WO2011087343A2 - Hpv 감염과 관련된 암의 치료용 조성물 - Google Patents
Hpv 감염과 관련된 암의 치료용 조성물 Download PDFInfo
- Publication number
- WO2011087343A2 WO2011087343A2 PCT/KR2011/000365 KR2011000365W WO2011087343A2 WO 2011087343 A2 WO2011087343 A2 WO 2011087343A2 KR 2011000365 W KR2011000365 W KR 2011000365W WO 2011087343 A2 WO2011087343 A2 WO 2011087343A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cancer
- sirna
- oligonucleotide
- hpv
- group
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
Definitions
- the present invention relates to chemo or radiation sensitizers in the anti-cancer treatment of cancer caused by human papilloma virus (HPV) infection.
- HPV human papilloma virus
- High-risk Human Papilloma Virus (HPV) types 16 and 18 are the leading causes of cervical cancer and cervical dysplasia and are associated with other genital and head and neck squamous cell carcinomas.
- Cervical cancer is one of the most common types of malignant tumors in women. The incidence of invasive cervical cancer is slowly decreasing, but it is the most frequent cancer for all women in developing countries, accounting for 25% of female cancers.
- HPV is a small DNA virus that causes benign malignancies with approximately 8,000 sequences. To date, more than 100 HPV subtypes have been identified according to genome differences, and approximately 90 HPV genotypes have been fully analyzed.
- HPV-16 high risk HPV types
- HPV-18 More than 50% of cervical cancers infected with HPV are related to HPV-16 type, followed by HPV-18 (12%), HPV-45 (8%) and HPV-31 (5%) types.
- HPV-31 56% types.
- This HPV encodes two oncogenic proteins E6 and E7. These proteins are all involved in HPV-mediated immortalization and cell transformation. Carcinogenic E6 protein binds to wild type p53 tumor suppressor protein and degrades p53 via the ubiquitin pathway. E7 protein, on the other hand, directly binds to Rb for hyperphosphorylation.
- E6 complexes with E6-AP E6-associated protein
- E6-AP E6-associated protein
- E6-AP E6-associated protein
- E3 ubiquitin-protein ligase E6-associated protein
- the E6 / E6-AP complex then binds to the p53 of the wild type and ubiquitizes, interfering with the p53-mediated cell response to DNA damage.
- p53 tumor suppressor proteins are regulated by Mdm2 mediated ubiquitination, but in HPV-infected cervical cancer cells, the degradation of p53 is completely replaced by M6 and U6 ubiquitination.
- cervical cancer infected with HPV almost all have the wild type p53 gene. But consistently degraded by the E6 protein, the expression level of the p53 protein is very low.
- HPV E6 protein has received considerable attention because it is a specific target capable of killing only cervical cancer cells.
- RNA interference caused by transfection of siRNAs has emerged as a new treatment for treating viral infections in humans.
- RNAi targeting the E6 and E7 cancer genes of the virus was found to selectively silence the expression of these proteins.
- Cisplatin is currently a DAN damaging drug widely used to treat cancers including ovaries, neck, head and neck, non-small cell lung cancer, and the like. More recently, the mechanism of action of platinum-based drugs has been investigated. However, the processes involving the control of drug uptake and excretion by treatment of cisplatin on cells, signaling of DNA damage, cell cycle tracking, DNA repair and cell death are not yet fully understood. After cisplatin treatment in HPV-18 HeLa cells, p53 protein escaped from E6-mediated degradation and accumulated preferentially in nuclear phosphorus. In addition, HPV-16 SiHa cells restored p53 function by simultaneous radiation therapy and cisplatin treatment, resulting in increased radiation sensitivity.
- siRNAs specific for E6 / E7 that can be synergistic by being treated together when performing chemotherapy or radiation therapy, resulting in sense oligonucleotides selected from the group consisting of SEQ ID NOs: 1-10.
- siRNAs formed by hybridizing antisense oligonucleotides complementarily binding to the sense sequence were treated in combination when performing chemotherapy or radiation therapy, thereby confirming that the synergistic effect was significantly higher than that of a single treatment. .
- HPV human papilloma virus
- Still another object of the present invention is to provide a method for enhancing sensitivity to chemotherapy or radiotherapy of cancer associated with HPV infection when performing chemotherapy or radiation therapy for the treatment of cancer caused by the HPV infection.
- the present invention comprises an oligonucleotide having any nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10 as an active ingredient, cancer treatment caused by human papilloma virus (HPV) infection Provide chemical or radiation sensitizers.
- the present invention includes a recombinant expression vector expressing a DNA fragment corresponding to an oligonucleotide having any one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10 as an active ingredient, cancer induced by HPV infection Therapeutic chemical or radiation sensitizers are provided.
- the present invention includes the step of co-administering the sensitizer to cancer cells caused by HPV infection when performing chemotherapy or radiation therapy for the treatment of cancer caused by HPV infection, caused by HPV infection It provides a method for enhancing the sensitivity of chemotherapy or radiotherapy to cancer.
- the present invention also provides the use of an oligonucleotide having a nucleic acid sequence selected from the group consisting of SEQ ID NOs. 1 to 10 in the manufacture of a chemistry or radiation sensitizer for treating cancer caused by HPV infection.
- the present invention is a chemical or radiation sensitization for cancer treatment caused by HPV infection of a recombinant expression vector expressing a DNA fragment corresponding to an oligonucleotide having any one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10 Provided are uses for the manufacture of medicaments.
- the siRNA of the present invention has superior cervical cancer treatment effect than HPV-specific siRNA or chemotherapy or radiation therapy alone, and can maximize the apoptosis effect by enhancing the sensitivity of cervical cancer cells to radiation or anticancer agents. have.
- FIG. 1 is a diagram showing the effect of inhibiting the cell proliferation of cervical cancer cell lines by siRNA treatment prepared by targeting HPV 18 E6 / E7:
- Figure 2 is a diagram confirming the synergistic effect of 426 siRNA and chemotherapy combined treatment in HeLa cervical cancer cell lines infected with cervical cancer cells and HPV type 18 virus:
- Figure 3 is a diagram confirming the synergistic effect of 497 siRNA and chemotherapy combination in SiHa cervical cancer cell line infected with HPV type 16 virus:
- Figure 4 is a diagram confirming the synergistic effect by radiotherapy combination with 426 siRNA or 450 siRNA in HeLa cell line:
- d microscopic observation of the morphological changes of the cells.
- 5 is a diagram confirming the synergistic effect on the inhibition of cell proliferation by 497 siRNA and radiotherapy combined treatment in SiHa cell line.
- 6 is a diagram confirming the synergistic effect of the combination of siRNA and cisplatin or irradiation by Chou-Talalay analysis:
- siRNA refers to a double-chain RNA capable of inducing RNA interference (RNAi) through cleavage of mRNA of a target gene, and is homologous to mRNA of a target gene. It consists of a sense RNA strand having a sequence and an antisense RNA strand having a sequence complementary thereto. Since siRNA can inhibit expression of a target gene, it is provided by an efficient gene knockdown method or gene therapy method.
- RNAi RNA interference
- the phrase “inhibition of gene expression” refers to the ability of gene silencing for the E6 / E7 gene of HPV18 or HPV16 of the siRNA of the invention. Inhibition of expression of the E6 / E7 gene is achieved when the test value based on the control is about 90%, preferably 50%, more preferably 25-0%.
- Suitable assays are, for example, using techniques known to those of skill in the art, such as dot blots, northern blots, in situ hybridization, ELISA, immunoprecipitation, enzyme functions, as well as phenotypic assays known to those skilled in the art. Investigation of protein or mRNA levels.
- the term “specific” or “specific” refers to the ability to inhibit only target genes without affecting other genes in the cell, and is E6 / E7 specific in the present invention.
- a chemical or radiation sensitizer for cancer treatment caused by HPV infection comprising an oligonucleotide having any one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10 as an active ingredient.
- the high-risk human papilloma virus (HPV) 16, 18 types of two oncogenic proteins E6 and E7 that can specifically bind to SiRNAs having a nucleic acid sequence as set forth in SEQ ID NOs: 1 to 10 were prepared.
- the cell proliferation inhibitory activity of cervical cancer cells of the prepared siRNA showed an excellent cell proliferation inhibitory effect on 103, 426, 450, 456 or 458 siRNA in HeLA cell line infected with HPV type 18 virus, and HPV 16.
- CaSki cell lines infected with the bun form of virus showed excellent cell proliferation inhibitory effects on 366, 448, 497, 573 or 752 siRNA.
- the combination of chemotherapy and 426 siRNA in HeLa cells showed a synergistic effect on the inhibition of cell proliferation and induction of cell senescence than the group treated alone.
- the combination of chemotherapy and 497 siRNA showed a synergistic effect on the inhibition of cell proliferation and induction of cell senescence compared to the single treatment group.
- the siRNA and radiotherapy combination group showed similar results.
- 426 siRNA showed better combination treatment effect than 450 siRNA (see FIGS. 4 and 5).
- the more accurate synergistic effect of the combination treatment was confirmed by Chou-Talalay analysis, which showed synergistic effect in the low concentration of siRNA in the HPV-18 HeLa cell line, HPV-16 SiHa cell line, and HPV-16 CaSki cell line and the combination of CDDP.
- the therapeutic effect was shown, and it was analyzed to show synergistic therapeutic effect in the combination of low concentration of siRNA and irradiation in the HPV-16 SiHa cell line (see FIG. 6).
- the siRNA described in SEQ ID NOS: 1 to 10 of the present invention may be usefully used as a chemical or radiation sensitizer that may have a synergistic effect when combined with chemotherapy or radiation therapy for the treatment of cancer associated with HPV infection. have.
- Cancer caused by the HPV infection is not limited to cervical cancer, vagina cancer (vulgina cancer), vulva cancer (vulva cancer), anal cancer (anal cancer), penis cancer (penis cancer), tonsill cancer (tonsil cancer) ), Pharynx cancer, larynx cancer, head & neck and lung adenocarcinoma, preferably cervical cancer.
- the oligonucleotide is a shRNA that is a single RNA strand of stem-loop structure in which a small interfering RNA (siRNA), in which a sense oligonucleotide and complementary antisense oligonucleotides are complementarily intermixed, an oligonucleotide and an antisense oligonucleotide are connected by a loop.
- siRNA small interfering RNA
- ASO antisense oligonucleotide
- ASO antisense oligonucleotide
- the siRNA can be easily produced by requesting siRNA manufacturers such as Ambion (//www.ambion.com), Dharmacon (//www.dharmacon.com), and SIGMA (//www.sigmaaldrich.com). Because of the short oligomers, it is easy to transduce common cell lines.
- the siRNA is not limited to completely paired double-chain RNA portion paired with RNA, and may have a hairpin structure that forms a stem-loop structure, in particular, shRNA (short hairpin RNA).
- shRNA short hairpin RNA
- the double-chain or stem region may include a portion not paired by mismatch (corresponding base is not complementary), bulge (the base does not have a corresponding chain).
- the total length is 10 to 80 bases, preferably 15 to 60 bases, more preferably 20 to 40 bases.
- the loop region has no special meaning in the sequence, and only 3 to 10 bases are needed to connect the sense oligonucleotide and the antisense oligonucleotide at appropriate intervals.
- Examples that have been widely used as loop regions of siRNAs are as follows: AUG (Sui et al., Proc. Natl. Acad. Sci . USA 99 (8): 5515-5520, 2002), CCC, CCACC or CCACACC ( Paul et al., Nature Biotechnology 20: 505-508, 2002), UUCG (Lee et al., Nature Biotechnology 20: 500-505), CTCGAG, AAGCUU (Editors of Nature Cell Biology Whither RNAi, Nat Cell Biol. 5: 489-490, 2003), UUCAAGAGA (Yu et al., Proc. Natl. Acad. Sci.
- siRNA terminal structures can be either blunt ends or cohesive ends.
- the cohesive end structure can be both a 3 'protruding structure and a 5' end protruding structure, and the number of protruding bases is not limited.
- the number of bases may be 1 to 8 bases, preferably 2 to 6 bases.
- siRNA is a low-molecular RNA (e.g., a natural RNA molecule such as tRNA, rRNA, viral RNA or the like) in the protruding portion of one end in a range capable of maintaining the expression inhibitory effect of carcinogenic E6 / E7 protein Artificial RNA molecules).
- the siRNA terminal structure does not need to have a cleavage structure at both sides, and may be a stem loop type structure in which one terminal portion of the double chain RNA is connected by a linker RNA.
- the length of the linker is not particularly limited as long as it does not interfere with pairing of stem portions.
- the present invention includes a recombinant expression vector expressing a DNA fragment corresponding to an oligonucleotide having any one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10 as an active ingredient, cancer induced by HPV infection Therapeutic chemical or radiation sensitizers are provided.
- the cancer caused by the HPV infection may be selected from the group consisting of, but not limited to, cervical cancer, vaginal cancer, vulvar cancer, anal cancer, penis cancer, tonsil cancer, pharyngeal cancer, laryngeal cancer, head and neck cancer and lung adenocarcinoma. And preferably cervical cancer.
- the oligonucleotide is a shRNA that is a single RNA strand of stem-loop structure in which a small interfering RNA (siRNA), in which a sense oligonucleotide and complementary antisense oligonucleotides are complementarily intermixed, an oligonucleotide and an antisense oligonucleotide are connected by a loop.
- siRNA small interfering RNA
- ASO antisense oligonucleotide
- ASO antisense oligonucleotide
- the expression vector may be any expression vector known in the art capable of expressing any one selected from the group consisting of siRNA, shRNA and antisense oligonucleotides described in SEQ ID NOS: 1 to 10 of the present invention.
- Promega products include the GeneClip TM U1 Hairpin Cloning System (Cat. # 'S C8750, C8760, C8770, C8780, C8790), siLentGene TM U6 Cassette RNA Interference System (Cat. # C7800), and the T7 RiboMAX TM Express RNAi System (Cat # P1700), siSTRIKE TM U6 Hairpin Cloning Systems (Cat.
- GenRNA products available include pRNA-U6.1 (Cat. # 'S SD1201, SD1202, SD1207), pRNATin-H1.2 (Cat. #' S SD1223, 1224) and pRNA-H1.1 / Adeno (Cat # SD12009).
- the present invention includes the step of co-administering the sensitizer to cancer cells associated with HPV infection when performing chemotherapy or radiation therapy for the treatment of cancer caused by HPV infection, cancer caused by HPV infection It provides a method for increasing sensitivity to chemotherapy or radiotherapy.
- the step of first administering the sensitizer several hours before the chemotherapy preferably four hours before the chemotherapy is performed.
- a step of administering a sensitizer twice a day over two days after irradiation is performed.
- the cancer caused by the HPV infection may be selected from the group consisting of, but not limited to, cervical cancer, vaginal cancer, vulvar cancer, anal cancer, penis cancer, tonsil cancer, pharyngeal cancer, laryngeal cancer, head and neck cancer and lung adenocarcinoma. And preferably cervical cancer.
- the cancer cells caused by HPV infection may be isolated cells or cultured cells expressing the E6 / E7 gene, and may be included in mammals without being separated. Examples of mammals include non-human mammals (eg, dogs, cats, horses, pigs, sheep, cattle, goats, rodents; hamsters, mice, rats, and primates) and humans. In the present invention, HeLa and SiHa were used as cancers associated with HPV infection expressing the E6 / E7 gene.
- SiRNA, shRNA, antisense oligonucleotide or expression vector included as an active ingredient in the sensitizer is usually administered as a pharmaceutical composition.
- the administration can be carried out by commonly used gene transduction techniques, in which the nucleic acid is introduced into the target cell in vitro or in vivo .
- siRNA, shRNA or antisense oligonucleotide into the cell is not particularly limited, but may be directly synthesized and then directly incorporated into a host cell, or an expression vector prepared to express siRNA, shRNA or antisense oligonucleotide in a cell or It is preferable to carry out by transforming or infecting cells with a PCR-based expression cassette or the like, and the expression vector is not particularly limited thereto.
- cationic liposomes a recent addition to these techniques for introducing nucleotides into cells is the use of cationic liposomes (Felgner PL et al ., Proc. Nati. Acad. Sci. USA 84: 7413, 1987).
- Commercially available cationic lipid preparations are, for example, Tfx 50 (Promega) or Lipofectamin 20OO (Life Technologies).
- the method of directly incorporating siRNA, shRNA or antisense oligonucleotides capable of complementarily hybridizing to genes of oncogenic E6 / E7 proteins into the cells is not particularly limited, but cations per ⁇ g of siRNA, shRNA or antisense oligonucleotides 2-6 ⁇ g of sex liposomes are mixed and lipofection is performed for 15-40 minutes.
- the sensitizer of the present invention further contains a pharmaceutically acceptable excipient.
- Pharmaceutically acceptable excipients are known in the art and are relatively inert substances which facilitate the administration of pharmaceutically active substances.
- an excipient can impart a shape or viscosity or can also act as a diluent.
- Suitable excipients include, but are not limited to, stabilizers, moisturizers, and emulsifiers, salts capable of varying osmolality, encapsulating agents, buffers, skin penetration promoters. Excipients and formulations for oral and parenteral drug delivery are presented in Remington, The Science and Practice of Pharmacy, 20th Edition, Mack Publishing (2000).
- the sensitizer may be mixed with a suitable carrier and administered in any suitable manner, such as by injection, oral, topical, nasal, rectal application, and the like.
- the carrier can be any suitable pharmaceutical carrier.
- a carrier is used that can increase the efficiency with which the RNA molecule is introduced into the target-cell.
- Suitable examples of such carriers are liposomes, especially cationic liposomes. More preferred method of administration is injection.
- the sensitizer may be used for therapeutic application as a human medicine or a veterinary medicine, and the sensitizer may be in the form of a liquid such as an injectable solution, cream, ointment, tablet, suspension, and the like.
- siRNA, shRNA or antisense oligonucleotides The effective concentration of siRNA, shRNA or antisense oligonucleotides is sufficient to provide a reduction in the expression of the E7 / E7 gene, a carcinogenic protein, relative to the level of expression detected in the absence of the desired effect, e.g., siRNA, shRNA or antisense oligonucleotides.
- Amount. siRNA, shRNA or antisense oligonucleotides may be introduced in an amount that allows delivery of at least one copy per cell. The higher the amount of double stranded material introduced (e.g., at least 5, at least 10, at least 100, at least 500 or at least 1000 copies per cell), the higher the inhibitory efficiency, the lower the amount of introduction for specific applications. It may be advantageous.
- the present invention also provides the use of an oligonucleotide having a nucleic acid sequence selected from the group consisting of SEQ ID NOs. 1 to 10 in the manufacture of a chemistry or radiation sensitizer for treating cancer caused by HPV infection.
- the present invention is a chemical or radiation sensitization for cancer treatment caused by HPV infection of a recombinant expression vector expressing a DNA fragment corresponding to an oligonucleotide having any one nucleic acid sequence selected from the group consisting of SEQ ID NO: 1 to 10 Provided are uses for the manufacture of medicaments.
- the cancer caused by the HPV infection may be selected from the group consisting of, but not limited to, cervical cancer, vaginal cancer, vulvar cancer, anal cancer, penis cancer, tonsil cancer, pharyngeal cancer, laryngeal cancer, head and neck cancer and lung adenocarcinoma. And preferably cervical cancer.
- the oligonucleotide is a shRNA that is a single RNA strand of stem-loop structure in which a small interfering RNA (siRNA), in which a sense oligonucleotide and complementary antisense oligonucleotides are complementarily intermixed, an oligonucleotide and an antisense oligonucleotide are connected by a loop.
- siRNA small interfering RNA
- ASO antisense oligonucleotide
- ASO antisense oligonucleotide
- Recombinant expression vector expressing the DNA fragment corresponding to the oligonucleotide is any expression vector known in the art that can express any one selected from the group consisting of siRNA, shRNA and antisense oligonucleotide described in SEQ ID NOS: 1 to 10 of the present invention Can also be used.
- Recombinant expression vector expressing the oligonucleotide or the corresponding DNA fragment of the present invention can maximize the effect of apoptosis by enhancing the sensitivity of cancer cells associated with HPV infection to radiation or anticancer agent, thereby treating cancer caused by HPV infection It can be usefully used for the preparation of chemical or radiation sensitizers.
- the siRNA of Table 1 below was obtained by customizing to Dharmacon (USA) Custom Service.
- Target base sequence Target transcript 426 One 5'- CAACCGAGCACGACAGGAA -3 ' HPV18 E6 / E7 450 2 5'- CCAACGACGCAGAGAAACA -3 ' HPV18 E6 / E7 103 3 5'- GCAAGACAGUAUUGGAACU -3 ' HPV18 E6 / E7 456 4 5'- ACGCAGAGAAACACAAGU -3 ' HPV18 E6 / E7 458 5 5'- GCAGAGAAACACAAGUAUA -3 ' HPV18 E6 / E7 366 6 5'- GCAAAGACAUCUGGACAAA-3 ' HPV16 E6 / E7 497 7 5'- GACCGGUCGAUGUAUGUCUUG -3 ' HPV16 E6 / E7 573 8 5'- CACCUACAUUGCAUGAAUAUA -3 ' HPV16 E6 / E7 752 9 5'- CUUCG
- HeLa cervical cancer cell line infected with cervical cancer cells and HPV type 18 virus (HeLa; ATCC CCL-2), SiHa (SiHa; ATCC HTB-35) or CaSki (ATCC CRL-1550) infected with HPV type 16 virus
- Cervical cancer cell lines were dispensed into 6-well plates with cell numbers of 5 ⁇ 10 4 or 1 ⁇ 10 5 , and then cultured in RPMI1640 or DMEM medium for 24 hours at 37 ° C. and 5% carbon dioxide.
- siRNA oligonucleotides of SEQ ID NOS: 1 to 10 prepared by the method of Example ⁇ 1-1> was used as a control oligofectamine (invitrogen, USA) and then incubated for 4 hours in 1 ml of medium. Thereafter, 500 ⁇ l of RPMI1640 or DMEM medium containing 30% bovine serum (Hyclone, USA) was added thereto and then cultured for 3 to 4 days.
- SiRNA was transduced into HeLa or SiHa cell lines cultured for 1 day by dispensing into 5 ⁇ 10 4 or 1 ⁇ 10 5 cells by the method of Example ⁇ 1-2>. After incubation for 4 hours, 30% bovine serum-containing medium was added, followed by treatment with cisplatin (CDDP) or nutlin-3 at a final concentration of 1.25 and 5 nM, respectively. DMSO was identified as a control.
- the cell lines were dispensed at a concentration of 1 ⁇ 10 6 or 5 ⁇ 10 5 cells in a T25 flask, followed by a 60Co source (Gamma cell 220) (AtomicLanergyLof Canada Limited, Canada) in a HeLa or SiHa cell line cultured for 1 day.
- Gamma radiation was irradiated for 60 hours using 60 Co as a source and a total dose of 2 Gy (dose rate 1.333 Gy / min).
- the cells were cultured for 6 days by dispensing 5 ⁇ 10 4 or 1 ⁇ 10 5 cells in 6 well-plates, followed by transducing siRNA by the method of Example ⁇ 1-2>, and further incubating for another day.
- SiRNA was transduced again by the method of Example ⁇ 1-2>.
- SA- ⁇ -gal ⁇ -galactosidase
- Example ⁇ 1-3> The method of Example ⁇ 1-3> was cultured for 7 days after the transduction of siRNA and anticancer agent / radiation alone or in combination with HeLa or SiHa cell lines. It was washed with PBS using a cell aging measurement kit (BioVision, USA) and treated with SA- ⁇ -gal staining solution at 37 ° C. for 12 hours. Cells stained blue were observed at 100-200 times magnification using a general optical microscope.
- Example ⁇ 1-3> The method of Example ⁇ 1-3> was cultured for 7 days after the transduction of siRNA and anticancer agent / radiation alone or in combination with HeLa or SiHa cell lines. On day 7, cell morphology was examined using a phase contrast microscope (AxioVision, Carl Zeiss, German).
- the cervical cancer cell line was transduced, and further cultured for one more day, siRNA was then transduced by the method of Example ⁇ 1-2>. After transduction, the cells were cultured for 3 days and the cell number was measured.
- 18E6-1 SEQ ID NO: 12: 5'-UAACCUGUGUAUAUUGCAA-3 '
- the HPV 18 HeLA cell line showed an excellent cell proliferation inhibitory effect in 103, 426, 450, 456 or 458 siRNA, and 103, 426, 448, 450, 456 or 458 siRNA were preceded.
- the proliferation of cell lines was significantly suppressed than that of 18E6-1 (herein described as 18E6 / E7), the siRNA targeting HPV 18 in the literature.
- HPV 16 CaSki cell line showed excellent cell proliferation inhibitory effect on 366, 448, 497, 573 or 752 siRNA, all 16E6-1 siRNAs targeting HPV No. 16 of the prior document (described herein as 16E6). More significantly inhibited proliferation of cell lines.
- the single treatment group (426 siRNA, cisplatin, nutlin respectively treated) and the combination group (426 siRNA and cisplatin or nutlin combined treatment) prepared for the HeLa cell line by the method of Example 1 were further incubated for 6 days Then, the cell number was measured.
- the group treated with chemotherapy and 426 siRNA in combination the cell proliferation was drastically reduced than the siRNA alone or anticancer alone or in combination.
- the number of cells significantly decreased in the group treated with 426 siRNA and nutlin-3, and the group treated with 426 siRNA, CDDP and nutlin-3.
- SA ⁇ -Gal activity was measured by the method of Example ⁇ 1-4> on day 6 of the cell lines treated by the method of Experimental Example ⁇ 1-1>.
- the single treatment group (only treated with 497 siRNA, cisplatin, and nutlin) and the combined treatment group (combined with 497 siRNA and cisplatin or nutlin) prepared for the SiHa cell line by the method of Example 1 were further incubated for 3 days. Then, the cell number was measured.
- the group treated with the chemotherapy and the 497 siRNA decreased dramatically compared to the group treated with the siRNA alone or the anticancer agent alone or in combination.
- SA ⁇ -Gal activity was measured by the method of Example ⁇ 1-4> on day 6 of the cell line treated by the method of Experimental Example ⁇ 3-1>.
- the group treated with radiation therapy and 426 siRNA or 450 siRNA showed a sharp decrease in cell proliferation than the group treated with siRNA alone or radiotherapy alone or in combination.
- 426 siRNA showed better combination effect than 450 siRNA.
- the SA ⁇ -Gal activity was measured by the method of Example 1-4 on day 4 of the cell line treated by the method of Experimental Example ⁇ 4-1>, and the form of the method of Example ⁇ 1-5> Physiologic changes were observed.
- the experimental group was prepared for the HeLa, SiHa or Caski cell line with the following design.
- HeLa cell line was treated with 426 siRNA, SiHa cell line with 497 siRNA, and CaSki cell line with 336 siRNA, respectively:
- siRNA treatment group 0, 5, 25, 50, 100 or 200 nM
- CDDP platinum alone group: 0, 0.625, 1.25, 2.5, 5 or 10 ⁇ ;
- siRNA + CDDP (cisplatin) combination group siRNA (0, 5, 25, 50, 100 or 200 nM) + CDDP 5 ⁇ M.
- siRNA + radiation combination group siRNA (0, 25 or 50 nM) + radiation (2 or 4 Gy)
- Equation 1 was converted to Equation 2 below.
- CI values of 0.36, 0.47 and 0.56 were lower than 1 in the combination of low concentrations of 5, 25 or 50 nM and 5 ⁇ M CDDP of 426 siRNA in HPV-18 HeLa cell line, respectively. It was analyzed to show a synergistic therapeutic effect.
- CI values of 0.60, 0.71 and 0.69 were synergistically lower than 1 in the combination of 5, 25 or 50 nM and 5 ⁇ M CDDP at low concentrations of 497 siRNA, respectively. It was analyzed to show a therapeutic effect.
- the siRNA of the present invention in chemotherapy, it has a superior cervical cancer treatment effect than HPV-specific siRNA or chemotherapy or radiation therapy alone, and the treatment of cervical cancer cells against radiation or anticancer agents. Since it enhances the sensitivity to maximize the apoptosis effect, it can be usefully used in the development and production of chemical or radiation sensitizers in the anti-cancer treatment of cancer caused by HPV infection.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Virology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
본 발명은 인간 유두종 바이러스(human papilloma virus: 이하, HPV) 감염에 의해 유발된 암의 항암 치료시 화학 또는 방사선 감작제에 관한 것으로, 구체적으로 서열번호 1 내지 10으로 구성된 군으로부터 선택되는 작은 간섭 RNA(small interfering RNA), shRNA(short hairpin RNA), 또는 안티센스 올리고뉴클레오티드(Antisense oligonucleotide, ASO)를 유효성분으로 포함하는, HPV 감염에 의해 유발된 암의 치료시 화학 또는 방사선 감작제에 관한 것이다. 본 발명의 siRNA는 단독으로 HPV 특이적인 siRNA 또는 화학요법 또는 방사선 요법을 수행하는 것보다 뛰어난 자궁경부암 치료 효과를 가지며, 방사선 또는 항암제에 대한 자궁경부암세포의 민감도를 증진시켜 세포사멸 효과를 극대화할 수 있다.
Description
본 발명은 인간 유두종 바이러스(human papilloma virus: 이하, HPV) 감염에 의해 유발된 암의 항암 치료시 화학 또는 방사선 감작제에 관한 것이다.
고위험성(High-risk) 인간 유두종 바이러스(Human Papilloma Virus: 이하, HPV) 16, 18 타입은 자궁경부암 및 자궁경부이형화의 주된 원인이 되는 요인이며 다른 생식기 암과 머리와 목 편평상피세포 암을 일으키는 원인이 된다. 자궁경부암은 여성에게 악성종양의 가장 일반적인 타입 중의 하나이다. 침윤성 자궁경부암의 발병률은 서서히 감소하고 있지만, 개발도상국의 모든 여성에게는 가장 빈번한 암으로 여성암의 25%를 차지한다. HPV는 대략 8,000개의 염기서열을 가진 양성 악성 종양을 일으키는 작은 DNA 바이러스이다. 현재까지 게놈의 차이에 따라 100여개 이상의 HPV 아류형이 확인되었으며, 대략 90개 정도의 HPV는 유전자형이 완전하게 분석되어있다. 이러한 타입 중에서 고위험성 HPV 타입(예를 들면, HPV-16, 18, 31, 33, 35, 45, 51, 52, 56)은 자궁경부암의 거의 90%에 관계하고 있다. HPV에 감염된 자궁경부암의 50% 이상은 HPV-16 타입이 관련이 있으며 다음으로 HPV-18(12%), HPV-45(8%), HPV-31(5%) 타입이 관련이 있다. 이러한 HPV는 2개의 발암성(oncogenic) 단백질 E6와 E7을 코드화한다. 이 단백질들은 모두 HPV를 매개로 한 세포의 불멸화 및 세포 형질 전환에 관계한다. 발암성 E6 단백질은 야생형의 p53 종양 억제 단백질에 결합하여 유비퀴틴 경로를 통하여 p53을 분해시킨다. 한편, E7 단백질은 직접 Rb에 결합하여 과-인산화를 시킨다. 먼저 E6는 E3 유비퀴틴-단백질 리가아제(ubiquitin-protein ligase)인 E6-AP(E6-associated protein)와 복합체를 형성한다. 그 후, E6/E6-AP 복합체는 야생형의 p53과 결합하여 유비퀴틴화 시킴으로 DNA 손상에 대한 p53을 매개로 하는 세포의 반응을 방해한다. 주로, p53 종양억제 단백질은 Mdm2를 매개로 하는 유비퀴틴화에 의해서 조절되지만, HPV에 감염된 자궁경부암 세포에서는 p53의 분해는 Mdm2에서 E6를 매개로 하는 유비퀴틴화로 완전하게 교체된다. 따라서 다른 많은 암과 달리, HPV에 감염된 자궁경부암은 거의 모두 야생형의 p53 유전자를 가진다. 그러나 일관적으로 E6 단백질에 의해서 분해되므로, p53 단백질의 발현 레벨은 매우 낮다. 특히, HPV E6단백질은 오로지 자궁경부암 세포만을 죽일 수 있는 특정 타깃이기에 상당한 주목을 받고 있다. E6 혹은 E6/E6-AP복합체를 타깃으로 하는 이러한 전략들은 여러 가지 치료를 포함하고 있다.
세포 독소 약의 사용, 바이러스의 E6 발암성 단백질의 아연을 방출하는 억제제, E6-AP의 모방의 에피토프펩티드(mimotope), 항-E6 리보자임, 바이러스의 E6 발암성 단백질을 타깃으로 하는 펩티드 압타머, 바이러스의 E6 발암 유전자를 타깃으로 하는 siRNA 및 이들의 병용처리 등이 있다. 최근, siRNA는 동물 세포에서 선택적으로 내부 유전자를 침묵시키는 것뿐만이 아니라, 바이러스에 의해 발생된 질병 중에서도 바이러스의 유전자를 선택적으로 침묵시킬 수 있음이 증명되었다. siRNA의 형질감염에 의해서 일어난 RNA 간섭(RNAi)은 인간의 바이러스 감염을 치료하기 위한 새로운 치료법으로서 등장했다. HPV에 감염된 자궁경부암 세포에서 E6와 E7의 유전자를 타깃으로 하는 siRNA는 p53과 pRb의 축적을 일으켜 아폽토시스(apoptosis) 또는 세포노화를 일으킨다. HPV-16에 감염된 자궁경부암 세포주와 HPV-18에 감염된 세포주의 경우에는 바이러스의 E6 및 E7암 유전자를 타깃으로 하는 RNAi가 선택적으로 이들 단백질의 발현을 침묵시키는 것이 밝혀졌다.
1999년에 시스플라틴(cisplatin)에 근거한 화학요법과 방사선 치료를 병용처리한 결과, 현저하게 로컬에 중증의 자궁경부암을 가진 여성의 생존률을 개선했다. 현재 시스플라틴은 난소, 경부, 머리 및 목, 비소세포 폐암 등을 포함하는 암을 치료하기 위해서 넓게 사용되는 DAN 손상 약물이다. 보다 최근, 플라티눔(Platinum)에 근거한 약제의 작용 메커니즘이 조사되었다. 그러나 세포 상에서 시스플라틴의 치료에 의한 약물의 흡수 및 배출 조절, DNA 손상의 시그널링, 세포 주기 추적, DNA 복구 및 세포 사멸을 포함하는 과정은 아직 완전하게는 이해되지 않았다. HPV-18 헬라(HeLa) 세포에서 시스플라틴 치료 후에 p53 단백질은 E6를 매개로 한 분해로부터 빠져나와 핵인에 우선적으로 축적되었다. 또한 HPV-16 SiHa 세포는 동시적인 방사선 요법과 시스플라틴 치료에 의해 p53 기능을 회복해 방사선 감수성이 증가되었다.
이에, 본 발명자들은 화학요법 또는 방사선 요법의 수행 시, 함께 처리됨으로써 상승 효과를 낼 수 있는 E6/E7에 특이적인 siRNA를 찾고자 예의 노력한 결과, 서열번호 1 내지 10으로 구성된 군으로부터 선택되는 센스 올리고뉴클레오티드 및 상기 센스 서열에 상보적으로 결합하는 안티센스 올리고뉴클레오티드를 혼성화하여 구성된 siRNA가 화학요법 또는 방사선 요법의 수행 시 병용 치료됨으로써, 단일 치료에 비해 유의하게 높은 상승 효과를 내는 것을 확인함으로써 본 발명을 완성하였다.
본 발명의 목적은 HPV(human papilloma virus) 감염에 의해 유발된 암의 치료를 위한 화학요법 또는 방사선 요법의 수행 시, 병용 처리됨으로써 상승 효과를 낼 수 있는 화학 또는 방사선 감작제를 제공하는 것이다.
본 발명의 또 다른 목적은 상기 HPV 감염에 의해 유발된 암의 치료를 위한 화학요법 또는 방사선 요법의 수행 시, HPV 감염과 관련된 암의 화합요법 또는 방사선요법에 대한 민감도 증진 방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 서열번호 1 내지 10으로 구성된 군으로부터 선택되는 어느 하나의 핵산 서열을 갖는 올리고뉴클레오티드를 유효성분으로 포함하는, HPV(human papilloma virus) 감염에 의해 유발된 암 치료용 화학 또는 방사선 감작제를 제공한다.
또한, 본 발명은 서열번호 1 내지 10으로 구성된 군으로부터 선택되는 어느 하나의 핵산 서열을 갖는 올리고뉴클레오티드에 상응하는 DNA 단편을 발현하는 재조합 발현벡터를 유효성분으로 포함하는, HPV 감염에 의해 유발된 암 치료용 화학 또는 방사선 감작제를 제공한다.
또한, 본 발명은 HPV 감염에 의해 유발된 암의 치료를 위한 화학요법 또는 방사선 요법의 수행 시, 상기 감작제를 HPV 감염에 의해 유발된 암세포에 병용투여하는 단계를 포함하는, HPV 감염에 의해 유발된 암의 화합요법 또는 방사선요법에 대한 민감도 증진 방법을 제공한다.
또한, 본 발명은 서열번호 1 내지 10으로 구성된 군으로부터 선택되는 어느 하나의 핵산 서열을 갖는 올리고뉴클레오티드를 HPV 감염에 의해 유발된 암 치료용 화학 또는 방사선 감작제의 제조에 이용하는 용도를 제공한다.
아울러, 본 발명은 서열번호 1 내지 10으로 구성된 군으로부터 선택되는 어느 하나의 핵산 서열을 갖는 올리고뉴클레오티드에 상응하는 DNA 단편을 발현하는 재조합 발현벡터를 HPV 감염에 의해 유발된 암 치료용 화학 또는 방사선 감작제의 제조에 이용하는 용도를 제공한다.
본 발명의 siRNA는 단독으로 HPV 특이적인 siRNA 또는 화학요법 또는 방사선 요법을 수행하는 것보다 뛰어난 자궁경부암 치료 효과를 가지며, 방사선 또는 항암제에 대한 자궁경부암세포의 민감도를 증진시켜 세포사멸 효과를 극대화할 수 있다.
도 1은 HPV 18 E6/E7을 표적으로 하여 제작된 siRNA 처리에 의한 자궁경부암 세포주의 세포 증식 억제 효과를 확인한 도이다:
a: HPV 18번 형태의 바이러스에 감염된 HeLa 자궁경부암 세포주에서의 효과; 및
b: HPV 16번 형태의 바이러스에 감염된 CaSki 자궁경부암 세포주에서의 효과.
도 2는 자궁경부암세포와 HPV 18번 형태의 바이러스에 감염된 HeLa 자궁경부암 세포주에서, 426 siRNA와 화학요법 병용처리에 의한 상승 효과를 확인한 도이다:
a: 세포 증식 억제 효과;
b: 세포 노화 유도 효과; 및,
c: 세포 노화 유도 효과의 현미경 관찰.
도 3은 HPV 16번 형태의 바이러스에 감염된 SiHa 자궁경부암세포주에서, 497 siRNA와 화학요법 병용처리에 의한 상승 효과를 확인한 도이다.:
a: 세포 증식 억제 효과;
b: 세포 노화 유도 효과; 및,
c: 세포 노화 유도 효과의 현미경 관찰.
도 4는 HeLa 세포주에서, 426 siRNA 또는 450 siRNA와 방사선요법 병용처리에 의한 상승 효과를 확인한 도이다:
a: 세포 증식 억제 효과;
b: 세포 노화 유도 효과;
c: 세포 노화 유도 효과의 현미경 관찰; 및,
d: 세포의 형태적 변화의 현미경 관찰.
도 5는 SiHa 세포주에서, 497 siRNA와 방사선요법 병용처리에 의한 세포 증식 억제에 대한 상승 효과를 확인한 도이다.
도 6은 siRNA 및 시스플라틴 또는 방사선 조사의 병용처리에 의한 상승효과를 Chou-Talalay 분석으로 확인한 도이다:
a: 426 siRNA-HeLa 세포주;
b: 497 siRNA-SiHa 세포주;
c: 366 siRNA+시스플라틴-CaSki 세포주; 및
d: 497 siRNA+방사선-SiHa 세포주.
이하, 본 발명에서 사용한 용어를 설명한다.
본 발명에서 사용되는 용어, "siRNA"는 표적 유전자의 mRNA의 절단(cleavage)을 통하여 RNA 간섭(RNAi: RNA interference) 현상을 유도할 수 있는 이중사슬 RNA를 의미하고, 표적유전자의 mRNA와 상동인 서열을 가지는 센스 RNA 가닥과 이와 상보적인 서열을 가지는 안티센스 RNA 가닥으로 구성된다. siRNA는 표적유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉다운 방법 또는 유전자치료(gene therapy)의 방법으로 제공된다.
본 발명에서 사용되는 문구 "유전자 발현 억제"는 본 발명의 siRNA의 HPV18 또는 HPV16의 E6/E7 유전자에 대한 유전자 침묵(silencing) 능력을 지칭한다. E6/E7 유전자의 발현 억제는 대조군에 기준한 시험 값이 약 90%, 바람직하게는 50%, 더욱 바람직하게는 25 ~ 0%인 경우 달성된다. 적합한 분석시험은 예를 들면, 당업자에게 공지된 기술, 예를 들면 도트 블롯, 노던 블롯, 인 시튜(in situ) 하이브리드화, ELISA, 면역 침전, 효소 기능뿐만 아니라 당업자에게 공지된 표현형 분석시험을 사용한 단백질 또는 mRNA 수준의 조사를 포함한다.
본 발명에서 사용되는 용어, "특이적" 또는 "특이적인"은 세포 내에서 다른 유전자에 영향을 미치지 않고 표적 유전자만 억제하는 능력을 의미하고, 본 발명에서는 E6/E7 특이적이다.
이하, 본 발명을 상세히 설명한다.
서열번호 1 내지 10으로 구성된 군으로부터 선택되는 어느 하나의 핵산 서열을 갖는 올리고뉴클레오티드를 유효성분으로 포함하는, HPV 감염에 의해 유발된 암 치료용 화학 또는 방사선 감작제를 제공한다.
본 발명의 구체적인 실시예에서는, 고위험성(High-risk) 인간 유두종 바이러스(Human Papilloma Virus: 이하, HPV) 16, 18 타입의 2개의 발암성(oncogenic) 단백질인 E6와 E7에 특이적으로 결합할 수 있는 서열번호 1 내지 10으로 기재된 핵산 서열을 갖는 siRNA를 제작하였다. 제작한 siRNA의 자궁경부암세포에 대한 세포증식 억제 활성을 확인한 결과, HPV 18번 형태의 바이러스에 감염된 HeLA 세포주에서는 103, 426, 450, 456 또는 458 siRNA에서 뛰어난 세포증식 억제 효과를 나타냈고, HPV 16번 형태의 바이러스에 감염된 CaSki 세포주에서는 366, 448, 497, 573 또는 752 siRNA에서 뛰어난 세포증식 억제 효과를 나타냈다. 이는 이전 특허 문헌(대한민국 특허 공개번호 10-2008-0040412)에서 공개한 HPV siRNA인 18E6-1(본 명세서에서는 18E6/E7로 기재) 및 16E6-1(본 명세서에서는 16E6으로 기재)보다 세포주의 증식 억제 활성이 현저히 뛰어난 것으로 확인되었다(도 1 참조). 이후, 자궁경부암세포와 HPV 18번 형태의 바이러스에 감염된 HeLa 자궁경부암 세포주 또는 HPV 16번 형태의 바이러스에 감염된 SiHa 자궁경부암 세포주에 상기 siRNA를 단독처리 하거나; 상기 siRNA를 처리 후, 시스플라틴(CDDP) 또는 nutlin-3의 항암제를 병용처리 하거나; 방사선 조사 후, 상기 siRNA를 병용처리 하였다. 상기와 같이 처리된 세포주의 병용처리에 의한 세포 증식 억제 효과를 측정한 결과, HeLa 세포에서 화학요법과 426 siRNA의 병용처리에 의해, 단독처리 군 보다 세포 증식 억제 및 세포 노화 유도에 상승 효과를 나타낸 바와 같이, SiHa 세포주에서도 화학요법과 497 siRNA의 병용처리가 단독처리 군 보다 세포 증식 억제 및 세포 노화 유도에 상승 효과를 나타내었다(도 2 및 도 3 참조). 또한, 상기 siRNA와 방사선 요법의 병용처리 군에서도 유사한 결과를 나타내었는데, 특히, 450 siRNA 보다 426 siRNA가 더 좋은 병용처리 효과를 보여주었다(도 4 및 도 5 참조). 또한, 상기 병용처리의 보다 정확한 상승 효과를 Chou-Talalay 분석을 통해 확인한 결과, HPV-18 HeLa 세포주, HPV-16 SiHa 세포주 및 HPV-16 CaSki 세포주에서 siRNA의 낮은 농도와 CDDP의 병용처리 군에서 상승적 치료 효과를 나타냈고, HPV-16 SiHa 세포주에서 siRNA의 낮은 농도와 방사선 조사의 병용처리 군에서 상승적 치료 효과를 나타낸 것으로 분석되었다(도 6 참조). 이로써, 본 발명의 서열번호 1 내지 10으로 기재된 siRNA는 HPV 감염과 관련된 암의 치료를 위한 화학요법 또는 방사선 요법의 수행 시, 병용처리됨으로써 상승 효과를 낼 수 있는 화학 또는 방사선 감작제로 유용하게 사용될 수 있다.
상기 HPV 감염에 의해 유발된 암은, 이에 제한되는 것은 아니나 자궁경부암, 질암(vagina cancer), 외음부암(vulva cancer), 항문암(anal cancer), 음경암(penis cancer), 편도암(tonsil cancer), 인두암(pharynx cancer), 후두암(larynx cancer), 머리와 목암(head & neck) 및 폐의 선암(lung adenocarcinoma)으로 이루어진 군으로부터 선택될 수 있으며, 바람직하게는 자궁경부암이다.
상기 올리고뉴클레오티드는 센스 올리고뉴클레오티드 및 이에 상보적인 안티센스 올리고뉴클레오티드가 상보적으로 혼상화된 siRNA(small interfering RNA), 올리고뉴클레오티드 및 안티센스 올리고뉴클레오티드가 루프에 의해 연결된 스템-루프 구조의 단일 RNA 가닥인 shRNA(short hairpin RNA), 및 안티센스 올리고뉴클레오티드(Antisense oligonucleotide, ASO)로 구성된 군으로부터 선택되는 어느 하나인 것이 바람직하나 이에 한정되지 않는다. 상기 siRNA는 Ambion(//www.ambion.com), Dharmacon(//www.dharmacon.com), SIGMA(//www.sigmaaldrich.com) 같은 siRNA 제조회사에 의뢰하여 손쉽게 제작할 수 있고, 21nt 내외의 짧은 올리고머이기 때문에 일반적인 세포주에 형질도입이 수월하다.
상기 siRNA는 RNA끼리 짝을 이루는 이중사슬 RNA 부분이 완전히 쌍을 이루는 것에 한정되지 않고, 스템-루프(stem-loop)의 구조를 이루는 헤어핀 구조를 가질 수 있는데, 이를 특히 shRNA(short hairpin RNA)라 지칭한다. 한편, 상기 이중사슬 또는 스템 부위는 미스매치(상응하는 염기가 상보적이지 않음), 벌지(일방의 사슬에 상응하는 염기가 없음) 등에 의하여 쌍을 이루지 않는 부분이 포함될 수도 있다. 전체 길이는 10 내지 80 염기, 바람직하게는 15 내지 60 염기, 더욱 바람직하게는 20 내지 40 염기이다. 또한, 상기 루프 영역은 서열에 특별한 의미가 없으며, 단지 센스 올리고뉴클레오티드와 안티센스 올리고뉴클레오티드를 적당한 간격으로 연결하기 위하여 3 ~ 10 정도의 염기가 있으면 가능하다. 종래에 siRNA의 루프 영역으로 많이 사용되어온 예들은 다음과 같다: AUG(Sui et al.,
Proc. Natl. Acad. Sci. USA 99(8):5515-5520, 2002), CCC, CCACC 또는 CCACACC(Paul et al.,
Nature Biotechnology 20:505-508, 2002), UUCG(Lee et al.,
Nature Biotechnology 20:500-505), CTCGAG, AAGCUU(Editors of Nature Cell Biology Whither RNAi, Nat Cell Biol. 5:489-490, 2003), UUCAAGAGA(Yu et al.,
Proc. Natl. Acad. Sci. USA 99(9):6047-6052, 2002) 및 TTGATATCCG(www.genscript.com의 default spacer). siRNA 말단 구조는 평활(blunt) 말단 또는 점착(cohesive) 말단 모두 가능하다. 점착 말단 구조는 3' 말단 돌출한 구조(protruding structure)와 5' 말단 쪽이 돌출한 구조가 모두 가능하고 돌출하는 염기 수는 한정되지 않는다. 예를 들어, 염기 수로는 1 내지 8 염기, 바람직하게는 2 내지 6 염기로 할 수 있다. 또한, siRNA는 발암성 E6/E7 단백질의 발현억제 효과를 유지할 수 있는 범위에서 예를 들어, 한쪽 말단의 돌출 부분에 저분자 RNA(예를 들어, tRNA, rRNA, 바이러스 RNA와 같은 천연의 RNA분자 또는 인공의 RNA분자)를 포함할 수 있다. siRNA 말단구조는 양측 모두 절단 구조를 가질 필요는 없고, 이중사슬 RNA의 일방의 말단 부위가 링커 RNA에 의하여 접속된 스템 루프형 구조일 수도 있다. 링커의 길이는 스템 부분의 쌍을 이루는 데 지장이 없는 길이면 특별히 한정되지 않는다.
또한, 본 발명은 서열번호 1 내지 10으로 구성된 군으로부터 선택되는 어느 하나의 핵산 서열을 갖는 올리고뉴클레오티드에 상응하는 DNA 단편을 발현하는 재조합 발현벡터를 유효성분으로 포함하는, HPV 감염에 의해 유발된 암 치료용 화학 또는 방사선 감작제를 제공한다.
상기 HPV 감염에 의해 유발된 암은, 이에 제한되는 것은 아니나 자궁경부암, 질암, 외음부암, 항문암, 음경암, 편도암, 인두암, 후두암, 머리와 목암 및 폐의 선암으로 이루어진 군으로부터 선택될 수 있으며, 바람직하게는 자궁경부암이다.
상기 올리고뉴클레오티드는 센스 올리고뉴클레오티드 및 이에 상보적인 안티센스 올리고뉴클레오티드가 상보적으로 혼상화된 siRNA(small interfering RNA), 올리고뉴클레오티드 및 안티센스 올리고뉴클레오티드가 루프에 의해 연결된 스템-루프 구조의 단일 RNA 가닥인 shRNA(short hairpin RNA), 및 안티센스 올리고뉴클레오티드(Antisense oligonucleotide, ASO)로 구성된 군으로부터 선택되는 어느 하나인 것이 바람직하나 이에 한정되지 않는다.
상기 발현벡터는 본 발명의 서열번호 1 내지 10으로 기재된 siRNA, shRNA 및 안티센스 올리고뉴클레오티드로 구성된 군으로부터 선택되는 어느 하나를 발현할 수 있는 종래 알려진 어떠한 발현 벡터도 사용할 수 있다. 예컨대, Promega 제품으로 GeneClip™ U1 Hairpin Cloning System(Cat.#'s C8750, C8760, C8770, C8780, C8790), siLentGene™ U6 Cassette RNA Interference System(Cat.# C7800), T7 RiboMAX™ Express RNAi System(Cat.# P1700), siSTRIKE™ U6 Hairpin Cloning Systems(Cat.#'s C7890, C7900, C7910, C7920) 및 siLentGene™ -2 U6 Hairpin Cloning Systems(Cat.#'s C7860, C8060, C8070, C8080) 등을 사용할 수 있으며, Genscript 제품으로 pRNA-U6.1(Cat.#'s SD1201, SD1202, SD1207), pRNATin-H1.2(Cat.#'s SD1223, 1224) 및 pRNA-H1.1/Adeno(Cat.# SD12009) 등을 사용할 수 있다.
또한, 본 발명은 HPV 감염에 의해 유발된 암의 치료를 위한 화학요법 또는 방사선 요법의 수행 시, 상기 감작제를 HPV 감염과 관련된 암세포에 병용투여하는 단계를 포함하는, HPV 감염에 의해 유발된 암의 화합요법 또는 방사선요법에 대한 민감도 증진 방법을 제공한다.
상기 "병용투여"는 화합요법의 경우, 화학요법을 수행하기 수 시간 전에, 바람직하게는 4시간 전에 감작제를 투여하는 단계를 먼저 수행하는 방법이다. 또한, 방사선요법의 경우, 방사선 조사 1일 후에, 2일에 걸쳐 두 차례 감작제를 투여하는 단계를 수행하는 방법이다.
상기 HPV 감염에 의해 유발된 암은, 이에 제한되는 것은 아니나 자궁경부암, 질암, 외음부암, 항문암, 음경암, 편도암, 인두암, 후두암, 머리와 목암 및 폐의 선암으로 이루어진 군으로부터 선택될 수 있으며, 바람직하게는 자궁경부암이다.
상기 HPV 감염에 의해 유발된 암세포는 E6/E7 유전자를 발현하는 분리된 세포이거나 배양된 세포일 수 있고, 분리되지 않은 채로 포유동물 중에 포함될 수 있다. 포유동물의 예로는 비인간 포유동물(예컨대, 개, 고양이, 말, 돼지, 양, 소, 염소, 설치류; 햄스터, 마우스, 래트, 및 영장류) 및 인간을 들 수 있다. 본 발명에서는 E6/E7 유전자를 발현하는 HPV 감염과 관련된 암으로 HeLa와 SiHa를 사용하였다.
상기 감작제에 유효성분으로 포함된 siRNA, shRNA, 안티센스 올리고뉴클레오티드 또는 발현벡터는 보통 약학적 조성물로서 투여된다. 상기 투여는 핵산이 원하는 in vitro 또는 in vivo에서 표적 세포로 도입되는, 통상적으로 사용되는 유전자 도입 기법에 의하여 수행될 수 있다. 이때, siRNA, shRNA 또는 안티센스 올리고뉴클레오티드의 세포 내로 도입은 특별히 이에 제한되지 않으나, 직접 합성한 뒤, 숙주세포 내로 직접 함입되거나, 또는 siRNA, shRNA 또는 안티센스 올리고뉴클레오티드가 세포 안에서 발현되도록 제조된 발현 벡터 또는 PCR-기반 발현카세트 등으로 세포를 형질전환 또는 감염(infection)시켜서 수행하는 것이 바람직하며, 발현벡터는 특별히 이에 제한되지는 않는다.
한편, 통상적으로 사용되는 표적 세포로의 유전자 도입 기법에는 칼슘 포스페이트, DEAE-덱스트란, 전기천공 및 미세주입법 및 바이러스 법이 포함된다(Graham FL 및 van der Eb AJ Virol. 52:456, 1973; McCutchan JH & Pagano JS J. Natl. Cancer Inst. 41:351, 1968; Chu G et al., Nucl. Acids Res. 15:1311, 1987; Fraley R et al., J. Biol. Chem. 255:10431, 1980; Capecchi MR, Cell 22:479, 1980). 뉴클레오티드를 세포 내로 도입하는 이러한 기법들에 최근 추가된 것은 양이온성 리포좀을 사용하는 것이다(Felgner PL et al., Proc. Nati. Acad. Sci. USA 84:7413, 1987). 상업적으로 구입할 수 있는 양이온성 지질 제제는 예를 들면, Tfx 50(Promega) 또는 Lipofectamin 2OOO(Life Technologies)이 있다. 발암성 E6/E7 단백질의 유전자와 상보적으로 잡종 결합할 수 있는 siRNA, shRNA 또는 안티센스 올리고뉴클레오티드를 직접 세포에 함입시키는 방법은 특별히 이에 제한되지는 않으나, siRNA, shRNA 또는 안티센스 올리고뉴클레오티드 1 ㎍ 당 양이온성 리포좀을 2 내지 6 ㎍ 혼합하여, 15 내지 40분간 리포펙션(lipofection)하여 수행함이 바람직하다.
본 발명의 감작제는 약학적으로 허용 가능한 부형제를 추가로 함유한다. 약학적으로 허용되는 부형제는 기술 분야에 알려져 있으며 약학적 활성 물질의 투여를 용이하게 해주는 비교적 불활성인 물질이다. 예컨대, 부형제는 형상이나 점도를 부여할 수 있고 또는 희석제 역할도 할 수 있다. 적절한 부형제로는 안정화제, 보습제, 및 유화제, 오스몰 농도를 변화시킬 수 있는 염류, 캡슐화제제, 완충액, 피부침투 촉진제를 들 수 있으며, 이에 한정되지 않는다. 경구 및 비경구용 약물 전달용 부형제 및 포뮬레이션은 Remington, The Science and Practice of Pharmacy 제20판, Mack Publishing (2000)에 제시되어 있다. 또한, 상기 감작제는 적당한 담체와 함께 혼합되어, 임의의 적당한 방식, 예를 들면, 주사, 경구, 국부(topical), 코, 직장 적용 등과 같은 방식으로 투여될 수 있다. 상기 담체는 임의의 적당한 약제학적 담체일 수 있다. 바람직하게는, 상기 RNA 분자가 표적-세포로 도입되는 효율을 증가시킬 수 있는 담체가 사용된다. 그러한 담체의 적당한 예는 리포좀, 특히 양이온성 리포좀이다. 더욱 바람직한 투여 방법은 주사 (injection)이다.
상기 감작제는 인간 의약 또는 수의 의약으로 치료학적 적용을 위하여 사용될 수 있으며, 상기 감작제는 주입가능한 용액과 같은 액제, 크림, 연고, 정, 현탁액 등과 같은 형태일 수 있다.
siRNA, shRNA 또는 안티센스 올리고뉴클레오티드의 유효농도는 원하는 효과, 예를 들면 siRNA, shRNA 또는 안티센스 올리고뉴클레오티드의 부재 하에서 검출되는 발현 수준에 비해 발암성 단백질인 E7/E7 유전자의 발현의 감소를 제공하기에 충분한 양이다. siRNA, shRNA 또는 안티센스 올리고뉴클레오티드는 세포 하나 당 적어도 하나의 카피의 전달을 허용하는 양으로 도입될 수 있다. 이중 가닥 물질의 도입량이 많을수록(예컨대, 세포 하나 당 5개 이상, 10 개 이상, 100개 이상, 500개 이상 또는 1000개 이상의 카피), 억제 효율이 더 높아질 수 있고, 특이적인 응용에는 도입량이 적은 것이 유리할 수 있다.
또한, 본 발명은 서열번호 1 내지 10으로 구성된 군으로부터 선택되는 어느 하나의 핵산 서열을 갖는 올리고뉴클레오티드를 HPV 감염에 의해 유발된 암 치료용 화학 또는 방사선 감작제의 제조에 이용하는 용도를 제공한다.
아울러, 본 발명은 서열번호 1 내지 10으로 구성된 군으로부터 선택되는 어느 하나의 핵산 서열을 갖는 올리고뉴클레오티드에 상응하는 DNA 단편을 발현하는 재조합 발현벡터를 HPV 감염에 의해 유발된 암 치료용 화학 또는 방사선 감작제의 제조에 이용하는 용도를 제공한다.
상기 HPV 감염에 의해 유발된 암은, 이에 제한되는 것은 아니나 자궁경부암, 질암, 외음부암, 항문암, 음경암, 편도암, 인두암, 후두암, 머리와 목암 및 폐의 선암으로 이루어진 군으로부터 선택될 수 있으며, 바람직하게는 자궁경부암이다.
상기 올리고뉴클레오티드는 센스 올리고뉴클레오티드 및 이에 상보적인 안티센스 올리고뉴클레오티드가 상보적으로 혼상화된 siRNA(small interfering RNA), 올리고뉴클레오티드 및 안티센스 올리고뉴클레오티드가 루프에 의해 연결된 스템-루프 구조의 단일 RNA 가닥인 shRNA(short hairpin RNA), 및 안티센스 올리고뉴클레오티드(Antisense oligonucleotide, ASO)로 구성된 군으로부터 선택되는 어느 하나인 것이 바람직하나 이에 한정되지 않는다.
상기 올리고뉴클레오티드에 상응하는 DNA 단편을 발현하는 재조합 발현벡터는 본 발명의 서열번호 1 내지 10으로 기재된 siRNA, shRNA 및 안티센스 올리고뉴클레오티드로 구성된 군으로부터 선택되는 어느 하나를 발현할 수 있는 종래 알려진 어떠한 발현 벡터도 사용할 수 있다.
본 발명의 올리고뉴클레오티드 또는 이에 상응하는 DNA 단편을 발현하는 재조합 발현벡터는 방사선 또는 항암제에 대한 HPV 감염과 관련된 암세포의 민감도를 증진시켜 세포사멸 효과를 극대화할 수 있으므로, HPV 감염에 의해 유발된 암 치료용 화학 또는 방사선 감작제의 제조에 유용하게 이용할 수 있다.
이하, 본 발명을 실시예에 의해 상세히 설명한다.
단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
<실시예 1> 재료 및 방법
<1-1> HPV18 E6/E7 siRNA의 제작
하기 표 1의 siRNA를 Dharmacon(USA) Custom Service에 주문제작하여 수득하였다.
표 1
| siRNA | 서열번호 | 표적염기서열 | 표적 전사체 |
| 426 | 1 | 5'- CAACCGAGCACGACAGGAA -3' | HPV18 E6/E7 |
| 450 | 2 | 5'- CCAACGACGCAGAGAAACA -3' | HPV18 E6/E7 |
| 103 | 3 | 5'- GCAAGACAGUAUUGGAACU -3' | HPV18 E6/E7 |
| 456 | 4 | 5'- ACGCAGAGAAACACAAGU -3' | HPV18 E6/E7 |
| 458 | 5 | 5'- GCAGAGAAACACAAGUAUA -3' | HPV18 E6/E7 |
| 366 | 6 | 5'- GCAAAGACAUCUGGACAAA-3' | HPV16 E6/E7 |
| 497 | 7 | 5'- GACCGGUCGAUGUAUGUCUUG -3' | HPV16 E6/E7 |
| 573 | 8 | 5'- CACCUACAUUGCAUGAAUAUA -3' | HPV16 E6/E7 |
| 752 | 9 | 5'- CUUCGGUUGUGCGUACAAAGC -3' | HPV16 E6/E7 |
| 448 | 10 | 5'- UCAAGAACACGUAGAGAAA -3' | HPV16 E6/E7 |
| GFP | 11 | 5'- GGCUACGUCCAGGAGCGCACC -3' |
<1-2> 세포배양 및 siRNA 형질도입
자궁경부암세포와 HPV 18번 형태의 바이러스에 감염된 HeLa 자궁경부암 세포주(HeLa; ATCC CCL-2), HPV 16번 형태의 바이러스에 감염된 SiHa(SiHa; ATCC HTB-35) 또는 CaSki(ATCC CRL-1550) 자궁경부암 세포주를 6-웰 플레이트에 5×104 또는 1×105의 세포수로 분주한 후 37℃, 이산화탄소 5% 조건하에서 RPMI1640 또는 DMEM 배지에서 각각 24시간 동안 배양하였다. 24 시간 동안 배양하여 세포 배양용기 표면에 흡착되면, 대조군으로 GFP RNA 및 실험군으로 상기 실시예 <1-1>의 방법으로 제조된 서열번호 1 내지 10의 siRNA 올리고뉴클레오티드 각각 100 nM을 oligofectamine(invitrogen, USA)을 사용하여 형질도입한 뒤, 1 ㎖의 배지에서 4시간 동안 배양하였다. 이후, 30%의 우혈청(Hyclone, USA)이 포함된 RPMI1640 또는 DMEM 배지 500 ㎕를 넣어 준 뒤 3 ~ 4일간 배양하였다.
<1-3> 항암제/방사선 처리
상기 실시예 <1-2>의 방법으로 5×104 또는 1×105 세포로 분주하여 1일간 배양된 HeLa 또는 SiHa 세포주에 siRNA를 형질도입시켰다. 4시간 동안 배양한 후에 30%의 우혈청이 들어간 배지를 넣어 준 뒤에 시스플라틴(CDDP) 또는 nutlin-3을 최종 농도 각각 1.25 및 5 nM로 처리하였다. 대조군으로는 DMSO를 확인하였다.
또한, 세포주들을 T25 플라스크에 1×106 또는 5×105 세포의 농도로 분주한 뒤, 1일간 배양된 HeLa 또는 SiHa 세포주에 60Co source(Gamma cell 220)(AtomicLanergyLof Canada Limited, 캐나다)을 이용하여 60Co를 선원으로 사용하고 총선량이 2 Gy(선량률 1.333 Gy/분)가 되도록 1시간 30분 동안 감마방사선을 조사하였다. 이후, 6 웰-플레이트에 5×104 또는 1×105 세포로 분주하여 하루 동안 배양한 후, 실시예 <1-2>의 방법으로 siRNA를 형질도입하였고, 추가로 하루 더 배양한 후, 다시 실시예 <1-2>의 방법으로 siRNA를 형질도입하였다.
<1-4> 세포노화에 관련한 β 갈락토시다아제(SA-β-gal) 활성 측정
상기 실시예 <1-3>의 방법으로 HeLa 또는 SiHa 세포주에 siRNA의 형질도입과 항암제/방사선을 단독 또는 병용 처리한 후 7일 동안 배양하였다. 세포노화 측정 키트(BioVision, USA)를 이용하여 PBS로 세척하고 SA-β-gal 염색용액에 37℃에서 12시간 처리하였다. 일반광학현미경을 이용하여 100 ~ 200배의 배율로 파란색으로 염색된 세포들을 관찰하였다.
<1-5> 세포형태 변화 측정
상기 실시예 <1-3>의 방법으로 HeLa 또는 SiHa 세포주에 siRNA의 형질도입과 항암제/방사선을 단독 또는 병용 처리한 후 7일 동안 배양하였다. 7일째에 위상차 현미경(AxioVision, Carl Zeiss, German)을 사용하여 세포 형태를 조사하였다.
<실험예 1> siRNA의 세포 증식 억제 효과
상기 실시예 <1-1>의 HPV18 E6/E7을 표적으로 하는 siRNA를 상기 실시예 <1-2>의 방법으로, HPV 18번 형태의 바이러스에 감염된 HeLa 또는 HPV 16번 형태의 바이러스에 감염된 CaSki 자궁경부암 세포주에 형질도입하였고, 추가로 하루 더 배양한 후, 다시 실시예 <1-2>의 방법으로 siRNA를 형질도입하였다. 형질도입한 뒤 3일 동안 배양한 후 세포수를 측정하였다. 이때, 선행 특허 문헌(대한민국 특허 공개번호 10-2008-0040412)에서 공개한 HPV 특이적인 siRNA인 18E6-1(서열번호 12: 5'-UAACCUGUGUAUAUUGCAA-3')(본 명세서에서는 18E6/E7로 기재, HPV 18번 형태의 E6/E7 두 가지 유전자 모두를 표적으로 하는 siRNA) 및 16E6-1(서열번호 13: 5'-ACCGUUGUGUGAUUUGUUA-3')(본 명세서에서는 16E6으로 기재, HPV 16번 형태의 E6 유전자 하나를 표적으로 하는 siRNA)을 대조군으로 사용하였다.
그 결과, 도 1a 및 1b에 나타난 바와 같이 HPV 18 HeLA 세포주에서는 103, 426, 450, 456 또는 458 siRNA에서 뛰어난 세포증식 억제 효과를 나타냈고, 103, 426, 448, 450, 456 또는 458 siRNA는 선행 문헌의 HPV 18번을 표적하는 siRNA인 18E6-1(본 명세서에서 18E6/E7로 기재)보다 현저하게 세포주의 증식을 억제하였다. 또한, HPV 16 CaSki 세포주에서는 366, 448, 497, 573 또는 752 siRNA에서 뛰어난 세포증식 억제 효과를 나타냈고, 모두 선행 문헌의 HPV 16번을 표적하는 siRNA인 16E6-1(본 명세서에서 16E6으로 기재)보다 현저하게 세포주의 증식을 억제하였다.
<실험예 2> 426 siRNA와 화학요법 병용처리의 세포 상해 효과
<2-1> 세포 증식 억제 효과
상기 실시예 1의 방법으로 HeLa 세포주에 대해 준비한 단독처리 군(426 siRNA, 시스플라틴, nutlin만 각각 처리하였음) 및 병용처리 군(426 siRNA와 시스플라틴 또는 nutlin을 병용처리하였음)을 6일간 추가로 배양한 후, 세포수를 측정하였다.
그 결과, 도 2a에 나타난 바와 같이 화학요법과 426 siRNA를 병용처리한 군이 siRNA 단독처리 군 또는 항암제를 단독 또는 병용처리한 군보다 세포 증식이 급격하게 감소하였다. 특히, 426 siRNA와 nutlin-3을 병용처리한 군과 426 siRNA와 CDDP, nutlin-3을 병용처리한 군에서 현저하게 세포의 수가 감소하였다. 이러한 결과는, HeLa 세포에서 화학요법과 426 siRNA의 병용처리가 단독처리 군 보다 세포 상해 효과를 현저하게 증가시키는 것을 나타낸다.
<2-2> 세포 노화 유도 효과
상기 실험예 <1-1>의 방법으로 처리된 세포주를 대상으로 6일째에 상기 실시예 <1-4>의 방법으로 SA β-Gal 활성을 측정하였다.
그 결과, 도 2b 및 도 2c에 나타난 바와 같이 화학요법처리 군에서는 활성을 띈 세포주가 검출되지 않았고, 426 siRNA와 화학요법의 병용처리 군에서는 거의 모든 세포가 진한 파란색으로 염색되어 강한 SA-β Gal의 활성을 보여주었다. 이러한 결과는, 매우 낮은 농도의 시스플라틴, nutlin-3 처리가 세포노화에 대한 426 siRNA의 영향을 상승적으로 증가시킨다는 것을 보여준다.
<실험예 3> 497 siRNA와 화학요법 병용처리의 세포 상해 효과
<3-1> 세포 증식 억제 효과
상기 실시예 1의 방법으로 SiHa 세포주에 대해 준비한 단독처리 군(497 siRNA, 시스플라틴, nutlin만 각각 처리하였음) 및 병용처리 군(497 siRNA와 시스플라틴 또는 nutlin을 병용처리 하였음)을 3일간 추가로 배양한 후, 세포수를 측정하였다.
그 결과, 도 3a에 나타난 바와 같이 화학요법과 497 siRNA를 병용처리한 군이 siRNA 단독처리 군 또는 항암제를 단독 또는 병용처리한 군보다 세포 증식이 급격하게 감소하였다. 특히, 497 siRNA+CDDP 처리군, 497 siRNA+nutlin-3 처리군, 426 siRNA+CDDP+nutlin-3의 병용처리 군에서 현저하게 세포의 수가 감소하였다. 이러한 결과는, SiHa 세포주에서도 화학요법과 497 siRNA의 병용처리가 단독처리 군 보다 세포 상해 효과를 현저하게 증가시키는 것을 나타낸다.
<3-2> 세포 노화 유도 효과
상기 실험예 <3-1>의 방법으로 처리된 세포주를 대상으로 6일째에 상기 실시예 <1-4>의 방법으로 SA β-Gal 활성을 측정하였다.
그 결과, 도 3b 및 도 3c에서 나타난 바와 같이, 비록 시스플라틴, nutlin-3의 병용처리 군에서도 SA-β Gal의 활성이 강하게 나타났지만 497 siRNA와 병용처리 함으로써 유의하게 SA-β Gal의 활성이 증가한 것으로 나타났다.
<실험예 4> siRNA와 방사선요법 병용처리의 세포 상해 효과
<4-1> 세포 증식 억제 효과
상기 실시예 1의 방법으로 HeLa 세포주에 대해 준비한 단독처리 군(426 siRNA, 450 siRNA, 방사선 조사만 각각 처리하였음) 및 병용처리 군(426 siRNA 또는 450 siRNA와 방사선 조사를 병용처리 하였음); 또는 SiHa 세포주에 대해 준비한 단독처리 군(497 siRNA, 방사선 조사만 각각 처리하였음) 및 병용처리 군(497 siRNA와 방사선 조사를 병용처리 하였음)을 4일간 추가로 배양한 후, 세포수를 측정하였다.
그 결과, 도 4a에 나타난 바와 같이 방사선 요법과 426 siRNA 또는 450 siRNA를 병용처리한 군이 siRNA 단독처리 군 또는 방사선 요법을 단독 또는 병용처리한 군보다 세포 증식이 급격하게 감소하였다. 특히, 450 siRNA 보다 426 siRNA가 더 좋은 병용처리 효과를 보여주었다. 이러한 결과는, HeLa 세포에서 방사선 요법과 426 siRNA 또는 450 siRNA의 병용처리가 단독처리 군 보다 세포 상해 효과를 현저하게 증가시키는 것을 나타낸다.
또한, 도 5에 나타난 바와 같이 HPV 16 타입인 SiHa 세포주에서도 497 siRNA와 방사선 병용처리의 결과가 HPV 18 타입인 HeLa 세포주의 결과와 동일하게 나타남을 알 수 있었다.
<4-2> 세포 노화 유도 효과
상기 실험예 <4-1>의 방법으로 처리된 세포주를 대상으로 4일째에 상기 실시예 1-4의 방법으로 SA β-Gal 활성을 측정하였고, 상기 실시예 <1-5>의 방법으로 형태학적 변화를 관찰하였다.
그 결과, 도 4b 및 도 4c에 나타난 바와 같이 단독처리 군에서는 활성을 띈 세포주가 검출되지 않았고 426 siRNA와 방사선 요법의 병용처리 군에서는 거의 모든 세포가 진한 파란색으로 염색되어 강한 SA-β Gal의 활성을 보여주었다. 또한, 도 4d에 나타난 바와 같이 세포형태학적으로도 siRNA와 방사선 요법의 병용처리 군에서 세포의 형태가 두드러지게 변하였다. 이러한 결과는, 매우 낮은 농도의 방사선 조사가 세포노화에 대한 426 siRNA의 영향을 상승적으로 증가시킨다는 것을 보여준다.
<실험예 5> Chou-Talalay 분석에 의한 병용처리의 상승적(synergistic) 세포 상해 효과 분석
<5-1> 세포 처리
상기 실시예 1의 방법에 따라 HeLa, SiHa 또는 Caski 세포주에 대해 하기의 설계로 실험군을 준비하였다. 이때, HeLa 세포주에는 426 siRNA를, SiHa 세포주에는 497 siRNA를, CaSki 세포주에는 336 siRNA를 각각 처리하였다:
1) siRNA 단독처리 군: 0, 5, 25, 50, 100 또는 200 nM;
2) CDDP(시스플라틴) 단독처리 군: 0, 0.625, 1.25, 2.5, 5 또는 10 μM; 및,
3) siRNA+CDDP(시스플라틴) 병용처리 군: siRNA(0, 5, 25, 50, 100 또는 200 nM) + CDDP 5 μM.
4)방사선 단독처리 군: 0, 1, 2, 4 또는 6 Gy
5)siRNA+방사선 병용처리 군: siRNA(0, 25 또는 50 nM)+ 방사선 (2 또는 4 Gy)
<5-2> 항암제와의 병용요법에서 Chou-Talalay 분석
병용처리의 보다 정확한 상승적 치료효과를 확인하기 위하여 Chou-Talalay 분석을 수행하였다. 이 분석법은 두 가지 이상의 병용처리법에서 상승적 치료 효과를 증명하기 위하여 가장 일반적 사용되는 분석법이다.
<수학식 1>
fa/fu = (D/Dm)m
D: 용량(the dose);
Dm: 50% 효과를 위한 용량(the dose required for 50% effect);
fa: the fraction affected by dose D; 및
fu: the unaffected fraction(따라서 fa = 1 fu).
이때, 상기 <수학식 1>을 하기 <수학식 2>와 같이 전환하였다.
<수학식 2>
D = Dm [fa/(1 - fa)] 1/m
상기 <수학식 2>를 이용하여 하기 <수학식 3>을 작성하였다.
<수학식 3>
log(D) = 1/m × log[fa/(1 - fa)] + log Dm
따라서, Median Effect plot에서 x = log(D), y = log(fa/fu), m은 기울기, log(Dm)은 X축-intercept로 계산할 수 있다. 이러한 값은 하기의 <수학식 4>에 따라 치료효과를 나타내는 각각 약물의 농도와 병용처리 시 약물조합의 농도를 계산하는데 사용되었다.
<수학식 4>
Combination Index(CI) = (D combi)1/(D alone)1 + (D combi)2/(D alone)2
(D combi)1 및 (D combi)2 : 약물을 병용처리 시 사용한 치료효과(fa)를 나타내는 농도; 및
(D alone)1 및 (D alone)2 : 약제 1 또는 2의 단독 처리 시 치료 효과(fa)를 얻기 위한 약물의 농도, D alone = Dm [fa/(1 - fa)] 1/m.
Chou-Talalay 분석에서 최종적으로 CI(Combination Index)값이 CI<1이면 상승적(synergistic) 치료 효과 나타내고, CI=1이면 병합치료(additive) 효과를 나타내며, CI>1 은 병합치료 효과보다 적을 경우(sub-additive)라고 분석하였다.
상기 실험예 <5-1>의 방법으로 HeLa, SiHa 또는 CaSki 세포주에 대해 준비한 단독처리 군(siRNA, 시스플라틴만 각각 처리하였음) 및 병용처리 군(siRNA와 시스플라틴을 병용처리하였음)을 2일간 추가로 배양한 후, 세포수를 측정하였다.
그 결과, 도 6a에 나타난 바와 같이 HPV-18 HeLa 세포주에서 426 siRNA의 낮은 농도 5, 25 또는 50 nM과 5 μM CDDP의 병용처리 군에서 각각 CI 값이 0.36, 0.47 및 0.56 으로 1보다 낮게 나옴으로 상승적 치료 효과를 나타내는 것으로 분석되었다.
또한, 도 6b에 나타난 바와 같이 HPV-16 SiHa 세포주에서도 497 siRNA의 낮은 농도 5, 25 또는 50 nM과 5 μM CDDP의 병용처리 군에서 각각 CI 값이 0.60, 0.71 및 0.69 로 1보다 낮게 나옴으로 상승적 치료 효과를 나타내는 것으로 분석되었다.
아울러, HPV-16 CaSki 세포주에서도 도 6c에 나타난 바와 같이 336 siRNA 5 nM + CDDP 2.5 μM, 336 siRNA 25nM + CDDP 1.25 μM, 336 siRNA 50 nM + CDDP 5 μM 또는 336 siRNA 100 nM + CDDP 5μM 병용처리 군에서 각각 CI 값이 0.9, 0.9, 0.86 및 0,73 로 1보다 낮게 나옴으로 상승적 치료 효과를 나타내는 것으로 분석되었다.
<5-3> 방사선 치료와의 병용요법에서 Chou-Talalay 분석
상기 실험예 <5-1>의 방법으로 SiHa 세포주에 대해 준비한 단독처리 군(459 siRNA, 방사선 조사만 각각 처리하였음) 및 병용처리 군(siRNA와 방사선 요법을 병용처리하였음)을 3일간 추가로 배양한 후, 세포수를 측정하였다.
그 결과, 도 6d에 나타난 바와 같이 HPV-16 SiHa 세포주에서 459 siRNA의 낮은 농도 25, 50 nM과 2 Gy 방사선 조사의 병용처리 군에서 각각 CI 값이 063 및 0.71이었고 또한, 459 siRNA의 낮은 농도 50 nM과 4 Gy 방사선 조사의 병용처리 군에서 CI 값이 0.8로 1보다 낮게 나옴으로 상승적 치료 효과를 나타내는 것으로 분석되었다.
상기와 같이, 본 발명의 siRNA를 항암치료시 병용처리함으로써, 단독으로 HPV 특이적인 siRNA 또는 화학요법 또는 방사선 요법을 수행하는 것보다 뛰어난 자궁경부암 치료 효과를 가지며, 방사선 또는 항암제에 대한 자궁경부암세포의 민감도를 증진시켜 세포사멸 효과를 극대화하므로, HPV 감염에 의해 유발된 암의 항암 치료시 화학 또는 방사선 감작제의 개발 및 생산에 유용하게 이용될 수 있다.
Claims (12)
- 서열번호 1 내지 10으로 구성된 군으로부터 선택되는 어느 하나의 핵산 서열을 갖는 올리고뉴클레오티드를 유효성분으로 포함하는, HPV(human papilloma virus) 감염에 의해 유발된 암 치료용 화학 또는 방사선 감작제.
- 제 1항에 있어서, 상기 올리고뉴클레오티드는 센스 올리고뉴클레오티드 및 이에 상보적인 안티센스 올리고뉴클레오티드가 상보적으로 혼상화된 siRNA(small interfering RNA), 올리고뉴클레오티드 및 안티센스 올리고뉴클레오티드가 루프에 의해 연결된 스템-루프 구조의 단일 RNA 가닥인 shRNA(short hairpin RNA), 및 안티센스 올리고뉴클레오티드(Antisense oligonucleotide, ASO)로 구성된 군으로부터 선택되는 어느 하나인 것을 특징으로 하는 감작제.
- 제 1항에 있어서, 상기 HPV 감염에 의해 유발된 암은 자궁경부암, 질암(vagina cancer), 외음부암(vulva cancer), 항문암(anal cancer), 음경암(penis cancer), 편도암(tonsil cancer), 인두암(pharynx cancer), 후두암(larynx cancer), 머리와 목암(head & neck) 및 폐의 선암(lung adenocarcinoma)으로 이루어진 군으로부터 선택되는 것을 특징으로 하는 감작제.
- 서열번호 1 내지 10으로 구성된 군으로부터 선택되는 어느 하나의 핵산 서열을 갖는 올리고뉴클레오티드에 상응하는 DNA 단편을 발현하는 재조합 발현벡터를 유효성분으로 포함하는, HPV 감염에 의해 유발된 암 치료용 화학 또는 방사선 감작제.
- 제 4항에 있어서, 상기 올리고뉴클레오티드는 센스 올리고뉴클레오티드 및 이에 상보적인 안티센스 올리고뉴클레오티드가 상보적으로 혼상화된 siRNA, 올리고뉴클레오티드 및 안티센스 올리고뉴클레오티드가 루프에 의해 연결된 스템-루프 구조의 단일 RNA 가닥인 shRNA, 및 안티센스 올리고뉴클레오티드로 구성된 군으로부터 선택되는 어느 하나인 것을 특징으로 하는 감작제.
- 제 4항에 있어서, 상기 HPV 감염에 의해 유발된 암은 자궁경부암, 질암, 외음부암, 항문암, 음경암, 편도암, 인두암, 후두암, 머리와 목암 및 폐의 선암으로 이루어진 군으로부터 선택되는 것을 특징으로 하는 감작제.
- HPV 감염에 의해 유발된 암의 치료를 위한 화학요법 또는 방사선 요법의 수행 시, 제 1항 또는 제 4항의 감작제를 HPV 감염에 의해 유발된 암세포에 병용투여하는 단계를 포함하는, HPV 감염에 의해 유발된 암의 화합요법 또는 방사선치료에 대한 민감도 증진 방법.
- 제 7항에 있어서, 상기 HPV 감염에 의해 유발된 암은 자궁경부암, 질암, 외음부암, 항문암, 음경암, 편도암, 인두암, 후두암, 머리와 목암 및 폐의 선암으로 이루어진 군으로부터 선택되는 것을 특징으로 하는 민감도 증진 방법.
- 제 7항에 있어서, 상기 병용투여는 화합요법의 경우, 화학요법을 수행하기 전에 감작제를 투여하는 단계를 수행하는 방법인 것을 특징으로 하는 민감도 증진 방법.
- 제 7항에 있어서, 상기 병용투여는 방사선요법의 경우, 방사선 조사 1일 후에, 2일에 걸쳐 두 차례 감작제를 투여하는 단계를 수행하는 방법인 것을 특징으로 하는 민감도 증진 방법.
- 서열번호 1 내지 10으로 구성된 군으로부터 선택되는 어느 하나의 핵산 서열을 갖는 올리고뉴클레오티드를 HPV 감염에 의해 유발된 암 치료용 화학 또는 방사선 감작제의 제조에 이용하는 용도.
- 서열번호 1 내지 10으로 구성된 군으로부터 선택되는 어느 하나의 핵산 서열을 갖는 올리고뉴클레오티드에 상응하는 DNA 단편을 발현하는 재조합 발현벡터를 HPV 감염에 의해 유발된 암 치료용 화학 또는 방사선 감작제의 제조에 이용하는 용도.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020100004311A KR101197627B1 (ko) | 2010-01-18 | 2010-01-18 | Hpv 감염과 관련된 암의 치료용 조성물 |
| KR10-2010-0004311 | 2010-01-18 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2011087343A2 true WO2011087343A2 (ko) | 2011-07-21 |
| WO2011087343A3 WO2011087343A3 (ko) | 2011-12-01 |
Family
ID=44304852
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2011/000365 Ceased WO2011087343A2 (ko) | 2010-01-18 | 2011-01-18 | Hpv 감염과 관련된 암의 치료용 조성물 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR101197627B1 (ko) |
| WO (1) | WO2011087343A2 (ko) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104324363A (zh) * | 2014-09-30 | 2015-02-04 | 苑振贵 | 一种治疗宫颈糜烂和宫颈癌的药物 |
| CN104884096A (zh) * | 2012-08-02 | 2015-09-02 | Abion株式会社 | 人乳头瘤病毒感染相关癌症的治疗用组合物 |
| EP3295960A4 (en) * | 2015-05-12 | 2019-01-23 | EnhancedBio Inc. | COMPOSITION FOR SUBSTANCE CANCER SENSITIZATION TO INHIBIT THE EXPRESSION OF THE ONKOGEN OF THE HPV VIRUS AS AN ACTIVE SUBSTANCE |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6084090A (en) | 1997-09-05 | 2000-07-04 | The United States Of America As Represented By The Department Of Health And Human Services | Human papilloma virus anti-sense oligonucleotides |
| KR100441202B1 (ko) * | 2001-12-11 | 2004-07-23 | 대한민국 | Hpv e6 유전자를 발현하는 마우스 수정란 |
| US7223408B2 (en) | 2002-10-03 | 2007-05-29 | Wyeth Holdings Corporation | Human papillomavirus polypeptides and immunogenic compositions |
| JP2009525048A (ja) * | 2006-02-01 | 2009-07-09 | ザ ジョンズ ホプキンス ユニバーシティー | 腫瘍性障害または感染症に対する免疫学的予防法または免疫療法のためのポリペプチド−核酸複合体 |
| KR100962301B1 (ko) * | 2006-11-03 | 2010-06-11 | 재단법인서울대학교산학협력재단 | 자궁경부암을 위한 치료용 조성물 |
-
2010
- 2010-01-18 KR KR1020100004311A patent/KR101197627B1/ko not_active Expired - Fee Related
-
2011
- 2011-01-18 WO PCT/KR2011/000365 patent/WO2011087343A2/ko not_active Ceased
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10221418B2 (en) | 2012-08-02 | 2019-03-05 | EnhancedBio Inc. | Composition for treating cancer associated with HPV infection |
| CN104884096A (zh) * | 2012-08-02 | 2015-09-02 | Abion株式会社 | 人乳头瘤病毒感染相关癌症的治疗用组合物 |
| JP2016190845A (ja) * | 2012-08-02 | 2016-11-10 | アビオン インコーポレーテッド | Hpv感染に係わる癌の治療用組成物 |
| EP3178498A3 (en) * | 2012-08-02 | 2017-09-27 | Abion Inc. | Composition for treating cancer associated with hpv infection |
| JP2018109058A (ja) * | 2012-08-02 | 2018-07-12 | エンハンストバイオ インコーポレイテッド | Hpv感染に係わる癌の治療用組成物 |
| JP2019194234A (ja) * | 2012-08-02 | 2019-11-07 | エンハンストバイオ インコーポレイテッド | Hpv感染に係わる癌の治療用組成物 |
| EP3699278A1 (en) * | 2012-08-02 | 2020-08-26 | EnhancedBio Inc. | Composition for treating cancer associated with hpv infection |
| EP3699279A1 (en) * | 2012-08-02 | 2020-08-26 | EnhancedBio Inc. | Composition for treating cancer associated with hpv infection |
| EP3722425A1 (en) * | 2012-08-02 | 2020-10-14 | EnhancedBio Inc. | Composition for treating cancer associated with hpv infection |
| EP3757213A1 (en) * | 2012-08-02 | 2020-12-30 | EnhancedBio Inc. | Composition for treating cancer associated with hpv infection |
| CN104884096B (zh) * | 2012-08-02 | 2022-05-24 | 银汉斯德生物技术公司 | 人乳头瘤病毒感染相关癌症的治疗用组合物 |
| CN104324363A (zh) * | 2014-09-30 | 2015-02-04 | 苑振贵 | 一种治疗宫颈糜烂和宫颈癌的药物 |
| EP3295960A4 (en) * | 2015-05-12 | 2019-01-23 | EnhancedBio Inc. | COMPOSITION FOR SUBSTANCE CANCER SENSITIZATION TO INHIBIT THE EXPRESSION OF THE ONKOGEN OF THE HPV VIRUS AS AN ACTIVE SUBSTANCE |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101197627B1 (ko) | 2012-11-07 |
| KR20110084650A (ko) | 2011-07-26 |
| WO2011087343A3 (ko) | 2011-12-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2010041913A2 (ko) | Grs 단백질 또는 이의 단편의 신규한 용도 | |
| Zhai et al. | MicroRNA‐98 attenuates cardiac ischemia‐reperfusion injury through inhibiting DAPK1 expression | |
| WO2019050071A1 (ko) | 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물 | |
| WO2020080861A1 (ko) | Syt11 억제제를 유효성분으로 포함하는 위암 치료용 조성물 | |
| US10337012B2 (en) | Method and composition for the treatment, prevention, and diagnosis of cancer containing or derived from cancer stem cells | |
| WO2017119744A1 (ko) | 켈로이드 또는 비후성 반흔 예방 또는 치료용 조성물 | |
| CN105903036A (zh) | miR-130a反义核酸及其衍生物在Hippo-YAP信号通路抑制剂中的应用 | |
| WO2018155890A1 (ko) | 남성형 탈모 표적 유전자의 발현을 억제하는 비대칭 siRNA | |
| WO2018117345A1 (ko) | 글루타치온, 티오레독신 및 엔알에프2 항산화계 병합억제를 통한 선택적 암세포사멸 유도 | |
| KR101197627B1 (ko) | Hpv 감염과 관련된 암의 치료용 조성물 | |
| RU2664466C1 (ru) | Композиция для лечения рака, ассоциированного с инфекцией hpv | |
| WO2010021516A9 (ko) | 뇌 손상 치료를 위한 리포칼린 2의 신규한 용도 | |
| WO2013165061A1 (ko) | Scf 또는 이의 수용체를 억제하는 물질을 포함하는 혈관 투과성 관련 질환의 치료 또는 예방용 조성물 | |
| WO2020235936A1 (ko) | Pd-1의 발현을 억제하는 비대칭 sirna | |
| WO2010076935A1 (en) | Pharmaceutical composition comprising sirna specific for reduced expression-1 for treating the bcnu-resistance glioblastoma multiforme | |
| WO2021137506A1 (ko) | Wdr34 억제제를 포함하는 암줄기세포 성장 억제용 조성물 및 그 용도 | |
| WO2016140552A1 (ko) | 항암제 내성 유방암의 항암제 민감성 진단용 바이오마커 조성물 | |
| WO2023163497A1 (ko) | Ednra 억제제를 유효성분으로 포함하는 대장암의 예방 또는 치료용 약학적 조성물 | |
| WO2023068820A1 (ko) | 암 치료 또는 예방용 조성물 | |
| WO2023172032A1 (ko) | Nmur2 억제제를 유효성분으로 포함하는 암의 예방 또는 치료용 조성물 | |
| WO2017061828A1 (ko) | Plrg1 (pleiotropic regulator 1) 억제제를 유효성분으로 포함하는 암의 예방 또는 치료용 약학 조성물 | |
| CN116270697A (zh) | 一种具有协同增效的化疗表观药物组合物 | |
| WO2021075853A1 (ko) | Emp3 억제제를 포함하는 암 줄기세포 성장 억제용 조성물 및 그 용도 | |
| WO2010095879A2 (ko) | 세포사멸 관련 유전자의 전사체에 결합하는 siRNA 및 이를 이용한 암 치료용 조성물 | |
| WO2020122534A1 (ko) | Snai1의 발현을 억제하는 비대칭 sirna |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 11733130 Country of ref document: EP Kind code of ref document: A2 |