WO2011049273A1 - Skin-whitening composition containing saponified evening primrose seed oil - Google Patents

Abstract

The present invention relates to a skin-whitening composition containing saponified evening primrose seed oil as an active ingredient. The saponified evening primrose seed oil of the present invention inhibits tyrosinase gene expression, which is essential for melanin production, inhibits Trp1, Trp2 and MITF gene expression, which are associated with melanin production, exhibits excellent effects in inhibiting pigmentation, and may be effectively used for whitening the skin.

Description

Evening Primrose Oil Saponified Skin Whitening Composition

The present invention relates to a skin whitening composition, and more particularly to a whitening composition that inhibits the production of melanin pigment in skin cells.

Melanin absorbs ultraviolet rays and protects skin organs from damage caused by ultraviolet rays. It also protects skin by removing harmful substances such as free radicals and free radicals. Do it.

Despite the useful role of melanin pigments, melanin pigments are excessively synthesized and deposited on the skin by various environmental factors such as ultraviolet rays, hormonal changes, inflammation, or medications, causing skin pigmentation disorders and adversely affect skin beauty. It can also cause skin cancer.

The skin pigmentation disease caused by the melanin pigment is recognized as a factor that deteriorates the whitening, which is the standard of modern people's beauty, and various solutions have been studied in terms of health and beauty.

Current methods for treating skin pigmentation include electrophoretic treatments that infiltrate high concentrations of vitamin C, using a combination of hydroquinone bleach, vitamin A ointment, topical steroid ointment, vitamin C, glycolic acid, and azelic acid. There is a treatment method, and recently, a method of periodically performing dermabrasion using TCA or glycolic acid in combination with local treatment is also frequently used.

However, there is no method to completely treat skin pigmentation disease to date, and there is a possibility of easily recurrence using any treatment method. Therefore, there is a need to develop a new therapeutic agent that can fundamentally understand the melanin production mechanism of the skin and can suppress melanin production based on this.

On the other hand, melanin pigment is converted into dopaquinone (DOPA) by tyrosine through dopa (DOPA) by an enzyme called tyrosinase in mesosome vesicles in melanocyte cells. It is synthesized through dopa chrome through oxidation reaction and enzyme reaction.

This synthesized melanin pigment is delivered to the surrounding keratinocyte (keratinocyte) is exposed to the phenotype of dark brown pigmentation or skin pigmentation disease in the skin.

Therefore, inhibiting the synthesis of melanin pigment is the most fundamental way to treat and prevent skin pigmentation disorders, and melanin pigment metabolism, which is a toxic substance that specifically acts on melanocyte cells that synthesize the melanin pigment. In order to achieve the treatment of skin whitening and skin pigmentation diseases by regulating the expression of tyrosinase genes, which are essential in the synthesis process, researches are being actively conducted.

Para-methoxyphenol, hydroquinone, kojic acid, arbutin, etc. have been used to treat skin pigmentation diseases. It may cause degeneration or lethality of the pigment cells, and there are disadvantages such as impairing the original function of the cells. On the other hand, vitamin C and derivatives thereof are used for the purpose of inhibiting melanin production, but they also have the disadvantage of low inhibitory activity.

In addition to these therapeutic agents, research has been conducted to find whitening active ingredients in natural products, especially plants, among them, extracts of many plants and herbal extracts such as lettuce, licorice, peony, cinnamon, red ginseng, brown root, donkey, bark peel, pear, aloe, etc. It has been found that the back acts on tyrosinase and inhibits melanin production, but they also have many problems in the use of cosmetics or pharmaceuticals in the concentration above the effective concentration. have.

Therefore, the development of natural products with excellent melanin biosynthesis inhibitory activity and low side effects even in small amounts is urgently required.

In order to solve the above problems of the prior art, an object of the present invention is to provide a skin whitening composition excellent in melanin biosynthesis inhibitory activity with a small amount of side effects. In addition, another object of the present invention is to effectively treat skin pigmentation disease caused by the excessive synthesis of melanin pigment using the skin lightening composition.

Skin whitening cosmetic composition according to one feature of the present invention for achieving the above problems contains evening primrose seed oil saponification as an active ingredient.

Preferably, the saponification may be saponified by treating any of the alkali metal hydroxides selected from the group consisting of NaOH, LiOH, and KOH to evening primrose seed oil.

Preferably, the composition is a skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisturizing lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, essence, nutrition essence, pack, soap, shampoo , Cleansing foam, cleansing lotion, cleansing cream, body lotion, body cleanser, latex, press powder, loose powder and eye shadow can be any one of the formulations selected from the group consisting of.

Preferably, the skin whitening may be performed by inhibiting the production of melanin pigment.

Preferably, the skin whitening may be performed by inhibiting tyrosinase gene expression.

In addition, the composition for treating and preventing skin pigmentation disease according to another feature of the present invention contains evening primrose seed oil saponification as an active ingredient.

Preferably, the skin pigmentation disease occurs locally on the skin due to the increased synthesis of melanin pigment, hyperpigmentation in spots, freckles, black spots, birthmarks, pigmentation by drugs, pigmentation after inflammation, and dermatitis May be one or more diseases selected from deposition.

Preferably, the saponified material may be included in the composition at 0.001 to 99.9 parts by weight based on the total weight.

Preferably, the composition may further comprise a pharmaceutically acceptable carrier, excipient, diluent or mixture thereof.

Preferably, the treatment and prevention of the skin pigmentation disease is performed by inhibiting the production of melanin pigment, and may be performed by inhibiting tyrosinase gene expression.

Preferably, the composition may be a formulation of any one selected from creams, gels, patches, sprays, ointments, warnings, lotions, linen, pasta, and cataplasma.

A composition for inhibiting tyrosinase activity according to another feature of the present invention contains evening primrose seed oil saponification as an active ingredient.

The composition for inhibiting tyrosinase gene expression according to another feature of the present invention includes evening primrose seed oil saponification as an active ingredient.

Evening primrose seed oil saponification of the present invention can inhibit the transcription of tyrosinase gene and synthesis of tyrosinase protein of the tyrosinase protein involved in the formation of melanin pigment can effectively inhibit the production of melanin pigment have.

Accordingly, evening primrose seed oil saponification of the present invention has an excellent skin whitening effect through the suppression of the production of melanin pigment, it can be usefully used as a skin whitening cosmetic composition.

In addition, the evening primrose seed oil saponification of the present invention can be effectively used to treat and prevent skin pigmentation diseases caused by the excessive production of melanin pigment through the inhibition of the production of melanin pigment.

Figure 1 is a graph showing the results of cytotoxicity test measured against melanoma cells (B16 melanoma cells) of evening primrose seed oil saponification.

2 is a photograph and graph showing that evening primrose seed oil saponification inhibits the production of melanin pigment in melanoma cells.

3 is a graph showing that evening primrose seed oil saponification inhibits the activity of tyrosinase enzyme in a concentration-dependent manner.

4 is a graph showing that evening primrose seed oil saponification inhibits the synthesis of tyrosinase protein in a concentration-dependent manner.

FIG. 5 is a real-time RT-PCR result graph showing that evening primrose seed oil saponification inhibits transcription of tyrosinase, Trp1, Trp2, and MITF genes, which are genes involved in melanin production, in a concentration-dependent manner.

Figure 6 is a photograph and graph observed the effect on the whitening after applying Evening Primrose seed oil saponification for 8 weeks after the direct irradiation of ultraviolet rays to induce pigmentation.

Hereinafter, the present invention will be described in detail with reference to a preferred embodiment so that those skilled in the art can easily practice the present invention. However, the following examples are merely provided to explain the present invention more easily, and the content of the present invention is not limited by the examples.

Skin whitening composition of the present invention contains evening primrose seed oil saponification as an active ingredient.

Here, the evening primrose (Oenothera odorata) seed oil refers to an oil component obtained by physically crushing the evening primrose seeds, and then juice. In addition, the term "saponification" refers to the reaction of hydrolysis of the ester bond in the oil and fat component contained in the evening primrose seed oil to produce carboxylic acid and alcohol, that is, the reverse reaction of the esterification reaction. In addition, the "saponifier" refers to a fatty acid alkali salt hydrolyzed by treating the ester group bond in the oil-fat component contained in the evening primrose seed oil with a "saponification reagent", wherein the "saponification reagent" that can be used as Alkali metal hydroxides, such as NaOH, KOH, or LiOH, are mentioned preferably.

"Skin whitening" means inhibiting the synthesis of melanin pigment to inhibit or prevent the skin deposition of the melanin pigment, and is used in the sense including treating or preventing skin pigmentation disease.

In addition, the "skin pigmentation disease" is a symptom such as blemishes, freckles, black spots, birthmarks, etc. occurring locally on the skin due to the increase in the synthesis of melanin pigment, pigmentation by drugs, found in the wound site healed After the inflammation is used as a meaning including both pigmentation, or hyperpigmentation appearing as a symptom of dermatitis.

In the present invention, the evening primrose seed saponification is related to the tyrosinase gene, which is a key enzyme involved in the synthesis of melanin metabolism, and tyrosinase related protein 1 (Trp1), Trp2, and microphthalmia associated transcription factor (MITF). It inhibits the expression of genes and performs skin whitening through this mechanism of action.

Evening primrose seed oil saponified composition of the present invention may be used as a cosmetic composition by containing one or more active ingredients exhibiting skin whitening action, examples of such components are lettuce, red ginseng, peony, cinnamon, red ginseng, brown root, donkey Many plant extracts or herbal extracts, such as bark bark, bark and aloe, are mentioned.

In addition, the cosmetic composition of the present invention may be blended with the evening primrose seed oil saponification, which is an essential component, and other ingredients normally formulated into cosmetics as needed, and as such a blending component, an oil-fat component, a humectant, an emollient agent, and a surfactant And organic and inorganic pigments, organic powders, ultraviolet absorbers, preservatives, fungicides, antioxidants, plant extracts, pH adjusters, alcohols, pigments, flavorings, blood circulation accelerators, cooling agents, limiting agents, purified water and the like.

The cosmetic composition may be prepared in the form of emulsion formulations and solubilizing formulations commonly used in the art, and examples thereof include skin lotions, skin softeners, skin toners, astringents, lotions, milk lotions, moisturizing lotions, nourishing lotions, and massage creams. Creams, nourishing creams, hand creams, essences, nourishing essences, packs, soaps, shampoos, cleansing foams, cleansing lotions, cleansing creams, body lotions, body cleansers, emulsions, press powders, loose powders, or eye shadows. Can be.

In addition, the composition of the present invention is evening primrose seed oil saponification itself has excellent skin whitening activity by effectively inhibiting the gene expression of enzymes involved in the synthesis of melanin pigment metabolism, blemishes, freckles, black spots, birthmarks, pigments by drugs It can also be used as a pharmaceutical composition for use in treating or preventing skin pigmentation diseases such as deposition, post-inflammatory pigmentation, and hyperpigmentation resulting from dermatitis.

Evening primrose seed oil saponified content included in the pharmaceutical composition in the present invention is skin pigmentation in an amount of 0.001 to 99.9 parts by weight relative to the total weight of the composition in consideration of the type of skin pigmentation disease, the severity of symptoms, the purpose of use, etc. It can be widely used for the treatment and prevention of diseases.

The pharmaceutical composition may be any formulation commonly applied to the skin in the art, such as creams, gels, patches, sprays, ointments, warnings, lotions, linings, pasta, or cata Plasma agents; and the like.

Evening primrose seed oil saponification does not show cytotoxicity can be used on the skin without concern for side effects, and used as an external preparation for skin as described above, there is no fear of side effects absorbed by the human body, giving any irritation to the skin surface Do not.

In addition, the pharmaceutical composition may be used in a homogeneous mixture with a pharmaceutically acceptable carrier, excipient, diluent or mixture thereof as necessary, and examples of such carrier, excipient, or diluent include petrolatum, liquid paraffin, paraffin, Oily base such as plastibase, lard, vegetable oil, wax, refined lanolin, water soluble base such as polyethylene glycol, etc. have.

The amount of the pharmaceutical composition may be used to the extent that the entire skin can be completely applied. The amount of the pharmaceutical composition is not particularly limited, and may be applied to the skin from time to time according to the user's convenience.

EMBODIMENT OF THE INVENTION Hereinafter, this invention is demonstrated in detail.

The active ingredient that inhibits melanin production in the present invention is an evening primrose seed oil saponified hydrolyzed fatty acid alkali salt by treating the ester group bond in the oil and fat component contained in evening primrose seed oil with a saponification reagent such as NaOH, KOH, or LiOH.

In order to confirm whether the evening primrose seed oil saponification reduces the production of melanin pigment, the present inventors treated melanoma cells with IBMX (Isobutylmethylxanthine) to create an environment that promotes melanin production, and compared the evening primrose seed oil saponification with the control group It was confirmed to reduce melanin production.

In addition, the expression of tyrosinase, TRP1, TRP2, and MITF genes involved in melanogenesis is confirmed by Western blotting and real time PCR techniques to confirm the reduction of melanogenesis at the cellular level. The change was measured.

Specifically, the present inventors conducted the experiment to the next step to prove the skin whitening effect of evening primrose seed oil saponification.

First, candidates were added in a melanogenesis-promoting environment to screen for melanin-producing substances, and melanoma cells were cultured to compare melanin production. The candidates included herbal extracts or drugs that are expected to be involved in melanogenesis.

As a result, the most effective evening primrose seed oil saponification was selected as the final candidate.

The selected evening primrose seed oil saponification was used to inhibit melanin production in melanoma cells, and the skin whitening effect was confirmed by measuring the expression and activity of intracellular tyrosinase, TRP1, TRP2, and MITF enzymes.

In order to verify whether evening primrose seed oil saponification has a skin whitening effect on the human body, UV light was irradiated on human skin to cause pigmentation of the skin, and then evening primrose seed oil saponification products were applied to directly observe the skin whitening effect.

The experiments were carried out varying the concentration and culture conditions of evening primrose seed oil saponification products.

Hereinafter, the present invention will be described in detail with reference to preferred embodiments and experimental examples.

Example. Preparation of Evening Primrose Seed Oil Saponification Products

Evening primrose seed oil and 2.5M KOH solution dissolved in ethanol in a 2: 1 volume ratio, and heated to 80 ° C. to prepare evening primrose seed saponification. After saponification reaction, the pH of evening primrose seed oil saponification was adjusted to 7.4 and used as evening primrose seed oil saponification.

Experimental Example 1. Cytotoxicity Test

In order to measure the cytotoxicity of the evening primrose seed oil saponification prepared in the above example, melanoma cells (B16 melanoma cell, Korea Cell Line Bank, Seoul) were cultured and MTT [3- (4,5-dimethylthiazol-2- yl) -2,5-diphenyltetrazolium bromide] method (J. Immunol. Methods , 141 (1), 15 (1991).) was tested as follows.

The MTT method is an experimental method used for cell proliferation or toxicity measurement. The principle of reducing the yellow water-soluble salt MTT to a water-insoluble purple formazan derivative by succinate dehydrogenase or mitochondrial dehydrogenase in mitochondria of living cells. Formazan derivative produced by the method used is a method of measuring the absorbance after dissolving a solution (dimethyl sulfoxide or 2-propanol).

Melanoma cells at 37 ° C in 96-well culture plates containing DMB (Dulbecco's Modified Eagles Medium, GIBCO) medium containing 10% fetal bovine serum (FBS; GIBCO) at a density of 1 × 10 ⁵ cells / well. , 1 day incubation in a 5% CO ₂ environment. Evening primrose seed oil saponification prepared according to the Example was added for each concentration of 12.5 to 100 ㎍ / ml (diluted with DMSO) and incubated in 37 ℃, 5% CO ₂ incubator for 24 hours. Thereafter, MTT solution (2.5 mg / ml; Sigma, USA) was added at a rate of 0.1 ml per well, the reaction was carried out at 37 ° C. for 30 minutes, the MTT solution was removed, and DMSO was added at a concentration of 0.1 ml per well. After dissolving the formazan derivative at room temperature, the absorbance was measured at 570 nm, and the difference in absorbance was compared with that of the negative control group without the evening primrose seed oil saponification. The results are shown in FIG. 1.

Referring to Figure 1, evening primrose seed oil saponification of the present invention showed the same high cell viability compared to the negative control at a concentration of 0 to 100㎍ / ml, cell survival rate of about 92.6% even at a concentration of 50㎍ / ml Showed little cytotoxicity.

As a result of the cytotoxicity test as described above, it was found that evening primrose seed oil saponification of the present invention is a substance that can be safely administered to cells and living organisms.

Experimental Example 2 Inhibitory Effects of Evening Primrose Seed Oil Saponified with Melanin Production

To determine if the evening primrose seed saponification reduces the production of melanin pigment, melanoma cells are treated with IBMX (Isobutylmethylxanthine) to create an environment that promotes melanin production, and the evening primrose seed oil saponification is compared with the control group to produce melanin. It was confirmed to decrease.

Human melanoma cells were treated with 0.1 mM concentration of IBMX to promote melanin production in melanoma cells, and evening primrose seed oil saponified at a concentration of 0-100 ug / ml. Human melanoma cells treated with evening primrose seed saponification were incubated for 3 days.

In order to measure the melanin pigment content of the cultured melanoma cells, the cells were washed with physiological saline, dissolved in lysis buffer, and treated with 20% TCA solution. The precipitate was washed twice with 10% TCA solution, and then sequentially treated with a mixed solution of ethanol and diethyl ether (3: 1), and diethyl ether solution, dried in air, and then 0.85 M potassium hydroxide. Dissolved into solution and heated for 15 minutes. Absorbance was measured at 440 nm after cooling. To correct the difference in melanin content by cell number, the protein is quantified by the Bradford Method (Anna Biochem 1976; 72: 248-54), and the melanin pigment is divided by the amount of protein per 1 mg unit protein. The melanin pigment | dye production | generation measurement value (melanin pigment | dye measurement amount / protein) is shown in FIG.

Referring to FIG. 2, the unsaponified Evening Primrose Seed Oil Treatment control did not significantly reduce the amount of melanin pigment produced even when the dose was increased to a concentration of 100 ug / ml.

On the contrary, in the group treated with evening primrose seed oil saponification of the present invention, the melanin pigment content generated in the cells was reduced depending on the treatment dose, and melanin pigment production was suppressed up to about 90% at a concentration of 100.0 ug / ml.

As a result of the above cell experiments, it was found that the evening primrose seed oil saponification of the present invention has an excellent effect on inhibiting the production of melanin in the actual cells.

Experimental Example 3. Inhibitory Effect of Evening Primrose Seed Oil Saponified Tyrosinase Activity

The effect of evening primrose seed oil saponification on the activity of tyrosinase, which plays an important role in the formation of melanin pigment, was evaluated.

Tyrosinase activity was evaluated by measuring the activity of dopa oxidase in which dopa is oxidized to dopa chrome.

Using the cell eluate of melanoma cells treated with IBMX and Evening Primrose Seed Oil saponification of Experimental Example 2, the reaction of dopa (DOPA) oxidation to dopa chrome (DOPA chrome) was measured by a spectrophotometer at 475 nm. The reaction was measured by adding the cell eluate to a freshly prepared substrate solution (0.1% L-DOPA in 0.1 M sodium phosphate, pH 6.0) and placing it at 37 ° C.

And, tyrosinase activity is shown in Figure 3 by correcting the tyrosinase activity per 1 mg unit protein using the protein quantification method described in Experimental Example 2.

Referring to FIG. 3, in the group treated with Evening Primrose seed oil saponification of the present invention, the activity of tyrosinase was reduced depending on the treatment dose, and at the concentration of 100.0 ug / ml, the activity of tyrosinase was about 20%. It can be seen that until.

Therefore, the evening primrose seed oil saponification of the present invention was found to have an excellent skin whitening effect by effectively inhibiting the increase of the activity of tyrosinase, which plays a key role in the production of melanocytes.

Experimental Example 4. Inhibitory Effect of Evening Primrose Seed Oil Saponified Tyrosinase Protein Expression

The effect of evening primrose seed saponification on the expression of tyrosinase protein, which plays an important role in the formation of melanin pigment, was evaluated.

Cellular eluate of melanoma cells treated with IBMX and Evening Primrose Seed Oil saponification of Experimental Example 2 was subjected to Western blot using a anti-murine tyrosinase IgG antibody (Santa-Cruz Biotechnology Inc.). Western blotting) was performed and the expression of tyrosinase protein was quantified by color development with a chemiluminant system.

Referring to Figure 4, evening primrose seed oil saponification of the present invention reduced the protein expression of tyrosinase in a concentration-dependent manner as in the results of Experimental Examples 2 and 3. These results indicate that evening primrose seed saponification of the present invention inhibits the synthesis of tyrosinase protein at the protein level.

Therefore, the evening primrose seed oil saponification of the present invention was found to have an excellent skin whitening effect by effectively inhibiting the synthesis of tyrosinase protein that plays a key role in the production of melanocytes.

Experimental Example 5. Inhibitory Effect of Evening Primrose Seed Oil Saponified Tyrosinase Gene Expression

The effect of evening primrose seed saponification on the expression of genes that play an important role in the formation of melanin pigment was evaluated.

As the genes, TRP-1, TRP-2, and MITF genes were selected, including tyrosinase.

MRNA was extracted from the cell eluate of melanoma cells treated with IBMX and Evening Primrose Seed Oil saponification of Experimental Example 2 using Trizol solution (Invitrogen, Praisly, UK) and cDNA was synthesized using reverse transcriptase (TaKaRa, Japan). The primers of Table 1 are added to the synthesized cDNA, and real-time PCR reaction is performed using an ABI Prism 7900HT Sequence Detection System (Applied Biosystems) to treat evening primrose seed oil saponification. Transcriptional changes of the cy Tyrosinase gene were measured.

To verify the effect by evening primrose seed saponification, melanoma cells without any treatment were used as controls, and melanoma cells treated with IMBX only were used as IBMX treatment groups.

Transcriptional changes of tyrosinase, TRP-1, TRP-2, and MITF genes in each experimental group were measured and the results are shown in FIG. 5.

Table 1 gene 5 'primer sequence 3 'primer sequence Tyrosinase TTGCCACTTCATGTCATCATAGAATATT TTTATCAAAGGTGTGACTGCTATACAAAT TRP-1 ATGCGGTCTTTGACGAATGG CGTTTTCCAACGGGAAGGT TRP-2 CTCAGAGCTCGGGCTCAGTT TGTTCAGCACGCCATCCA MITF CGCCTGATCTGGTGAATCG CCTGGCTGCAGTTCTCAAGAA GAPDH CGTCCCGTAGACAAAATGGT TTGATGGCAACAATCTCCAC

Referring to FIG. 5, compared to the control group which did not receive any treatment, the group treated with IBMX observed a sharp increase in the amount of transcription more than two times in all selected genes.

However, in the group administered with IBMX and Evening Primrose seed oil saponification of the present invention, the increase in transcription amount of the genes was observed to be alleviated significantly compared to the group treated with IBMX alone.

Through the above results, it was found that evening primrose seed saponification of the present invention inhibits the transcription of tyrosinase, TRP1, TRP2, and MITF genes involved in the production of melanin, inhibits melanin production, and is effective in skin whitening. .

Experimental Example 6. Skin whitening effect by evening primrose seed oil saponification

Induced pigmentation by irradiating 400mJ / cm ² of UVB 5 times a week (Aurora UV-Light, Chaoyang Medics, Seongnam) three times on the inner skin of human arm It was.

Evening primrose seed oil saponified solution was applied twice daily from 2 weeks to 10 weeks after the start of UV irradiation to evaluate the effect of evening primrose seed oil saponification on skin whitening. As a control group, irradiated with ultraviolet rays under the same conditions on the opposite upper arm, the group without any treatment was used.

Skin whitening effect was measured by measuring melanogenic index (MI) using Mexammeter (CK, Mexameter, MPA 9, Courage, Khazaka, Germany), and the difference with the MI value at the beginning of application of evening primrose oil saponification ( ΔMI) is shown in FIG. 6.

6, in the evening primrose seed oil saponification treatment group of the present invention, the ΔMI value began to decrease as soon as the saponification process was performed, and the ΔMI value decreased steadily until 8 weeks, thereby treating the evening primrose seed oil saponification of the present invention. At 8 weeks, the ΔMI value declined linearly to -30.

However, in the group not treated with the evening primrose seed oil saponification of the present invention, the melanin production was increased until 4 weeks after the ultraviolet irradiation, and even after 8 weeks there was no noticeable decrease in melanin production.

The evening primrose seed oil saponification of the present invention through the above results was found to have an excellent skin whitening effect by acting on the skin induced melanin pigmentation by the actual UV.

Although the preferred embodiments of the present invention have been described above, the present invention is not limited thereto, and various modifications and changes can be made within the scope of the technical idea of the present invention, which also belong to the appended claims. It is natural.

The present invention is a natural product having excellent melanin biosynthesis inhibitory activity and fewer side effects, and can be used in cosmetics and cosmetic compositions necessary for skin whitening, such as cosmetics, whitening creams and whitening agents.

Claims (14)

Skin whitening cosmetic composition containing evening primrose seed oil saponification as an active ingredient. The method of claim 1, The saponified product is a cosmetic composition, characterized in that the evening primrose seed oil is treated by treating any one alkali metal hydroxide selected from the group consisting of NaOH, LiOH, and KOH. The method of claim 1, The composition includes skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutrition lotion, massage cream, nutrition cream, moisture cream, hand cream, essence, nutrition essence, pack, soap, shampoo, cleansing foam , Cleansing lotion, cleansing cream, body lotion, body cleanser, emulsion, press powder, loose powder and eye shadow any one of the formulations selected from the group consisting of. The method of claim 1, The skin whitening is a cosmetic composition, characterized in that performed by inhibiting the production of melanin pigment. The method of claim 1, The skin whitening is a cosmetic composition, characterized in that performed by inhibiting tyrosinase gene expression. A pharmaceutical composition for the treatment and prevention of skin pigmentation diseases containing evening primrose seed oil saponification. The method of claim 6, The skin pigmentation disease occurs locally on the skin with an increased synthesis of melanin pigment and is selected from blemishes, freckles, black spots, birthmarks, drug pigmentation, pigmentation after inflammation, and hyperpigmentation occurring in dermatitis Pharmaceutical composition, characterized in that at least one disease. The method of claim 6, The saponified drug composition, characterized in that 0.001 to 99.9 parts by weight relative to the total weight of the composition. The method of claim 6, Pharmaceutical composition, characterized in that it further comprises a pharmaceutically acceptable carrier, excipient, diluent or mixture thereof. The method of claim 6, The pharmaceutical composition, characterized in that the treatment and prevention of the skin pigmentation disease is carried out by inhibiting the production of melanin pigment. The method of claim 6, The treatment and prevention of the skin pigmentation disease is a pharmaceutical composition, characterized in that performed by the inhibition of user expression of tyrosinase enzyme. The method according to any one of claims 6 to 8, The composition is a pharmaceutical composition, characterized in that the formulation of any one selected from creams, gels, patches, sprays, ointments, warnings, lotions, linings, pasta, and cataplasma. A composition for inhibiting tyrosinase activity containing evening primrose seed saponification as an active ingredient. Composition for inhibiting tyrosinase gene expression containing evening primrose seed saponification as an active ingredient.

Images