, comprising phytosterol compound
WO2015034247A1 (ko) 모노아세틸디아실글리세롤 화합물을 유효성분으로 함유하는 아토피 피부염의 예방 또는 치료용 조성물
WO2015167240A1 (ko) 알피나 골무꽃 추출물을 포함하는 조성물
WO2019083132A1 (ko) 사이토칼라신 d 또는 sag를 포함하는 항노화용 조성물 및 항노화 물질 스크리닝 방법
WO2011093664A2 (ko) （１ｓ,２ｓ,３ｓ,４ｓ）-５- 아미노사이클로펜탄 - １,２,３,４- 테트라올을 포함하는 항비만 조성물.
WO2019031655A1 (ko) 티몰을 유효성분으로 함유하는 피부 주름 또는 아토피성 피부염의 예방 또는 치료용 조성물
WO2020256381A1 (ko) 옥타데센 또는 이의 염을 유효성분으로 포함하는 피부 미백용 조성물
WO2016003120A1 (ko) 알피나 골무꽃 추출물을 포함하는 미백용 조성물
KR100959557B1 (ko) 육두구 가종피 추출 화합물을 유효성분으로 포함하는당뇨병 또는 피피에이알-감마 매개 질환 예방 및 치료용약학적 조성물
WO2018155933A1 (ko) 아쿠아포린-3의 발현을 증가시키는 6,7-디메톡시-2,2-디메틸-2h-크로멘 및 이의 용도
WO2023080726A1 (ko) 대황 추출물 또는 2-phloroeckol을 유효성분으로 포함하는 에너지 대사 촉진 또는 개선용 조성물
WO2018038313A1 (ko) 신규한 디노익산 화합물 및 이를 포함하는 골 질환의 예방 또는 치료용 약학적 조성물
WO2023282624A1 (ko) 멸가치 추출물 또는 네오클로로겐산을 유효성분으로 포함하는 비만 예방 또는 개선용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11737303

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11737303

Country of ref document: EP

Kind code of ref document: A2