WO2011066783A1 - Anticorps monoclonaux de la protéine anti-cyr61 et utilisations de ceux-ci - Google Patents

Anticorps monoclonaux de la protéine anti-cyr61 et utilisations de ceux-ci Download PDF

Info

Publication number
WO2011066783A1
WO2011066783A1 PCT/CN2010/079208 CN2010079208W WO2011066783A1 WO 2011066783 A1 WO2011066783 A1 WO 2011066783A1 CN 2010079208 W CN2010079208 W CN 2010079208W WO 2011066783 A1 WO2011066783 A1 WO 2011066783A1
Authority
WO
WIPO (PCT)
Prior art keywords
monoclonal antibody
cyr61
protein
cell line
human cyr61
Prior art date
Application number
PCT/CN2010/079208
Other languages
English (en)
Chinese (zh)
Inventor
李宁丽
沈佰华
王利
Original Assignee
上海市免疫学研究所
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from CN200910199937A external-priority patent/CN101709088A/zh
Priority claimed from CN200910199938A external-priority patent/CN101709089A/zh
Application filed by 上海市免疫学研究所 filed Critical 上海市免疫学研究所
Priority to EP10834216.3A priority Critical patent/EP2540742A4/fr
Publication of WO2011066783A1 publication Critical patent/WO2011066783A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/74—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A61P19/04—Drugs for skeletal disorders for non-specific disorders of the connective tissue
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/475—Assays involving growth factors

Definitions

  • the invention belongs to the field of immunotechnology, and particularly relates to a monoclonal antibody against Cyr61 protein and application thereof.
  • the antibody binds to Cyr61 protein and inhibits proliferation, adhesion and prolongation of synovial cells and malignant cells, and can also be used for in vitro detection of Cyr61 protein.
  • the human Cyr61 protein (hCyr61) consists of 381 amino acid residues and is rich in cysteine and proline residues with a relative molecular mass of 42 kDa. It is known that Cyr61 is widely expressed in various normal tissue cells, including fibroblasts, epithelial cells, endothelial cells, bladder and vascular smooth muscle cells, mesenchymal cells, chondrocytes, osteoblasts, nerve cells and the like. In addition, Cyr61 is also highly expressed in certain tumor cells. Currently known breast cancer cells, liver cancer cells, prostate cancer cells, gastric cancer cells, melanoma cells, etc., are important cell matrix regulators, and are widely involved in regulating cell proliferation. Multiple functions such as adhesion, migration, differentiation, and apoptosis.
  • Cyr61 protein is rich in cysteine, it is easy to form disulfide when expressed, resulting in various conformations, and
  • Cyr61 as an important matrix protein, is highly conserved and has high homology between mammals, especially in mice.
  • Cyr61 The homology of Cyr61 is as high as 93%. Therefore, the technical difficulty in preparing monoclonal antibodies is high. For various reasons, to date, there are only commercial polyclonal antibodies against Cyr61 (Santa Crus, USA), and no monoclonal antibodies. The applicant has prepared two anti-human Cyr61 monoclonal antibodies, which are hybridoma CGMCC N0.2766 and B CGMCC N0.2767 (Chinese Invention Patent Application No. 200810207273.8).
  • Cyr61 In order to further study the function of Cyr61 and its subsequent clinical applications, including the detection of human Cyr61 and the prevention and treatment of cell proliferation, adhesion, migration or invasive growth-related diseases, there is a need in the art for a new single fragment that binds to different regions of the Cyr61 protein. Cloning antibodies.
  • the inventors of the present invention have provided extensive and intensive research to provide novel monoclonal antibodies against human Cyr61 protein and have studied the functions of these monoclonal antibodies to inhibit cell proliferation, adhesion, migration or invasive growth by a large number of experiments. Further, the use of the monoclonal antibody of the present invention for preventing or treating diseases associated with cell proliferation, adhesion, migration or invasive growth has been confirmed by animal experiments, thereby completing the present invention.
  • one of the technical problems to be solved by the present invention is to provide a novel monoclonal antibody against human Cyr61 protein.
  • a second technical problem to be solved by the present invention is to provide the use of the monoclonal antibody against human Cyr61 protein of the present invention for the preparation of a medicament for treating or preventing a disease associated with cell proliferation, adhesion, migration or invasive growth.
  • the third technical problem to be solved by the present invention is to provide a hybridoma cell strain which secretes a monoclonal antibody against human Cyr61 protein.
  • the technical problem to be solved by the present invention is to provide a preparation method of the monoclonal antibody against human Cyr61 protein of the present invention.
  • the invention provides:
  • a monoclonal antibody against human Cyr61 protein that recognizes an epitope located in Seq ID No. 16-103 is an IgG1 class antibody. More preferably, the monoclonal antibody against human Cyr61 protein is of the IgGl ⁇ type.
  • the monoclonal antibody anti-human Cyr61 protein which recognizes epitopes located 26-103 of Seq ID No.l, its K D value and the human Cyr61 bound to no more than about 5 X 10- 7 M. More preferably, its K D value and the human Cyr61 bound to no more than about 1 X 10- 8 M.
  • the present invention also provides a monoclonal antibody against human Cyr61 protein which recognizes an epitope located in Seq ID No. 132-103, which is prepared from a hybridoma cell line of the accession number CGMCC3298. It is known to those skilled in the art that an antibody which competitively binds to a monoclonal antibody prepared by a hybridoma cell line of the accession number CGMCC3298 has the same function as the monoclonal antibody against human Cyr61 protein, and the anti-human Cyr61 protein monoclonal antibody is also within the scope of the present invention. Inside.
  • the present invention also provides an anti-human Cyr61 protein monoclonal antibody which recognizes an epitope located in Seq ID No. 132-103, which is prepared from a hybridoma cell line of the accession number CGMCC3351. It is known to those skilled in the art that an antibody which competitively binds to a monoclonal antibody prepared by a hybridoma cell line of the accession number CGMCC3351 has the same function as the monoclonal antibody against human Cyr61 protein, and is also within the scope of the present invention. Inside.
  • the invention provides a monoclonal antibody against human Cyr61 protein that recognizes an epitope located in Seq ID No. 103-267.
  • it is an IgGl class antibody. More preferably, it is of the IgGl ⁇ type.
  • monoclonal anti-human Cyr61 antibody which recognizes an epitope located in the 103- 267 Seq ID No.l, its K D value and the human Cyr61 bound to no more than about 1 X 10- 7 M. More preferably, its K D value and the human Cyr61 bound to no more than about 1 X 10- 8 M.
  • the present invention provides a monoclonal antibody against human Cyr61 protein which recognizes an epitope located in Seq ID No. 103-267, which is prepared from a hybridoma cell line of accession number CGMCC3299. It is known to those skilled in the art that an antibody which competitively binds to a monoclonal antibody prepared by a hybridoma cell line of the accession number CGMCC3299 has the same function as the monoclonal antibody against human Cyr61 protein, and is also within the scope of the present invention. Inside.
  • the present invention provides an anti-human Cyr61 protein monoclonal antibody which recognizes an epitope located in Seq ID No. 103-267, which is characterized in that it is prepared from a hybridoma cell line of the accession number CGMCC3300. It is known to those skilled in the art that an antibody which competitively binds to a monoclonal antibody prepared by a hybridoma cell line of the accession number CGMCC3300 has the same function as the monoclonal antibody against human Cyr61 protein, and the anti-human Cyr61 protein monoclonal antibody is also within the scope of the present invention. Inside.
  • the present invention also provides the use of the anti-human Cyr61 protein monoclonal antibody of the present invention for the preparation of a medicament for preventing or treating a disease associated with cell proliferation, adhesion, migration or invasive growth.
  • the disease is selected from the group consisting of rheumatoid arthritis Or cancer.
  • the cancer is selected from the group consisting of breast cancer, liver cancer, prostate cancer, gastric cancer, melanoma cells and the like. More preferably, the cancer is selected from the group consisting of breast cancer.
  • the anti-human Cyr61 protein monoclonal antibody is selected from the group consisting of an antibody prepared by the CGMCC3298 hybridoma cell line, a monoclonal antibody against the Cyr61 protein which is competitively bound thereto, and a hybrid of the accession number CGMCC3351.
  • the antibody is selected from the group consisting of an antibody prepared by the CGMCC3351 hybridoma cell line and a monoclonal antibody against Cyr61 protein which competes therewith.
  • the antibody is selected from the group consisting of an antibody prepared by the CGMCC3351 hybridoma cell line.
  • the anti-human Cyr61 protein monoclonal antibody is selected from the group consisting of an antibody prepared by the CGMCC3298 hybridoma cell line and a monoclonal antibody against the Cyr61 protein which is competitively bound thereto. More preferably, the antibody is selected from the group consisting of an antibody prepared by the CGMCC3298 hybridoma cell line.
  • the use of the anti-human Cyr61 protein monoclonal antibody of the present invention for the preparation of a reagent for detecting a Cyr61 protein is provided.
  • the invention also provides:
  • Hybridoma cell line CGMCC3298 Hybridoma cell line
  • Hybridoma cell line CGMCC3351 Hybridoma cell line
  • Hybridoma cell line CGMCC3300 Hybridoma cell line CGMCC3300.
  • the method for preparing a monoclonal antibody against human Cyr61 protein comprises: (1) amplifying a corresponding hybridoma cell strain, and
  • Natural human antibodies and “native human immunoglobulins” are heterotetrameric glycoproteins of approximately 150,000 daltons composed of two identical light chains (L) and two identical heavy chains (H) due to It is a macromolecule, so it is often expressed in kDa (kilotonton).
  • Each light chain is linked to a heavy chain by a covalent disulfide bond, and the number of disulfide bonds between different immunoglobulin isotype heavy chains is different.
  • Each heavy and light chain also has regularly spaced intrachain disulfide bonds.
  • One end of each heavy chain has a variable region (VH) followed by a plurality of constant regions (CH).
  • Each light chain has a variable region (VL) at one end and a constant region (CL) at the other end; the constant region of the light chain is opposite the first constant region of the heavy chain.
  • the light chain of a human antibody can be classified into two distinct types of kappa ( ⁇ ) and lambda ( ) according to the amino acid sequence of its constant region. According to the amino acid sequence of the heavy chain constant region, immunoglobulins can be classified into different types. There are five main classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, some of which can be further divided into no The same subclasses, such as IgG1, IgG2, IgG3, and IgG4, as well as IgAl and IgA2.
  • the heavy chain invariant regions corresponding to different classes of immunoglobulins become 0, ⁇ , ⁇ , ⁇ .
  • the subunit structures and three-dimensional configurations of different immunoglobulins are well known.
  • the antibody of the present invention is of the IgG1 ⁇ type, that is, the light chain of the antibody of the present invention is a ⁇ type.
  • Hybridoma technology is well known to those skilled in the art for preparing monoclonal antibodies, and sensitized B cells having the ability to secrete antibodies and myeloma cells having unlimited proliferative ability are fused into B cell hybridomas, so that the fused cells have two parental cells.
  • the characteristic is that it becomes a hybridoma cell capable of secreting antibodies and capable of long-term propagation in vitro.
  • Hybridoma cells are cloned and become single cell clones, and the secreted antibodies are monoclonal antibodies.
  • the technique generally involves three steps: (i) cell fusion and screening; (ii) medium culture and screening, and (iii) cell cloning and culture.
  • the present invention uses a commonly used hybridoma technique to prepare a monoclonal antibody against Cyr61 protein, including immunizing a mammal by intradermal injection of a protein antigen (eg, human Cyr61 protein) according to conventional immunization methods (eg, abdominal, subcutaneous, and intravenous).
  • a protein antigen eg, human Cyr61 protein
  • conventional immunization methods eg, abdominal, subcutaneous, and intravenous.
  • the spleen cells of the immunized animals are fused with myeloid cells derived from the same germline.
  • purified recombinant human Cyr61 fusion protein is used to immunize BABL/c mice (conventional method).
  • the human Cyr61 protein as an immunizing antigen can be prepared by genetic recombination according to the full-length cDNA sequence of human Cyr61 published by GeneBank, and may be an intact human Cyr61 protein (Seq ID No. 3 26-381) or an expression vector comprising His peptide. Fusion protein (Seq ID No. 4).
  • mouse spleen lymphocytes were fused with mouse myeloma cells SP20/Ag-14 (trade name HB-12546TM) under the action of polyethylene glycol (PEG), and the SEC was used to screen for stable secretion resistance.
  • Cyr61 protein monoclonal hybridoma cell line ELISA method to identify subclasses and subtypes of monoclonal antibodies, and compare the titer of positive clone culture supernatant antibody.
  • Purified human Cyr61 N-terminal protein fragment (Seq ID No. 3 26-267, Seq ID No. 5)-His fusion protein or human Cyr61 C-terminal protein fragment (Seq ID No.
  • the present invention provides hybridoma cell lines CGMCC3298, CGMCC335 K CGMCC3299 and CGMCC3300.
  • a method for preparing a corresponding monoclonal antibody against Cyr61 protein comprises (1) amplifying a corresponding hybridoma cell line, and (2) recovering an antibody from the amplification product. For example, when the anti-Cyr61 protein monoclonal antibody 3351 is prepared, the hybridoma cell line CGMCC3351 is first amplified, and then the monoclonal antibody is recovered from the amplification product.
  • Methods for amplifying cell lines are well known in the art, such as in vitro culture of animal cells, such as roller bottles, square bottles or animal cell fermentors, or expansion of hybridoma cells; or in vivo preparation of ascites, such as amplification
  • animal cells such as roller bottles, square bottles or animal cell fermentors
  • ascites such as amplification
  • the above hybridoma cell line was then intraperitoneally injected into BABL/C mice, and ascites was collected 7-10 days later.
  • Methods for recovering anti-HBeAg monoclonal antibodies from culture or ascites are also commonly used in the art, such as ammonium sulfate precipitation, anion exchange chromatography or staphylococcal A protein affinity chromatography.
  • monoclonal antibodies and monoclonal antibodies are synonymous and can be used interchangeably.
  • the monoclonal antibody against Cyr61 protein of the present invention has an effect of inhibiting proliferation, adhesion, migration or invasive growth of tumor cells or rheumatoid arthritis synovial cells. It can be used to treat or prevent diseases associated with cell proliferation, adhesion, migration or invasive growth associated with Cyr61.
  • the antibodies of the invention may be added to a pharmaceutical composition suitable for administration to a subject.
  • the pharmaceutical composition comprises an antibody of the invention and a pharmaceutically acceptable carrier.
  • the "pharmaceutically acceptable carrier” includes any and all physiologically acceptable solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents and the like.
  • examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffer, dextrose, glycerol, ethanol, and the like, or combinations thereof. In many cases, it will be preferred to include isotonic agents, for example, sugars, polyols such as mannitol, sorbitol, or sodium chloride in the compositions.
  • the pharmaceutically acceptable carrier may also contain minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers which enhance the expiration or potency of the antibodies of the invention.
  • compositions of the present invention can take a wide variety of forms. These forms include, for example, liquid, semi-solid, and solid dosage forms, such as liquid solutions (e.g., injection or infusion solutions), dispersions or suspensions, tablets, pills, powders, liposomes, or suppositories.
  • liquid solutions e.g., injection or infusion solutions
  • dispersions or suspensions tablets, pills, powders, liposomes, or suppositories.
  • the recommended form depends on the mode of administration and the intended use.
  • a typical recommended composition is in the form of an infusate or infusion.
  • the recommended mode of administration is parenteral, such as intravenous, subcutaneous, intraperitoneal, and muscular.
  • the antibody of the invention is administered by intravenous infusion or injection.
  • the antibody is administered by intramuscular or subcutaneous injection.
  • compositions generally must be sterile and stable under the conditions of production and storage.
  • the composition can be formulated as a solution, microemulsion, dispersion, liposome or other ordered structure suitable for high drug concentrations.
  • a sterile injectable solution is prepared by adding the required amount of the active compound (i.e., antibody) to one or a combination of the above ingredients, in a suitable solvent, followed by sterile filtration.
  • dispersions are prepared by incorporating the active compound into a sterile vehicle which contains the ⁇ Desc/Clms Page number>>>
  • the preferred methods of preparation are vacuum drying and lyophilization to produce the active ingredient with any other powder from the desired ingredients of the previously sterile filtration solution.
  • the proper fluidity of the solution can be maintained, for example, by a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • Prolonged absorption of the injectable compositions can be brought about by the inclusion of agents which delay absorption (e.g., monostearate and gelatin) in the compositions.
  • the antibodies of the invention can be administered by a variety of methods known in the art, although the recommended route of administration/administration in many therapeutic uses is intravenous injection or infusion. The skilled artisan will appreciate that the route of administration and/or mode of administration will vary with the desired result.
  • the active compound can be prepared with a carrier that protects the compound from rapid release,
  • controlled release formulations include grafts, transdermal patches, and microcapsule delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoester, and polylactic acid. Many methods of preparing such formulations are known to those skilled in the art, see JR Robinson, drinking and control led release drug del ivery system, Marcel Dekker, Inc., New York, 1978.
  • the antibodies of the invention may be administered orally with, for example, an inert diluent or an assimilable edible carrier.
  • the compound (and other active ingredients, if desired) may also be enclosed in hard or soft shell gelatin capsules, compressed into tablets or added directly to the subject's diet.
  • the compound may be added together with excipients and used in the form of edible tablets, buccal tablets, troches, capsules, suspensions, syrups and the like.
  • compositions of the present invention may comprise a "therapeutically effective amount” or a "prophylactically effective amount” of an antibody of the invention.
  • “Therapeutically effective amount” means an amount effective to achieve the desired therapeutic effect at the necessary dosages and times.
  • the therapeutically effective amount of the antibody or antibody binding moiety can vary depending on factors such as the condition, age, sex and weight of the individual and the ability of the antibody or antibody binding moiety to elicit a desired response in the individual.
  • a therapeutically effective amount is also one in which the beneficial therapeutic effect of the antibody exceeds any of its toxic or detrimental effects.
  • “Prophylactically effective amount” means an amount effective to achieve the desired prophylactic effect at the necessary dosage and time. Because a prophylactically effective amount is administered to a subject prior to or at an early stage of the disease, the prophylactically effective amount will generally be less than the therapeutically effective amount.
  • Dosage specifications can be adjusted to provide the optimal desired response (eg, therapeutic or prophylactic response). For example, a single bolus dose may be administered, and several sub-fractions may be administered over a period of time or the dose may be proportionally reduced or increased depending on the urgency of the treatment. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity.
  • Dosage unit form as used herein refers to a physically discrete unit of unit dosage suitable for the mammalian subject to be treated; each unit contains a predetermined amount of the active compound(s) employed in association with the desired pharmaceutical carrier.
  • the specification of the dosage unit form of the present invention is determined by the following and is directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic or prophylactic effect to be achieved, and (b) in mixing the sensitive activity for treating the individual There are inherent limitations in the art of compounds.
  • Therapeutic antibody of the invention or typical non-limiting range is prophylactically effective amount of 0. 01 - 100mg / kg, preferably 0. l-50mg / kg, and most preferably a 1 50mg / k g. It should be noted that the dose value will vary depending on the type and severity of the disease to be alleviated. It is further understood that for any particular subject, the particular dosage regimen should be adjusted over time according to the individual needs and the professional judgment of the person administering or supervising the composition, and the dosage range set herein is illustrative only. It should not be construed as limiting the scope or practice of the claimed compositions.
  • the ability of the anti-human Cyr61 protein monoclonal antibody of the present invention to bind to human Cyr61 is known to be used for detection in routine immunoassays for enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) or tissue immunohistochemistry.
  • Human Cyr61 eg in a sample such as serum or plasma.
  • the present invention provides a method for detecting Cyr61 in a biological sample, which comprises contacting the biological sample with the antibody of the present invention and detecting or binding to an antibody of Cyr61 or an unbound antibody, thereby detecting the organism Cyr61 in the sample.
  • the antibody is labeled, directly or indirectly, with a detectable substance, for ease of detection of bound or unbound antibodies.
  • Suitable detectable substances include various enzymes, prosthetic groups, fluorescent substances, luminescent substances, and radioactive materials.
  • suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase or acetylcholinesterase;
  • suitable prosthetic complexes include streptavidin/biotin and avidin / biotin;
  • suitable fluorescent substances include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinamide fluorescein, dansyl chloride or phycoerythrin;
  • luminescent substances include Luminol;
  • suitable radioactive materials include 125 i, 131 i, 35 s or 3 ⁇ 4.
  • the Cyr61 can be detected in a biological fluid by competitive immunoassay using either Cyr61-labeled or unlabeled anti-Cyr61 antibody labeled with a detectable substance.
  • a biological sample, the labeled Cyr61 standard and the anti-Cyr61 antibody are mixed and the amount of the labeled Cyr61 standard bound to the labeled antibody is determined.
  • the amount of Cyr61 in the biological sample is inversely proportional to the amount of the labeled Cyr61 standard bound to the anti-Cyr61 antibody.
  • the antibodies of the invention are capable of neutralizing Cyr61 activity in vitro or in vivo.
  • the antibody of the present invention can be used, for example, to inhibit Cyr61 activity in a cell culture containing Cyr61, in a human subject, or in a mammalian subject having Cyr61 which can cross-react with the antibody of the present invention.
  • a method of inhibiting Cyr61 activity comprising contacting Cyr61 with an antibody of the invention such that Cyr61 activity is inhibited is provided.
  • the Cyr61 is preferably human Cyr61.
  • an antibody of the present invention can be added to a medium containing or suspected of a cell culture containing Cyr61 to inhibit Cyr61 activity in the culture.
  • the antibody of the present invention inhibits Cyr61 in a subject suffering from a disease in which Cyr61 activity is harmful.
  • Cyr61 has been proposed to be involved in the pathophysiology of many disorders, such as cancers such as breast cancer and autoimmune diseases such as rheumatoid arthritis.
  • a method of treating or preventing a Cyr61-associated disease with an antibody of the present invention comprising administering an antibody of the present invention to such subjects such that the activity of Cyr61 in the subject is inhibited.
  • the antibody produced was an IgGl subtype ⁇ subclass. These antibodies have an inhibitory effect on inhibiting adhesion or proliferation of human breast cancer cells.
  • Figure 1 is a schematic diagram showing the construction of the expression plasmid pET28(a)-hCyr61 expressing human full-length Cyr61.
  • Figure 2A shows the restriction enzyme digestion of pET28a-hCyr61 recombinant plasmid.
  • Figure 2B shows the sequencing results of pET28a-hCyr61 recombinant plasmid;
  • A represents the sequencing result of T7 promoter primer,
  • B represents the sequencing result of T7 terminator primer;
  • the arrow on the figure identifies the position of the upstream and downstream primers of hCyr61.
  • Figure 3A shows the expression of the His-hCyr6 fusion protein; wherein M represents the low molecular weight protein Marker;
  • Figure 3A left, Figures 1, 3, 5 and 7 indicate the induction of 4 different clones; 2, 4, 6 and 8 represent 4 different Figure 3A
  • Right panel Pre indicates pre-induction; IN indicates post-induction; CL indicates lytic supernatant; Pellet indicates inclusion body precipitation, and arrows indicate expressed proteins.
  • Figure 3B shows the His-hCyr61 fusion protein sequence; the box portion is the removed signal peptide sequence, and the underlined portion is pET28a (+) with a sequence of histidine on the vector.
  • FIG. 4 shows the results of electroelution purification and identification of His-hCyr61 fusion protein: in the left part, M means low molecular weight protein Marker, Pre means before induction; IN means induction, Pellet means inclusion body lysate, Elu means over-chromatography The eluted protein after the column, Ele is the purified protein eluted by tapping; the right is identified by Western Blotting; wherein M is the pre-stained protein Marker, 1 is the pET28a-OVA66m bacterial lysate, and 2 is the pET28a-hCyr61 bacterial lysate. 3 indicates that the His-hCyr61 recombinant protein was purified by tapping.
  • Figure 5 is a schematic representation of the construction of the expression vectors pET28(a)-hCyr61-XN and pET28(a)-hCyr61-XC.
  • Figure 6 shows the results of restriction enzyme digestion of pET28a-hCyr61-XN recombinant plasmid: where Mark indicates DNA signature, left: 1 : pET28a-hCyr61-XN plasmid; 2: pET28a-hCyr61-XN enzyme fragment; right 3: pET28a-hCyr61- XC plasmid; 4: pET28a-hCyr61-XC enzyme was cut off.
  • Figure 7 SDS-PAGE and Western Blotting were used to identify the N-terminal and C-terminal fragments of recombinant His-hCyr61.
  • Figure 7 Left Purified protein SDS-PAGE electrophoresis results: M: low molecular weight protein Marker; FL: purified His-hCyr61 full-length fusion protein; XN: purified near-N-terminal His-hCyr61-XN fusion protein fragment; XC : Purified near-C-terminal His-hCyr61-XC fusion protein fragment.
  • Figure 7 is the result of Western Blotting.
  • the FL, XN, and XC representations are the same as in Figure 7.
  • Figure 8A shows the specific identification of 9 anti-human Cyr61 monoclonal antibodies; His-Cyr61 represents the OD492nm value of the hybridoma culture supernatant by His-Cyr61 fusion protein coated well, and His-OVA66 represents the His-OVA66m fusion protein package. The OD492nm value of the hybridoma culture supernatant was determined by the well.
  • Figure 8B shows subclasses and subtypes of monoclonal antibodies by ELISA
  • PAb serum of immunized mice as a positive control for subclasses and subtypes of antibodies
  • Figure 8C shows the purity and molecular weight of the purified antibody by SDS-PAGE; wherein M represents the low molecular weight protein Marker; R78E4, R367E10 R131E3 and R220E5.
  • Figure 9A is an ELISA analysis of the binding antigenic sites of four heavy chain IgGl monoclonal antibodies; wherein FL represents the OD value of hCyr6126-381 full-length protein coated well, and XN represents the OD of hCyr61 26 _ 267 coated pores Value, XC represents the OD value of the hCyr6 l io3-38i coated well.
  • Figure 9B shows the specificity of mouse anti-hCyr61 monoclonal antibody and its binding to different fragments of Cyr61 by immunoblotting;
  • FL represents hCyr61 2 381 full-length protein
  • XN represents hCyr61 2 (3 ⁇ 467
  • XC represents hCyr61 1 ( ⁇ 381
  • hCyr61 is purchased from Peprotech human Cyr61 standard protein
  • OVA66m is human ovarian cancer-associated tumor antigen (as negative to Ba Zhao) ,,).
  • FIG. 10 Comparison of amino acid sequence between human Cyr61 protein and mouse Cyr61 protein.
  • the first behavior is Cyr61 sequence
  • the second behavior is the same sequence
  • the third behavior is mouse Cyr61 sequence
  • the box is the region where the mouse Cyr61 sequence is inconsistent with humans.
  • Figure 1 shows the expression of Cyr61 protein (x400) in synoviocytes by indirect immunofluorescence
  • mouse anti-human Cyr61 mAb detection of Cyr61 protein in FLS cells by monoclonal antibodies CGMCC3298 (R78E4) and CGMCC3299 (R131E4)
  • DAPI Indicates that the nucleus is displayed with DAPI dye, and Merge indicates the superposition of the cell image measured by the Cyr61 antibody and the picture of the DAPI stained nucleus.
  • Figure 12 shows the results of binding of anti-Cyr61 monoclonal antibody to human breast cancer cell line MDA-MB-231 (abbreviated as MAB-231) (high expression of Cyr61), but not to MCF-7 (low expression of Cyr61);
  • A indicates that real-time PCR analysis showed that human breast cancer cell line MDA-MB-231 has high expression of Cyr61, MCF-7 has low expression of Cyr61;
  • B indicates that Western Blotting shows that anti-Cyr61 monoclonal antibody CGMCC3351 can specifically express Cyr61 expressed by cells.
  • Binding; C indicates that immunofluorescence showed that Cyr61 monoclonal antibody CGMCC3351 specifically binds to Cyr61 expressed by cells.
  • Figure 13 shows the expression of Cyr61 protein (x200) in human FLS and mouse NIH3T3 cells by immunocytochemical staining.
  • Figure 14 Inhibition of synovial cell proliferation by mouse anti-human Cyr61 monoclonal antibody, wherein * is p ⁇ 0.05, ** is p ⁇ 0.01; * is
  • FIG. 15 Inhibition of mouse anti-human Cyr61 monoclonal antibody on synovial cell adhesion.
  • Figure 16 A shows a significant improvement in clinical inflammation in CIA mice treated with antibody CGMCC3351 (R367E10).
  • B tissue section HE staining Compared with control antibody treatment (left panel), CIA mice treated with anti-Cyr61 neutralizing antibody CGMCC3351 (R367E10) had less synovial hyperplasia and reduced articular surface destruction (right).
  • Figure 17 Antibodies R78E4 and R367E10 inhibited the proliferation of MDA-MB-231 cells.
  • Figure 17A 3H-TDR incorporation assay for cell proliferation.
  • Figure 17B MTT assay for cell proliferation, % inhibition was calculated, where * is p ⁇ 0.05, ** is p ⁇ 0.001.
  • Antibody R131E3 inhibits the adhesion of MDA-MB-231 cells, wherein * is P ⁇ 0.05.
  • Antibody R367E10 inhibits migration of MDA-MB-231 cells, wherein ** is ⁇ 0 ⁇ 01.
  • Figure 21 A shows a significant decrease in tumor growth and prolonged survival in mice treated with anti-Cyr61-specific neutralizing antibody CGMCC3351 (R367E10);
  • B shows that histological staining of tumor tissue sections showed a decrease in Cyr61 distribution;
  • C showed anti-Cyr61 specificity.
  • the corresponding anti-human Cyr61 protein monoclonal antibodies are referred to as R78E4, 093E2, R78, CGMCC3298 or 3298.
  • Hybridoma cell line R131E3, also known as 096B7 and R131 was submitted to the China Microbial Culture Collection Management Committee of the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing, China, on November 3, 2009. Deposited by the Microbiology Center, deposit number CGMCC3299.
  • the corresponding anti-human Cyr61 protein monoclonal antibody is referred to as R131E3 096B7, R131, CGMCC3299 or 3299.
  • the hybridoma cell line R220E5 also known as 098E8 and R220, was submitted to the China Microbial Culture Collection Management Committee of the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing, China, on November 3, 2009. Deposited by the Microbiology Center, deposit number CGMCC3300.
  • the corresponding anti-human Cyr61 protein monoclonal antibodies are referred to as R220E5, 098E8, R220, CGMCC3300 or 3300.
  • the hybridoma cell line R367E10 also known as 093G9 and R367, was submitted to the China Microbial Culture Collection Management Committee of the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing, China, on November 3, 2009. Deposited by the Microbiology Center, deposit number CGMCC3351.
  • the corresponding anti-human Cyr61 protein monoclonal antibodies are referred to as R367E10, 093G9, R367, CGMCC3351 or 3351.
  • the primer design software Primer 5.0 was used to remove the signal peptide, and the corresponding restriction sites were added at both ends.
  • Upstream bow I (Seq ID No.l): 5'- TTGGATCCTGCCCCGCTGCCTGCCACT-3 '
  • Downstream primer (Seq ID No. 2): 5'- TTAAGCTTCTAGTCCCTAAATTTGTGAATGTCATT -3'
  • the plasmid pET28(a) was co-digested with restriction endonucleases BamH I and Hind III, and the amplified human full-length Cyr61 (hCyr61-FL) was ligated into the pET28(a) vector according to the conventional ligation method to construct a plasmid.
  • the recombinant plasmid was identified by enzyme digestion and sequencing. The results showed that the recombinant plasmid was completely correct and identical to the sequence reported in GenBank (see Figure 2A, the restriction enzyme identification was marked with an arrow; Figure 2B, sequencing identification). This indicates that the amplified fragment is correctly linked to pET28(a) and conforms to the experimental design and can be used for subsequent plasmid amplification and expression of the target protein.
  • Recombinant human Cyr61 full-length expression protein induced expression according to conventional molecular cloning methods. Briefly: Pick up the monoclonal colonies and shake them overnight, inoculate them in 5ml fresh LB liquid medium, shake at 37 °C 250rpm until the OD600 is 0.6 ⁇ 0.8, and add the final concentration of 1mmol/L IPTG for 3h; SDS The results of the -PAGE assay showed that the induced bacterial protein had a distinct band at 45 kDa, while the uninduced bacterial protein had no corresponding band (see Figure 3A, left arrow).
  • 34-389 is the human Cyr61 sequence
  • the constructed His-hCyr61 fusion protein has a molecular weight of about 44.7 KDa
  • an SDS-PAGE gel The molecular weights of the displayed proteins are identical (see Figure 3B).
  • Cyr61-XN- 26-267aa Primer for the N-terminal fragment of Cyr61 protein (Cyr61-XN- 26-267aa or Seq ID No. 3 26-267)
  • Upstream bow I (Seq ID No. 7): 5'- TTGGATCCTGCCCCGCTGCCTGCCACT-3 '
  • Cyr61-XC-103-381aa Primer for C-terminal fragment of Cyr61 protein (Cyr61-XC-103-381aa, ie Seq ID No. 3 103-381)
  • Upstream Primer (Seq ID No. 9): 5 '-TTGGATCCGGCTGTCCCAACCCTCGGCTG-3 '
  • the total R A of the synovial cells of patients with rheumatoid arthritis was extracted, and cDNA was obtained by RT-RCR method.
  • the Cyr61-XN and Cyr61-XC DNA fragments were amplified by PCR using two pairs of primers for N-terminus and C-terminus.
  • Plasmid pET28 (a) was co-digested with restriction endonucleases BamH I and Hind III, respectively, and the amplified human Cyr61 N-terminal fragment (Cyr61-XN-26_267aa) and human Cyr61 near C-terminal 2/ according to the conventional ligation method. 3 clips
  • the positive clone plasmid was extracted and identified by enzyme digestion and sequencing.
  • the results showed that the Cyr61-XN gene was 728 bp (Fig. 6 left, arrow) and the Cyr61-XC gene was 716 bp (Fig. 6 right, as indicated by the arrow).
  • the above fragments were located at 282-1009 nt and 638-1353 nt of the Cyr61 gene sequence, respectively, and the results showed that the pET28(a) was correctly ligated and conformed to the expected experimental design.
  • the hCyr61-XN and hCyr61-XC fusion protein fragments were induced by the same method as human full-length Cyr61 protein expression and purification, and the purified hCyr61-XN and hCyr61-XC fusion protein fragments were subjected to Western blot analysis.
  • the results showed that the purified hCyr61-XN fusion protein comprises the N-terminal 242 amino acids of human Cyr61 protein (Seq ID No. 3 26-267, ie Seq ID No. 5) and the vector His peptide sequence (Seq ID No. 4 1-33).
  • hCyr61-XC fusion protein comprises 279 amino acids at the C-terminus of human Cyr61 protein (Seq ID No. 3 103-381, ie Seq ID No. 6) and vector His peptide sequence (Seq ID No. 4 1-33) And 390-402), two fusion protein fragments at 35 kDa, and the hCyr61-FL (human Cyr61 full-length protein) band at 45 kDa (Fig. 7 left); Western blot analysis indicated that the 35 kDa fragment and hCyr61-FL (Human Cyr61 full-length protein) is identical, and can specifically bind to the commercially available anti-Cyr61 protein (Fig. 7 right), in line with the intended experimental purpose.
  • Example 3 Preparation and Binding Site Analysis of Mouse Anti-Human Cyr61 Monoclonal Antibody BABC/c mice: Female, 4 to 8 to 8 weeks old and 50 to 8 to 10 weeks old, provided by the Animal Science Center of the Shanghai Academy of Sciences, Chinese Academy of Sciences.
  • Mouse myeloma cells SP20/Ag-14 (trade name HB-12546TM).
  • mice were immunized with a self-made human His-hCyr61 fusion protein according to a conventional immunization method, and mouse spleen cells were taken, and cell fusion was carried out according to a classical method. After 5 consecutive subcloning and ELISA screening, 9 hybridoma cells can stably secrete specific anti-human Cyr61 antibody (only reacted with purified or His-hCyr61, but not with His, nor with His-OVA66m) (see Figure 8A). Further, the types of antibodies were identified, and five of them were IgM type ⁇ type.
  • the other four subtypes are IgGl type ⁇ type, named R78E4 (also known as R78 or 093E2), R131E3 (also called R131 or 096B7), R220E5 (also called R220 or 098E8), R367E10 (also called R367 or 093G9).
  • R78E4 also known as R78 or 093E2
  • R131E3 also called R131 or 096B7
  • R220E5 also called R220 or 098E8E8
  • R367E10 also called R367 or 093G9.
  • the four hybridoma cell lines were deposited on November 3, 2009 at the General Microbiology Center of the China Microbial Culture Collection Management Committee of the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing, China. In turn, it is CGMCC3298, CGMCC3299, CGMCC3300 and B CGMCC3351 (see Figure 8B).
  • the four monoclonal antibodies were used to prepare ascites (conventional method), and after SDS-page electrophoresis by Protein A-Sepharose affinity chromatography, the results showed that the heavy chains of the four monoclonal antibodies were all located at 52 kD, while the light chain. At about 27 kD, it was verified again that the four monoclonal antibodies were of the IgGl type kappa type (Fig. 8C).
  • the full length of His-hCyr61 purified by prokaryotic expression and its N-terminal hCyr61 26 _ 267 and C-terminal fragment hCyr61 1Q3 _ 381 were coated with ELISA plates, and the monoclonal antibodies in the culture supernatants of 4 IgG1 hybridoma cells were determined to be different from the above. The ability of the antigen to bind. Further determination was made by Western blotting.
  • the genital synovial cells were derived from the scraped synovium of joint replacement surgery (patients were informed by informed consent and hospital ethics committee).
  • BALB/c mouse fibroblast strain NIH3T3 (trade name CRL-1658TM)
  • Human breast cancer cell line MCF-7 (trade name HTB-22TM)
  • the purified mouse monoclonal antibody against human Cyr61 (CGMCC3298 CGMCC3299 CGMCC3300 CGMCC3351) was used as the primary antibody, and the binding ability of the prepared monoclonal antibody to cytosolic Cyr61 was determined by indirect immunofluorescence. The result confirmed that the antibody can be combined with rheumatoid. Cyr61 protein binding in the cytoplasm of synovial cells in patients with arthritis (RA) showed no fluorescence in the nucleus.
  • Figure 11 shows the fluorescence detection results of CGMCC3298 CGMCC3299. This result further confirmed the specificity of the preparation of monoclonal antibodies, and also confirmed the high expression of Cyr61 protein in synovial cells of RA patients.
  • Cyr61 as a matrix protein, can promote the adhesion of a variety of cells, and thus participate in the pathological and physiological processes such as tumor cell metastasis and injury repair.
  • the adhesion of Cyr61 to synoviocytes has not been reported.
  • the effects of the prepared monoclonal antibodies against human wind-slip synovial cell adhesion were determined. First, different concentrations of human Cyr61 standard protein-coated plates were used to confirm that Cyr61 promoted adhesion of synoviocytes in a dose-dependent manner (see Figure 15A).
  • heparin significantly inhibited the adhesion of Cyr61 to synoviocytes and was dose-dependent (see Figure 15B).
  • CIA model type II collagen-induced arthritis model
  • DBA1 mice DBA1 mice using international standard methods, and randomized when the clinical score of mice was 4 points.
  • Control IgG and CGMCC3351 were used for treatment.
  • the treatment was as follows: twice a week, 100ug each time, intraperitoneal injection. Observe changes in their clinical inflammatory scores.
  • the results showed that clinical inflammation was significantly improved in CIA mice treated with anti-Cyr61-specific neutralizing antibody CGMCC3351 (Fig. 16A), and HE staining of joint tissue sections also showed a decrease in synovial proliferation and a marked reduction in joint destruction (Fig. 16B).
  • the Cyr61 protein was plated at 4 ug/ml, lOOul/well, overnight at 4°. After blocking with 1% BSA for 2 h, PBS was washed and 4 monoclonal antibodies (CGMCC3298, CGMCC3299, CGMCC3300 and CGMCC3351) were added at 37 ⁇ g/well, 37. After incubation for 1 h, 5 ⁇ 10 4 cells/well were added, and after incubation for 1 h at 37°, crystal violet staining, 2% SDS dissolution and crystallization, and OD550 detection. The results showed that the antibody CGMCC3299 had the effect of inhibiting cell adhesion, while the other three strains (CGMCC3298, CGMCC3300 and CGMCC3351) had no significant effect (see Figure 18).
  • Transwell assay was used to observe the effect of antibodies on MDA-MB-231 cell migration.
  • 4 monoclonal antibodies CGMCC3298, CGMCC3299, CGMCC3300 and CGMCC3351
  • control IgG1 monoclonal antibody concentration 10ug/ml
  • the upper layer of the membrane was wiped off with a cotton swab and stained with crystal violet for 20 minutes. Microscopic observation, taking pictures, counting. The results showed that only CGMCC3351 significantly inhibited the migration of MDA-MB-231 cells among the four monoclonal antibodies (see Figure 19).
  • conditioned medium MDA-MB-231 cell culture medium
  • 4 monoclonal antibodies and control IgG1 monoclonal antibody concentration of 10 ug/ml
  • MDA-MB-231 cells were added to the upper layer (5 ⁇ 10 4 /well).
  • the supernatant liquid was aspirated and fixed in 4% paraformaldehyde for 15 min.
  • the upper layer of the membrane was wiped off with a cotton swab and stained with crystal violet for 20 minutes. Microscopic observation, taking pictures, counting. The results showed that only CGMCC3351 significantly inhibited the invasion and growth of MDA-MB-231 cells among the four monoclonal antibodies (see Figure 20).
  • 5X10 6 MDA-MB-231 cells were inoculated into nude mice. After 2 days, they were randomly divided into 2 groups and treated with control IgG and CGMCC3351 respectively. The treatment was: intraperitoneal injection of 5 mg/kg body weight twice a week. Observe its tumor growth size. When the tumor grew to 2 CM 2 , the mice were considered dead and discontinued treatment. Lymph node metastasis experiments: 1X10 6 MDA-MB-231 cells were inoculated into the footpad of nude mice, grouped, treated and observed as above. The results showed that the growth of tumor cells treated with anti-Cyr61-specific neutralizing antibody CGMCC3351 was significantly reduced and the survival time was prolonged (Fig. 21A). At the same time, histological staining of tumor tissue sections showed a decrease in Cyr61 distribution (Fig. 21B) and lymphatic metastasis (Fig. 21B). Figure 21C).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Endocrinology (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Rheumatology (AREA)
  • Microbiology (AREA)
  • Pain & Pain Management (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des anticorps monoclonaux de la protéine anti-Cyr61 et un procédé de préparation de ceux-ci, et des souches de cellules d'hybridomes utilisées pour produire lesdits anticorps monoclonaux. L'invention concerne aussi des utilisations de ces anticorps monoclonaux pour fabriquer des médicaments destinés à prévenir ou à traiter des maladies associées à la prolifération, à l'adhérence, à la migration ou à la croissance invasive de cellules, et pour fabriquer des réactifs permettant de détecter la protéine Cyr61.
PCT/CN2010/079208 2009-12-04 2010-11-27 Anticorps monoclonaux de la protéine anti-cyr61 et utilisations de ceux-ci WO2011066783A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP10834216.3A EP2540742A4 (fr) 2009-12-04 2010-11-27 Anticorps monoclonaux de la protéine anti-cyr61 et utilisations de ceux-ci

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
CN200910199937A CN101709088A (zh) 2009-12-04 2009-12-04 抗Cyr61蛋白的单克隆抗体及其应用
CN200910199938.X 2009-12-04
CN200910199938A CN101709089A (zh) 2009-12-04 2009-12-04 抗Cyr61蛋白的单克隆抗体及其应用
CN200910199937.5 2009-12-04

Publications (1)

Publication Number Publication Date
WO2011066783A1 true WO2011066783A1 (fr) 2011-06-09

Family

ID=44114613

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2010/079208 WO2011066783A1 (fr) 2009-12-04 2010-11-27 Anticorps monoclonaux de la protéine anti-cyr61 et utilisations de ceux-ci

Country Status (2)

Country Link
EP (1) EP2540742A4 (fr)
WO (1) WO2011066783A1 (fr)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001098359A2 (fr) * 2000-06-21 2001-12-27 Wyeth Cyr61 utilise comme cible dans le traitement et le diagnostic du cancer du sein
WO2002026193A2 (fr) * 2000-09-29 2002-04-04 Wyeth Utilisation de cyr61 dans le traitement et le diagnostic des leiomyomes uterins chez la femme
US20020150986A1 (en) * 1996-03-15 2002-10-17 Munin Corporation Extracellular matrix signalling molecules
CN101709088A (zh) * 2009-12-04 2010-05-19 上海市免疫学研究所 抗Cyr61蛋白的单克隆抗体及其应用
CN101709089A (zh) * 2009-12-04 2010-05-19 上海市免疫学研究所 抗Cyr61蛋白的单克隆抗体及其应用

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020150986A1 (en) * 1996-03-15 2002-10-17 Munin Corporation Extracellular matrix signalling molecules
WO2001098359A2 (fr) * 2000-06-21 2001-12-27 Wyeth Cyr61 utilise comme cible dans le traitement et le diagnostic du cancer du sein
WO2002026193A2 (fr) * 2000-09-29 2002-04-04 Wyeth Utilisation de cyr61 dans le traitement et le diagnostic des leiomyomes uterins chez la femme
CN101709088A (zh) * 2009-12-04 2010-05-19 上海市免疫学研究所 抗Cyr61蛋白的单克隆抗体及其应用
CN101709089A (zh) * 2009-12-04 2010-05-19 上海市免疫学研究所 抗Cyr61蛋白的单克隆抗体及其应用

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
J.R. ROBINSON: "sustainable and controlled the release drug delivery system", 1978, MARCEL DEKKER, INC.
See also references of EP2540742A4 *

Also Published As

Publication number Publication date
EP2540742A1 (fr) 2013-01-02
EP2540742A4 (fr) 2014-02-12

Similar Documents

Publication Publication Date Title
TWI688403B (zh) 人類ｃｇｒｐ受體結合蛋白
RU2517596C2 (ru) МОНОКЛОНАЛЬНЫЕ АНТИТЕЛА, КОТОРЫЕ СВЯЗЫВАЮТСЯ С hGM-CSF, И СОДЕРЖАЩИЕ ИХ КОМПОЗИЦИИ МЕДИЦИНСКОГО НАЗНАЧЕНИЯ
AU2011319843C1 (en) DKK1 antibodies and methods of use
EP2970448B1 (fr) Anticorps humains dirigés contre le grem1
AU2007332855B2 (en) Monoclonal antibodies against ANGPTL3
TWI636064B (zh) 人類ｐａｃ１抗體
TW201522369A (zh) 經生物工程之抗－ＴＧＦ－β抗體及抗原結合片段
JP2023503700A (ja) Ｔｓｌｐ関連疾患に対する治療薬の開発及び用途
CN110105451B (zh) IL-4Rα抗体及其用途
EP2744822A2 (fr) Protéines et peptides modifiés
JP2008531608A (ja) Ｙｋｌ−４０モノクローナル抗体
CN112585165A (zh) 优化的抗tl1a抗体
US11370836B2 (en) Monoclonal antibody binding to human IL-5, preparation method therefor and use thereof
WO2020119728A1 (fr) Anticorps monoclonal anti-interleukine 5(il-5) humaine et son utilisation
WO2022033538A1 (fr) Anticorps d'il-11 et son utilisation
JP2023153984A (ja) 腫瘍治療薬及びその応用
WO2023016449A1 (fr) Polypeptide de fusion bispécifique et son application
CA3208455A1 (fr) Nouveaux anticorps anti-gremlin-1
WO2019148405A1 (fr) ANTICORPS D'IL-4Rα ET SON UTILISATION
CN116617388A (zh) 靶向冠状病毒的抗体在预防、治疗或改善covid-19中的应用
WO2022205021A1 (fr) Anticorps anti-angptl3 ou fragment de liaison à un antigène associé, sa méthode de préparation et son utilisation
WO2015113494A1 (fr) Protéine de fusion bifonctionnelle, procédé de préparation s'y rapportant et son utilisation
WO2020093957A1 (fr) ANTICORPS SE LIANT À L'IL-1 β HUMAINE, SON PROCÉDÉ DE PRÉPARATION ET SON UTILISATION
WO2022174781A1 (fr) Protéine de fusion à domaines multiples et son utilisation
WO2013103783A1 (fr) Anticorps murins il-13

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10834216

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2010834216

Country of ref document: EP