WO2011025904A1 - Bispecific immunocytokine dock-and-lock (dnl) complexes and therapeutic use thereof - Google Patents
Bispecific immunocytokine dock-and-lock (dnl) complexes and therapeutic use thereof Download PDFInfo
- Publication number
- WO2011025904A1 WO2011025904A1 PCT/US2010/046889 US2010046889W WO2011025904A1 WO 2011025904 A1 WO2011025904 A1 WO 2011025904A1 US 2010046889 W US2010046889 W US 2010046889W WO 2011025904 A1 WO2011025904 A1 WO 2011025904A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- antibody
- cancer
- mab
- dnl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/06—Antipsoriatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
- A61P21/02—Muscle relaxants, e.g. for tetanus or cramps
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
- A61P21/04—Drugs for disorders of the muscular or neuromuscular system for myasthenia gravis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/14—Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/24—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
- C07K16/249—Interferons
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2833—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against MHC-molecules, e.g. HLA-molecules
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2887—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD20
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/55—Fab or Fab'
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
- C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
- C07K2317/734—Complement-dependent cytotoxicity [CDC]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/30—Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
Definitions
- the present invention relates to compositions and methods of use of bispecific antibody immunocytokine DNL constructs, comprising first and second antibodies or antigen-binding antibody fragments and one or more copies of a cytokine. More generally, the present invention relates to compositions and methods of use of any DNL construct in which three different effector moieties are joined together using the DDD (dimerization and docking domain) and AD (anchoring domain) conjugation technique described below.
- the first and second antibodies or fragments thereof preferably bind to two different target antigens.
- the bispecific immunocytokine DNL construct comprising a therapeutic cytokine
- the bispecific immunocytokine constructs show greater potency against target cells than the parent antibodies alone, the cytokine alone, a non-conjugated combination of antibodies and cytokine or cytokine conjugated to control antibodies.
- the DNL construct may comprise interferon- ⁇ 2b linked to an anti-CD20 IgG and anti-HLA-DR Fab.
- the anti-CD20 IgG is veltuzumab and the anti-HLA-DR Fab is derived from a humanized L243 antibody.
- the DNL complex exhibits high toxicity for human lymphoma cells, multiple myeloma cells and other hematopoietic cancers in vitro and in vivo.
- the subject DNL complexes may comprise any combination of antibodies or antibody fragments, with specificity against target antigens that may be expressed by any tumor, autoimmune disease cell or other diseased cell.
- the subject DNL complexes may be utilized for delivery of any therapeutic cytokine for treatment of a wide variety of diseases, such as cancer, immune dysfunction or autoimmune disease.
- the subject bispecific complexes are not limited to delivery of cytokines, but may provide highly efficacious delivery of any therapeutic protein, peptide or other therapeutic effector moiety known in the art.
- NHL non-Hodgkin lymphoma
- interferon-alpha The clinical activity of interferon-alpha (IFN ⁇ ) is established in NHL therapy (Armitage et al., Bone Marrow Transplant 2006;38:701-2; Ann Oncol 2000;l 1 :359-61), and the addition of IFN ⁇ to rituximab immunotherapy has shown some clinical advantage (Davis et al., Clin Cancer Res 2000;6:2644-52; Kimby et al., Leuk Lymphoma 2008;49:lQ2-12). Available data suggest that progression- free survival of MM patients is improved with IFN ⁇ , but the benefit is small and its use remains controversial because of toxicity (Gisslinger and Kees, Wien Klin Klin Klin Klin Klinschr 2003 ;115:451-61).
- Interferon- ⁇ has been reported to have anti-tumor activity in both animal models of cancer (Ferrantini et al., 1994, J Immunol 153:4604-15) and human cancer patients (Gutterman et al., 1980, Ann Intern Med 93:399-406).
- IFN ⁇ can exert a variety of direct anti-tumor effects, including down-regulation of oncogenes, up-regulation of tumor suppressors, enhancement of immune recognition via increased expression of tumor surface MHC class I proteins, potentiation of apoptosis, and sensitization to chemotherapeutic agents (Gutterman et al., 1994, PNAS USA 91 :1198-205; Matarrese et al., 2002, Am J Pathol 160:1507-20; Mecchia et al., 2000, Gene Ther 7:167-79; Sabaawy et al., 1999, Int J Oncol 14:1143-51; Takaoka et al, 2003, Nature 424:516-23).
- IFN ⁇ can have a direct and potent antiproliferative effect through activation of STATl (Grimley et al., 1998 Blood 91 :3017-27). Indirectly, IFN ⁇ can inhibit angiogenesis (Sidky and Borden, 1987, Cancer Res 47:5155-61) and stimulate host immune cells, which may be vital to the overall antitumor response but has been largely underappreciated (Belardelli et al., 1996, Immunol Today 17:369-72).
- IFN ⁇ has a pleiotropic influence on immune responses through effects on myeloid cells (Raefsky et al, 1985, J Immunol 135:2507-12; Luft et al, 1998, J Immunol 161 :1947-53), T-cells (Carrero et al, 2006, J Exp Med 203:933-40; Pilling et al., 1999, Eur J Immuol 29:1041-50), and B-cells (Le et al, 2001, Immunity 14:461-70).
- IFN ⁇ induces the rapid differentiation and activation of dendritic cells (Belardelli et al, 2004, Cancer Res 64:6827-30; Paquette et al., 1998, J Leukoc biol 64:358-67; Santini et al., 2000, J Exp med 191 :1777-88) and enhances the cytotoxicity, migration, cytokine production and antibody-dependent cellular cytotoxicity (ADCC) of NK cells (Biron et al., 1999, Annu Rev Immunol 17:189-220; Brunda et al. 1984, Cancer Res 44:597-601).
- ADCC antibody-dependent cellular cytotoxicity
- IFN ⁇ As a cancer therapeutic has been hindered primarily due to its short circulating half-life and systemic toxicity. PEGylated forms of IFN ⁇ 2 display increased circulation time, which augments their biological efficacy (Harris and Chess, 2003, Nat Rev Drug Discov 2:214-21; Osborn et al., 2002, J Pharmacol Exp Ther 303:540-8). Fusion of IFN ⁇ to a monoclonal antibody (MAb) can provide similar benefits as PEGylation, including reduced renal clearance, improved solubility and stability, and markedly increased circulating half-life. The immediate clinical benefit of this is the requirement for less frequent and lower doses, allowing prolonged therapeutic concentrations.
- MAb monoclonal antibody
- TAA tumor-associated antigen
- CD20 is an attractive candidate TAA for the therapy of B-cell lymphomas using MAb-IFN ⁇ .
- Anti-CD20 immunotherapy with rituximab is one of the most successful therapies against lymphoma, with relatively low toxicity (McLaughlin et al., 1998, J Clin Oncol 16:2825-33). Since rituximab is a chimeric antibody that can show immunogenicity in some patient populations and has considerably long infusion times for the initial
- CD20- targeting is the humanized MAb, veltuzumab (Stein et al., 2004, Clin Cancer Res 10:2868- 78).
- An antibody-IFN ⁇ conjugate could allow the less frequent administration of a single agent at a lower dose, limit or eliminate side effects, and may result in far superior efficacy.
- lymphomas and leukemias that express little or no CD2Q are expected to be resistant to therapy with an immunoconjugated anti-CD20-IFN ⁇ construct.
- HLA-DR human leukocyte antigen-DR
- MHC major histocompatibilty complex
- HLA-DR is also expressed on a subset of normal immune cells, including B cells, monocytes/macrophages, Langerhans cells, dendritic cells, and activated T cells (Dechant et al., 2003, Semin Oncol 30:465-75).
- the present invention concerns compositions and methods of use of dock-and-lock (DNL) constructs (complexes) comprising three or more different effector moieties, such as antibodies, antibody fragments and cytokines.
- DNL constructs are not so limited and the effector moieties of use may comprise any protein, peptide or other molecule that may be attached to a DDD or AD moiety.
- Effector moieties of use in DNL constructs include but are not limited to proteins, peptides, antibodies, antibody fragments, immunomodulators, cytokines, hormones, enzymes, antisense oligonucleotides such as siRNA, toxins such as ribonucleases, xenoantigens, polyethylene glycol (PEG) and other polymers, anti-angiogenic agents, cytotoxic agents, pro- apoptosis agents and other known therapeutic agents.
- Preferred embodiments concern DNL constructs comprising three different effector moieties - first and second antibodies or antibody fragments and one or more copies of a cytokine.
- the DNL construct comprises an anti-CD20 antibody, such as veltuzumab, an anti-HLA-DR antibody fragment, such as hL243, and a cytokine, such as IFN- ⁇ 2b.
- an anti-CD20 antibody such as veltuzumab
- an anti-HLA-DR antibody fragment such as hL243
- a cytokine such as IFN- ⁇ 2b.
- Such DNL constructs are highly efficacious for therapy of hematopoietic and other tumors that express CD20, HLA-DR, or both.
- each component of the multifunctional complex (veltuzumab, anti-HLA-DR Fab , and IFN- ⁇ 2b) has anti-tumor activity independently, the combined construct shows greater efficacy than any individual component, or the sum of the individual components administered in unconjugated form.
- the DNL construct may comprise a humanized anti-HLA- DR antibody or fragment thereof, such as an hL243 antibody comprising the heavy chain CDR sequences CDRl (NYGMN, SEQ ID NO:1), CDR2 (WINTYTREPTYADDFKG, SEQ ID NO:2) and CDR3 (DITAVVPTGFDY, SEQ ID NO:3) and the light chain CDR sequences CDRl (RASENIYSNLA, SEQ ID NO:4), CDR2 (AASNLAD, SEQ ID NO:5), and CDR3 (QHFWTTPWA, SEQ ID NO:6), attached to human antibody framework (FR) and constant region sequences (see, e.g., U.S. Patent No.
- a humanized L243 antibody may further comprise one or more of framework residues 27, 38, 46, 68 and 91 substituted from the murine L243 (mL243) heavy chain and/or one or more of framework residues 37, 39, 48 and 49 substituted from the mL243 light chain.
- the mL243 may be obtained at the American Type Culture Collection, Rockville, MD, (see Accession number ATCC HB55).
- the DNL construct may comprise a humanized anti- CD20 antibody or fragment thereof, such as veltuzumab, comprising light chain variable region CDRl (RASSSVSYIH, SEQ ID NO:7); CDR2 (ATSNLAS, SEQ ID NO:8); and CDR3 (QQWTSNPPT, SEQ ID NO:9); and heavy chain variable region CDRl (SYNMH, SEQ ID NO:10); CDR2 (AIYPGNGDTSYNQKFKG, SEQ ID NO:11); and CDR3 (STYYGGDWYFDV or VVYYSNSYWYFDV, SEQ ID NO:12) (see, e.g., U.S. Patent No. 7,435,803, the Examples section of which is incorporated herein by reference.
- veltuzumab comprising light chain variable region CDRl (RASSSVSYIH, SEQ ID NO:7); CDR2 (ATSNLAS, SEQ ID NO:8); and CDR3 (
- the DNL construct may comprise a human IFN- ⁇ 2b amino acid sequence.
- Clones comprising such sequences are commercially available from a variety of sources, such as a full length human IFN ⁇ 2b cDNA clone (Ultimate ORF human clone cat# HORFOlClone ID IOH35221, Invitrogen, Carlsbad, CA).
- the DNL constructs may comprise one or more antibodies or fragments thereof which bind to an antigen antigen other than CD20 and/or HLA-DR.
- the antigen(s) may be selected from the group consisting of carbonic anhydrase IX, CCCL19, CCCL21, CSAp, CDl, CDIa, CD2, CD3, CD4, CD5, CD8, CDl IA, CD14, CD15, CD16, CD18, CD19, IGF-IR, CD20, CD21, CD22, CD23, CD25, CD29, CD30, CD32b, CD33, CD37, CD38, CD40, CD40L, CD45, CD46, CD52, CD54, CD55, CD59, CD64, CD66a-e, CD67, CD70, CD74, CD79a, CD80, CD83, CD95, CD126, CD133, CD 138, CD 147, CD 154, AFP, PSMA, CEACAM5, CEACAM-6, B
- Exemplary antibodies that may be utilized include, but are not limited to, hRl (anti- IGF-IR, U.S. Patent Application Serial No. 12/722,645, filed 3/12/10) hPAM4 (anti-mucin, U.S. Patent No. 7,282,567), hA20 (anti-CD20, U.S. Patent No. 7,251,164), hA19 (anti-CD 19, U.S. Patent No. 7,109,304), MMMU31 (anti-AFP, U.S. Patent No. 7,300,655), hLLl (anti- CD74, U.S. Patent No. 7,312,318), hLL2 (anti-CD22, U.S. Patent No.
- Exemplary cytokines that may be incorporated into the DNL constructs include but are not limited to MIF (macrophage migration inhibitory factor), HMGB-I (high mobility group box protein 1), TNF- ⁇ , IL-I, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-IO, IL- 11, IL-12, IL-13, IL-15, IL-16, IL-17, IL-18, IL-19, IL-23, IL-24, CCL19, CCL21, IL-8, MCP-I, RANTES, MIP-IA, MIP-IB, ENA-78, MCP-I, IP-IO, Gro- ⁇ , Eotaxin, interferon- ⁇ , - ⁇ , - ⁇ , G-CSF, GM-CSF, SCF, PDGF, MSF, Flt-3 ligand, erythropoietin, thrombopoi
- Various embodiments may concern use of the subject DNL constructs to treat or diagnose a disease, including but not limited to non-Hodgkin's lymphomas, B cell acute and chronic lymphoid leukemias, Burkitt lymphoma, Hodgkin's lymphoma, hairy cell leukemia, acute and chronic myeloid leukemias, T cell lymphomas and leukemias, multiple myeloma, glioma, Waldenstrom's macro globulinemia, carcinomas, melanomas, sarcomas, gliomas, and skin cancers.
- the carcinomas may be selected from the group consisting of carcinomas of the oral cavity, gastrointestinal tract, pulmonary tract, lung, breast, ovary, prostate, uterus, endometrium, cervix, urinary bladder, pancreas, bone, liver, gall bladder, kidney, skin, and testes.
- the subject DNL constructs may be used to treat an autoimmune disease, for example acute idiopathic thrombocytopenic purpura, chronic idiopathic thrombocytopenic purpura, dermatomyositis, Sydenham's chorea, myasthenia gravis, systemic lupus
- erythematosus erythematosus, lupus nephritis, rheumatic fever, polyglandular syndromes, bullous pemphigoid, diabetes mellitus, Henoch-Schonlein purpura, post-streptococcal nephritis, erythema nodosum, Takayasu's arteritis, Addison's disease, rheumatoid arthritis, multiple sclerosis, sarcoidosis, ulcerative colitis, erythema multiforme, IgA nephropathy, polyarteritis nodosa, ankylosing spondylitis, Goodpasture's syndrome, thromboangitis obliterans,
- the subject antibodies may be used to treat leukemia, such as chronic lymphocytic leukemia, acute lymphocytic leukemia, chronic myeloid leukemia or acute myeloid leukemia.
- a pharmaceutical composition of the present invention may be use to treat a subject having a metabolic disease, such amyloidosis, or a neurodegenerative disease, such as Alzheimer's disease.
- a pharmaceutical composition of the present invention may be use to treat a subject having an immune-dysregulatory disorder.
- FIG. 1 shows in vitro IFN ⁇ activity in a cytokine-MAb DNL construct compared to PEGylated or native IFN ⁇ . Specific activities (IU/pmol) measured as described in the Examples. The activity of known concentrations of each test article was extrapolated from a rhIFN ⁇ 2b standard curve. Cultures were grown in the presence of increasing concentrations of 20-2b (•), 734-2b ( ⁇ ), v-mab (O), v-mab + 734-2b (D), PEGASYS (T), PEG-Intron (A) or lR-2b (V) and the relative viable cell densities were measured with MTS. The % of the signal obtained from untreated cells was plotted vs.
- FIG. 2 shows the results of pharmacokinetic analyses in Swiss- Webster mice. Mice were administered 20-2b, ⁇ 2b-413, PEGINTRON or PEGASYS and serum samples were analyzed for IFNoc2b concentration by ELISA over 96 hours. Serum elimination curves are shown. Serum half-life (Ti /2 ) elimination rates and mean residence times (MRT) are summarized in the inserted table.
- FIG. 3 illustrates ADCC effector functions of 20-2b. Daudi or Raj i cells were incubated with 20-2b, 22-2b, v-mab, epratuzumab (e-mab), or h734 at 5 ⁇ g/ml in the presence of freshly isolated PBMCs for 4 h before quantification of cell lysis.
- B shows CDC effector functions of 20-2B. Daudi cells were incubated with serial dilutions of 20-2b (•), 734-2b ( ⁇ ) or v-mab (O) in the presence of human complement. The % complement control (number of viable cells in the test sample compared to cells treated with complement only) was plotted vs. the log of the nM concentration. Error bars, SD.
- FIG. 4 shows enhanced depletion of NHL cells from whole blood by 20-2b.
- Fresh heparinized human blood was mixed with either Daudi or Ramos and incubated with 20-2b (•), v-mab (O), 734-2b ( ⁇ ) or v-mab + 734-2b (D) at 0.01, 0.1 or 1 nM for two days.
- the effect of the indicated treatments on lymphoma and peripheral blood lymphocytes was evaluated using flow cytometry. Error bars, SD.
- FIG. 5 (A) illustrates survival curves showing therapeutic efficacy of 20-2b in a disseminated Burkitt's lymphoma (Daudi) xenograft model.
- Female CB. 17 SCID mice were administered Daudi cells i.v. on day 0.
- Treatments consisted of 20-2b (•), 734-2b ( ⁇ ), v- mab (O), PEGASYS (T) or saline (X) given as a single s.c. doses. Days of treatment are indicated with arrows. Survival curves were analyzed using Prism software.
- In an Early Daudi model Groups of 10 mice were given a single dose of 0.7 pmol (solid line) or 0.07 pmol (dashed line) on day 1.
- FIG. 6(B) shows a similar study to FIG. 6(A), but in an Advanced Daudi model.
- Groups of 10 mice were given a single dose of 0.7 pmol (solid line), 7 pmol (dashed line) or 70 pmol (gray line) on day 7.
- FIG. 6 (A) presents survival curves showing therapeutic efficacy of 20-2b in disseminated Burkitt's lymphoma (Raji and NAMALWA) xenograft models.
- Female CB. 17 SCID mice were administered NHL cells i.v. on day 0.
- Treatments consisted of 20-2b (•), 734-2b ( ⁇ ), v-mab (O) or saline (X) given as s.c. doses. Days of treatment are indicated with arrows. Survival curves were analyzed using Prism software.
- groups of 10 received 250 pmol doses on days 5, 7, 9, 12, 14 and 16.
- (B) shows a similar study to FIG. 7(A), but in an Early NAMALWA model.
- Groups of 6 received 250 pmol doses of 20-2b or 734-2b on days 1, 3, 5, 8, 10 and 12 or 3.5 nmol doses of v-mab on days 1, 5, 9, 13, 17, 21 and 25.
- FIG. 7 shows the results of a cell-based assay for EPO activity using TFl cells that were treated with EPO standard, 734-EPO, or EPO-DDD2 for 72 hours. Dose response curves and EC 50 values were generated using Graph Pad Prism software.
- FIG. 8 Biological activity of 20-C2-2b.
- a and B indirect immunofluorescence showing binding of MAbs and MAb-IFN ⁇ to live NHL cells (Raji or RL). Cells were incubated at 4°C for 1 h in the presence of 5 nM (A) or 0.2 - 50 nM (B) of the indicated construct prior to probing with PE-conjugated goat-anti-human Fc. MFI, mean fluorescence intensity; error bars, 95% CI.
- C IFN ⁇ 2 specific activities determined using a cell-based reporter gene assay shown as IU/pmol of the whole molecule and IU/pmol of IFN ⁇ 2b.
- FIG. 9 Apoptosis in NHL and MM cells. Cells were treated for 48 h before quantification of the % annexin-V-positive cells by flow cytometry.
- A For Daudi: v-mab and hL243 ⁇ 4p were 10 pM; 20-C2-2b, 20-2b-2b and V+L243+2b (a mixture of v-mab, hL243 ⁇ 4p and 734-2b-2b) were 1 pM. For Jeko-1, all treatments were at 0.5 nM.
- CAG was treated at 1, 0.1 and 0.01 nM.
- KMS12-BM was treated at 20 and 2 nM. V+L243, mixture of v-mab and hL243 ⁇ 4p; L243+2b, mixture of hL243 ⁇ 4p and 734-2b-2b.
- FIG. 10 Characterization of multiple myeloma cell lines.
- A Antigen densities of HLA-DR and CD20 on selected myeloma lines. After 30 min incubation with hL243 ⁇ 4p, v- mab or hMN-14 (isotype control MAb), cells were probed with PE-Goat anti-human IgG (Fab) and analyzed by flow cytometry.
- B Relative sensitivity of myeloma lines to IFN ⁇ 2. Cells were incubated in the presence or absence of 3 nM peginterferon alfa-2b for 4 days prior to quantification of viable cells with MTS.
- FIG. 11 In vitro cytotoxicity of multiple myeloma. Indicated cell lines were cultured in the presence of increasing concentrations of the indicated constructs or combinations and the relative viable cell densities were measured with MTS. The % of the signal obtained from untreated cells was plotted vs. the log of the molar concentration. Dose-response curves and EC 50 values were generated using Prism software. Error bars, SD.
- FIG. 12 Enhanced depletion of NHL cells from whole blood. Fresh heparinized human blood was mixed with Daudi and incubated with 1 nM of the indicated Mab-IFN ⁇ or MAb for two days. The effect on Daudi, B cells, T cells, and monocytes was evaluated by flow cytometry. Error bars, SD.
- a “therapeutic agent” is an atom, molecule, or compound that is useful in the treatment of a disease.
- therapeutic agents include antibodies, antibody fragments, peptides, drugs, toxins, enzymes, nucleases, hormones, immunomodulators, antisense oligonucleotides, small interfering RNA (siRNA), chelators, boron compounds, photoactive agents, dyes, and radioisotopes.
- a "diagnostic agent” is an atom, molecule, or compound that is useful in diagnosing a disease.
- useful diagnostic agents include, but are not limited to, radioisotopes, dyes (such as with the biotin-streptavidin complex), contrast agents, fluorescent compounds or molecules, and enhancing agents (e.g., paramagnetic ions) for magnetic resonance imaging (MRI).
- an “antibody” as used herein refers to a full-length (ie, naturally occurring or formed by normal immunoglobulin gene fragment recombinatorial processes) immunoglobulin molecule (eg, an IgG antibody) or an immunologically active (ie, specifically binding) portion of an immunoglobulin molecule, like an antibody fragment.
- An “antibody” includes monoclonal, polyclonal, bispecific, multispecific, murine, chimeric, humanized and human antibodies.
- a "naked antibody” is an antibody or antigen binding fragment thereof that is not attached to a therapeutic or diagnostic agent.
- the Fc portion of an intact naked antibody can provide effector functions, such as complement fixation and ADCC (see, e.g., Markrides, Pharmacol Rev 50:59-87, 1998).
- Other mechanisms by which naked antibodies induce cell death may include apoptosis. (Vaswani and Hamilton, Ann Allergy Asthma Immunol 81 : 105- 119,1998.)
- an “antibody fragment” is a portion of an intact antibody such as F(ab') 2 , Fab', Fab, Fv, sFv, scFv and the like. Regardless of structure, an antibody fragment binds with the same antigen that is recognized by the full-length antibody.
- antibody fragments include isolated fragments consisting of the variable regions, such as the "Fv” fragments consisting of the variable regions of the heavy and light chains or recombinant single chain polypeptide molecules in which light and heavy variable regions are connected by a peptide linker ("scFv proteins").
- Single-chain antibodies consist of a polypeptide chain that comprises both a V H and a V L domain which interact to form an antigen- binding site.
- the V H and V L domains are usually linked by a peptide of 1 to 25 amino acid residues.
- Antibody fragments also include diabodies, triabodies and single domain antibodies (dAb).
- An antibody or immunoconjugate preparation, or a composition described herein is said to be administered in a "therapeutically effective amount” if the amount administered is physiologically significant.
- An agent is physiologically significant if its presence results in a detectable change in the physiology of a recipient subject.
- an antibody preparation is physiologically significant if its presence invokes an antitumor response or mitigates the signs and symptoms of an autoimmune disease state.
- physiologically significant effect could also be the evocation of a humoral and/or cellular immune response in the recipient subject leading to growth inhibition or death of target cells.
- the "dock-and-lock” (DNL) method exploits specific protein/protein interactions that occur between the regulatory (R) subunits of cAMP-dependent protein kinase (PKA) and the anchoring domain (AD) of A-kinase anchoring proteins (AKAPs) (Baillie et al, FEBS Letters. 2005; 579: 3264. Wong and Scott, Nat. Rev. MoI. Cell Biol. 2004; 5: 959).
- PKA which plays a central role in one of the best studied signal transduction pathways triggered by the binding of the second messenger cAMP to the R subunits, was first isolated from rabbit skeletal muscle in 1968 (Walsh et al, J. Biol. Chem.
- the structure of the holoenzyme consists of two catalytic subunits held in an inactive form by the R subunits (Taylor, J. Biol. Chem. 1989;264:8443). Isozymes of PKA are found with two types of R subunits (RI and RII), and each type has ⁇ and ⁇ isoforms (Scott, Pharmacol. Ther.
- R subunits have been isolated only as stable dimers and the dimerization domain has been shown to consist of the first 44 amino-terminal residues (Newlon et al, Nat. Struct. Biol. 1999;6:222). Binding of cAMP to the R subunits leads to the release of active catalytic subunits for a broad spectrum of serine/threonine kinase activities, which are oriented toward selected substrates through the compartmentalization of PKA via its docking with AKAPs (Scott et al, J. Biol. Chem. 1990;265;21561)
- AKAP microtubule-associated protein-2
- the amino acid sequences of the AD are quite varied among individual AKAPs, with the binding affinities reported for RII dimers ranging from 2 to 90 nM (Alto et al, Proc. Natl. Acad. Sci. USA. 2003;100:4445). Interestingly, AKAPs will only bind to dimeric R subunits. For human RIIa, the AD binds to a
- the dimerization domain and AKAP binding domain of human RIIa are both located within the same N-terminal 44 amino acid sequence (Newlon et al, Nat. Struct. Biol. 1999;6:222; Newlon et al, EMBO J. 2001 ;20:1651), which is termed the DDD herein.
- Entity B is constructed by linking an AD sequence to a precursor of B, resulting in a second component hereafter referred to as b.
- the dimeric motif of DDD contained in a 2 will create a docking site for binding to the AD sequence contained in b, thus facilitating a ready association of a 2 and b to form a trimeric complex composed of a 2 b.
- This binding event is made irreversible with a subsequent reaction to covalently secure the two entities via disulfide bridges, which occurs very efficiently based on the principle of effective local concentration because the initial binding interactions should bring the reactive thiol groups placed onto both the DDD and AD into proximity (Chmura et al, Proc. Natl. Acad. Sci. USA.
- the a 2 subunit may contain two identical effector moieties, in preferred embodiments described below the a 2 subunit may comprise two different effector moieties, each attached to an identical DDD sequence.
- the trimeric a 2 b complex may comprise three different effector moieties.
- the immunocytokine DNL constructs may be based on a variation of the a 2 b structure, in which a first and a second effector are attached to DDD moieties and a third effector is attached to an AD moiety.
- Each AD moiety is capable of binding to two DDD moieties in the form of a dimer.
- the effector moiety is a protein or peptide, more preferably an antibody, antibody fragment or cytokine, which can be linked to a DDD or AD moiety to form a fusion protein or peptide.
- fusion proteins include nucleic acid synthesis, hybridization and/or amplification to produce a synthetic double-stranded nucleic acid encoding a fusion protein of interest.
- double-stranded nucleic acids may be inserted into expression vectors for fusion protein production by standard molecular biology techniques (see, e.g. Sambrook et al., Molecular Cloning, A laboratory manual, 2 nd Ed, 1989).
- the AD and/or DDD moiety may be attached to either the N-terminal or C-terminal end of an effector protein or peptide.
- site of attachment of an AD or DDD moiety to an effector moiety may vary, depending on the chemical nature of the effector moiety and the part(s) of the effector moiety involved in its physiological activity.
- attachment of AD or DDD moieties to an antibody or antibody fragment occurs at the C-terminal end of the heavy chain subunit, at the opposite end of the molecule from the antingen-binding site.
- N-terminal attachment to antibodies or antibody fragments may also be utilized while retaining antigen-binding activity.
- Site-specific attachment of a variety of effector moieties may be performed using techniques known in the art, such as the use of bivalent cross-linking reagents and/or other chemical conjugation techniques.
- AD and DDD sequences incorporated into the AD and DDD sequences incorporated into the AD and DDD sequences incorporated into the AD and DDD sequences incorporated into the AD and DDD sequences incorporated into the AD and DDD sequences incorporated into the AD and DDD sequences incorporated into the AD and DDD sequences incorporated into the AD and DDD sequences incorporated into the AD and DDD sequences incorporated into the AD and DDD sequences incorporated into the AD and DDD sequences incorporated into the
- immunocytokine DNL complex comprise the amino acid sequences of DDDl and ADl below.
- the AD and DDD sequences comprise the amino acid sequences of DDD2 and AD2, which are designed to promote disulfide bond formation between the DDD and AD moieties.
- DDDl and DDD2 comprise the DDD sequence of the human RIIa form of protein kinase A.
- the DDD and AD moieties may be based on the DDD sequence of the human RIIa form of protein kinase A and a corresponding AKAP sequence, as exemplified in DDD3, DDD3C and AD3 below.
- DDD moieties based on the known human Rl ⁇ and Rll ⁇ amino acid sequences may be designed and utilized (see, e.g., NCBI Accession Nos. NP_001158233 and NP_002727, sequences below).
- AD and/or DDD moieties may be utilized in construction of the bispecific immunocytokine DNL complexes.
- the structure-function relationships of the AD and DDD domains have been the subject of investigation. (See, e.g., Burns-Hamuro et al., 2005, Protein Sci 14:2982-92; Carr et al., 2001, J Biol Chem 276:17332-38; Alto et al., 2003, Proc Natl Acad Sci USA 100:4445-50; Hundsrucker et al., 2006, Biochem J 396:297-306; Stokka et al., 2006, Biochem J 400:493- 99; Gold et al., 2006, MoI Cell 24:383-95; Kinderman et al., 2006, MoI Cell 24:397-408, the entire text of each of which is incorporated herein by reference.)
- amino acid substitutions are discussed in more detail below, but could involve for example substitution of an aspartate residue for a glutamate residue, or a leucine or valine residue for an isoleucine residue, etc. Such conservative amino acid substitutions are well known in the art.
- Alto et al. (2003) performed a bioinformatic analysis of the AD sequence of various AKAP proteins to design an RII selective AD sequence called AKAP-IS shown below, with a binding constant for DDD of 0.4 nM.
- the AKAP-IS sequence was designed as a peptide antagonist of AKAP binding to PKA. Residues in the AKAP-IS sequence where
- the SuperAKAP-IS sequence may be substituted for the AKAP-IS AD moiety sequence to prepare bispecific immunocytokine DNL constructs.
- Other alternative sequences that might be substituted for the AKAP-IS AD sequence are shown below. Substitutions relative to the AKAP-IS sequence are underlined. It is anticipated that, as with the AKAP-IS sequence, the AD moiety may also include the additional N-terminal residues cysteine and glycine and C- terminal residues glycine and cysteine.
- Figure 2 of Gold et al. disclosed additional DDD-binding sequences from a variety of AKAP proteins, shown below.
- LAWKIAKMIVSDVMQQ (SEQ ID NO:37)
- AKAPIS represents a synthetic RII subunit-binding peptide. All other peptides are derived from the RII-binding domains of the indicated AKAPs.
- AKAP10-pep NTDEAQEELAWKIAKMIVSDIMQQA (SEQ ID NO: 54)
- AKAP12-pep NGILELETKSSKLVQNIIQTAVDQF (SEQ ID NO:56)
- Carr et al. examined the degree of sequence homology between different AKAP-binding DDD sequences from human and non-human proteins and identified residues in the DDD sequences that appeared to be the most highly conserved among different DDD moieties. These are indicated below by underlining with reference to the human PKA RIIa DDD sequence. Residues that were particularly conserved are further indicated by italics. The residues overlap with, but are not identical to those suggested by Kinderman et al. (2006) to be important for binding to AKAP proteins. Thus, a potential DDD sequence is indicated below, wherein "X" represents a conservative amino acid substitution.
- amino acid residues that are highly conserved in the DDD and AD sequences from different proteins are ones that it may be preferred to remain constant in making amino acid substitutions, while residues that are less highly conserved may be more easily varied to produce sequence variants of the AD and/or DDD sequences described herein.
- sequence variants of the DDD and/or AD moieties in certain embodiments it may be preferred to introduce sequence variations in the antibody moiety or the linker peptide sequence joining the antibody with the AD sequence.
- sequence variations in the antibody moiety or the linker peptide sequence joining the antibody with the AD sequence in one illustrative example, three possible variants of fusion protein sequences, are shown below.
- the disclosed methods and compositions may involve production and use of proteins or peptides with one or more substituted amino acid residues.
- the structural, physical and/or therapeutic characteristics of native, chimeric, humanized or human antibodies, or AD or DDD sequences may be optimized by replacing one or more amino acid residues. For example, it is well known in the art that the functional
- FR human framework region
- the therapeutic properties of an antibody such as binding affinity for the target antigen, the dissociation- or off-rate of the antibody from its target antigen, or even the effectiveness of induction of CDC (complement-dependent cytotoxicity) or ADCC (antibody dependent cellular cytotoxicity) by the antibody, may be optimized by a limited number of amino acid substitutions.
- the DDD and/or AD sequences used to make the subject DNL constructs may be further optimized, for example to increase the DDD-AD binding affinity. Potential sequence variations in DDD or AD sequences are discussed above.
- amino acid substitutions typically involve the replacement of an amino acid with another amino acid of relatively similar properties (i.e., conservative amino acid substitutions).
- conservative amino acid substitutions The properties of the various amino acids and effect of amino acid substitution on protein structure and function have been the subject of extensive study and knowledge in the art.
- the hydropathic index of amino acids may be considered (Kyte & Doolittle, 1982, J. MoI. Biol., 157:105-132).
- the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules.
- Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics (Kyte & Doolittle, 1982), these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (- 0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).
- the use of amino acids whose hydropathic indices are within ⁇ 2 is preferred, within ⁇ 1 are more preferred, and within ⁇ 0.5 are even more preferred.
- Amino acid substitution may also take into account the hydrophilicity of the amino acid residue (e.g., U.S. Pat. No. 4,554,101). Hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0); glutamate (+3.0); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 .+-.1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4). Replacement of amino acids with others of similar hydrophilicity is preferred.
- amino acid side chain For example, it would generally not be preferred to replace an amino acid with a compact side chain, such as glycine or serine, with an amino acid with a bulky side chain, e.g., tryptophan or tyrosine.
- a compact side chain such as glycine or serine
- an amino acid with a bulky side chain e.g., tryptophan or tyrosine.
- tryptophan or tyrosine The effect of various amino acid residues on protein secondary structure is also a
- amino acid substitutions include whether or not the residue is located in the interior of a protein or is solvent exposed.
- conservative substitutions would include: Asp and Asn; Ser and Thr; Ser and Ala; Thr and Ala; Ala and GIy; He and Val; Val and Leu; Leu and Ile; Leu and Met; Phe and Tyr; Tyr and Trp.
- conservative substitutions would include: Asp and Asn; Asp and Glu; Glu and GIn; Glu and Ala; GIy and Asn; Ala and Pro; Ala and GIy; Ala and Ser; Ala and Lys; Ser and Thr; Lys and Arg; Val and Leu; Leu and Ile; He and Val; Phe and Tyr.
- an effector moiety may be an immunomodulator.
- An immunomodulator is an agent that when present, alters, suppresses or stimulates the body's immune system.
- Immunomodulators of use may include a cytokine, a stem cell growth factor, a lymphotoxin, a hematopoietic factor, a colony stimulating factor (CSF), an interferon (IFN), erythropoietin, thrombopoietin and a combination thereof.
- lymphotoxins such as tumor necrosis factor (TNF), hematopoietic factors, such as interleukin (IL), colony stimulating factor, such as granulocyte-colony stimulating factor (G-CSF) or granulocyte macrophage-colony stimulating factor (GM-CSF), interferon, such as
- interferons- ⁇ , - ⁇ or - ⁇ interferons- ⁇ , - ⁇ or - ⁇ , and stem cell growth factor, such as that designated "Sl factor”.
- the effector moieties are cytokines, such as lymphokines, monokines, growth factors and traditional polypeptide hormones. Included among the cytokines are growth hormones such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine;
- insulin insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), and luteinizing hormone (LH); placenta growth factor (PlGF), hepatic growth factor; prostaglandin, fibroblast growth factor;
- FSH follicle stimulating hormone
- TSH thyroid stimulating hormone
- LH luteinizing hormone
- PlGF placenta growth factor
- hepatic growth factor prostaglandin, fibroblast growth factor
- prolactin placental lactogen, OB protein; tumor necrosis factor- ⁇ and - ⁇ ; mullerian- inhibiting substance; mouse gonadotropin-associated peptide; inhibin; activin; vascular endothelial growth factor; integrin; thrombopoietin (TPO); nerve growth factors such as NGF- ⁇ ; platelet-growth factor; transforming growth factors (TGFs) such as TGF- ⁇ and TGF- ⁇ ; insulin-like growth factor-I and -II; erythropoietin (EPO); osteoinductive factors;
- interferons such as interferon- ⁇ , - ⁇ , and - ⁇
- colony stimulating factors CSFs
- CSFs colony stimulating factors
- M-CSF colony stimulating factors
- ILs interleukins
- IL-I interleukins
- IL-l ⁇ interleukins
- IL-2 IL-2, IL-3, IL-4, IL-5, IL- 6, IL-7, IL-8, IL-9, IL-IO, IL-I l, IL-12; IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-21, IL- 25, LIF, kit-ligand or FLT-3, angiostatin, thrombospondin, endostatin, tumor necrosis factor (TNF, such as TNF- ⁇ ) and LT.
- CSFs colony stimulating factors
- ILs interleukins
- IL-I interleukins
- IL-I interleukins
- amino acid sequences of protein or peptide immunomodulators are well known in the art and any such known sequences may be used in the practice of the instant invention.
- the skilled artisan is aware of numerous sources of public information on cytokine sequence.
- the NCBI database contains both protein and encoding nucleic acid sequences for a large number of cytokines and immunomodulators, such as erythropoietin (GenBank NM 000799), IL-I beta (GenPept AAH08678), GM-CSF (GenPept AAA52578), TNF- ⁇ (GenPept CAA26669), interferon-alpha (GenPept
- monoclonal antibodies can be obtained by injecting mice with a composition comprising an antigen, removing the spleen to obtain B- lymphocytes, fusing the B-lymphocytes with myeloma cells to produce hybridomas, cloning the hybridomas, selecting positive clones which produce antibodies to the antigen, culturing the clones that produce antibodies to the antigen, and isolating the antibodies from the hybridoma cultures.
- MAbs can be isolated and purified from hybridoma cultures by a variety of well-established techniques. Such isolation techniques include affinity chromatography with Protein-A Sepharose, size-exclusion chromatography, and ion-exchange chromatography. See, for example, Coligan at pages 2.7.1-2.7.12 and pages 2.9.1-2.9.3. Also, see Baines et al, "Purification of Immunoglobulin G (IgG)," in METHODS IN MOLECULAR
- BIOLOGY, VOL. 10, pages 79-104 The Humana Press, Inc. 1992.
- the antibodies can be sequenced and subsequently prepared by recombinant techniques. Humanization and chimerization of murine antibodies and antibody fragments are well known to those skilled in the art. The use of antibody components derived from humanized, chimeric or human antibodies obviates potential problems associated with the immunogenicity of murine constant regions.
- a chimeric antibody is a recombinant protein in which the variable regions of a human antibody have been replaced by the variable regions of, for example, a mouse antibody, including the complementarity-determining regions (CDRs) of the mouse antibody.
- Chimeric antibodies exhibit decreased immunogenicity and increased stability when administered to a subject.
- CDRs complementarity-determining regions
- a chimeric or murine monoclonal antibody may be humanized by transferring the mouse CDRs from the heavy and light variable chains of the mouse immunoglobulin into the
- variable domains of a human antibody The mouse framework regions (FR) in the chimeric monoclonal antibody are also replaced with human FR sequences.
- additional modification might be required in order to restore the original affinity of the murine antibody. This can be accomplished by the replacement of one or more human residues in the FR regions with their murine counterparts to obtain an antibody that possesses good binding affinity to its epitope. See, for example, Tempest et al., Biotechnology 9:266 (1991) and Verhoeyen et al, Science 239: 1534 (1988).
- those human FR amino acid residues that differ from their murine counterparts and are located close to or touching one or more CDR amino acid residues would be candidates for substitution.
- the phage display technique may be used to generate human antibodies (e.g., Dantas-Barbosa et al., 2005, Genet. MoI. Res. 4:126-40).
- Human antibodies may be generated from normal humans or from humans that exhibit a particular disease state, such as cancer (Dantas-Barbosa et al., 2005).
- the advantage to constructing human antibodies from a diseased individual is that the circulating antibody repertoire may be biased towards antibodies against disease-associated antigens.
- Fab fragment antigen binding protein
- RNAs were converted to cDNAs and used to make Fab cDNA libraries using specific primers against the heavy and light chain immunoglobulin sequences (Marks et al., 1991, J MoI. Biol. 222:581-97).
- Library construction was performed according to Andris-Widhopf et al. (2000, In: Phage Display Laboratory Manual, Barbas et al. (eds), 1 st edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY pp. 9.1 to 9.22).
- Fab fragments were digested with restriction endonucleases and inserted into the bacteriophage genome to make the phage display library.
- libraries may be screened by standard phage display methods, as known in the art (see, e.g., Pasqualini and Ruoslahti, 1996, Nature 380:364-366; Pasqualini, 1999, The Quart. J. Nucl. Med. 43:159- 162).
- Phage display can be performed in a variety of formats, for their review, see e.g. Johnson and Chiswell, Current Opinion in Structural Biology 3:5564-571 (1993). Human antibodies may also be generated by in vitro activated B cells. See U.S. Patent Nos.
- transgenic animals that have been genetically engineered to produce human antibodies may be used to generate antibodies against essentially any immunogenic target, using standard immunization protocols.
- Methods for obtaining human antibodies from transgenic mice are disclosed by Green et al, Nature Genet. 7:13 (1994), Lonberg et al, Nature 368:856 (1994), and Taylor et al, Int. Immun. 6:579 (1994).
- a non- limiting example of such a system is the XenoMouse® (e.g., Green et al., 1999, J. Immunol. Methods 231 : 11-23) from Abgenix (Fremont, CA).
- the mouse antibody genes have been inactivated and replaced by functional human antibody genes, while the remainder of the mouse immune system remains intact.
- the XenoMouse® was transformed with germline-coniigured YACs (yeast artificial chromosomes) that contained portions of the human IgH and Igkappa loci, including the majority of the variable region sequences, along accessory genes and regulatory sequences.
- the human variable region repertoire may be used to generate antibody producing B cells, which may be processed into hybridomas by known techniques.
- a XenoMouse® immunized with a target antigen will produce human antibodies by the normal immune response, which may be harvested and/or produced by standard techniques discussed above.
- a variety of strains of XenoMouse® are available, each of which is capable of producing a different class of antibody.
- Transgenically produced human antibodies have been shown to have therapeutic potential, while retaining the pharmacokinetic properties of normal human antibodies (Green et al., 1999).
- the skilled artisan will realize that the claimed compositions and methods are not limited to use of the XenoMouse® system but may utilize any transgenic animal that has been genetically engineered to produce human antibodies.
- Antibody fragments which recognize specific epitopes can be generated by known techniques.
- Antibody fragments are antigen binding portions of an antibody, such as F(ab') 2j Fab', F(ab) 2 , Fab, Fv, sFv and the like.
- F(ab') 2 fragments can be produced by pepsin digestion of the antibody molecule and Fab' fragments can be generated by reducing disulfide bridges of the F(ab') 2 fragments.
- Fab' expression libraries can be constructed (Huse et al., 1989, Science, 246:1274-1281) to allow rapid and easy identification of monoclonal Fab' fragments with the desired specificity.
- F(ab) 2 fragments may be generated by papain digestion of an antibody and Fab fragments obtained by disulfide reduction.
- a single chain Fv molecule comprises a VL domain and a VH domain.
- the VL and VH domains associate to form a target binding site. These two domains are further covalently linked by a peptide linker (L).
- L peptide linker
- DABs single domain antibodies
- An antibody fragment can be prepared by proteolytic hydrolysis of the full length antibody or by expression in E. coli or another host of the DNA coding for the fragment.
- An antibody fragment can be obtained by pepsin or papain digestion of full length antibodies by conventional methods. These methods are described, for example, by Goldenberg, U.S. Patent Nos. 4,036,945 and 4,331 ,647 and references contained therein. Also, see Nisonoff et al, Arch Biochem. Biophys. 89: 230 (1960); Porter, Biochem. J. 73: 1 19 (1959), Edelman et al, in METHODS IN ENZYMOLOGY VOL. 1, page 422 (Academic Press 1967), and Coligan at pages 2.8.1-2.8.10 and 2.10.-2.10.4.
- Antibodies of use may be commercially obtained from a wide variety of known sources.
- a variety of antibody secreting hybridoma lines are available from the American Type Culture Collection (ATCC, Manassas, VA).
- ATCC American Type Culture Collection
- VA Manassas
- a large number of antibodies against various disease targets, including but not limited to tumor-associated antigens, have been deposited at the ATCC and/or have published variable region sequences and are available for use in the claimed methods and compositions. See, e.g., U.S. Patent Nos.
- antibody sequences or antibody- secreting hybridomas against almost any disease-associated antigen may be obtained by a simple search of the ATCC, NCBI and/or USPTO databases for antibodies against a selected disease-associated target of interest.
- the antigen binding domains of the cloned antibodies may be amplified, excised, ligated into an expression vector, transfected into an adapted host cell and used for protein production, using standard techniques well known in the art.
- the antibodies or fragments thereof may be conjugated to one or more therapeutic or diagnostic agents.
- the therapeutic agents do not need to be the same but can be different, e.g. a drug and a radioisotope.
- 131 I can be incorporated into a tyrosine of an antibody or fusion protein and a drug attached to an epsilon amino group of a lysine residue.
- Therapeutic and diagnostic agents also can be attached, for example to reduced SH groups and/or to carbohydrate side chains. Many methods for making covalent or non-covalent conjugates of therapeutic or diagnostic agents with antibodies or fusion proteins are known in the art and any such known method may be utilized.
- a therapeutic or diagnostic agent can be attached at the hinge region of a reduced antibody component via disulfide bond formation.
- such agents can be attached using a heterobifunctional cross-linker, such as iV-succinyl 3-(2-pyridyldithio)propionate (SPDP). Yu et al, Int. J. Cancer 56: 244 (1994).
- SPDP iV-succinyl 3-(2-pyridyldithio)propionate
- the therapeutic or diagnostic agent can be conjugated via a carbohydrate moiety in the Fc region of the antibody.
- the carbohydrate group can be used to increase the loading of the same agent that is bound to a thiol group, or the carbohydrate moiety can be used to bind a different therapeutic or diagnostic agent.
- the general method involves reacting an antibody component having an oxidized carbohydrate portion with a carrier polymer that has at least one free amine function. This reaction results in an initial Schiff base (imine) linkage, which can be stabilized by reduction to a secondary amine to form the final conjugate.
- the Fc region may be absent if the antibody used as the antibody component of the immunoconjugate is an antibody fragment. However, it is possible to introduce a
- carbohydrate moiety into the light chain variable region of a full length antibody or antibody fragment. See, for example, Leung et ah, J. Immunol. 154: 5919 (1995); Hansen et ah, U.S. Patent No. 5,443,953 (1995), Leung et ah, U.S. patent No. 6,254,868, incorporated herein by reference in their entirety.
- the engineered carbohydrate moiety is used to attach the therapeutic or diagnostic agent.
- a chelating agent may be attached to an antibody, antibody fragment or fusion protein and used to chelate a therapeutic or diagnostic agent, such as a radionuclide.
- exemplary chelators include but are not limited to DTPA (such as Mx-DTPA), DOTA, TETA, NETA or NOTA.
- Methods of conjugation and use of chelating agents to attach metals or other ligands to proteins are well known in the art (see, e.g., U.S. Patent Application Serial No. 12/112,289, incorporated herein by reference in its entirety).
- radioactive metals or paramagnetic ions may be attached to proteins or peptides by reaction with a reagent having a long tail, to which may be attached a multiplicity of chelating groups for binding ions.
- a tail can be a polymer such as a polylysine, polysaccharide, or other derivatized or derivatizable chains having pendant groups to which can be bound chelating groups such as, e.g., ethylenediaminetetraacetic acid (EDTA), diethylenetriaminepentaacetic acid (DTPA), porphyrins, polyamines, crown ethers, bis-thiosemicarbazones, polyoximes, and like groups known to be useful for this purpose.
- EDTA ethylenediaminetetraacetic acid
- DTPA diethylenetriaminepentaacetic acid
- porphyrins polyamines, crown ethers, bis-thiosemicarbazones, polyoximes, and like groups known to be useful for
- Chelates may be directly linked to antibodies or peptides, for example as disclosed in U.S. Patent 4,824,659, incorporated herein in its entirety by reference.
- Particularly useful metal-chelate combinations include 2-benzyl-DTPA and its monomethyl and cyclohexyl analogs, used with diagnostic isotopes in the general energy range of 60 to 4,000 keV, such as 125 1, 131 I, 123 1, 124 1, 62 Cu, 64 Cu, 18 F, 111 In, 67 Ga, 68 Ga, 99m Tc, 94m Tc, 11 C, 13 N, 15 0, 76 Br , for radioimaging.
- chelates when complexed with non-radioactive metals, such as manganese, iron and gadolinium are useful for MRI.
- Macrocyclic chelates such as NOTA, DOTA, and TETA are of use with a variety of metals and radiometals, most particularly with radionuclides of gallium, yttrium and copper, respectively.
- metal-chelate complexes can be made very stable by tailoring the ring size to the metal of interest.
- Other ring-type chelates such as macrocyclic polyethers, which are of interest for stably binding nuclides, such as 223 Ra for RAIT are encompassed.
- therapeutic agents such as cytotoxic agents, anti- angiogenic agents, pro-apoptotic agents, antibiotics, hormones, hormone antagonists, chemokines, drugs, prodrugs, toxins, enzymes or other agents may be used, either conjugated to the subject DNL complexes or separately administered before, simultaneously with, or after the antibody.
- Drugs of use may possess a pharmaceutical property selected from the group consisting of antimitotic, antikinase, alkylating, antimetabolite, antibiotic, alkaloid, anti- angiogenic, pro-apoptotic agents and combinations thereof.
- Exemplary drugs of use may include 5-fluorouracil, aplidin, azaribine, anastrozole, anthracyclines, bendamustine, bleomycin, bortezomib, bryostatin-1, busulfan, calicheamycin, camptothecin, carboplatin, 10-hydroxycamptothecin, carmustine, celebrex, chlorambucil, cisplatin (CDDP), Cox-2 inhibitors, irinotecan (CPT-11), SN-38, carboplatin, cladribine, camptothecans, cyclophosphamide, cytarabine, dacarbazine, docetaxel, dactinomycin, daunorubicin, doxorubicin, 2-pyrrolinodoxorubicine (2P-DOX), cyano-morpholino doxorubicin, doxorubicin glucuronide, epirubicin glucuronide,
- epipodophyllotoxin estrogen receptor binding agents, etoposide (VP 16), etoposide glucuronide, etoposide phosphate, floxuridine (FUdR), 3',5'-O-dioleoyl-FudR (FUdR-dO), fludarabine, flutamide, farnesyl-protein transferase inhibitors, gemcitabine, hydroxyurea, idarubicin, ifosfamide, L-asparaginase, lenolidamide, leucovorin, lomustine,
- mitoxantrone mithramycin, mitomycin, mitotane, navelbine, nitrosurea, plicomycin, procarbazine, paclitaxel, pentostatin, PSI-341, raloxifene, semustine, streptozocin, tamoxifen, taxol, temazolomide (an aqueous form of DTIC), transplatinum, thalidomide, thioguanine, thiotepa, teniposide, topotecan, uracil mustard, vinorelbine, vinblastine, vincristine and vinca alkaloids.
- Toxins of use may include ricin, abrin, alpha toxin, saporin, ribonuclease (RNase), e.g., onconase, DNase I, Staphylococcal enterotoxin-A, pokeweed antiviral protein, gelonin, diphtheria toxin, Pseudomonas exotoxin, and Pseudomonas endotoxin.
- RNase ribonuclease
- Chemokines of use may include RANTES, MCAF, MIPl -alpha, MIPl -Beta and IP-10.
- anti-angiogenic agents such as angiostatin, baculostatin, canstatin, maspin, anti-VEGF antibodies, anti-PIGF peptides and antibodies, anti-vascular growth factor antibodies, anti-Flk-1 antibodies, anti-Fit- 1 antibodies and peptides, anti-Kras antibodies, anti-cMET antibodies, anti-MIF (macrophage migration-inhibitory factor) antibodies, laminin peptides, fibronectin peptides, plasminogen activator inhibitors, tissue metalloproteinase inhibitors, interferons, interleukin-12, IP-10, Gro- ⁇ , thrombospondin, 2- methoxyoestradiol, proliferin-related protein, carboxiamidotriazole, CMlOl, Marimastat, pentosan polysulphate, angiopoietin-2, interferon-alpha, herbimycin A, PNU145156E, 16K
- Immunomodulators of use may be selected from a cytokine, a stem cell growth factor, a lymphotoxin, a hematopoietic factor, a colony stimulating factor (CSF), an interferon (IFN), erythropoietin, thrombopoietin and a combination thereof. Specifically useful are
- lymphotoxins such as tumor necrosis factor (TNF), hematopoietic factors, such as interleukin (IL), colony stimulating factor, such as granulocyte-colony stimulating factor (G-CSF) or granulocyte macrophage-colony stimulating factor (GM-CSF), interferon, such as
- interferons- ⁇ , - ⁇ or - ⁇ interferons- ⁇ , - ⁇ or - ⁇ , and stem cell growth factor, such as that designated "Sl factor”.
- cytokines include growth hormones such as human growth hormone, N- methionyl human growth hormone, and bovine growth hormone; parathyroid hormone;
- thyroxine insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), and luteinizing hormone (LH); hepatic growth factor; prostaglandin, fibroblast growth factor; prolactin; placental lactogen, OB protein; tumor necrosis factor- ⁇ and - ⁇ ; mullerian-inhibiting substance; mouse gonadotropin-associated peptide; inhibin; activin; vascular endothelial growth factor;
- FSH follicle stimulating hormone
- TSH thyroid stimulating hormone
- LH luteinizing hormone
- hepatic growth factor prostaglandin, fibroblast growth factor
- prolactin prolactin
- placental lactogen OB protein
- tumor necrosis factor- ⁇ and - ⁇ mullerian-inhibiting substance
- mouse gonadotropin-associated peptide inhibin
- activin vascular endothelial growth factor
- thrombopoietin TPO
- nerve growth factors such as NGF- ⁇ ; platelet-growth factor; transforming growth factors (TGFs) such as TGF- ⁇ and TGF- ⁇ ; insulin-like growth factor-I and -II; erythropoietin (EPO); osteoinductive factors; interferons such as interferon- ⁇ , - ⁇ , and - ⁇ ; colony stimulating factors (CSFs) such as macrophage-CSF (M-CSF); interleukins (ILs) such as IL-I, IL-I ⁇ , IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-IO, IL-I l, IL-12; IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-21, IL-25, LIF, kit-ligand or FLT-3, angiostatin, thrombospond
- Radionuclides of use include, but are not limited to- 111 In, 177 Lu, 212 Bi, 213 Bi, 211 At, 62 Cu, 67 Cu, 90 Y, 125 I, 131 I 5 32 P, 33 P, 47 Sc, 111 Ag, 67 Ga, 142 Pr, 153 Sm, 161 Tb, 166 Dy, 166 Ho, 186 Re, 188 Re, 189 Re, 212 Pb, 223 Ra, 225 Ac, 59 Fe, 75 Se, 77 As, 89 Sr, 99 Mo, 105 Rh, 109 Pd, 143 Pr, 149 Pm, 169 Er, 194 Ir, 198 Au, 199 Au, and 211 Pb.
- the therapeutic radionuclide preferably has a decay-energy in the range of 20 to 6,000 keV, preferably in the ranges 60 to 200 keV for an Auger emitter, 100-2,500 keV for a beta emitter, and 4,000-6,000 keV for an alpha emitter.
- Maximum decay energies of useful beta-particle-emitting nuclides are preferably 20-5,000 keV, more preferably 100-4,000 keV, and most preferably 500-2,500 keV. Also preferred are radionuclides that substantially decay with Auger-emitting particles.
- beta-particle-emitting nuclides are preferably ⁇ l,000 keV, more preferably ⁇ 100 keV, and most preferably ⁇ 70 keV. Also preferred are radionuclides that substantially decay with generation of alpha-particles.
- Such radionuclides include, but are not limited to: Dy-152, At-211, Bi-212, Ra-223, Rn-219, Po-215, Bi-21 1, Ac-225, Fr- 221, At-217, Bi-213 and Fm-255. Decay energies of useful alpha-particle-emitting radionuclides are preferably 2,000-10,000 keV, more preferably 3,000-8,000 keV, and most preferably 4,000-7,000 keV.
- radioisotopes of use include 11 C, 13 N, 15 O, 75 Br, 198 Au, 224 Ac, 126 I, 133 I, 77 Br, 113m In, 95 Ru, 97 Ru, 103 Ru, 105 Ru, 107 Hg, 203 Hg, 121m Te, 122m Te, 12501 Te, 165 Tm, 167 Tm, 168 Tm, 197 Pt, 109 Pd, 105 Rh, 142 Pr, 143 Pr, 161 Tb, 166 Ho, 199 Au, 57 Co, 58 Co, 51 Cr, 59 Fe, 75 Se, 201 Tl, 225 Ac, 76 Br, 169 Yb, and the like.
- Some useful diagnostic nuclides may include 18 F, 52 Fe, 62 Cu, 64 Cu, 67 Cu, 67 Ga, 68 Ga, 86 Y, 89 Zr, 94 Tc, 94111 Tc 5 99111 Tc Or 111 In.
- Therapeutic agents may include a photoactive agent or dye.
- compositions such as fiuorochrome, and other chromogens, or dyes, such as porphyrins sensitive to visible light, have been used to detect and to treat lesions by directing the suitable light to the lesion. In therapy, this has been termed photoradiation, phototherapy, or photodynamic therapy. See Jori et al. (eds.), PHOTOD YNAMIC THERAPY OF TUMORS AND OTHER DISEASES (Libreria Progetto 1985); van den Bergh, Chem. Britain (1986), 22:430. Moreover, monoclonal antibodies have been coupled with photoactivated dyes for achieving phototherapy. See Mew et al, J. Immunol. (1983), 130:1473; idem., Cancer Res. (1985), 45:4380; Oseroff et al., Proc. Natl. Acad. Sci. USA (1986), 83:8744; idem.,
- oligonucleotides especially antisense oligonucleotides that preferably are directed against oncogenes and oncogene products, such as bcl-2 or p53.
- a preferred form of therapeutic oligonucleotide is siRNA.
- Diagnostic agents are preferably selected from the group consisting of a radionuclide, a radiological contrast agent, a paramagnetic ion, a metal, a fluorescent label, a
- diagnostic agents are well known and any such known diagnostic agent may be used.
- diagnostic agents may include a radionuclide such as 110 In, 111 In, 177 Lu, 18 F, 52 Fe, 62 Cu, 64 Cu, 67 Cu, 67 Ga, 68 Ga, 86 Y, 90 Y, 89 Zr, 94m Tc, 94 Tc, 99m Tc, 120 I, 123 1, 124 I, 125 I, 131 I, 154"158 Gd, 32 P, 11 C, 13 N, 15 O, 186 Re, 188 Re, 51 Mn, 52m Mn, 55 Co, 72 As, 75 Br, 76 Br, 82m Rb, 83 Sr, or other gamma-, beta-, or positron-emitters.
- a radionuclide such as 110 In, 111 In, 177 Lu, 18 F, 52 Fe, 62 Cu, 64 Cu, 67 Cu, 67 Ga, 68 Ga, 86 Y, 90 Y, 89 Zr,
- Paramagnetic ions of use may include chromium (III), manganese (II), iron (III), iron (II), cobalt (II), nickel (II), copper (II), neodymium (III), samarium (III), ytterbium (III), gadolinium (III), vanadium (II), terbium (III), dysprosium (III), holmium (III) or erbium (III).
- Metal contrast agents may include lanthanum (III), gold (III), lead (II) or bismuth (III).
- Ultrasound contrast agents may comprise liposomes, such as gas filled liposomes.
- Radiopaque diagnostic agents may be selected from compounds, barium compounds, gallium compounds, and thallium compounds.
- fluorescent labels are known in the art, including but not limited to fluorescein isothiocyanate, rhodamine, phycoerytherin, phycocyanin, allophycocyanin, o- phthaldehyde and fluorescamine.
- Chemiluminescent labels of use may include luminol, isoluminol, an aromatic acridinium ester, an imidazole, an acridinium salt or an oxalate ester.
- Various embodiments concern methods of treating a cancer in a subject, such as a mammal, including humans, domestic or companion pets, such as dogs and cats, comprising administering to the subject a therapeutically effective amount of a bispecific immunocytokine DNL construct.
- immunological diseases which may be treated with the subject DNL constructs may include, for example, joint diseases such as ankylosing spondylitis, juvenile rheumatoid arthritis, rheumatoid arthritis; neurological disease such as multiple sclerosis and myasthenia gravis; pancreatic disease such as diabetes, especially juvenile onset diabetes; gastrointestinal tract disease such as chronic active hepatitis, celiac disease, ulcerative colitis, Crohn's disease, pernicious anemia; skin diseases such as psoriasis or scleroderma; allergic diseases such as asthma and in transplantation related conditions such as graft versus host disease and allograft rejection.
- joint diseases such as ankylosing spondylitis, juvenile rheumatoid arthritis, rheumatoid arthritis
- neurological disease such as multiple sclerosis and myasthenia gravis
- pancreatic disease such as diabetes, especially juvenile onset diabetes
- gastrointestinal tract disease such as chronic active hepatitis,
- the administration of the bispecific immunocytokine DNL constructs can be supplemented by administering concurrently or sequentially a therapeutically effective amount of another antibody that binds to or is reactive with another antigen on the surface of the target cell.
- Preferred additional MAbs comprise at least one humanized, chimeric or human MAb selected from the group consisting of a MAb reactive with CD4, CD5, CD8, CD 14, CD 15, CD16, CD19, IGF-IR, CD20, CD21, CD22, CD23, CD25, CD30, CD32b, CD33, CD37, CD38, CD40, CD40L, CD45, CD46, CD52, CD54, CD70, CD74, CD79a, CD80, CD95, CD126, CD133, CD138, CD154, CEACAM5, CEACAM6, B7, AFP, PSMA, EGP-I, EGP-2, carbonic anhydrase IX, PAM4 antigen, MUCl, MUC2, MUC3, MUC4, MUC5, Ia, MIF
- the DNL construct therapy can be further supplemented with the administration, either concurrently or sequentially, of at least one therapeutic agent.
- at least one therapeutic agent for example, "CVB" (1.5 g/m 2 cyclophosphamide, 200-400 mg/m 2 etoposide, and 150-200 mg/m 2 carmustine) is a regimen used to treat non-Hodgkin's lymphoma. Patti et al, Eur. J. Haematol. 51: 18 (1993).
- Other suitable combination chemotherapeutic regimens are well-known to those of skill in the art.
- first generation chemotherapeutic regimens for treatment of intermediate- grade non-Hodgkin's lymphoma include C-MOPP (cyclophosphamide, vincristine, procarbazine and prednisone) and CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone).
- a useful second generation chemotherapeutic regimen is m-BACOD
- a suitable third generation regimen is MACOP-B (methotrexate, doxorubicin, cyclophosphamide, vincristine, prednisone, bleomycin and leucovorin).
- Additional useful drugs include phenyl butyrate, bendamustine, and bryostatin-1.
- the subject DNL constructs can be formulated according to known methods to prepare pharmaceutically useful compositions, whereby The DNL construct is combined in a mixture with a pharmaceutically suitable excipient.
- a pharmaceutically suitable excipient Sterile phosphate-buffered saline is one example of a pharmaceutically suitable excipient.
- Other suitable excipients are well-known to those in the art. See, for example, Ansel et al, PHARMACEUTICAL DOSAGE FORMS AND DRUG DELIVERY SYSTEMS, 5th Edition (Lea & Febiger 1990), and Gennaro (ed.), REMINGTON'S PHARMACEUTICAL SCIENCES, 18th Edition (Mack Publishing Company 1990), and revised editions thereof.
- the subject DNL constructs can be formulated for intravenous administration via, for example, bolus injection or continuous infusion.
- DNL construct is infused over a period of less than about 4 hours, and more preferably, over a period of less than about 3 hours.
- the first 25-50 mg could be infused within 30 minutes, preferably even 15 min, and the remainder infused over the next 2-3 hrs.
- Formulations for injection can be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
- the compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- the active ingredient can be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
- Control release preparations can be prepared through the use of polymers to complex or adsorb the DNL constructs.
- biocompatible polymers include matrices of poly(ethylene-co-vinyl acetate) and matrices of a polyanhydride copolymer of a stearic acid dimer and sebacic acid. Sherwood et al, Bio/Technology 10: 1446 (1992). The rate of release from such a matrix depends upon the molecular weight of the DNL construct, the amount of DNL construct within the matrix, and the size of dispersed particles. Saltzman et al, Biophys. J.
- the DNL construct may also be administered to a mammal subcutaneously or even by other parenteral routes. Moreover, the administration may be by continuous infusion or by single or multiple boluses. Preferably, the DNL construct is infused over a period of less than about 4 hours, and more preferably, over a period of less than about 3 hours.
- the dosage of an administered DNL construct for humans will vary depending upon such factors as the patient's age, weight, height, sex, general medical condition and previous medical history. It may be desirable to provide the recipient with a dosage of DNL construct that is in the range of from about 1 mg/kg to 25 mg/kg as a single intravenous infusion, although a lower or higher dosage also may be administered as circumstances dictate.
- the dosage may be repeated as needed, for example, once per week for 4-10 weeks, once per week for 8 weeks, or once per week for 4 weeks. It may also be given less frequently, such as every other week for several months, or monthly or quarterly for many months, as needed in a maintenance therapy.
- a DNL construct may be administered as one dosage every 2 or 3 weeks, repeated for a total of at least 3 dosages.
- the construct may be administered twice per week for 4-6 weeks. If the dosage is lowered to approximately 200-300 mg/m 2 (340 mg per dosage for a 1.7-m patient, or 4.9 mg/kg for a 70 kg patient), it may be administered once or even twice weekly for 4 to 10 weeks.
- the dosage schedule may be decreased, namely every 2 or 3 weeks for 2-3 months. It has been determined, however, that even higher doses, such as 20 mg/kg once weekly or once every 2-3 weeks can be administered by slow i.v. infusion, for repeated dosing cycles.
- the dosing schedule can optionally be repeated at other intervals and dosage may be given through various parenteral routes, with appropriate adjustment of the dose and schedule.
- the DNL constructs are of use for therapy of cancer.
- cancers include, but are not limited to, carcinoma, lymphoma, glioblastoma, melanoma, sarcoma, and leukemia, myeloma, or lymphoid malignancies. More particular examples of such cancers are noted below and include: squamous cell cancer (e.g., epithelial squamous cell cancer), Ewing sarcoma, Wilms tumor, astrocytomas, lung cancer including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung and squamous carcinoma of the lung, cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer including gastrointestinal cancer, pancreatic cancer, glioblastoma multiforme, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, hepatocellular carcinoma, neuroendocrine tumors, medullary thyroid cancer, differentiated thyroid carcinoma, breast cancer, ovarian cancer, colon cancer, rectal
- cancer includes primary malignant cells or tumors (e.g., those whose cells have not migrated to sites in the subject's body other than the site of the original malignancy or tumor) and secondary malignant cells or tumors (e.g., those arising from metastasis, the migration of malignant cells or tumor cells to secondary sites that are different from the site of the original tumor).
- primary malignant cells or tumors e.g., those whose cells have not migrated to sites in the subject's body other than the site of the original malignancy or tumor
- secondary malignant cells or tumors e.g., those arising from metastasis, the migration of malignant cells or tumor cells to secondary sites that are different from the site of the original tumor.
- Cancers conducive to treatment methods of the present invention involves cells which express, over-express, or abnormally express IGF-IR.
- cancers or malignancies include, but are not limited to: Acute Childhood Lymphoblastic Leukemia, Acute Lymphoblastic Leukemia, Acute Lymphocytic Leukemia, Acute Myeloid Leukemia, Adrenocortical Carcinoma, Adult (Primary)
- Lymphoma Central Nervous System Lymphoma, Cerebellar Astrocytoma, Cerebral
- Macroglobulinemia Male Breast Cancer, Malignant Mesothelioma, Malignant Thymoma, Medulloblastoma, Melanoma, Mesothelioma, Metastatic Occult Primary Squamous Neck Cancer, Metastatic Primary Squamous Neck Cancer, Metastatic Squamous Neck Cancer, Multiple Myeloma, Multiple Myeloma/Plasma Cell Neoplasm, Myelodysplastic Syndrome, Myelogenous Leukemia, Myeloid Leukemia, Myeloproliferative Disorders, Nasal Cavity and Paranasal Sinus Cancer, Nasopharyngeal Cancer, Neuroblastoma, Non-Hodgkin's
- compositions described and claimed herein may be used to treat malignant or premalignant conditions and to prevent progression to a neoplastic or malignant state, including but not limited to those disorders described above.
- Such uses are indicated in conditions known or suspected of preceding progression to neoplasia or cancer, in particular, where non-neoplastic cell growth consisting of hyperplasia, metaplasia, or most particularly, dysplasia has occurred (for review of such abnormal growth conditions, see Robbins and Angell, Basic Pathology, 2d Ed., W. B. Saunders Co., Philadelphia, pp. 68-79 (1976)).
- Dysplasia is frequently a forerunner of cancer, and is found mainly in the epithelia. It is the most disorderly form of non-neoplastic cell growth, involving a loss in individual cell uniformity and in the architectural orientation of cells. Dysplasia characteristically occurs where there exists chronic irritation or inflammation.
- Dysplastic disorders which can be treated include, but are not limited to, anhidrotic ectodermal dysplasia, anterofacial dysplasia, asphyxiating thoracic dysplasia, atriodigital dysplasia, bronchopulmonary dysplasia, cerebral dysplasia, cervical dysplasia, chondroectodermal dysplasia, cleidocranial dysplasia, congenital ectodermal dysplasia, craniodiaphysial dysplasia, craniocarpotarsal dysplasia, craniometaphysial dysplasia, dentin dysplasia, diaphysial dysplasia, ectodermal dysplasia, enamel dysplasia, encephalo-ophthalmic dysplasia, dysplasia epiphysialis hemimelia, dysplasia epiphysialis multiplex, dysplasia epiphysialis punctata, epi
- pseudoachondroplastic spondyloepiphysial dysplasia retinal dysplasia, septo-optic dysplasia, spondyloepiphysial dysplasia, and ventriculoradial dysplasia.
- Additional pre-neoplastic disorders which can be treated include, but are not limited to, benign dysproliferative disorders (e.g., benign tumors, fibrocystic conditions, tissue hypertrophy, intestinal polyps or adenomas, and esophageal dysplasia), leukoplakia, keratoses, Bowen's disease, Farmer's Skin, solar cheilitis, and solar keratosis.
- benign dysproliferative disorders e.g., benign tumors, fibrocystic conditions, tissue hypertrophy, intestinal polyps or adenomas, and esophageal dysplasia
- leukoplakia keratoses
- Bowen's disease keratoses
- Farmer's Skin Farmer's Skin
- solar cheilitis solar keratosis
- the method of the invention is used to inhibit growth, progression, and/or metastasis of cancers, in particular those listed above.
- Additional hyperproliferative diseases, disorders, and/or conditions include, but are not limited to, progression, and/or metastases of malignancies and related disorders such as leukemia (including acute leukemias (e.g., acute lymphocytic leukemia, acute myelocytic leukemia (including myeloblasts, promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemias (e.g., chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia)), polycythemia vera, lymphomas (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors including, but not limited to, sarcomas and carcinomas such as fibrosarcoma, myxosarcoma, lipos
- lymphangioendotheliosarcoma synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma,
- Still other embodiments may concern DNA sequences comprising a nucleic acid encoding an antibody, antibody fragment, cytokine or constituent fusion protein of a DNL construct.
- Fusion proteins may comprise an antibody or fragment or cytokine attached to, for example, an AD or DDD moiety.
- Various embodiments relate to expression vectors comprising the coding DNA sequences.
- the vectors may contain sequences encoding the light and heavy chain constant regions and the hinge region of a human immunoglobulin to which may be attached chimeric, humanized or human variable region sequences.
- the vectors may additionally contain promoters that express the encoded protein(s) in a selected host cell, enhancers and signal or leader sequences. Vectors that are particularly useful are pdHL2 or GS.
- the light and heavy chain constant regions and hinge region may be from a human EU myeloma immunoglobulin, where optionally at least one of the amino acid in the allotype positions is changed to that found in a different IgGl allotype, and wherein optionally amino acid 253 of the heavy chain of EU based on the EU number system may be replaced with alanine.
- an IgGl sequence may be converted to an IgG4 sequence.
- kits containing components suitable for treating or diagnosing diseased tissue in a patient.
- Exemplary kits may contain one or more DNL constructs as described herein.
- a device capable of delivering the kit components through some other route may be included.
- One type of device, for applications such as parenteral delivery, is a syringe that is used to inject the composition into the body of a subject. Inhalation devices may also be used.
- a therapeutic agent may be provided in the form of a prefilled syringe or autoinjection pen containing a sterile, liquid formulation or lyophilized preparation.
- the kit components may be packaged together or separated into two or more containers.
- the containers may be vials that contain sterile, lyophilized formulations of a composition that are suitable for reconstitution.
- a kit may also contain one or more buffers suitable for reconstitution and/or dilution of other reagents.
- Other containers that may be used include, but are not limited to, a pouch, tray, box, tube, or the like. Kit components may be packaged and maintained sterilely within the containers.
- Another component that can be included is instructions to a person using a kit for its use.
- Fab modules may be produced as fusion proteins containing either a DDD or AD sequence. Independent transgenic cell lines are developed for each fusion protein. Once produced, the modules can be purified if desired or maintained in the cell culture supernatant fluid. Following production, any DDD 2 module can be combined with any AD module to generate a trivalent DNL construct.
- the plasmid vector pdHL2 has been used to produce a number of antibodies and antibody-based constructs. See Gillies et al, J Immunol Methods (1989), 125:191-202;
- the di-cistronic mammalian expression vector directs the synthesis of the heavy and light chains of IgG.
- the vector sequences are mostly identical for many different IgG-pdHL2 constructs, with the only differences existing in the variable domain (VH and VL) sequences.
- VH and VL variable domain sequences.
- these IgG expression vectors can be converted into Fab-DDD or Fab- AD expression vectors.
- Fab-DDD expression vectors To generate Fab-DDD expression vectors, the coding sequences for the hinge, CH2 and CH3 domains of the heavy chain are replaced with a sequence encoding the first 4 residues of the hinge, a 14 residue Gly-Ser linker and the first 44 residues of human RIIa (referred to as DDDl).
- ADl AKAP-IS
- Two shuttle vectors were designed to facilitate the conversion of IgG-pdHL2 vectors to either Fab-DDD 1 or Fab-AD 1 expression vectors, as described below.
- the CHl domain was amplified by PCR using the pdHL2 plasmid vector as a template.
- the left PCR primer consists of the upstream (5') of the CHl domain and a SacII restriction endonuclease site, which is 5' of the CHl coding sequence.
- the right primer consists of the sequence coding for the first 4 residues of the hinge followed by a short linker, with the final two codons comprising a Bam HI restriction site.
- the 410 bp PCR amplimer was cloned into the pGemT PCR cloning vector (Promega, Inc.) and clones were screened for inserts in the T7 (5') orientation.
- the encoded polypeptide sequence is shown below.
- the two oligonucleotides designated RIIAl -44 top and RIIAl -44 bottom, that overlap by 30 base pairs on their 3' ends, were synthesized (Sigma Genosys) and combined to comprise the central 154 base pairs of the 174 bp DDDl sequence.
- the oligonucleotides were annealed and subjected to a primer extension reaction with Taq polymerase.
- the duplex was amplified by PCR using the following primers:
- G4S Bam-Left 5'-GGATCCGGAGGTGGCGGGTCTGGCGGAGGT-S' (SEQ ID NO:68) 1-44 stop Eag Right 5'-CGGCCGTCAAGCGCGAGCTTCTCTCAGGCG-S' (SEQ ID NO:69)
- This amplimer was cloned into pGemT and screened for inserts in the T7 (5') orientation.
- the encoded polypeptide sequence is shown below.
- AKAP-IS Top Two complimentary overlapping oligonucleotides, designated AKAP-IS Top and AKAP-IS Bottom, were synthesized.
- the duplex was amplified by PCR using the following primers:
- a 190 bp fragment encoding the DDDl sequence was excised from pGemT with BamHI and Notl restriction enzymes and then ligated into the same sites in CHl-pGemT to generate the shuttle vector CHl-DDDl-pGemT.
- a 110 bp fragment containing the ADl sequence was excised from pGemT with BamHI and Notl and then ligated into the same sites in CHl-pGemT to generate the shuttle vector CHl-ADl-pGemT.
- CHl-DDDl or CHl-ADl can be incorporated into any IgG construct in the pdHL2 vector.
- the entire heavy chain constant domain is replaced with one of the above constructs by removing the SacII/Eagl restriction fragment (CHl -CH3) from pdHL2 and replacing it with the SacII/Eagl fragment of CHl-DDDl or CHl-ADl, which is excised from the respective pGemT shuttle vector.
- DDD or AD is not restricted to the carboxyl terminal end of CHl.
- a construct was engineered in which the DDDl sequence was attached to the amino terminal end of the VH domain.
- h679-Fd-ADl-pdHL2 is an expression vector for production of h679 Fab with ADl coupled to the carboxyl terminal end of the CHl domain of the Fd via a flexible Gly/Ser peptide spacer composed of 14 amino acid residues.
- a pdHL2-based vector containing the variable domains of h679 was converted to h679-Fd-ADl-pdHL2 by replacement of the SacII/EagI fragment with the CHl-ADl fragment, which was excised from the CHl-ADl- SV3 shuttle vector with SacII and Eagl.
- C-DDD l-Fd-hMN-14-pdHL2 is an expression vector for production of fusion protein C-DDD 1-Fab-hMN- 14, in which DDDl is linked to hMN-14 Fab at the carboxyl terminus of CHl via a flexible peptide spacer.
- the plasmid vector hMN14(I)-pdHL2 which has been used to produce hMN-14 IgG, was converted to C-DDD l-Fd-hMN-14-pdHL2 by digestion with SacII and Eagl restriction endonucleases to remove the CH1-CH3 domains and insertion of the CHl-DDDl fragment, which was excised from the CH1-DDD1-SV3 shuttle vector with SacII and Eagl.
- N-DDD l-Fd-hMN-14-pdHL2 is an expression vector for production of a stable dimer that comprises two copies of a fusion protein N-DDD 1-Fab-hMN- 14, in which DDDl is linked to hMN-14 Fab at the amino terminus of VH via a flexible peptide spacer.
- the expression vector was engineered as follows. The DDDl domain was amplified by PCR using the two primers shown below.
- CHl-C stop Eag 5'- CGGCCGTCAGCAGCTCTTAGGTTTCTTGTC -3' (SEQ ID NO: 78)
- N-DDDl -hMN-14 Fd sequence was excised with Xhol and Eagl restriction enzymes and the 1.28 kb insert fragment was ligated with a vector fragment that was prepared by digestion of C-hMN-14-pdHL2 with those same enzymes.
- the final expression vector is N-DDD l-Fd-hMN-14-pDHL2.
- the 679 antibody binds to an HSG target antigen and may be purified by affinity chromatography.
- the h679-Fd-ADl-pdHL2 vector was linearized by digestion with Sal I restriction endonuclease and transfected into Sp/EEE myeloma cells by electroporation.
- the di-cistronic expression vector directs the synthesis and secretion of both h679 kappa light chain and h679 Fd-ADl, which combine to form h679 Fab-ADl.
- the cells were plated in 96-well tissue culture plates and transfectant clones were selected with 0.05 ⁇ M methotrexate (MTX).
- MTX methotrexate
- Clones were screened for protein expression by ELISA using microtitre plates coated with a BSA- IMP-260 (HSG) conjugate and detection with HRP-conjugated goat anti-human Fab.
- HSG BSA- IMP-260
- HRP-conjugated goat anti-human Fab HRP-conjugated goat anti-human Fab.
- BIAcore analysis using an HSG (IMP-239) sensorchip was used to determine the productivity by measuring the initial slope obtained from injection of diluted media samples. The highest producing clone had an initial productivity of approximately 30 mg/L.
- a total of 230 mg of h679-Fab-ADl was purified from 4.5 liters of roller bottle culture by single-step IMP-291 affinity chromatography.
- Culture media was concentrated approximately 10-fold by ultrafiltration before loading onto an IMP-291-affigel column.
- the column was washed to baseline with PBS and h679-Fab- ADl was eluted with 1 M imidazole, 1 mM EDTA, 0.1 M NaAc, pH 4.5.
- SE-HPLC analysis of the eluate showed a single sharp peak with a retention time (9.63 min) consistent with a 50 kDa protein (not shown). Only two bands, which represent the polypeptide constituents of h679-ADl, were evident by reducing SDS-PAGE analysis (not shown).
- C-DDD l-Fd-hMN-14-pdHL2 and N-DDD l-Fd-hMN-14-pdHL2 vectors were transfected into Sp2/0-derived myeloma cells by electroporation.
- C-DDD 1-Fd-hMN- 14- pdHL2 is a di-cistronic expression vector, which directs the synthesis and secretion of both hMN-14 kappa light chain and hMN-14 Fd-DDDl, which combine to form C-DDD 1-hMN- 14 Fab.
- N-DDD l-hMN-14-pdHL2 is a di-cistronic expression vector, which directs the synthesis and secretion of both hMN-14 kappa light chain and N-DDD 1-Fd-hMN- 14, which combine to form N-DDD 1-Fab-hMN- 14.
- Each fusion protein forms a stable homodimer via the interaction of the DDDl domain.
- Clones were screened for protein expression by ELISA using microtitre plates coated with WI2 (a rat anti-id monoclonal antibody to hMN-14) and detection with HRP-conjugated goat anti-human Fab.
- WI2 a rat anti-id monoclonal antibody to hMN-14
- HRP-conjugated goat anti-human Fab The initial productivity of the highest producing C-DDD 1-Fab-hMN 14 Fab and N-DDDl- Fab-hMN14 Fab clones was 60 mg/L and 6 mg/L, respectively.
- ADl-C is a peptide that was made synthetically consisting of the ADl sequence and a carboxyl terminal cysteine residue, which was used to couple the peptide to Affigel following reaction of the sulfhydryl group with chloroacetic anhydride.
- DDD-containing a 2 structures specifically bind to the ADl-C-Affigel resin at neutral pH and can be eluted at low pH (e.g., pH 2.5).
- a total of 81 mg of C-DDD 1-Fab-hMN- 14 was purified from 1.2 liters of roller bottle culture by single-step ADl-C affinity chromatography.
- Culture media was concentrated approximately 10-fold by ultrafiltration before loading onto an ADl-C-affigel column.
- the column was washed to baseline with PBS and C-DDD 1-Fab-hMN- 14 was eluted with 0.1 M Glycine, pH 2.5.
- SE-HPLC analysis of the eluate showed a single protein peak with a retention time (8.7 min) consistent with a 107 kDa protein (not shown).
- the purity was also confirmed by reducing SDS-PAGE, showing only two bands of molecular size expected for the two polypeptide constituents of C-DDD 1-Fab-hMN- 14 (not shown).
- N-DDDl-hMN-14 A total of 10 mg of N-DDDl-hMN-14 was purified from 1.2 liters of roller bottle culture by single-step ADl-C affinity chromatography as described above. SE-HPLC analysis of the eluate showed a single protein peak with a retention time (8.77 min) similar to C-DDD 1-Fab-hMN- 14 and consistent with a 107 kDa protein (not shown). Reducing SDS- PAGE showed only two bands attributed to the polypeptide constituents of N-DDD 1-Fab- hMN- 14 (not shown).
- C-DDD 1-Fab-hMN- 14 The binding activity of C-DDD 1-Fab-hMN- 14 was determined by SE-HPLC analysis of samples in which the test article was mixed with various amounts of WI2.
- a sample prepared by mixing WI2 Fab and C-DDD 1-Fab-hMN- 14 at a molar ratio of 0.75: 1 showed three peaks, which were attributed to unbound C-DDD 1-Fab-hMN 14 (8.71 min), C-DDDl- Fab-hMN-14 bound to one WI2 Fab (7.95 min), and C-DDD 1-Fab-hMN 14 bound to two WI2 Fabs (7.37 min) (not shown).
- a competitive ELISA demonstrated that both C-DDD 1-Fab-hMN- 14 and N-DDDl- Fab-hMN-14 bind to CEA with an avidity similar to hMN-14 IgG, and significantly stronger than monovalent hMN-14 Fab (not shown).
- ELISA plates were coated with a fusion protein containing the epitope (A3B3) of CEA for which hMN-14 is specific.
- BIAcore was used to further demonstrate and characterize the specific interaction between the DDl and ADl fusion proteins.
- the experiments were performed by first allowing either h679-Fab-ADl or 679-Fab-NEM to bind to the surface of a high density HSG-coupled (IMP239) sensorchip, followed by a subsequent injection of C- DDDl-Fab- hMN-14 or hMN-14 F(ab') 2 .
- IMP239 high density HSG-coupled
- Universal affinity purification systems can be developed by production of DDD or AD proteins, which have lower affinity docking.
- the DDD formed by RIa dimers binds AKAP-IS (ADl) with a 500-fold weaker affinity (225 nM) compared to RIIa.
- ADl AKAP-IS
- 225 nM 500-fold weaker affinity
- RIa dimers formed from the first 44 amino acid resides can be produced and coupled to a resin to make an affinity matrix for purification of any ADl -containing fusion protein.
- N-DDD2-hMN-14-pdHL2 is an expression vector for production of N-DDD2-Fab- hMN-14, which possesses a dimerization and docking domain sequence of DDD2 appended to the amino terminus of the Fd.
- the DDD2 is coupled to the V H domain via a 15 amino acid residue Gly/Ser peptide linker.
- DDD2 has a cysteine residue preceding the dimerization and docking sequences, which are identical to those of DDDl .
- the expression vector was engineered as follows. Two overlapping, complimentary oligonucleotides (DDD2 Top and DDD2 Bottom), which comprise residues 1 - 13 of DDD2, were made synthetically. The oligonucleotides were annealed and phosphorylated with T4 polynucleotide kinase (PNK), resulting in overhangs on the 5' and 3' ends that are compatible for ligation with DNA digested with the restriction endonucleases Ncol and Pstl, respectively.
- PNK polynucleotide kinase
- the duplex DNA was ligated with a vector fragment, DDDl-hMN14 Fd-SV3 that was prepared by digestion with Ncol and Pstl, to generate the intermediate construct DDD2- hMN14 Fd-SV3.
- the final expression vector is N-DDD2-Fd-hMN-14- pdHL2.
- C-DDD2-Fd-hMN-14-pdHL2 is an expression vector for production of C-DDD2-Fab- hMN-14, which possesses a dimerization and docking domain sequence of DDD2 appended to the carboxyl terminus of the Fd via a 14 amino acid residue Gly/Ser peptide linker.
- the expression vector was engineered as follows. Two overlapping, complimentary oligonucleotides, which comprise the coding sequence for part of the linker peptide
- GGGGSGGGCG SEQ ID NO:81
- residues 1 - 13 of DDD2 were made synthetically.
- the oligonucleotides were annealed and phosphorylated with T4 PNK, resulting in overhangs on the 5' and 3' ends that are compatible for ligation with DNA digested with the restriction endonucleases BamHI and Pstl, respectively.
- the duplex DNA was ligated with the shuttle vector CHl-DDDl-pGemT, which was prepared by digestion with BamHI and Pstl, to generate the shuttle vector CH1-DDD2- pGemT.
- a 507 bp fragment was excised from CHl-DDD2-pGemT with SacII and Eagl and ligated with the IgG expression vector hMN14(I)-pdHL2, which was prepared by digestion with SacII and Eagl.
- the final expression construct is C-DDD2-Fd-hMN-14-pdHL2. h679-Fd-AD2-pdHL2
- h679-Fd-AD2-pdHL2 is an expression vector for the production of h679-Fab-AD2, which possesses an anchor domain sequence of AD2 appended to the carboxyl terminal end of the CHl domain via a 14 amino acid residue Gly/Ser peptide linker.
- AD2 has one cysteine residue preceding and another one following the anchor domain sequence of ADl.
- duplex DNA was ligated into the shuttle vector CHl-ADl-pGemT, which was prepared by digestion with BamHI and Spel, to generate the shuttle vector CH1-AD2- pGemT.
- a 429 base pair fragment containing CHl and AD2 coding sequences was excised from the shuttle vector with SacII and Eagl restriction enzymes and ligated into h679-pdHL2 vector that prepared by digestion with those same enzymes.
- the final expression vector is h679-Fd-AD2-pdHL2.
- TFl trivalent DNL construct
- N-DDD2-Fab-hMN-14 Protein L-purified
- h679-Fab-AD2 IMP-291- purified
- SE-HPLC did not show any evidence of a 2 b formation (not shown). Instead there were peaks representing a_j (7.97 min; 200 kDa), a 2 (8.91 min; 100 kDa) and B (10.01 min; 50 kDa).
- TF2 was obtained by reacting C-DDD2-Fab-hMN-14 with h679-Fab-AD2.
- a pilot batch of TF2 was generated with >90% yield as follows.
- Protein L-purified C-DDD2-Fab-hMN-14 200 mg was mixed with h679-Fab-AD2 (60 mg) at a 1.4:1 molar ratio.
- the total protein concentration was 1.5 mg/ml in PBS containing 1 mM EDTA.
- Subsequent steps involving TCEP reduction, HIC chromatography, DMSO oxidation, and IMP-291 affinity chromatography were the same as described for TFl.
- TF2 The functionality of TF2 was determined by BIACORE as descibed for TFl .
- TF2 C- DDDl-hMN-14 + h679-ADl (used as a control sample of noncovalent a 2 b complex), or C- DDD2-hMN-14 + h679-AD2 (used as a control sample of unreduced a 2 and b components) were diluted to 1 ⁇ g/ml (total protein) and pass over a sensorchip immoblized with HSG.
- the response for TF2 was approximately two-fold that of the two control samples, indicating that only the h679-Fab-AD component in the control samples would bind to and remains on the sensorchip.
- WI2 IgG injections demonstrated that only TF2 had a DDD-Fab- hMN-14 component that was tightly associated with h679-Fab-AD as indicated by an additional signal response.
- the additional increase of response units resulting from the binding of WI2 to TF2 immobilized on the sensorchip also corresponds to two fully functional binding sites, each contributed by one subunit of C-DDD2-Fab-hMN-14. This was confirmed by the ability of TF2 to bind two Fab fragments of WI2 (not shown).
- the relative CEA-binding avidity of TF2 was determined by competitive ELISA. Plates were coated (0.5 ⁇ g/well) with a fusion protein containing the A3B3 domain of CEA , which is recognized by hMN-14. Serial dilutions of TFl, TF2 and hMN-14 IgG were made in quadruplicate and incubated in wells containing HRP-conjugated hMN-14 IgG (1 nM). The data indicate that TF2 binds CEA with an avidity that is at least equivalent to that of IgG and two-fold stronger than TFl (not shown).
- TFl and TF2 were designed to be stably tethered structures that could be used in vivo where extensive dilution in blood and tissues would occur.
- the stability of TF2 in human sera was assessed using BIACORE.
- TF2 was diluted to 0.1 mg/ml in fresh human serum, which was pooled from four donors, and incubated at 37 0 C under 5% CO 2 for seven days. Daily samples were diluted 1 :25 and then analyzed by BIACORE using an IMP-239 HSG sensorchip. An injection of WI2 IgG was used to quantify the amount of intact and fully active TF2. Serum samples were compared to control samples that were diluted directly from the stock. TF2 is highly stable in serum, retaining 98% of its bispecific binding activity after 7 days (not shown). Similar results were obtained for TFl in either human or mouse serum (not shown).
- the pdHL2 mammalian expression vector has been used to mediate the expression of many recombinant IgGs (Qu et al., Methods 2005, 36:84-95).
- a plasmid shuttle vector was produced to facilitate the conversion of any IgG-pdHL2 vector into a C-H-AD2-IgG-pdHL2 vector.
- the gene for the Fc was amplified using the pdHL2 vector as a template and the oligonucleotides Fc BgIII Left and Fc Bam-Eco RI Right as primers.
- the amplimer was cloned in the pGemT PCR cloning vector.
- the Fc insert fragment was excised from pGemT with Xbal and BamHI restriction enzymes and ligated with AD2- pdHL2 vector that was prepared by digestion of h679-Fab-AD2-pdHL2 with Xbal and BamHI, to generate the shuttle vector Fc-AD2-pdHL2.
- Epratuzumab or hLL2 IgG, is a humanized anti-human CD22 MAb.
- An expression vector for C-H-AD2-hLL2 IgG was generated from hLL2 IgG-pdHL2, as described in Example 11 , and used to transfect Sp2/0 myeloma cells by electroporation. Following transfection, the cells were plated in 96-well plates and transgenic clones were selected in media containing methotrexate.
- Clones were screened for C-H-AD2-hLL2 IgG productivity by a sandwich ELISA using 96-well microtitre plates coated with an hLL2-specific antiidiotype MAb and detection with peroxidase-conjugated anti-human IgG. Clones were expanded to roller bottles for protein production and C-H-AD2-hLL2 IgG was purified from the spent culture media in a single step using Protein-A affinity chromatography. SE-HPLC analysis resolved two protein peaks (not shown). The retention time of the slower eluted peak (8.63 min) was similar to hLL2 IgG. The retention time of the faster eluted peak (7.75 min) was consistent with a -300 kDa protein.
- hA20 IgG is a humanized anti-human CD20 MAb.
- An expression vector for C-H- AD2-hA20 IgG was generated from hA20 IgG-pDHL2, as described in Example 27, and used to transfect Sp2/0 myeloma cells by electroporation. Following transfection, the cells were plated in 96-well plates and transgenic clones were selected in media containing methotrexate. Clones were screened for C-H-AD2-hA20 IgG productivity by a sandwich ELISA using 96-well microtitre plates coated with an hA20-specific anti-idiotype MAb and detection with peroxidase-conjugated anti-human IgG.
- Clones were expanded to roller bottles for protein production and C-H-AD2-hA20 IgG was purified from the spent culture media in a single step using Protein-A affinity chromatography. SE-HPLC and SDS-PAGE analyses gave very similar results to those obtained for C-H-AD2-hLL2 IgG in Example 28.
- IgG or Fab fusion proteins were constructed and incorporated into DNL constructs.
- the fusion proteins retained the antigen-binding characteristics of the parent antibodies and the DNL constructs exhibited the antigen-binding activities of the incorporated antibodies or antibody fragments.
- Example 15 Generation of DDD-module based on Interferon (IFN)- ⁇ 2b
- the cDNA sequence for IFN- ⁇ 2b was amplified by PCR resulting in sequences comprising IFN- ⁇ 2b fused at its C-terminus to a polypeptide of the following sequence:
- the PCR amplimer was cloned into the pGemT vector.
- a DDD2-pdHL2 mammalian expression vector was prepared for ligation with IFN- ⁇ 2b as follows.
- the C H i-DDD2-Fab- hMN-14-pdHL2 (Rossi et al, Proc Natl Acad Sci USA 2006, 103:6841-6) vector was digested with Xba I and Bam HI, which removes all of the Fab gene sequences but leaves the DDD2 coding sequence.
- the IFN- ⁇ 2b amplimer was excised from pGemT with Xba I and Bam HI and ligated into the DDD2-pdHL2 vector to generate the expression vector IFN- ⁇ 2b- DDD2-pdHL2.
- IFN- ⁇ 2b-DDD2-pdHL2 was linearized by digestion with Sal I and stably transfected by electroporation into Sp/ESF myeloma cells. Two clones were found to have detectable levels of IFN- ⁇ 2b by ELISA. One of the two clones, designated 95, was adapted to growth in serum-free media without substantial decrease in productivity. The clone was subsequently amplified with increasing MTX concentrations from 0.1 to 0.8 ⁇ M over five weeks. At this stage, it was sub-cloned by limiting dilution and the highest producing sub-clone (95-5) was expanded. The productivity of 95-5 grown in shake-flasks was estimated to be 2.5 mg/L using commercial rIFN-cc2b (Chemicon IF007, Lot 06008039084) as standards.
- IMAC chromatography
- the product was eluted with 110 mL of 250 mM imidazole, 0.02% Tween 20, 150 mM NaCl, 50 mM NaH 2 PO 4 , pH 7.5. Approximately 6 mg of IFN ⁇ 2b-DDD2 was purified.
- IFN- ⁇ 2b-DDD2 was also expressed by microbial fermentation as a soluble protein in E. coli.
- the coding sequence was amplified by PCR using IFN- ⁇ 2b-DDD2-pdHL2 DNA as a template.
- the amplimer was cloned into the pET26b E. coli expression vector using Nde I and Xho I restriction sites. Protein was expressed intracellularly in BL21pLysS host cells by induction of LB shake flasks with 100 ⁇ M IPTG at 18°C for 12 hours. Soluble IFN- ⁇ 2b- DDD2 was purified from cell lysates by IMAC as described above.
- Example 16 Generation of a DNL conjugate comprising IFN- ⁇ 2b-DDD2 linked to C H3 - AD2-IgG
- a DNL construct designated 20-2b comprising four copies of IFN ⁇ 2b-DDD2 attached to one C H3 -AD2-IgG, was produced by DNL via the combination of two DNL modules, C H3 -AD2-IgG-v-mab and IFN ⁇ 2b-DDD2, which were each expressed in Sp/ESF.
- Additional DNL-generated MAb-IFN ⁇ constructs of similar design as 20-2b (humanized IgGl + 4 IFN ⁇ 2b) but with different targeting MAbs, were used as controls in several experiments: 22-2b has CH 3 -AD2-IgG-e-mab (epratuzumab) as its AD2 module, which is directed against CD22 and binds lymphoma; 734-2b has C H3 -AD2-IgG-h734 as its AD2 module, which is directed against the hapten, In-DTPA and does not bind to any animal proteins or tissues; and Rl -2b uses C H3 -AD2-IgG-hRl, which binds human insulin-like growth factor 1 receptor (IGF-IR).
- IGF-IR insulin-like growth factor 1 receptor
- the 20-2b DNL construct was made as follows. A select C H3 -AD2-IgG was combined with approximately two mole-equivalents of IFN- ⁇ 2b-DDD2 and the mixture was reduced under mild conditions overnight at room temperature after adding 1 mM EDTA and 2 mM reduced glutathione (GSH). Oxidized glutathione was added to 2 mM and the mixture was held at room temperature for an additional 12-24 hours. The DNL conjugate was purified over a Protein A affinity column.
- IFN- ⁇ 2b-DDD2 each showed a major peak having a retention time consistent with a covalent complex composed of an IgG and 4 IFN- ⁇ 2b groups (not shown). Similar SE-HPLC profiles were observed for the other three IFN-IgG conjugates.
- the in vitro IFN ⁇ biological activity of 20-2b was compared to that of commercial PEGylated IFN ⁇ 2 agents, PEGASYS and PEG-Intron, using cell-based reporter, viral protection, and lymphoma proliferation assays. Specific activities were determined using a cell-based kit, which utilizes a transgenic human pro-monocyte cell line carrying a reporter gene fused to an interferon-stimulated response element (FIG. 1A-1D). The specific activity of 20-2b (5300 IU/pmol) was greater than both PEGASYS (170 IU/pmol) and PEG-Intron (3400 IU/pmol) (FIG. IA).
- IFN ⁇ 2b can have a direct antiproliferative or cytotoxic effect on some tumor lines.
- the activity of 20-2b was measured in an in vitro proliferation assay with a Burkitt lymphoma cell line (Daudi) that is highly sensitive to IFN ⁇ (FIG. 1C).
- Daudi Burkitt lymphoma cell line
- the parent anti-CD20 MAb of 20-2b has anti -proliferative activity in vitro on many lymphoma cell lines, including Daudi (Rossi et al., 2008, Cancer Res 68:8384-92), at considerably greater concentrations (EC 5 o>lOnM).
- a combination of the parent anti-CD20 antibody and 734-2b (v-mab+734-2b) was assayed to elucidate whether the increased potency of 20-2b is due to an additive/synergistic effect of CD20 and IFN ⁇ signaling.
- the dose response curve for v-mab+734-2b was largely similar to 734-2b alone, except at >1 nM, where inhibition increased for the former but not the latter.
- IFN ⁇ can potentiate ADCC activity, which is a fundamental mechanism of action (MOA) for anti-CD20 immunotherapy, by activating NK cells and macrophages.
- MOA fundamental mechanism of action
- PBMCs peripheral blood mononuclear cells
- CDC is thought to be an important MOA for Type-I anti-CD20 MAbs (including v- mab and rituximab). However, this function is lacking in the Type-II MAbs, represented by tositumomab (Cardarelli et al., 2002, Cancer Immunol Immunother 51 : 15-24), which nonetheless has anti-lymphoma activity. Unlike v-mab, 20-2b does not show CDC activity in vitro (FIG. 3B). These results are consistent with those for other DNL structures based on the C H3 -AD2-IgG-v-mab module, in which complement fixation is apparently impaired, perhaps by steric interference (Rossi et al., 2008).
- PK pharmacokinetic
- 20-2b The pharmacokinetic (PK) properties of 20-2b were evaluated in male Swiss- Webster mice and compared to those of PEGASYS, PEG-INTRON and ⁇ 2b-413 (Pegylated IFN made by DNL, see U.S. Patent Application Serial No. 11/925,408). Concentrations of IFN- ⁇ in the serum samples at various times were determined by ELISA. IFN ⁇ 2b specific activities were determined using the iLite Human Interferon Alpha Cell-Based Assay Kit following the manufacturer's suggested protocol (PBL Interferon Source).
- FIG. 2 presents the results of the PK analysis, which showed significantly slower elimination and longer serum residence of 20-2b compared to the other agents.
- the calculated pharmacokinetic serum half-life in hours was 8.0 hr (20-2b), 5.7 hr ( ⁇ 2b-413), 4.7 hr
- MRT 0 08 ⁇ (hr) was 22.2 (20-2b), 12.5 ( ⁇ 2b-413), 10.7 (PEGASYS) and 6.0 (PEG- INTRON). Because the pharmacokinetic parameters are determined more by the nature of the complex than the individual antibody or cytokine, it is expected that the PK
- cytokine-DNL complex characteristics of the cytokine-DNL complex are generalizable to other cytokine moieties and antibody moieties and are not limited to the specific 20-2b construct discussed above.
- 20-2b was stable in human sera (>10 days) or whole blood (>6 days) at 37°C (not shown). Concentration of 20-2b complex was determined using a bispecific ELISA assay. There was essentially no detectable change in serum 20-2b levels in either whole blood or serum over the time period of the assay.
- the IFN ⁇ 2b groups of 20-2b and 734-2b can act directly on tumor cells, augment the ADCC activity of v-mab, and possibly have some immunostimulatory effects.
- the full spectrum of IFN ⁇ -mediated activation of the innate and adaptive immune systems that might occur in vivo is not realized in this two-day ex vivo assay.
- a limitation of the mouse model is the very low sensitivity of murine cells to human IFN ⁇ 2b.
- the overall therapeutic advantage of 20-2b that might be achieved in humans can involve the enhancement of both innate and adaptive immunity.
- a single dose of v-mab or 734-2b at 0.7 pmol (170 ng) resulted in significant improvement in survival when compared to saline for v-mab (PO.0001), but not for the irrelevant MAb-IFN ⁇ control, 734-2b (FIG. 5A).
- This improvement was modest, with the median survival time (MST) increasing from 27 days for saline to 34 days for v- mab.
- MST median survival time
- a single dose of 0.7 pmol (170 ng) of 20-2b improved the MST by more than 100 days over both saline control and v-mab groups (PO.0001) (FIG. 5A).
- At the highest dose tested (70 pmol) improved the MST to >105 days with 100% LTS (FIG. 5B).
- Raji has a similar CD20 antigen density to Daudi (Stein et al, 2006, Blood 108:2736-44) and is responsive to v-mab, albeit considerably less so than Daudi (Goldenberg et al., 2009, Blood 113, 1062-70).
- MAb-IFN ⁇ made by chemical conjugation that revealed some of the potential clinical benefits of such constructs (Pelham et al., 1983, Cancer Immunol Immunother 15:210-16; Ozzello et al., 1998, Breast Cancer Res Treat 48:135-47).
- a recombinant MAb-IFN ⁇ comprising murine IFN ⁇ and an anti-HER2/neu MAb exhibited potent inhibition of a transgenic (HER2/neu) murine B-cell lymphoma in immunocompetent mice and was also capable of inducing a protective adaptive immune response with immunologic memory (Huang et al., 2007, J Immunol 179:6881-88).
- lymphoma models that are relatively insensitive to the direct action of IFN ⁇ (Raj i/N AMAL W A) or are resistant to anti-CD20 immunotherapy (NAMALWA), 20- 2b showed superior efficacy to either v-mab or non-targeted MAb-IFN ⁇ .
- 20-2b showed activity at a 25-fold lower concentration compared to non-targeting MAb-IFN ⁇ , either alone or when combined with v-mab.
- the ex vivo setting allows the involvement of all three of the anti-CD20 MOA.
- 20-2b was more effective at depleting lymphoma from blood than IFN ⁇ or v-mab, either alone or in combination, demonstrating the significance of targeting.
- the influence of MAb targeting in the in vitro/ex vivo studies is somewhat surprising, because the MAbs, effector, and target cells are all confined throughout the experiments. We expect that 20-2b will have a substantially greater impact in vivo in human patients.
- the IFN ⁇ 2b and v-mab components of 20-2b can apparently act additively or synergistically, to contribute to its enhanced potency.
- the in vitro proliferation assays suggest at least an additive effect, which was substantiated with the results of the ex vivo studies where the combination of v-mab and 734-2b was superior to either agent alone. This may be accomplished ex vivo via increased ADCC activity of v-mab as part of 20-2b or when combined with 734-2b, yet ADCC is not functional in the in vitro proliferation assays, suggesting additional mechanisms.
- the signal transduced by v-mab-bound CD20 may potentiate the IFN ⁇ signal, resulting in enhanced potency.
- the binding of v- mab which is a slowly internalizing MAb, may prevent the internalization/down-regulation of the Type-I IFN receptors, resulting in a more prolonged and effective IFN ⁇ -induced signal.
- Example 19 Generation of DDD module based on Erythropoeitin (EPO)
- the cDNA sequence for EPO was amplified by PCR resulting in EPO fused at its C- terminus to a polypeptide consisting of:
- PCR amplification was accomplished using a full-length human EPO cDNA clone as a template and the following oligonucleotides as primers:
- the PCR amplimer was cloned into the pGemT vector.
- a DDD2-pdHL2 mammalian expression vector was prepared for ligation with EPO by digestion with Xbal and Bam HI restriction endonucleases.
- the EPO amplimer was excised from pGemT with Xbal and Bam HI and ligated into the DDD2-pdHL2 vector to generate the expression vector EPO-DDD2- pdHL2.
- EPO-pdHL2 was linearized by digestion with Sail enzyme and stably transfected into Sp/ESF myeloma cells by electroporation. Clones were selected with media containing 0.15 ⁇ M MTX. Clones # 41, 49 and 37 each were shown to produce -0.5 mg/L of EPO by an ELISA using Nunc Immobilizer Nickel-Chelate plates to capture the His-tagged fusion protein and detection with anti-EPO antibody. Approximately 2.5 mg of EPO-DDD2 was purified by IMAC from 9.6 liters of serum-free roller bottle culture.
- Example 20 Generation of 734-EPO, a DNL conjugate comprising four EPO-DDD2 moieties linked to C H3 -AD2-IgG-h734
- 734-EPO was produced as described above for 20-2b.
- SE-HPLC analysis of the protein A-purified 734-EPO showed a major peak and a shoulder of a higher molecular size (not shown).
- the retention time of the major peak was consistent with a covalent complex composed of an IgG and 4 EPO groups.
- the shoulder was likely due to a non-covalent dimer of the IgG-EPO conjugate.
- SDS-PAGE analysis with Coomassie blue staining and anti-EPO immunoblot analysis showed that under non-reducing conditions the product had a Mr of >260 kDa (not shown), consistent with the deduced MW of ⁇ 310 kDa.
- the bands representing the three constituent polypeptides of 734-EPO (EPO- DDD2, Heavy chain-AD2, and light chain) were evident and appeared to be similar in quantity (not shown). Non-product contaminants were not detected.
- EPO-DDD2 and 734-EPO were assayed for their ability to stimulate the growth of EPO-responsive TFl cells (ATCC) using recombinant human EPO (Calbiochem) as a positive control.
- TFl cells were grown in RPMI 1640 media supplemented with 20% FBS without GM-CSF supplementation in 96-well plates containing 1 x 10 4 cells/well.
- concentrations (units/ml) of the EPO constructs were determined using a commercial kit (Human erythropoietin ELISA kit, Stem Cell Research, Cat# 01630).
- the cDNA sequence for G-CSF was amplified by PCR, resulting in G-CSF fused at its C-terminus to a polypeptide consisting of SEQ ID NO: 88.
- PCR amplification was accomplished using a full-length human G-CSF cDNA clone (Invitrogen IMAGE human cat# 97002RG Clone ID 5759022) as a template and the following oligonucleotides as primers:
- the PCR amplimer was cloned into the pGemT vector.
- a DDD2-pdHL2 mammalian expression vector was prepared for ligation with G-CSF by digestion with Xbal and Bam HI restriction endonucleases.
- the G-CSF amplimer was excised from pGemT with Xbal and Bam HI and ligated into the DDD2-pdHL2 vector to generate the expression vector G-CSF- DDD2-pdHL2.
- G-CSF-pdHL2 was linearized by digestion with Sal I enzyme and stably transfected into Sp/ESF myeloma cells by electroporation. Clones were selected with media containing 0.15 ⁇ M MTX. Clone # 4 was shown to produce 0.15 mg/L of G-CSF-DDD2 by sandwich ELISA.
- Clone #4 was expanded to 34 roller bottles containing a total of 20 L of Hybridoma SFM with 0.4 ⁇ M MTX and allowed to reach terminal culture. The supernatant fluid was clarified by centrifugation, filtered (0.2 ⁇ M), diafiltered into IX Binding buffer (10 mM Imidazole, 0.5 M NaCl, 50 mM NaH 2 PO 4 , pH 7.5 and concentrated. The concentrate was purified by IMAC.
- G-CSF-DDD2 was also expressed by microbial fermentation as a soluble protein in E. coli.
- the coding sequence was amplified by PCR using G-CSF-DDD2-pdHL2 DNA as a template.
- the amplimer was cloned into the pET26b E. coli expression vector using Nde I and Xho I restriction sites. Protein was expressed intracellularly in BL21pLysS host cells by induction of LB shake flasks with 100 ⁇ M IPTG at 18°C for 12 hours. Soluble G-CSF-DDD2 was purified from cell lysates by IMAC.
- G-CSF-DDD2 module was made by fusing the DDD2 sequence and a peptide spacer at the N-terminus of G-CSF(C 17S), which differs from the wild-type by substituting the unpaired cysteine residue at the 17 th position with a serine.
- N-DDD2-G- CSF(C 17S) was expressed in E. coli and purified by IMAC.
- Example 22 Generation of hRl-17S, a DNL conjugate comprising four N-DDD2-G- CSF(C17S) moieties linked to C H3 -AD2-IgG-hRl.
- hRl-17S was produced by combining C H3 -AD2-IgG-hRl with excess N-DDD2-G- CSF(C 17S) under redox conditions following purification by Protein A affinity
- Example 23 Production and Use of a DNL Construct Comprising Two Different
- 20-2b a monospecific immunocytokine generated by the dock- and-lock (DNL) method to comprise tetrameric IFN- ⁇ 2b covalently linked to veltuzumab, a humanized anti-CD20 mAb, exhibited very potent anti-tumor activity in vitro and in human lymphoma xenografts.
- lymphomas and leukemias that express little or no CD20 are expected to be resistant to therapy with 20-2b.
- HLA-DR is expressed on many hematopoietic tumors and some solid cancers.
- a bispecific immunocytokine that could target IFN- ⁇ to both CD20 and HLA-DR might be a more effective therapeutic against a wide variety of hematopoietic malignancies, including those that express CD20, HLA-DR, or both. Since each component of the multifunctional complex (veltuzumab, anti-HLA-DR F(ab) 2> and IFN- ⁇ 2b) has anti-tumor activity independently, we evaluated if the bispecific immunocytokine can potentially be even more potent than the monospecific immunocytokine, 20-2b.
- 20-C2-2b inhibited each of four lymphoma and eight myeloma cell lines, and was more effective than monospecific CD20-targeted MAb-IFN ⁇ or a mixture comprising the parental antibodies and IFN ⁇ in all but one (HLA-DR7CD20 " ) myeloma line, suggesting that 20-C2-2b should be useful in the treatment of various hematopoietic malignancies.
- the 20-C2-2b displayed greater cytotoxicity against KMS 12- BM (CD20 + /HLA-DR + myeloma) than monospecific MAb-IFN ⁇ that targets only HLA-DR or CD20, indicating that all three components in 20-C2-2b can contribute to toxicity.
- Our findings indicate that a given cell's responsiveness to MAb-IFN ⁇ depends on its sensitivity to IFN ⁇ and the specific antibodies, as well as the expression and density of the targeted antigens.
- 20-C2-2b has antibody-dependent cellular cytotoxicity (ADCC), but not CDC, and can target both CD20 and HLA-DR, it is useful for therapy of a broad range of hematopoietic cancers that express either or both antigens.
- the bispecific immunocytokine appears to be particularly effective in the elimination of the putative cancer stem cells associated with myeloma, which are resistant to current therapy regimens and reportedly express CD20.
- Antibodies and cell culture The abbreviations used in the following discussion are: 20 (C H 3-AD2-IgG-v-mab, anti-CD20 IgG DNL module); C2 (C H l-DDD2-Fab-hL243, anti- HLA-DR Fab 2 DNL module); 2b (dimeric IFN ⁇ 2B-DDD2 DNL module); 734 (anti-in-DTPA IgG DNL module used as non-targeting control).
- the following MAbs were provided by Immunomedics, Inc.: veltuzumab or v-mab (anti-CD20 IgG 1 ), hL243 ⁇ 4p (Immu-114, anti- HLA-DR IgG 4 ), a murine anti-IFN ⁇ MAb, and rat anti-idiotype MAbs to v-mab (WR2) and hL243 (WT).
- Heat-inactivated FBS was obtained from Hyclone (Logan, UT). All other cell culture media and supplements were purchased from Invitrogen Life Technologies (Carlsbad, CA).
- Sp/ESF cells a cell line derived from Sp2/0 with superior growth properties were maintained in Hybridoma Serum-Free Media.
- the NHL and MM cells were grown in RPMI 1640 medium with 10% FBS, 1 mM sodium pyruvate, 10 mM L-glutamine, and 25 mM HEPES.
- Daudi, Ramos, Raji, Jeko-1, NCI-H929, and U266 human lymphoma cell lines were purchased from ATCC (Manassas, VA).
- the sources of MM cell lines are as follows:
- KMSl 1, KMS 12-PE, and KMS 12-BM from Dr. Takemi Otsuki (Kawasaki Medical School, Okayama, Japan); CAG, OPM-6 and MM. IR from Dr. Joshua Epstein (University of Arkansas, Little Rock, AK), Dr. Kenji Oritani (Osaka University, Osaka, Japan) and Dr. Steven Rosen (Northwestern University, Chicago, IL), respectively. All cell lines were authenticated by the supplier, obtained within 6 months of their use and passaged less than 50 times. We did not re-authenticate the cell lines.
- DNL constructs Monospecific MAb-IFN ⁇ (20-2b-2b, 734-2b-2b and C2-2b-2b) and the bispecific HexAb (20-C2-C2) were generated by combination of an IgG-AD2-module with DDD2-modules using the DNL method, as described in the preceding Examples.
- the 734-2b-2b which comprises tetrameric IFN ⁇ 2b and MAb h734 [anti-Indium-DTPA IgG 1 ], was used as a non-targeting control MAb-IFN ⁇ .
- the construction of the mammalian expression vector as well as the subsequent generation of the production clones and the purification of C H 3-AD2-IgG-v-mab are disclosed in the preceding Examples.
- the expressed recombinant fusion protein has the AD2 peptide linked to the carboxyl terminus of the C H 3 domain of v-mab via a 15 amino acid long flexible linker peptide.
- Co-expression of the heavy chain- AD2 and light chain polypeptides results in the formation of an IgG structure equipped with two AD2 peptides.
- the expression vector was transfected into Sp/ESF cells (an engineered cell line of Sp2/0) by electroporation.
- the pdHL2 vector contains the gene for dihydrofolate reductase, thus allowing clonal selection, as well as gene amplification with methotrexate (MTX).
- Stable clones were isolated from 96-well plates selected with media containing 0.2 ⁇ M MTX. Clones were screened for C ⁇ 3-AD2-IgG-vmab productivity via a sandwich ELISA. The module was produced in roller bottle culture with serum-free media.
- the DDD-module, IFN ⁇ 2b-DDD2 was generated as discussed in Example 16 by recombinant fusion of the DDD2 peptide to the carboxyl terminus of human IFN ⁇ 2b via an 18 amino acid long flexible linker peptide. As is the case for all DDD-modules, the expressed fusion protein spontaneously forms a stable homodimer.
- C H l-DDD2-Fab-hL243 expression vector was generated from hL243-IgG-pdHL2 vector by excising the sequence for the C H l-Hinge-C H 2- C H 3 domains with SacII and Eagl restriction enzymes and replacing it with a 507 bp sequence encoding C H 1 -DDD2, which was excised from the C-DDD2-hMN-14-pdHL2 expression vector with the same enzymes.
- the culture broth containing the C H l-DDD2-Fab-hL243 module was applied directly to KappaSelect affinity gel (GE-Healthcare), which was washed to baseline with PBS and eluted with 0.1 M Glycine, pH 2.5.
- KappaSelect affinity gel GE-Healthcare
- the DNL mixture was purified with Protein A (MAbSelect), which binds the C H 3-AD2-IgG-v-mab group and eliminates un-reacted IFN ⁇ 2b-DDD2 or C H l-DDD2-Fab-hL243.
- the Protein A-bound material was further purified by IMAC using His-Select HF Nickel Affinity Gel, which binds specifically to the IFN ⁇ 2b-DDD2 moiety and eliminates any constructs lacking this group.
- the final process step, using an hL243-anti-idiotype affinity gel removed any molecules lacking C H l-DDD2-Fab-hL243.
- affinity chromatography may be used to purify DNL complexes comprising any combination of effector moieties, so long as ligands for each of the three effector moieties can be obtained and attached to the column material.
- the selected DNL construct is the one that binds to each of three columns containing the ligand for each of the three effector moieties and can be eluted after washing to remove unbound complexes.
- the eluate which contained -20 mg protein, was neutralized with 3 M Tris-HCl, pH 8.6 and dialyzed into HisSelect binding buffer (10 mM imidazole, 300 mM NaCl, 50 mM NaH 2 PO 4 , pH 8.0) prior to application to a 5-mL HisSelect IMAC column.
- HisSelect binding buffer 10 mM imidazole, 300 mM NaCl, 50 mM NaH 2 PO 4 , pH 8.0
- the column was washed to baseline with HisSelect binding buffer and eluted with 250 mM imidazole, 150 mM NaCl, 50 mM NaH 2 PO 4 , pH 8.0.
- the IMAC eluate which contained ⁇ 11.5 mg of protein, was applied directly to a WP (anti-hL243) affinity column, which was washed to baseline with PBS and eluted with 0.1 M Glycine, pH 2.5.
- the process resulted in 7 mg of highly purified 20-C2-2b. This was approximately 44% of the theoretical yield of 20-C2-2b, which is 50% of the total starting material (16 mg in this example) with 25% each of 20-2b-2b and 20-C2-C2 produced as side products.
- Electrospray ionization time of flight (ESI-TOF) liquid chromatography/mass spectrometry (LC/MS) was performed with a 1200-series HPLC coupled with a 6210 TOF MS (Agilent Technologies, Santa Clara, CA).
- the 20-C2-2b was reduced with 10 mM tris(2- carboxyethyl)phosphine at 60°C for 30 min and resolved by reversed phase HPLC (RP- HPLC), using a 10-min gradient of 20 - 90% acetonitrile in 0.1% aqueous formic acid with a Poroshell 300 SB, 5 ⁇ m C8 column (Agilent).
- RP- HPLC reversed phase HPLC
- the capillary and fragmentor voltages were set to 5500 and 200 V, respectively.
- IFN ⁇ 2b specific activities were determined using the iLite Human Interferon Alpha Cell-Based Assay Kit (PBL Interferon Source, Piscataway, NJ). Peginterferon alfa-2b (Schering Corp) was used as a positive control.
- In-vitro cytotoxicity Cells were seeded in 48-well plates (300 ⁇ L/well) at predetermined optimal initial densities (1 - 2.5 x 10 5 cells/mL) in the presence of increasing concentrations of the indicated agents and incubated at 37 0 C until the density of untreated cells increased > 10-fold (4 - 7 days). Relative viable cell densities at the end of the assay were determined using a CellTiter 96 Cell Proliferation Assay (Promega, Madison, WI).
- Daudi Ex-vivo depletion of Daudi from whole blood Blood specimens were collected under a protocol approved by the New England Institutional Review Board (Wellesley, MA). Daudi (5 x 10 4 ) cells were mixed with heparinized whole blood (150 ⁇ L) from healthy volunteers and incubated with MAbs or MAb-IFN ⁇ at 1 nM for 2 days at 37 0 C and 5% CO 2 . Cells were stained with FITC-anti-CD19, FITC-anti-CD14, APC-anti-CD3 or APC-mouse IgGi isotype control MAb (BD Biosciences, San Jose, CA) and analyzed by flow cytometry using a FACSCalibur (BD Biosciences). Daudi cells are CDl 9+ and in the monocyte gate. Normal B and T cells are CD 19+ and CD3+ cells, respectively, in the lymphocyte gate. Monocytes are CD 14+ cells in the monocyte gate.
- Non-reducing SDS-PAGE resolved 20-C2-2b (-305 kDa) as a cluster of bands positioned between those of 20-C2-C2 (-365 kDa) and 20-2b-2b (255 kDa).
- Reducing SDS-PAGE resolved the five polypeptides (v-mab HC-AD2, hL243 Fd-DDD2, IFN ⁇ 2b- DDD2 and co-migrating v-mab and hL243 kappa light chains) comprising 20-C2-2b (not shown).
- IFN ⁇ 2b-DDD2 and hL243 Fd-DDD2 are absent in 20-C2-C2 and 20-2b-2b.
- MAbSelect binds to all three of the major species produced in the DNL reaction, but removes any excess IFN ⁇ 2b-DDD2 and C H l-DDD2-Fab-hL243.
- the His-Select unbound fraction contained mostly 20-C2-C2 (not shown). The unbound fraction from WT affinity
- LC/MS analysis of 20-C2-2b identified both the O-glycosylated and non-glycosylated species of IFN ⁇ 2b-DDD2 with mass accuracies of 15 ppm and 2 ppm, respectively (not shown).
- the observed mass of the O-glycosylated form indicates an O-linked glycan having the structure NeuGc-NeuGc-Gal-GalNAc, which was also predicted ( ⁇ 1 ppm) for 20-2b-2b (not shown).
- LC/MS identified both v-mab and hL243 kappa chains as well as hL243-Fd-DDD2 (not shown) as single, unmodified species, with observed masses matching the calculated ones ( ⁇ 35 ppm).
- v-mab HC-AD2 Two major glycoforms of v-mab HC-AD2 were identified as having masses of 53,714.73 (70%) and 53,877.33 (30%), indicating GOF and GIF N-glycans, respectively, which are typically associated with IgG (not shown). The analysis also confirmed that the amino terminus of the HC- AD2 is modified to pyroglutamate, as predicted for polypeptides having an amino terminal glutamine.
- Immunoreactivity assays demonstrated the homogeneity of 20-C2-2b with each molecule containing the three functional groups (not shonw). Incubation of 20-C2-2b with an excess of antibodies to any of the three constituent modules resulted in quantitative formation of high molecular weight immune complexes and the disappearance of the 20-C2-2b peak. The His-Select and WT affinity unbound fractions were not immunoreactive with WT and anti-IFN ⁇ , respectively (not shown).
- IFN ⁇ biological activity The specific activities for various MAb-IFN ⁇ were measured using a cell-based reporter gene assay and compared to peginterferon alfa-2b (FIG. 8C). Expectedly, the specific activity of 20-C2-2b (2454 IU/pmol), which has two IFN ⁇ 2b groups, was significantly lower than those of 20-2b-2b (4447 IU/pmol) or 734-2b-2b (3764 IU/pmol), yet greater than peginterferon alfa-2b (PO.001). The difference between 20-2b-2b and 734-2b-2b was not significant. The specific activity among all agents varies minimally when normalized to IU/pmol of total IFN ⁇ . Based on these data, the specific activity of each IFN ⁇ 2b group of the MAb-IFN ⁇ is approximately 30% of recombinant IFN ⁇ 2b (-4000 IU/pmol).
- In-vitro cytotoxicity NHL
- the results of in-vitro cytotoxicity assays with B-cell NHL are summarized in Table 3.
- the relative antigen densities of HLA-DR and CD20 for each cell line has been reported (Stein et al, Blood 2010, in Press).
- the targeting index (TI) represents the fold-increase in potency of a targeted MAb-IFN ⁇ compared to non-targeted MAb-IFN ⁇ (734-2b-2b), with the EC 50 values converted to total IFN ⁇ concentration (I- EC 50 ).
- Apoptosis was induced in Daudi with only 1 pM of any MAb-IFN ⁇ but not with 10 pM of v-mab or hL243 ⁇ 4p (FIG. 9A).
- Treatment with 20-2b-2b or 20-C2-2b resulted in significantly more apoptotic cells than 734-2b-2b or v-mab+hL243+734-2b (PO.0005). There was no significant difference observed between 734-2b-2b and the mixture.
- v-mab+hL234+734-2b mixture was more potent than any of the single agents alone for Raji and Ramos. Targeting the IFN ⁇ 2b was critical for achieving maximal potency.
- 20-C2-2b was more effective than v- mab+hL234+734-2b, which comprises the same number of anti-CD20 and anti-HLA-DR Fabs and twice the amount (and activity) of IFN ⁇ 2b.
- Jeko-1 mantle cell lymphoma
- IFN ⁇ 2b minimum effect with 734-2b-2b
- the 20-C2-2b exhibited two-fold enhanced potency compared to hL243 ⁇ 4p or v-mab+hL243+734-2b.
- hL243 ⁇ 4p and 734-2b-2b induced similar levels of apoptosis and their effects are apparently additive, since treatment with v-mab+hL243+734-2b resulted in approximately twice the number of annexin-V-positive cells compared to either agent alone (FIG. 9A). Presumably, v-mab has little contribution in the mixture, since alone it had only a modest effect. Both 20-C2-2b and the mixture were superior to 20-2b-2b (PO.002), due to the action of hL243.
- In-vitro cytotoxicity Myeloma
- the eight MM cell lines vary in HLA-DR levels (and only KMS 12-BM expresses CD20) and sensitivity to IFN ⁇ 2b (FIG. 10), all responded to 20-C2-2b.
- Dose-response curves for each of the eight MM cell lines tested are shown in FIG. 11, and the results are summarized in Table 3. For example, five were highly responsive to IFN ⁇ 2 (I-EC 50 ⁇ 1 nM for 734-2b-2b), but varied in HLA-DR antigen density.
- CAG which has high HLA-DR density
- hL243 ⁇ 4p >1 nM
- Apoptosis of CAG was evident following treatment with hL243 ⁇ 4p, 20-2b-2b, 734- 2b-2b, or hL243+734-2b at 1 nM, but not at 0.1 or 0.01 nM (FIG. 9B).
- the 20-C2-2b induced apoptosis even at 0.01 nM, and the level observed for 0.1 nM 20-C2-2b was equal or higher than that resulting from any other treatment at 10-fold higher (1 nM) concentration.
- EC 50 S nM
- EC 50 OJ nM
- a MAb-IFN ⁇ designated C2-2b-2b, which comprises hL243 IgGi and tetrameric IFN ⁇ 2b (twice that of 20-C2-2b) exhibited less potent cytotoxicity (EC 50 0.4 nM) and weaker apoptosis-induction compared to 20-C2-2b, supporting a contribution of v-mab.
- 20-C2-C2 induced significantly (PO.0091) greater ADCC compared to v-mab (not shown).
- 20-C2-2b does not induce CDC in vitro (not shown).
- Monocytes were depleted by hL243 ⁇ 4p (48%), 734-2b- 2b (30%), and 20-2b-2b (21%), but not by v-mab.
- the 20-C2-2b (98%) was highly toxic to monocytes. None of the agents had a significant effect on T cells.
- Statistical significance with .PO.001 was determined by Student's Mest for each of the differences in % depletion indicated above.
- fusion proteins comprising CD20-targeting MAbs and IFN ⁇ are more effective against NHL compared to combinations of MAb and IFN ⁇ in xenograft and syngeneic mouse models, indicating that MAb-IFN ⁇ can overcome the toxicity and Pk limitations associated with IFN ⁇ (Rossi et al., Blood 2009;l 14:3864-71 ; Xuan et al., Blood 2010;l 15:2864-71).
- CD20 is an attractive candidate for targeted MAb-IFN ⁇ therapy of B-cell lymphoma, its expression is largely limited to malignancies of this lineage, with some individuals exhibiting low antigen density.
- the first bispecific immunocytokine, 20-C2-2b which specifically targets IFN ⁇ 2b to both CD20 and HLA-DR, thus potentially expanding the hematopoietic tumor types amenable to this immunocytokine therapy.
- Anti-HLA-DR MAbs efficiently induce apoptosis, which is mediated by direct signaling without the requirement of additional crosslinking, and are also potent inducers of ADCC and CDC (Stein et al., Blood 2006;108:2736-44; Rech et al., Leuk Lymphoma 2006;47:2147-54) Where ADCC may enhance therapeutic potential, CDC is largely responsible for the pathogenesis of the side effects associated with the MAb infusion (van der KoIk et al., Br J Haematol 2001 ;115:807-11).
- the humanized anti-HLA-DR MAb, hL243 ⁇ 4p, used as a control in this study was engineered for improved clinical safety by using the constant region of the human IgG 4 isotype, resulting in diminished ADCC and CDC.
- the 20-C2-2b is unique among anti-HLA-DR MAbs in that it lacks CDC, similar to hL243 ⁇ 4p, but has potent (enhanced) ADCC, making this agent an attractive candidate for immunotherapy.
- v-mab can deplete cells via signaling-induced apoptosis, ADCC, and CDC.
- MAb-IFN ⁇ can employ enhanced ADCC as well as both MAb- and IFN ⁇ 2b-induced signaling, but not CDC; and hL243- ⁇ 4p is limited to only direct signaling (Stein et al., Blood 2006; 108:2736-44).
- hL243- ⁇ 4p is limited to only direct signaling
- the four NHL and eight MM cell lines we studied encompass the naturally-occurring heterogeneity in expression and antigen density of HLA-DR and CD20, as well as responsiveness to the actions of IFN ⁇ , hL243 and v-mab, which all impact MAb-IFN ⁇ immunotherapy.
- Six and eight (of twelve lines) were inhibited (I max >30%) to varying degrees by hL243 ⁇ 4p and 734-2b-2b, respectively.
- the 20-C2-2b potently inhibited (EC 50 ⁇ 1 nM) 11 of the 12 cell lines, with an EC 50 ⁇ O.Ol nM for five. Even the least affected MM line
- the 20-C2-2b was superior to the mixture of v-mab+hL243+734-2b in 10 of the lines, further highlighting the impact of tumor targeting, which will be considerably greater in vivo, as demonstrated previously for 20-2b-2b (Rossi et al., Blood 2009;l 14:3864- 71). Further, z ' rc-v/v ⁇ -targeted MAb-IFN ⁇ might elicit a potent anti-tumor immune response.
- putative MM cancer stem cells are CD138 " and express B-cell surface antigens, including CD45, CD19, CD20, and CD22, reminiscent of memory B cells (Matsui et al., Blood 2004; 103:2332-6).
- B-cell surface antigens including CD45, CD19, CD20, and CD22.
- MM remains largely incurable due to relapses thought to be mediated by cancer stem cells, which are resistant to the various therapies.
- the B-cell phenotype of the putative stem cells prompted clinical investigation with rituximab in MM. However, limited effects on outcome were realized (Treon et al., J Immunother 2002;25:72-81).
- MAb-IFN ⁇ produced by DNL exhibits comparable activity to recombinant IFN ⁇ .
- Xuan et al. reported that anti-CD20-IFN ⁇ fusion proteins made by traditional recombinant engineering showed a 300-fold reduction in IFN ⁇ activity (Xuan et al., Blood 2010;l 15:2864-71).
- the bispecific MAb-IFN ⁇ 20-C2-2b is attractive for the treatment of NHL, because each of the three components is active against this disease. This study shows that 20-C2-2b may also be useful for the therapy of MM and other hematopoietic malignancies.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Neurology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Diabetes (AREA)
- Biochemistry (AREA)
- Physical Education & Sports Medicine (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Hematology (AREA)
- Heart & Thoracic Surgery (AREA)
- Cardiology (AREA)
- Neurosurgery (AREA)
- Dermatology (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Toxicology (AREA)
- Oncology (AREA)
- Pain & Pain Management (AREA)
- Pulmonology (AREA)
- Endocrinology (AREA)
- Psychology (AREA)
- Obesity (AREA)
- Rheumatology (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010800385485A CN102481348A (zh) | 2009-08-31 | 2010-08-27 | 双特异性免疫细胞因子停靠-和-加锁(dnl)复合物及其治疗性用途 |
| JP2012527002A JP5740772B2 (ja) | 2009-08-31 | 2010-08-27 | 二重特異性免疫サイトカインドック−アンド−ロック(dnl)複合体及びその治療的使用 |
| CA2772572A CA2772572A1 (en) | 2009-08-31 | 2010-08-27 | Bispecific immunocytokine dock-and-lock (dnl) complexes and therapeutic use thereof |
| EP10812633.5A EP2473186A4 (en) | 2009-08-31 | 2010-08-27 | BIS SPECIFIC IMMUNOZYTOKIN DOCK-AND-LOCK COMPLEXES AND THERAPEUTIC USE THEREOF |
| BR112012004269A BR112012004269A2 (pt) | 2009-08-31 | 2010-08-27 | complexos dock-and-lock (dnl) de imunocitosinas biespecíficos e uso terapêutico dos mesmos |
| IN1331DEN2012 IN2012DN01331A (https=) | 2009-08-31 | 2010-08-27 | |
| AU2010286642A AU2010286642B2 (en) | 2009-08-31 | 2010-08-27 | Bispecific immunocytokine dock-and-lock (DNL) complexes and therapeutic use thereof |
Applications Claiming Priority (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US23842409P | 2009-08-31 | 2009-08-31 | |
| US61/238,424 | 2009-08-31 | ||
| US12/644,146 | 2009-12-22 | ||
| US12/644,146 US7981398B2 (en) | 2005-04-06 | 2009-12-22 | PEGylation by the dock and lock (DNL) technique |
| US12/731,781 US8003111B2 (en) | 2005-04-06 | 2010-03-25 | Dimeric alpha interferon pegylated site-specifically shows enhanced and prolonged efficacy in vivo |
| US12/731,781 | 2010-03-25 | ||
| US12/752,649 US8034352B2 (en) | 2005-04-06 | 2010-04-01 | Tetrameric cytokines with improved biological activity |
| US12/752,649 | 2010-04-01 | ||
| US12/754,140 US8722047B2 (en) | 2005-03-03 | 2010-04-05 | Humanized anti-HLA-DR antibodies |
| US12/754,140 | 2010-04-05 | ||
| US12/754,740 US8562988B2 (en) | 2005-10-19 | 2010-04-06 | Strategies for improved cancer vaccines |
| US12/754,740 | 2010-04-06 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2011025904A1 true WO2011025904A1 (en) | 2011-03-03 |
Family
ID=43628394
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2010/046889 Ceased WO2011025904A1 (en) | 2009-08-31 | 2010-08-27 | Bispecific immunocytokine dock-and-lock (dnl) complexes and therapeutic use thereof |
Country Status (7)
| Country | Link |
|---|---|
| EP (1) | EP2473186A4 (https=) |
| JP (2) | JP5740772B2 (https=) |
| CN (1) | CN102481348A (https=) |
| AU (1) | AU2010286642B2 (https=) |
| CA (1) | CA2772572A1 (https=) |
| IN (1) | IN2012DN01331A (https=) |
| WO (1) | WO2011025904A1 (https=) |
Cited By (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2552483A4 (en) * | 2010-04-01 | 2013-09-25 | Immunomedics Inc | USE OF ANTIBODIES TO REDUCE THE NUMBER OF CELLS CONTAINING ANTIGENS AND DENDRITIC CELLS |
| WO2014028560A2 (en) | 2012-08-14 | 2014-02-20 | Ibc Pharmaceuticals, Inc. | T-cell redirecting bispecific antibodies for treatment of disease |
| CN104159600A (zh) * | 2012-01-26 | 2014-11-19 | Ibc药品公司 | 用抗体靶向干扰素-λ来有效增强抗肿瘤和抗病毒活性 |
| EP2473187A4 (en) * | 2009-08-31 | 2015-09-16 | Immunomedics Inc | COMPOSITIONS AND METHODS FOR USE OF IMMUNOXINS WITH RANPIRNASE (RAP) WITH HIGH CYTOTOXIC ACTIVITY |
| WO2016009029A1 (en) * | 2014-07-16 | 2016-01-21 | Ucb Biopharma Sprl | Molecules with specificity for cd45 and cd79 |
| US9382329B2 (en) | 2012-08-14 | 2016-07-05 | Ibc Pharmaceuticals, Inc. | Disease therapy by inducing immune response to Trop-2 expressing cells |
| US9481878B2 (en) | 2004-02-13 | 2016-11-01 | Immunomedics, Inc. | Compositions and methods of use of immunotoxins comprising ranpirnase (Rap) show potent cytotoxic activity |
| US9682143B2 (en) | 2012-08-14 | 2017-06-20 | Ibc Pharmaceuticals, Inc. | Combination therapy for inducing immune response to disease |
| US10245321B2 (en) | 2012-08-14 | 2019-04-02 | Ibc Pharmaceuticals, Inc. | Combination therapy for inducing immune response to disease |
| US10358493B2 (en) | 2014-05-29 | 2019-07-23 | Ucb Biopharma Sprl | Bispecific format suitable for use in high-through-put screening |
| US10370447B2 (en) | 2014-07-16 | 2019-08-06 | Ucb Biopharma Sprl | Molecules with specificity for CD79 and CD22 |
| US10590197B2 (en) | 2015-07-16 | 2020-03-17 | Ucb Biopharma Sprl | Antibody molecules which bind CD22 |
| US10604576B2 (en) | 2016-06-20 | 2020-03-31 | Kymab Limited | Antibodies and immunocytokines |
| US10618979B2 (en) | 2015-12-03 | 2020-04-14 | Ucb Biopharma Sprl | Multispecific antibodies |
| US10618957B2 (en) | 2015-07-16 | 2020-04-14 | Ucb Biopharma Sprl | Antibody molecules which bind CD79 |
| US10774157B2 (en) | 2015-12-03 | 2020-09-15 | UCB Biopharma SRL | Multispecific antibodies |
| US10829566B2 (en) | 2015-12-03 | 2020-11-10 | UCB Biopharma SRL | Method employing bispecific antibodies |
| US10954312B2 (en) | 2015-12-03 | 2021-03-23 | UCB Biopharma SRL | Method employing bispecific protein complex |
| US11007251B2 (en) | 2015-12-17 | 2021-05-18 | The Johns Hopkins University | Ameliorating systemic sclerosis with death receptor agonists |
| US11084879B2 (en) | 2016-04-07 | 2021-08-10 | The Johns Hopkins University | Compositions and methods for treating pancreatitis and pain with death receptor agonists |
| US11286312B2 (en) | 2015-12-03 | 2022-03-29 | UCB Biopharma SRL | Multispecific antibodies |
| US11299528B2 (en) | 2014-03-11 | 2022-04-12 | D&D Pharmatech Inc. | Long acting TRAIL receptor agonists for treatment of autoimmune diseases |
| CN115052625A (zh) * | 2019-12-03 | 2022-09-13 | 埃沃特克国际有限责任公司 | 干扰素相关抗原结合蛋白及其用途 |
| US11591378B2 (en) | 2015-12-23 | 2023-02-28 | eleva GmbH | Polypeptides for inhibiting complement activation |
| US11692041B2 (en) | 2015-07-16 | 2023-07-04 | UCB Biopharma SRL | Antibody molecules which bind CD45 |
| US11753479B2 (en) | 2014-03-04 | 2023-09-12 | Kymab Limited | Nucleic acids encoding anti-OX40L antibodies |
| US11767353B2 (en) | 2020-06-05 | 2023-09-26 | Theraly Fibrosis, Inc. | Trail compositions with reduced immunogenicity |
| US11779604B2 (en) | 2016-11-03 | 2023-10-10 | Kymab Limited | Antibodies, combinations comprising antibodies, biomarkers, uses and methods |
| US12209128B2 (en) | 2016-06-20 | 2025-01-28 | Kymab Limited | Anti-PD-L1 antibodies |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IN2014MN02585A (https=) * | 2012-07-06 | 2015-07-24 | Innovative Technologies In Biolog Systems S L | |
| EP2981281B1 (en) * | 2013-04-03 | 2020-07-15 | IBC Pharmaceuticals, Inc. | Combination therapy for inducing immune response to disease |
| CA3155409A1 (en) * | 2015-05-13 | 2016-11-17 | Ablynx N.V. | T cell recruiting polypeptides based on cd3 reactivity |
| US11001631B2 (en) * | 2016-02-05 | 2021-05-11 | Orionis Biosciences BV | Clec9A binding agents |
| CN112469661B (zh) * | 2018-06-13 | 2024-04-26 | 斯克里普斯研究学院 | 具有新结构组分的纳米粒疫苗 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060210475A1 (en) * | 2005-03-03 | 2006-09-21 | Goldenberg David M | Humanized L243 antibodies |
| US20070086942A1 (en) * | 2005-10-19 | 2007-04-19 | Ibc Pharmaceuticals, Inc. | Methods and compositions for generating bioactive assemblies of increased complexity and uses |
| US20090202487A1 (en) * | 2005-04-06 | 2009-08-13 | Ibc Pharmaceuticals, Inc. | Modular Method to Prepare Tetrameric Cytokines with Improved Pharmacokinetics by the Dock-and-Lock (DNL) Technology |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7550143B2 (en) * | 2005-04-06 | 2009-06-23 | Ibc Pharmaceuticals, Inc. | Methods for generating stably linked complexes composed of homodimers, homotetramers or dimers of dimers and uses |
| US7666400B2 (en) * | 2005-04-06 | 2010-02-23 | Ibc Pharmaceuticals, Inc. | PEGylation by the dock and lock (DNL) technique |
| US7527787B2 (en) * | 2005-10-19 | 2009-05-05 | Ibc Pharmaceuticals, Inc. | Multivalent immunoglobulin-based bioactive assemblies |
| US6958214B2 (en) * | 2000-07-10 | 2005-10-25 | Sequenom, Inc. | Polymorphic kinase anchor proteins and nucleic acids encoding the same |
| AU2003228809A1 (en) * | 2002-05-03 | 2003-11-17 | Sequenom, Inc. | Kinase anchor protein muteins, peptides thereof, and related methods |
| CA2497254A1 (en) * | 2002-09-06 | 2004-03-18 | Forschungsverbund Berlin E. V. | Akap18 delta, a novel splicing variant of a protein kinase a anchor protein and the use of the same |
| AU2006232310B9 (en) * | 2005-04-06 | 2011-07-21 | Ibc Pharmaceuticals, Inc. | Improved stably tethered structures of defined compositions with multiple functions or binding specificities |
| CA2607056C (en) * | 2005-10-19 | 2015-11-24 | Ibc Pharmaceuticals, Inc. | Methods and compositions for generating bioactive assemblies of increased complexity and uses |
| CN101374546B (zh) * | 2005-12-16 | 2016-03-23 | Ibc医药公司 | 基于免疫球蛋白的多价生物活性装配体 |
| BRPI0711586A2 (pt) * | 2006-05-15 | 2011-11-16 | Immunonomedics, Inc. | método para tratamento de infecção por hiv em um indivìduo, método para imagem latente detectar ou diagnosticar a infecção por hiv em um indivìduo, composição |
-
2010
- 2010-08-27 IN IN1331DEN2012 patent/IN2012DN01331A/en unknown
- 2010-08-27 CN CN2010800385485A patent/CN102481348A/zh active Pending
- 2010-08-27 JP JP2012527002A patent/JP5740772B2/ja active Active
- 2010-08-27 CA CA2772572A patent/CA2772572A1/en not_active Abandoned
- 2010-08-27 WO PCT/US2010/046889 patent/WO2011025904A1/en not_active Ceased
- 2010-08-27 EP EP10812633.5A patent/EP2473186A4/en not_active Withdrawn
- 2010-08-27 AU AU2010286642A patent/AU2010286642B2/en active Active
-
2015
- 2015-04-10 JP JP2015080993A patent/JP5999217B2/ja active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060210475A1 (en) * | 2005-03-03 | 2006-09-21 | Goldenberg David M | Humanized L243 antibodies |
| US20090202487A1 (en) * | 2005-04-06 | 2009-08-13 | Ibc Pharmaceuticals, Inc. | Modular Method to Prepare Tetrameric Cytokines with Improved Pharmacokinetics by the Dock-and-Lock (DNL) Technology |
| US20070086942A1 (en) * | 2005-10-19 | 2007-04-19 | Ibc Pharmaceuticals, Inc. | Methods and compositions for generating bioactive assemblies of increased complexity and uses |
Cited By (47)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9481878B2 (en) | 2004-02-13 | 2016-11-01 | Immunomedics, Inc. | Compositions and methods of use of immunotoxins comprising ranpirnase (Rap) show potent cytotoxic activity |
| EP2473187A4 (en) * | 2009-08-31 | 2015-09-16 | Immunomedics Inc | COMPOSITIONS AND METHODS FOR USE OF IMMUNOXINS WITH RANPIRNASE (RAP) WITH HIGH CYTOTOXIC ACTIVITY |
| EP2552483A4 (en) * | 2010-04-01 | 2013-09-25 | Immunomedics Inc | USE OF ANTIBODIES TO REDUCE THE NUMBER OF CELLS CONTAINING ANTIGENS AND DENDRITIC CELLS |
| CN104159600A (zh) * | 2012-01-26 | 2014-11-19 | Ibc药品公司 | 用抗体靶向干扰素-λ来有效增强抗肿瘤和抗病毒活性 |
| JP2015511225A (ja) * | 2012-01-26 | 2015-04-16 | アイビーシー ファーマスーティカルズ,インコーポレイテッド | 抗体を有するインターフェロンλでの標的化は抗腫瘍および抗ウイルス活性を大きく増強する |
| EP3586874A1 (en) * | 2012-08-14 | 2020-01-01 | IBC Pharmaceuticals, Inc. | T-cell redirecting bispecific antibodies for treatment of disease |
| AU2013302696B9 (en) * | 2012-08-14 | 2018-08-09 | Ibc Pharmaceuticals, Inc. | T-cell redirecting bispecific antibodies for treatment of disease |
| US9315567B2 (en) | 2012-08-14 | 2016-04-19 | Ibc Pharmaceuticals, Inc. | T-cell redirecting bispecific antibodies for treatment of disease |
| US9382329B2 (en) | 2012-08-14 | 2016-07-05 | Ibc Pharmaceuticals, Inc. | Disease therapy by inducing immune response to Trop-2 expressing cells |
| WO2014028560A3 (en) * | 2012-08-14 | 2014-05-01 | Ibc Pharmaceuticals, Inc. | T-cell redirecting bispecific antibodies for treatment of disease |
| US9670286B2 (en) | 2012-08-14 | 2017-06-06 | Ibc Pharmaceuticals, Inc. | Disease therapy by inducing immune response to Trop-2 expressing cells |
| US9682143B2 (en) | 2012-08-14 | 2017-06-20 | Ibc Pharmaceuticals, Inc. | Combination therapy for inducing immune response to disease |
| US9879088B2 (en) | 2012-08-14 | 2018-01-30 | Ibc Pharmaceuticals, Inc. | Disease therapy by inducing immune response to Trop-2 expressing cells |
| AU2013302696B2 (en) * | 2012-08-14 | 2018-07-26 | Ibc Pharmaceuticals, Inc. | T-cell redirecting bispecific antibodies for treatment of disease |
| US10662252B2 (en) | 2012-08-14 | 2020-05-26 | Ibc Pharmaceuticals, Inc. | Disease therapy by inducing immune response to Trop-2 expressing cells |
| US10111954B2 (en) | 2012-08-14 | 2018-10-30 | Ibc Pharmaceuticals, Inc. | Combination therapy for inducing immune response to disease |
| US10183992B2 (en) | 2012-08-14 | 2019-01-22 | Ibc Pharmaceuticals, Inc. | T-cell redirecting bispecific antibodies for treatment of disease |
| US10239938B2 (en) | 2012-08-14 | 2019-03-26 | Ibc Pharmaceuticals, Inc. | T-cell redirecting bispecific antibodies for treatment of disease |
| US10245321B2 (en) | 2012-08-14 | 2019-04-02 | Ibc Pharmaceuticals, Inc. | Combination therapy for inducing immune response to disease |
| US10308688B2 (en) | 2012-08-14 | 2019-06-04 | Ibc Pharmaceuticals, Inc. | T-cell redirecting bispecific antibodies for treatment of disease |
| WO2014028560A2 (en) | 2012-08-14 | 2014-02-20 | Ibc Pharmaceuticals, Inc. | T-cell redirecting bispecific antibodies for treatment of disease |
| US11753479B2 (en) | 2014-03-04 | 2023-09-12 | Kymab Limited | Nucleic acids encoding anti-OX40L antibodies |
| US11773175B2 (en) | 2014-03-04 | 2023-10-03 | Kymab Limited | Antibodies, uses and methods |
| US11299528B2 (en) | 2014-03-11 | 2022-04-12 | D&D Pharmatech Inc. | Long acting TRAIL receptor agonists for treatment of autoimmune diseases |
| US10358493B2 (en) | 2014-05-29 | 2019-07-23 | Ucb Biopharma Sprl | Bispecific format suitable for use in high-through-put screening |
| US11261252B2 (en) | 2014-07-16 | 2022-03-01 | UCB Biopharma SRL | Molecules with specificity for CD79 and CD22 |
| US10774152B2 (en) | 2014-07-16 | 2020-09-15 | Ucb Biopharma Sprl | Molecules with specificity for CD45 and CD79 |
| US10370447B2 (en) | 2014-07-16 | 2019-08-06 | Ucb Biopharma Sprl | Molecules with specificity for CD79 and CD22 |
| WO2016009029A1 (en) * | 2014-07-16 | 2016-01-21 | Ucb Biopharma Sprl | Molecules with specificity for cd45 and cd79 |
| US12331117B2 (en) | 2015-07-16 | 2025-06-17 | UCB Biopharma SRL | Antibody molecules which bind CD22 |
| US10618957B2 (en) | 2015-07-16 | 2020-04-14 | Ucb Biopharma Sprl | Antibody molecules which bind CD79 |
| US10590197B2 (en) | 2015-07-16 | 2020-03-17 | Ucb Biopharma Sprl | Antibody molecules which bind CD22 |
| US11692041B2 (en) | 2015-07-16 | 2023-07-04 | UCB Biopharma SRL | Antibody molecules which bind CD45 |
| US11472879B2 (en) | 2015-07-16 | 2022-10-18 | UCB Biopharma SRL | Antibody molecules which bind CD22 |
| US10774157B2 (en) | 2015-12-03 | 2020-09-15 | UCB Biopharma SRL | Multispecific antibodies |
| US11286312B2 (en) | 2015-12-03 | 2022-03-29 | UCB Biopharma SRL | Multispecific antibodies |
| US10954312B2 (en) | 2015-12-03 | 2021-03-23 | UCB Biopharma SRL | Method employing bispecific protein complex |
| US10829566B2 (en) | 2015-12-03 | 2020-11-10 | UCB Biopharma SRL | Method employing bispecific antibodies |
| US10618979B2 (en) | 2015-12-03 | 2020-04-14 | Ucb Biopharma Sprl | Multispecific antibodies |
| US11007251B2 (en) | 2015-12-17 | 2021-05-18 | The Johns Hopkins University | Ameliorating systemic sclerosis with death receptor agonists |
| US11591378B2 (en) | 2015-12-23 | 2023-02-28 | eleva GmbH | Polypeptides for inhibiting complement activation |
| US11084879B2 (en) | 2016-04-07 | 2021-08-10 | The Johns Hopkins University | Compositions and methods for treating pancreatitis and pain with death receptor agonists |
| US10604576B2 (en) | 2016-06-20 | 2020-03-31 | Kymab Limited | Antibodies and immunocytokines |
| US12209128B2 (en) | 2016-06-20 | 2025-01-28 | Kymab Limited | Anti-PD-L1 antibodies |
| US11779604B2 (en) | 2016-11-03 | 2023-10-10 | Kymab Limited | Antibodies, combinations comprising antibodies, biomarkers, uses and methods |
| CN115052625A (zh) * | 2019-12-03 | 2022-09-13 | 埃沃特克国际有限责任公司 | 干扰素相关抗原结合蛋白及其用途 |
| US11767353B2 (en) | 2020-06-05 | 2023-09-26 | Theraly Fibrosis, Inc. | Trail compositions with reduced immunogenicity |
Also Published As
| Publication number | Publication date |
|---|---|
| JP5740772B2 (ja) | 2015-07-01 |
| JP2013503184A (ja) | 2013-01-31 |
| CA2772572A1 (en) | 2011-03-03 |
| IN2012DN01331A (https=) | 2015-06-05 |
| JP2015157832A (ja) | 2015-09-03 |
| EP2473186A1 (en) | 2012-07-11 |
| AU2010286642A1 (en) | 2012-02-16 |
| JP5999217B2 (ja) | 2016-09-28 |
| CN102481348A (zh) | 2012-05-30 |
| EP2473186A4 (en) | 2013-07-10 |
| AU2010286642B2 (en) | 2016-03-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2010286642B2 (en) | Bispecific immunocytokine dock-and-lock (DNL) complexes and therapeutic use thereof | |
| US8282934B2 (en) | Modular method to prepare tetrameric cytokines with improved pharmacokinetics by the dock-and-lock (DNL) technology | |
| US9498542B2 (en) | Tetrameric cytokines with improved biological activity | |
| US20110020273A1 (en) | Bispecific Immunocytokine Dock-and-Lock (DNL) Complexes and Therapeutic Use Thereof | |
| CA2720748C (en) | Modular method to prepare tetrameric cytokines with improved pharmacokinetics by the dock-and-lock (dnl) technology | |
| US9446123B2 (en) | Multimeric complexes with improved in vivo stability, pharmacokinetics and efficacy | |
| US7901680B2 (en) | Dock-and-lock (DNL) vaccines for cancer therapy | |
| US9931413B2 (en) | Tetrameric cytokines with improved biological activity | |
| US20170166651A1 (en) | Modular Method to Prepare Tetrameric Cytokines with Improved Pharmacokinetics by the Dock-and-Lock (DNL) Technology | |
| AU2010286496B2 (en) | Compositions and methods of use of immunotoxins comprising ranpirnase (Rap) show potent cytotoxic activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201080038548.5 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10812633 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010286642 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1331/DELNP/2012 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 2010286642 Country of ref document: AU Date of ref document: 20100827 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012527002 Country of ref document: JP Ref document number: 2772572 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010812633 Country of ref document: EP |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112012004269 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112012004269 Country of ref document: BR Kind code of ref document: A2 Effective date: 20120227 |