WO2011019995A2 - Synthèse et identification de nouveaux inhibiteurs spécifiques de la rsk - Google Patents

Synthèse et identification de nouveaux inhibiteurs spécifiques de la rsk Download PDF

Info

Publication number
WO2011019995A2
WO2011019995A2 PCT/US2010/045440 US2010045440W WO2011019995A2 WO 2011019995 A2 WO2011019995 A2 WO 2011019995A2 US 2010045440 W US2010045440 W US 2010045440W WO 2011019995 A2 WO2011019995 A2 WO 2011019995A2
Authority
WO
WIPO (PCT)
Prior art keywords
group
hydroxyl
rsk
hydrogen
independently selected
Prior art date
Application number
PCT/US2010/045440
Other languages
English (en)
Other versions
WO2011019995A3 (fr
Inventor
Sidney M. Hecht
Deborah A. Lannigan-Macara
Jeffrey Allan Smith
George O. O'doherty
Michael Kenneth Hilinski
Original Assignee
Hecht Sidney M
Lannigan-Macara Deborah A
Jeffrey Allan Smith
O'doherty George O
Michael Kenneth Hilinski
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hecht Sidney M, Lannigan-Macara Deborah A, Jeffrey Allan Smith, O'doherty George O, Michael Kenneth Hilinski filed Critical Hecht Sidney M
Priority to US13/390,389 priority Critical patent/US9040673B2/en
Publication of WO2011019995A2 publication Critical patent/WO2011019995A2/fr
Publication of WO2011019995A3 publication Critical patent/WO2011019995A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • A61K31/353—3,4-Dihydrobenzopyrans, e.g. chroman, catechin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048—Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A61P31/06—Antibacterial agents for tuberculosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H17/00—Compounds containing heterocyclic radicals directly attached to hetero atoms of saccharide radicals
    • C07H17/04—Heterocyclic radicals containing only oxygen as ring hetero atoms
    • C07H17/06—Benzopyran radicals
    • C07H17/065—Benzo[b]pyrans
    • C07H17/075—Benzo[b]pyran-2-ones
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • MAPK Protein Kinase
  • p90 Ribosomal S6 Kinase is a serine/threonine kinase that is a downstream component of the Mitogen-activated Protein Kinase (MAPK) signaling pathway. Therefore, unregulated stimulation of the MAPK pathway results in unregulated RSK catalytic activity.
  • upstream components such as Epidermal Growth Factor Receptor (EGFR) and the products of the proto-oncogenes c-src, ras, and raf to activate the MAPK pathway, resulting in physiological responses by the cell that are associated with diseased states, have been well documented. However, the extent to which these physiological responses function through RSK is unknown.
  • a RSK specific inhibitor is highly desirable for use as a tool for investigating RSK function under normal conditions and under diseased conditions in which regulation of the MAPK signaling pathway has been compromised.
  • One aspect of the present disclosure provides a method for using compositions comprising such inhibitors for the treatment of diseases associated with elevated RSK activity.
  • the host cell signaling events essential for establishing and maintaining infection provide attractive targets for novel anti-infective agents. Accordingly, one set of targets for new anti- infective agents is the signaling events involved in
  • endosomal/phagosomal maturation For intracellular pathogens to survive in the host cell they must disrupt or avoid the microbicidal machinery. This often involves inhibiting maturation of the endocytotic vesicles and fusion with the lysosomes (See for example, hackstadt, T.
  • RSK activity is required for endothelial cell migration, and accordingly, inhibiting RSK activity represents a novel method for inhibiting
  • angiogenesis The purpose of the present disclosure is not to overcome shortcomings that have been identified with previous anti-angiogenic treatments. This present disclosure adds to the options for anti-angiogenic treatments and allows for new unique combinations of anti- angiogenic therapeutics.
  • composition that comprises a RSK specific inhibitory compound.
  • RSK inhibitors disclosed herein are derivatives of kaempferol 3-O-(3",4"-di-O-acetyl-.alpha.-L-rhamnopyranoside), referred to herein as SLOlOl :
  • SLOlOl has been described in published US application no. 20070049539, and international applications PCT/US03/18734 and PCT/US07/12156, the disclosures of which are each incorporated herein by reference, as an inhibitor of RSK activity.
  • the novel derivatives disclosed herein have surprisingly improved RSK-activity, relative to the parent compound, SLOlOl .
  • these new analogues are also anticipated to have improved pharmacokinetic properties (e.g., improved metabolic stability, solubility and membrane permeability), which in turn will make these new compounds better drugs for the treatment of RSK related diseases (e.g., cancer and infection by intracellular pathogens like Yersinia).
  • compositions comprising the novel SLOlOl RSK inhibitors disclosed herein can be used to target RSK activity for therapeutic intervention in diseased states in which the disease or the symptoms can be ameliorated by inhibition of RSK catalytic activity.
  • Ri, R2, R3, R 4 , R5, Rs, R7, Rs and R9 are independently selected from the group consisting of hydrogen, halo, hydroxyl, -OCOR H , -COR H , C 1 -C 4 alkyl and Ci-C 4 alkoxy;
  • Rio and Rn are independently selected from the group consisting of hydrogen, halo, hydroxyl, -NHOCOR H , -OCORi 4 , -CORi 4 and Ci-C 4 alkoxy;
  • R 12 is selected from the group consisting of Ci-C 4 alkyl, Ci-C 4 alkoxy, and [Co-C 4 alkyl]CHRi 8 Ri 9 ;
  • Rn is selected from the group consisting of hydrogen, hydroxyl, and
  • n and n are independently an integer from 0-3 ;
  • X is selected from the group consisting of O, NH, CH 2 , and CF 2 ;
  • Y is selected from the group consisting of O, NR 15 , and CRi 6R 17 ;
  • R H is selected from the group consisting of hydrogen, and Ci-C 4 alkyl
  • Ri5 is selected from the group consisting of hydrogen, halo, hydroxyl, and Ci-C 4 alkyl; Ri6, R 17 , R 1 8 and R 1 9 are independently and Ci-C 4 alkoxy, with the proviso that when
  • X is O, R 12 is not CH 2 and when X is CH 2 , at least one of Rio and Rn is hydroxyl.
  • the RSK inhibitory compound comprises a compound of Formula I wherein R 12 is C 2 -C 4 alkyl.
  • the RSK inhibitory compound comprises a compound of Formula I wherein X is selected from the group consisting of O, NR H , CHR H , and CF 2 and Y is selected from the group consisting OfNR 15 , and CR ⁇ R 17 .
  • R 2 and R 4 are each hydrogen, R 1 , R3 and R 7 are each hydroxyl and Ri 2 is C 2 -C 4 alkyl.
  • Ri, R 2 , R3, R 4 , R5, Re, R7, Rs and Rg are independently selected from the group consisting of hydrogen, halo, hydroxyl, -OCOR H , -COR H , C 1 -C 4 alkyl and Ci-C 4 alkoxy;
  • Rio and Rn are independently selected from the group consisting of hydrogen, halo, hydroxyl, -NHOCOR H , -OCORi 4 , -CORi 4 and Ci-C 4 alkoxy;
  • R 12 is selected from the group consisting of Ci-C 4 alkyl, Ci-C 4 alkoxy, and [Co-C 4 alkyl]CH 2 R 18 ;
  • Rn is selected from the group consisting of hydrogen, hydroxyl, and
  • n are independently an integer from 0-3;
  • Y is selected from the group consisting of O, NRi 5, and CRi ⁇ Ri 7 ;
  • R H is selected from the group consisting of hydrogen, and Ci-C 4 alkyl
  • Ri 5, Ri 8 and Ri 9 are independently selected from the group consisting of hydrogen, halo, hydroxyl, Ci-C 4 alkyl and Ci-C 4 alkoxy;
  • Ri6 and Rn are independently selected from the group consisting of hydrogen, halo, hydroxyl, Ci-C 4 alkyl and Ci-C 4 alkoxy.
  • the RSK inhibitory compound comprises a compound of Formula I or V wherein R 2 and R 4 are each hydrogen, R 1 , R 3 , R 5 , Rg, R 7 , Rs and R9 are independently selected from the group consisting of hydrogen, fluorine, hydroxyl, -OCOR H , -COR H and Ci-C 4 alkoxy, Ri 5 is hydrogen or Cj-C 4 alkyl and Ri6 and Rn are independently selected from the group consisting of hydrogen, hydroxyl and Ci-C 4 alkoxy.
  • the RSK inhibitory compound comprises a compound of Formula I or V wherein R 2 , R 4 , R5, Re, Rg and R9 are each hydrogen or fluorine, Ri, R3, and R 7 , are each hydroxyl, Rio and Rn are independently hydroxyl or -OCORi 4 and Ri 2 is Ci-C 4 alkyl.
  • the RSK inhibitory compound comprises a compound of Formula I or V wherein R 2 , R 4 , R5, R ⁇ 5, Rg and R9 are each hydrogen or fluorine, Ri, R3, and R7, are each hydroxyl, Rio and Rn are independently hydroxyl or -OCOR14, R12 is C2-C4 alkyl and Y is oxygen and R 1 5 is hydrogen or C 1 -C 4 alkyl and Ri6 and Rn are independently selected from the group consisting of hydrogen, hydroxyl and C 1 -C 4 alkoxy.
  • R5, Re, Rs and Rg are independently selected from the group consisting of hydrogen, halo, hydroxyl, -OCOR H , -COR H , Ci-C 4 alkyl and Ci-C 4 alkoxy;
  • Rio, Rn and R 2 0 are independently selected from the group consisting of -CORi 4 and hydroxyl, and R H is selected from the group consisting of hydrogen and C 1 -C 4 alkyl.
  • R5, R ⁇ , Rs and R9 are each hydrogen and at least one of Rio, Rn and R 2 0 is -COCH3 and at least one of Rio, Rn and R 2 0 is hydroxyl.
  • R 2 0 is - COCH3 and one of Rio and Rn is -COCH3 and the other is hydroxyl.
  • a method of inhibiting the proliferation of neoplastic cells comprising the steps of contacting neoplastic cells with a compound of the general structure of Formula I.
  • a composition comprising compounds of the general structure of Formula IV are administered to inhibit the proliferation of neoplastic cells and to treat cancer.
  • the RSK inhibitory SLOlOl derivatives can be used in a novel method of inhibiting endothelial cell migration. Inhibition of endothelial cell migration inhibits the ability of endothelial cells to conduct the initial steps needed for angiogenesis, leading to alleviation of the symptoms and restoration of the health of patients suffering from diseases associated with inappropriate angiogenic activity. Accordingly, in one embodiment a composition comprising a RSK inhibitory SLOlOl analog is placed in contact with endothelial cells of a patient in need of reduced angiogenic activity.
  • pharmaceutical compositions comprising a RSK specific inhibitor can be used to treat diseases as diverse as cancer, arthritis and diabetic retinopathy.
  • the SLOlOl derivatives disclosed herein are used to combat the establishment and maintenance of an infection by a pathogenic microorganism.
  • RSK activity is involved in endosomal/phagosomal maturation that some pathogens use to impede endosome/phagosome maturation through a mechanism that utilizes RSK activity. Therefore, inhibiting the activity of RSK decreases the pathogen's ability to impede endosome/phagosome maturation and can improve the host organism's ability to resist and/or mitigate pathogen infection. More particularly, the present application discloses that an inhibitor of RSK activity protects the host-cell's cytoskeleton from pathogen- induced actin reorganization, and furthermore that a RSK inhibitor reduces the viability of internalized Y.
  • the present invention provides compositions and methods for inhibiting native RSK activity in the cells of a potential host organism as a means of interfering with the ability of a pathogen to avoid the microbicidal machinery of the host.
  • Fig. 1 Molecular structure of SLOlOl-I, SL0101-2 (2",4"-di-O-acetyl SLOlOl) and
  • Figs. 2A & 2B Analysis of LPS stimulated cytokine expression.
  • J774A1 cells were treated with growth medium containing 1 ⁇ g/ml LPS and either vehicle or 60 ⁇ M SLOlOl. Reactions were terminated with 2X-SDS lysis buffer at indicated time points and the lysates were immunoblotted.
  • LPS treatment activates p42/44 MAPK (Erk 1/2) and does not alter the levels of RSK 1 or RSK2 (Fig. 2A).
  • LPS treatment also increased expression of the cytokines, TNF ⁇ and IL- l ⁇ (Fig. 2B). Equal loading is demonstrated by the Ran immunoblot.
  • Figs. 3A & 3B RSK inhibition abrogates LPS-induced iNOS expression.
  • J774A1 cells Fig. 3A
  • mouse primary peritoneal macrophages Fig. 3B
  • growth medium containing 1 ⁇ g/ml LPS and either vehicle or 60 ⁇ M SLOlOl.
  • Twenty-four hours after treatment reactions were terminated with 2X-SDS lysis buffer and the lysates were immunoblotted.
  • LPS treatment stimulates iNOS expression however, simultaneous contact with LPS and a RSK inhibitor abrogates iNOS expression in both the J774A.1 cells (Fig. 3A) and the primary macrophages (Fig. 3B). Equal loading is demonstrated by the Ran immunoblot.
  • Figs 4A & 4B graphically illustrate the results of experiments demonstrating that inhibition of RSK activity results in reduced viability of internalized Y. pseudotuberculosis.
  • Fig. 4A The results of culturing Y. pseudotuberculosis in liquid LB medium in the presence of vehicle or 60 ⁇ M SLOlOl .
  • the rate of Y. pseudotuberculosis growth in the presence of SLOlOl was identical to that in the presence of vehicle. Thus, SLOlOl does not directly alter the growth of Y. pseudotuberculosis.
  • Fig. 5A-5C graphically illustrates that 3Ac-SLOlOl selectively inhibits MCF-7 breast cancer cell proliferation, but not nontransformed breast cell proliferation.
  • 5A MCF-7 cells were treated with vehicle or the indicated concentration of kaempferol 3-O-(3",4"-di-O- butyryl-. alpha.
  • Fig. 6 Purified SLOlOl-I specifically inhibits RSK2 activity in vitro. Vehicle or inhibitor (5 ⁇ M) was added to the kinase mix containing 5 nM of the indicated purified kinases. The reaction was allowed to proceed for 30 mins at room temperature and the data were normalized to the kinase activity obtained in the presence of vehicle.
  • Figs. 7A & 7B SLOlOl-I inhibition of cell proliferation is reversible.
  • Fig. 7A SLOlOl-I inhibition of cell proliferation is reversible.
  • Fig. 7B Determination of siRNA to inhibit cancer cell proliferation. Duplex siRNAs to a sequence in the bluescript plasmid (Control), RSKl , RSK2 or RSKl and RSK2 were transfected into MCF-7 cells. Medium was replaced 24 hr post-transfection and the cells incubated for an additional 48 hr prior to measuring cell viability.
  • Figs. 8A-8D SLOlOl-I inhibits the proliferation of cancer cells but not normal cells.
  • Fig. 8A demonstrates the results of treating MCF-7 and MCF-IOA cells with vehicle or 50 ⁇ M SLO 101 - 1 or UO 126 (a MEK inhibitor) .
  • Fig. 8B demonstrates the results of treating LNCaP cells with vehicle or 50 ⁇ M SLOlOl-I or 50 ⁇ M U0126.
  • Fig. 8C demonstrates the results of treating MCF-7 cells with vehicle or 50 ⁇ M SLOlOl-I in serum- free medium.
  • Fig. 8D is a Western blot that presents data showing that SLOlOl-I does not inhibit kinases of the MAPK pathway upstream of RSK.
  • Fig. 9 Inhibition of RSK activity in the presence of 500 nM of SLOlOl derivative compounds.
  • 500 nM of the individual inhibitor was added to a RSK kinase mix containing 5 nM of RSK.
  • the reaction was allowed to proceed for 30 mins at room temperature and the data were normalized to the kinase activity obtained in the presence of Kaempferol L- rhamnoside (compound #4).
  • the structure of Kaempferol L-rhamnoside is as follows:
  • Fig. 10 graphically illustrates the ability of various SLOlOl derivative compounds to inhibit MCF-7 breast cancer cell proliferation.
  • Compounds tested include: Kaempferol L- carbarhamnoside 4"-acetate (12), Kaempferol L-carbarhamnoside 2", 4"-diacetate (13),
  • Fig. 11 is a graph providing the IC50 of RSK inhibitor compound 4 (Kaempferol Kaempferol L-rhamnoside) and compound 17 (Kaempferol -6"ethyl-L-rhamnoside).
  • Fig. 12 is a graph providing the IC50 of RSK inhibitor compound 7 (SLOlOl;
  • compound 14 Kaempferol L-carbarhamnoside 3", 4"-diacetate
  • compound 16 Kaempferol -6"ethyl-L-rhamnoside-3",4"-diacetate
  • PKA- protein kinase A PKC- protein kinase C
  • RSK- a 90 kDa ribosomal S6 kinase also referred to as p90RSK herein
  • bioactive polypeptide refers to polypeptides which are capable of exerting a biological effect in vitro and/or in vivo.
  • an antimicrobial is a substance that kills, or inhibits the growth or the ability of a microbe (such as bacteria, fungi, or viruses) to infect or maintain an infection in its host cell/organism.
  • a microbe such as bacteria, fungi, or viruses
  • the term "pharmaceutically acceptable carrier” includes any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water, emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents.
  • the term also encompasses any of the agents approved by a regulatory agency of the US Federal government or listed in the US Pharmacopeia for use in animals, including humans.
  • pharmaceutically acceptable salt refers to salts of compounds that retain the biological activity of the parent compound, and which are not biologically or otherwise undesirable. Many of the compounds disclosed herein are capable of forming acid and/or base salts by virtue of the presence of amino and/or carboxyl groups or groups similar thereto.
  • treating includes prophylaxis of the specific disorder or condition, or alleviation of the symptoms associated with a specific disorder or condition and/or preventing or eliminating said symptoms.
  • treating an infection will refer in general to decreasing the number of infectious agents present in a tissue or cell relative to a pretreatment status or relative to an untreated control infected with the relevant pathogen.
  • an "effective” amount or a “therapeutically effective amount” of a prodrug refers to a nontoxic but sufficient amount of a bioactive agent to provide the desired effect.
  • an effective amount of an RSK inhibitor is an amount of the inhibitor sufficient to, inter alia, suppress RSK activity as indicated in a serine/threonine kinase assay.
  • the term “effective amount” is used interchangeably with “effective concentration” herein.
  • the amount that is “effective” will vary from subject to subject, depending on the age and general condition of the individual, mode of administration, and the like. Thus, it is not always possible to specify an exact “effective amount.” However, an appropriate “effective” amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation.
  • parenteral means not through the alimentary canal but by some other route such as subcutaneous, intramuscular, intraspinal, or intravenous.
  • the term "affected cell” refers to a cell of a subject afflicted with a disease or disorder, which affected cell has an altered phenotype relative to a subject not afflicted with a disease or disorder.
  • Cells or tissue are "affected" by a disease or disorder if the cells or tissue have an altered phenotype relative to the same cells or tissue in a subject not afflicted with a disease or disorder.
  • an "agonist” is a composition of matter which, when administered to a mammal such as a human, enhances or extends a biological activity attributable to the level or presence of a target compound or molecule of interest in the mammal.
  • an "antagonist” is a composition of matter which when administered to a mammal such as a human, inhibits a biological activity attributable to the level or presence of a compound or molecule of interest in the mammal.
  • a disease or disorder is "alleviated” if the severity of a symptom of the disease or disorder, the frequency with which such a symptom is experienced by a patient, or both, are reduced.
  • amino acids are represented by the full name thereof, by the three letter code corresponding thereto, or by the one-letter code corresponding thereto, as indicated in the following table: Full Name Three-Letter Code One-Letter Code
  • amino acid as used herein is meant to include compounds having the following general structure:
  • R represents hydrogen or a hydrocarbon side chain, and includes both natural and synthetic amino acids, and both D and L amino acids.
  • Standard amino acid means any of the twenty standard L-amino acids commonly found in naturally occurring peptides.
  • Nonstandard amino acid residue means any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or derived from a natural source.
  • synthetic amino acid also encompasses chemically modified amino acids, including but not limited to salts, amino acid derivatives (such as amides), and substitutions.
  • Amino acids contained within the peptides of the present invention, and particularly at the carboxy- or amino-terminus, can be modified by methylation, amidation, acetylation or substitution with other chemical groups which can change the peptide's circulating half-life without adversely affecting their activity. Additionally, a disulfide linkage may be present or absent in the peptides of the invention.
  • amino acid is used interchangeably with “amino acid residue,” and may refer to a free amino acid and to an amino acid residue of a peptide. It will be apparent from the context in which the term is used whether it refers to a free amino acid or a residue of a peptide.
  • an "analog" of a chemical compound is a compound that, by way of example, resembles another in structure but is not necessarily an isomer (e.g., 5-fluorouracil is an analog of thymine).
  • biological sample refers to samples obtained from a subject, including, but not limited to, skin, hair, tissue, blood, plasma, cells, sweat and urine.
  • a "derivative" of a compound refers to a chemical compound that may be produced from another compound of similar structure in one or more steps, including for example, the replacement of hydrogen by an alkyl, acyl, or amino group.
  • a "detectable marker” or a “reporter molecule” is an atom or a molecule that permits the specific detection of a compound comprising the marker in the presence of similar compounds without a marker.
  • Detectable markers or reporter molecules include, e.g., radioactive isotopes, antigenic determinants, enzymes, nucleic acids available for hybridization, chromophores, fluorophores, chemiluminescent molecules, electrochemically detectable molecules, and molecules that provide for altered fluorescence-polarization or altered light-scattering.
  • a “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate.
  • a disorder in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
  • excessive RSK activity refers to an increase in RSK activity in a cell with a disease or disorder, relative to the amount of such RSK activity in an otherwise identical normal cell.
  • flavonoid refers to polyphenolic compounds possessing a carbon skeleton having the general structure:
  • formula and structure are used interchangeably herein.
  • a "functional" molecule is a molecule in a form in which it exhibits a property by which it is characterized.
  • a functional enzyme is one which exhibits the characteristic catalytic activity by which the enzyme is characterized.
  • any reference to a compound having a "greater uptake" into a cell relative to another compound is intended to portray that a higher concentration of the first compound relative to the second will be present in otherwise identical cells that are exposed to the respective compounds for the same length of time. Accordingly, the first compound either has the ability to enter a cell at a greater rate than the second compound or that the first compound has lower rate of degradation or a lower rate of efflux from the cell relative to the second compound.
  • inhibitor refers to the ability of a compound of the invention to reduce or impede a described function. In one embodiment, inhibition is at least 10%, at least 25%, at least 50%, at least 75% of the activity obtained in the absence of the inhibiting agent.
  • inhibitor infection refers to both direct and indirect inhibition of infection, regardless of the mechanism.
  • inhibitor a protein refers to any method or technique which inhibits protein synthesis, levels, activity, or function, as well as methods of inhibiting the induction or stimulation of synthesis, levels, activity, or function of the protein of interest.
  • the term also refers to any metabolic or regulatory pathway which can regulate the synthesis, levels, activity, or function of the protein of interest.
  • the term includes binding with other molecules and complex formation. Therefore, the term “protein inhibitor” refers to any agent or compound, the application of which results in the inhibition of protein function or protein pathway function. However, the term does not imply that each and every one of these functions must be inhibited at the same time.
  • inhibiting RSK refers to the use of any compound, agent, or mechanism to inhibit RSK synthesis, levels, activity, or function are reduced or inhibited as described above.
  • an "instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the peptide of the invention in the kit for effecting alleviation of the various diseases or disorders recited herein.
  • the instructional material may describe one or more methods of alleviating the diseases or disorders in a cell or a tissue of a mammal.
  • modification of a compound refers to a compound that's structure or composition has been somewhat changed from the original compound.
  • compositions includes formulations for human and veterinary use.
  • protein regulatory pathway refers to both the upstream regulatory pathway which regulates a protein, as well as the downstream events which that protein regulates. Such regulation includes, but is not limited to, transcription, translation, levels, activity, posttranslational modification, and function of the protein of interest, as well as the downstream events which the protein regulates.
  • protein pathway and “protein regulatory pathway” are used interchangeably.
  • purified and the like terms relate to the isolation of a molecule or compound in a form that is substantially free (at least 60% free, 75% free, or 90% free) from other components normally associated with the molecule or compound in a native environment.
  • stimulate refers to either stimulating or inhibiting a function or activity of interest.
  • RSK RSK2
  • RSK3, and RSK4 are specific human isotypes that have previously been described in the literature.
  • RSK activity includes synthesis, levels, activity, or function of RSK.
  • RSK inhibitor includes any compound or condition that specifically inhibits or reduces the kinase activity of RSK or which inhibits any function of RSK. Such inhibitory effects may result from directly, or indirectly, interfering with the protein's ability to phosphorylate its substrate, or may result from inhibiting the expression (transcription and/or translation) of RSK.
  • Standard refers to something used for comparison. For example, it can be a known standard agent or compound which is administered and used for comparing results when administering a test compound, or it can be a standard parameter or function which is measured to obtain a control value when measuring an effect of an agent or compound on a parameter or function. Standard can also refer to an "internal standard", such as an agent or compound which is added at known amounts to a sample and is useful in determining such things as purification or recovery rates when a sample is processed or subjected to purification or extraction procedures before a marker of interest is measured. Internal standards are often a purified marker of interest which has been labeled, such as with a radioactive isotope, allowing it to be distinguished from an endogenous marker.
  • a “subject” of analysis, diagnosis, or treatment is an animal. Such animals include mammals, preferably a human.
  • the term “host” and “subject” are used interchangeably herein.
  • patient without further designation is intended to encompass any warm blooded vertebrate domesticated animal (including for example, but not limited to livestock, horses, cats, dogs and other pets) and humans.
  • a “prophylactic” treatment is a treatment administered to a subject, who either does not exhibit signs of a disease or exhibits only early signs of the disease, for the purpose of decreasing the risk of developing pathology associated with the disease.
  • alkyl by itself or as part of another substituent means a straight or branched aliphatic chain having the stated number of carbon atoms.
  • Ci-C n alkyl wherein n can be from 1 through 6, as used herein, represents a branched or linear alkyl group having from one to the specified number of carbon atoms.
  • Ci-C ⁇ alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, iso-propyl, butyl, iso-butyl, sec-butyl, tert-butyl, pentyl, hexyl and the like.
  • C2-C n alkenyl wherein n can be from 2 through 6, as used herein, represents an olefmically unsaturated branched or linear group having from 2 to the specified number of carbon atoms and at least one double bond.
  • C 2 -C n alkynyl wherein n can be from 2 to 6, refers to an unsaturated branched or linear group having from 2 to n carbon atoms and at least one triple bond.
  • Examples of such groups include, but are not limited to, 1-propynyl, 2-propynyl, 1-butynyl, 2- butynyl, 1-pentynyl, and the like.
  • aryl refers to a mono- or bicyclic carbocyclic ring system having one or two aromatic rings including, but not limited to, phenyl, naphthyl,
  • (C 1 -C3 alkyl)(C6-Cio aryl) refers to a 5 to 10 membered aryl that is attached to a parent moiety via a one to three membered alkyl chain.
  • heteroaryl refers to a mono- or bi- cyclic ring system containing one or two aromatic rings and containing at least one nitrogen, oxygen, or sulfur atom in an aromatic ring.
  • the size of the heteroaryl ring and the presence of substituents or linking groups are indicated by designating the number of carbons present.
  • (Ci-C n alkyl)(Cs-C6 heteroaryl) refers to a 5 or 6 membered heteroaryl that is attached to a parent moiety via a one to "n" membered alkyl chain.
  • acyl refers to alkylcarbonyl species and includes any group or radical of the form RCO- where R is an organic group.
  • acyl further comprises an organic radical derived from an organic acid by removal of the hydroxyl group from the carboxyl group.
  • acyl and OAc are used interchangeably herein.
  • acylation refers to the process of adding an acyl group to a compound.
  • butyryl as used herein encompasses its usual meaning in the art.
  • halo includes bromo, chloro, fluoro, and iodo.
  • haloalkyl refers to a alkyl radical bearing at least one halogen substituent, for example, chloromethyl, fluoroethyl or trifluoromethyl and the like.
  • heterocyclic group refers to a C3-C8 cycloalkyl group containing from one to three heteroatoms wherein the heteroatoms are selected from the group consisting of oxygen, sulfur, and nitrogen.
  • bicyclic represents either an unsaturated or saturated stable 7- to 12- membered bridged or fused bicyclic carbon ring. The bicyclic ring may be attached at any carbon atom which affords a stable structure.
  • the term includes, but is not limited to, naphthyl, dicyclohexyl, dicyclohexenyl, and the like.
  • lower alkyl refers to branched or straight chain alkyl groups comprising one to eight carbon atoms, including methyl, ethyl, propyl, isopropyl, n-butyl, t- butyl, neopentyl and the like.
  • heteroatom means for example oxygen, sulfur, nitrogen, phosphorus, or silicon (including, any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quaternized form of any basic nitrogen or; a substitutable nitrogen of a heterocyclic ring.
  • the compounds of the present invention can contain one or more asymmetric centers in the molecule.
  • any structure that does not designate the stereochemistry is to be understood as embracing all the various optical isomers, as well as racemic mixtures thereof.
  • the present invention includes within its scope all such isomers and mixtures thereof.
  • the compounds of the present invention may exist in tautomeric forms and the invention includes both mixtures and separate individual tautomers.
  • the following structure: is understood to represent a mixture of the structures:
  • carbarhamnoside is intended to refer to a rhamnoside wherein the ring oxygen has been replaced with a carbon.
  • a novel set of p90 Ribosomal S6 Kinase (RSK) inhibitors is described for use in treating diseases or conditions that are associated with excessive or undesired RSK activity.
  • the compounds disclosed herein are novel derivatives of the RSK specific inhibitor, kaempferol 3-O-(3",4"-di-O-acetyl-.alpha.-L-rhamnopyranoside), referred to herein as SLOlOl.
  • SLOlOl kaempferol 3-O-(3",4"-di-O-acetyl-.alpha.-L-rhamnopyranoside
  • modification of the substituents of the rhamnopyranoside moiety produced derivative compounds with superior RSK inhibitory activity relative to the parent SLOlOl compound. Accordingly, these novel SLOlOl derivative compounds are anticipated to be useful for any of the prior uses that have been described for the parent SLOlOl compound.
  • Ri, R 2 , R3, R 4 , R5, Re, R 7 , Rs and R9 are independently selected from the group consisting of hydrogen, halo, hydroxyl, -OCOR 14 , -COR 14 , C 1 -C 4 alkyl and C 1 -C 4 alkoxy;
  • Rio and Rn are independently selected from the group consisting of hydrogen, halo, hydroxyl, -NHOCOR M , -OCOR M , -CORi 4 and Ci-C 4 alkoxy;
  • R 12 is selected from the group consisting OfCi-C 4 alkyl, Ci-C 4 alkoxy, and [Ci-C 4 alkyl]CH 2 R 18 ;
  • Ri 3 is selected from the group consisting of hydrogen, hydroxyl, and
  • n are independently an integer from 0-3;
  • X is selected from the group consisting of O, CH 2 , and CF 2 ;
  • Y is selected from the group consisting of O, NR 1 5, and CR 1 0R 17 ;
  • Ri 4 is selected from the group consisting of hydrogen, and Ci-C 4 alkyl
  • Ri6 and Rn are independently selected from the group consisting of hydrogen, halo, hydroxyl, Ci-C 4 alkyl and Ci-C 4 alkoxy, and Ri 5, Ri 8 and Ri 9 are independently selected from the group consisting of hydrogen and hydroxyl, with the proviso that when X is O, R12 is not CH3, and when X is CH2, at least one of Rio and Rn is hydroxyl.
  • the RSK inhibitory compound comprises a compound of Formula I wherein R2 and R 4 are each hydrogen, Ri , R3,and R7 are each hydroxyl, R5, Re, Rs and R9 are independently selected from the group consisting of hydrogen, fluorine, hydroxyl, -OCOR H , - COR H and Ci-C 4 alkoxy,
  • Rio and Rn are independently selected from the group consisting of hydroxyl, -OCORH and -COR H ;
  • Ri 2 is selected from the group consisting of propyl, propyloxy, and
  • Ri3 is selected from the group consisting of hydrogen, hydroxyl, and -CR 1 8R 1 9;
  • X is selected from the group consisting of O, CH 2 , and CF 2 ;
  • Y is selected from the group consisting of O, NR 15 , and CRi 6R 17 ;
  • R H is selected from the group consisting of hydrogen, and C 1 -C 4 alkyl
  • Ri6 and Rn are independently selected from the group consisting of hydrogen, halo, hydroxyl and C 1 -C 4 alkoxy, and
  • Ri 5, Ri 8 and Ri 9 are independently selected from the group consisting of hydrogen and hydroxyl.
  • Y is O and Ri 3 is hydrogen or CH 3 .
  • Ri 0 and Rn are independently selected from the group consisting of hydroxyl and -COCH3;
  • R12 is propyl or -(CH 2 ) 2 CH 2 Ris;
  • R13 is hydrogen or CH3, Y is O; and
  • Ris is hydroxyl.
  • R 1 5 is hydrogen or C 1 -C 4 alkyl and Ri6 and Rn are independently selected from the group consisting of hydrogen, hydroxyl and Ci -C 4 alkoxy.
  • the RSK inhibitory compound comprises a compound of Formula I wherein X is CH 2 or CF 2 ; Y is O; Rn is -CHR 1 9 and at least one of Rio and Rn is hydroxyl.
  • X is CH 2 or CF 2 ; Y is O; Rio and Rn, are independently selected from the group consisting of hydroxyl and -COCH3; Ri 2 is propyl or -(CH 2 ) 2 CH 2 Ris; Rn is -CHRi 9 ; and Ris is hydroxyl.
  • Ri 5 is hydrogen or Ci-C 4 alkyl and Ri 6 and Rn are independently selected from the group consisting of hydrogen, hydroxyl and Ci-C 4 alkoxy.
  • a RSK specific inhibitory compound comprising a compound of the general structure of Formula III.
  • Ri and R 3 are independently selected from the group consisting of hydroxyl, - OCORi 4 , -CORi 4 , and Ci-C 4 alkoxy;
  • R5, Re, R7, R 8 and R9 are independently selected from the group consisting of hydrogen, halo, hydroxyl, -0C0R M , -C0R M , Ci-C 4 alkyl and Ci-C 4 alkoxy;
  • Rn and R20 are independently selected from the group consisting of hydroxyl, - NHOCORi 4 , -OCORi 4 , -C0R H and Ci-C 4 alkoxy;
  • X is selected from the group consisting of O, NH, CH 2 , and CF 2 ;
  • Y is selected from the group consisting of O and NRi 5;
  • Ri 4 is selected from the group consisting of hydrogen, and C 1 -C 4 alkyl
  • Ri5 is selected from the group consisting of hydrogen, halo, hydroxyl, Ci-C 4 alkyl and Ci-C 4 alkoxy.
  • X is O or CH 2 ;
  • Rio, Rn and R 2 o are independently selected from the group consisting of hydroxyl, - NHOCORi 4 , and -COR] 4 , wherein at least one of Rio, Rn and R 2 o is hydroxyl.
  • R 5 , R 6 , R 8 andRg are each hydrogen
  • Ri, R 3 and R7 are each hydroxyl
  • R 2 o is - COCH3
  • one of Rio and Rn is -COCH3 and the other is hydroxyl.
  • R 5 , R 6 , R 8 andRg are each hydrogen, Ri, R 3 and R7 are each hydroxyl, and Rio, Rn and R 2 o are independently selected from the group consisting of hydroxyl, -NHOCORi 4 , and -COCH3.
  • R 5 , R 6 , R 8 andR ⁇ are each hydrogen, R 1 , R 3 and R7 are each hydroxyl, and Rio, Rn and R 2 o are independently selected from the group consisting of hydroxyl and -COCH 3 .
  • R5, Re, Rs and Rg are independently selected from the group consisting of hydrogen, halo, hydroxyl, -OCOR H , -COR H , Ci-C 4 alkyl and Ci-C 4 alkoxy;
  • Rio, Rn and R 2 0 are independently selected from the group consisting of -COR H and hydroxyl;
  • R H is selected from the group consisting of hydrogen and C 1 -C 4 alkyl. In one embodiment at least one of Rio, Rn and R 2 0 is hydroxyl. In a further embodiment R 5 , R 6 , R 8 and R9 are each hydrogen and R 2 0 is -COCH3 and at least one of Rio and Rn is hydroxyl. In a further embodiment R 2 0 is -COCH3 and one of Rio and Rn is -COCH3 and the other is hydroxyl.
  • X is O, CF 2 or CH 2 ;
  • Rio, Rn and R 2 o are independently selected from the group consisting of OH, OCOR 8 , COR 8 , NHOCOR 8 and Ci-C 4 alkoxy; and Ri 2 is C 1 -C 4 alkyl, with the proviso that when X is O, R 12 is propyl.
  • X is O
  • R12 is propyl
  • at least one of Rio, Rn and R20 is -COCH3 and at least one of Rio, Rn and R20 is hydroxyl.
  • X is O, R12 is propyl
  • R20 is -COCH3 and one of Rio and Rn is -COCH3 and the other is hydroxyl.
  • Formula IV as disclosed above, but having one or more sulfhydryls (-SH) groups substituting at positions on the flavonoid ring that designate a hydroxyl group (e.g., at positions R 1 , R 2 , R3, R 4 , R5, Re and R7 of the compound of Formula I).
  • a compound is provided having the general structure of Formula IV as disclosed above, wherein one or more sulfhydryls (-SH) groups are present at positions selected from the group consisting of Ri, R3 and R7, as designated in the structure of Formula I.
  • a compound having the general structure of Formula IV as disclosed above, but having one or more acetamide (NHOCCH 3 ) groups substituting at positions on the sugar moiety that designate a hydroxyl group (i.e., at positions Rio and Ri 1 ).
  • the acetamide can be a substituted acetamide comprising NHOCORi 4 .
  • the compounds encompassed by Formula IV have greater stability in their interaction with RSK than does SLOlOl in its interaction with RSK.
  • the compounds of Formula IV have a greater ability to inhibit RSK than does SLOlOl.
  • the compounds comprised by Formula IV are modified to replace the hydroxyl groups of the flavonoid with sulfhydryls (-SH).
  • the compounds comprised by Formula IV are modified to replace the hydroxyl groups of the flavonoid with an acetamide (NHOCR H ), including for example: or substituted acetamide such as
  • salts may be appropriate.
  • acceptable salts are organic acid addition salts formed with acids which form a physiological acceptable anion, for example, tosylate, methanesulfonate, acetate, citrate, malonate, tartarate, succinate, benzoate, ascorbate, ⁇ -ketoglutarate, and ⁇ -glycerophosphate.
  • Suitable inorganic salts may also be formed, including hydrochloride, sulfate, nitrate, bicarbonate, and carbonate salts.
  • salts may be obtained using standard procedures well known in the art, for example by reacting a sufficiently basic compound such as an amine with a suitable acid affording a physiologically acceptable anion.
  • a sufficiently basic compound such as an amine
  • a suitable acid affording a physiologically acceptable anion.
  • Alkali metal (for example, sodium, potassium or lithium) or alkaline earth metal (for example calcium) salts of carboxylic acids can also be made.
  • a pharmaceutical composition comprising the compound of Formula I, II, III, IV or V and a pharmaceutically acceptable carrier.
  • novel SLOlOl derivative compounds disclosed herein have improved activity as RSK inhibitors relative to the previously described RSK inhibitor, SLOlOl (see Fig. 9).
  • One key difference appears to be the addition of an ethyl group at position 6 of the rhamnoside moiety of the SLOlOl parent compound (see structure of Formulas III and IV).
  • the SLOlOl derivative compounds disclosed herein also display surprisingly improved pharmacokinetic properties (e.g., improved metabolic stability, solubility and membrane permeability), which in turn will make these new compounds better drugs for the treatment of RSK related diseases (e.g. , cancer and intracellular pathogenic infections, e.g., Yersinia infections).
  • RSK related diseases e.g. , cancer and intracellular pathogenic infections, e.g., Yersinia infections.
  • the present disclosure provides a method of treating septicemia.
  • Septicemia is characterized by evidence of acute inflammation present throughout the entire body that ultimately results in multiple organ dysfunction. Since the endothelium is both the target for, and the source of, inflammatory mediators, it is a key organ in the development of septicemia.
  • a therapeutic strategy is provided that is based on the inhibition of RSK activity as a means of limiting the development of systemic inflammation. More particularly, systemic inflammation is controlled by modifying the pattern of inflammatory mediators released upon activation, and/or attenuating the response of the endothelium to the inflammatory mediators.
  • RSK activity Upon detection of an invading pathogen, monocytes and macrophages initiate inflammatory cascades resulting in secretion of inflammatory mediators that dramatically alter the function of the endothelial cells. Inhibition of RSK activity has been found by applicants to reduce pathogenic stimulated expression of adhesion factors in endothelial cells and to reduce the pathogenic stimulated expression of nitric oxide synthase by macrophages (see Figs 2-3). Accordingly, inhibiting RSK activity provides a means of reducing the systemic inflammatory response associated with septicemia, and thus provide a novel method for preventing dysfunction of the endothelium that results in tissue damage and subsequent multiple organ failure.
  • a composition and method for use in reducing the systemic inflammatory response associated with septicemia and thereby preventing or treating septicemia, wherein the composition comprises a RSK inhibiting agent.
  • the RSK specific inhibitors used in accordance with the disclosed methods are selected from any of the novel kaempferol 3-O-(3",4"-di-O-acetyl- ⁇ -L-rhamnopyranoside) derivative compounds disclosed herein.
  • a method of reducing pathogenic stimulated expression of adhesion factors in endothelial cells, or reducing the pathogenic stimulated expression of nitric oxide synthase by macrophages wherein an RSK inhibitor is administered to an individual in need thereof.
  • the RSK specific inhibitor comprises a compound having the structure of formula I:
  • Ri, R2, R3, R 4 , R5, Re, R7, Rs and R9 are independently selected from the group consisting of hydrogen, halo, hydroxyl, -OCOR 14 , -COR 14 , C 1 -C 4 alkyl and C 1 -C 4 alkoxy;
  • Rio and Rn are independently selected from the group consisting of hydrogen, halo, hydroxyl, -NHOCORi 4 , -OCORi 4 , -CORi 4 and Ci-C 4 alkoxy;
  • R 12 is selected from the group consisting OfCi-C 4 alkyl, C 1 -C 4 alkoxy, and [C 1 -C 4 alkyl]CH 2 R 18 ;
  • Ri 3 is selected from the group consisting of hydrogen, hydroxyl, and
  • n are independently an integer from 0-3;
  • X is selected from the group consisting of O, CH 2 , and CF 2 ;
  • Y is selected from the group consisting of O, NR 1 S, and CRi 6R 17 ;
  • R H is selected from the group consisting of hydrogen, and C 1 -C 4 alkyl
  • Ri6 and Rn are independently selected from the group consisting of hydrogen, halo, hydroxyl, C 1 -C 4 alkyl and C 1 -C 4 alkoxy, and
  • Ri 5, Ri 8 and Ri 9 are independently selected from the group consisting of hydrogen and hydroxyl, with the proviso that when X is O, Ri 2 is not CH3, and when X is CH 2 , at least one of Rio and Rn is hydroxyl.
  • the RSK inhibitory compound comprises a compound of Formula I wherein R 2 and R 4 are each hydrogen, Ri , R 3 ,and R7 are each hydroxyl, R5, Re, Rs and R9 are independently selected from the group consisting of hydrogen, fluorine, hydroxyl, -OCOR H , - COR H and Ci-C 4 alkoxy,
  • Rio and Rn are independently selected from the group consisting of hydroxyl, -OCOR 14 and -CORH;
  • R 12 is selected from the group consisting of propyl, propyloxy, and
  • Rn is selected from the group consisting of hydrogen, hydroxyl, and -CRisRisi;
  • X is selected from the group consisting of O, CH 2 , and CF 2 ;
  • Y is selected from the group consisting of O, NR 15 , and CR 1 6R 17 ;
  • R H is selected from the group consisting of hydrogen, and C 1 -C 4 alkyl
  • Ri6 and R 17 are independently selected from the group consisting of hydrogen, halo, hydroxyl and C 1 -C 4 alkoxy, and
  • Ri 5, Ri 8 and Ri 9 are independently selected from the group consisting of hydrogen and hydroxyl.
  • Y is O and Rn is hydrogen or CH 3 .
  • Ri 0 and Rn are independently selected from the group consisting of hydroxyl and -COCH3; Ri 2 is propyl or -(CH 2 ) 2 CH 2 Ris; R13 is hydrogen or CH3, Y is O; and Ri8 is hydroxyl.
  • R 1 5 is hydrogen or C 1 -C 4 alkyl and Ri6 and Rn are independently selected from the group consisting of hydrogen, hydroxyl and Ci -C 4 alkoxy.
  • X is CH 2 or CF 2 ; Y is O; R 1 3 is -CHRi 9 and at least one of Rio and Rn is hydroxyl.
  • X is CH 2 or CF 2 ; Y is O; Rio and Rn, are independently selected from the group consisting of hydroxyl and -COCH3; Ri 2 is propyl or -(CH 2 ) 2 CH 2 Ris; Ri3 is -CHRi 9 ; and Ri8 is hydroxyl.
  • Ri 5 is hydrogen or Ci-C 4 alkyl and Ri e and Rn are independently selected from the group consisting of hydrogen, hydroxyl and Ci-C 4 alkoxy.
  • Ri, and R 3 are independently selected from the group consisting of hydroxyl, - OCORi 4 , -CORi 4 , and Ci-C 4 alkoxy;
  • R5, Re, R7, Rs and Rg are independently selected from the group consisting of hydrogen, halo, hydroxyl, -0C0R M , -C0R M , Ci-C 4 alkyl and Ci-C 4 alkoxy;
  • Rio and Rn are independently selected from the group consisting of hydrogen, halo, hydroxyl, -NHOCORi 4 , -OCORi 4 , -CORi 4 and Ci-C 4 alkoxy;
  • Ri 3 is selected from the group consisting of hydrogen, hydroxyl, and
  • n are independently an integer from 0-3;
  • X is selected from the group consisting of O, NH, CH 2 , and CF 2 ;
  • Y is selected from the group consisting of O and NRi 5;
  • Ri 4 is selected from the group consisting of hydrogen, and Ci-C 4 alkyl
  • Ri 5, Ri 8 and Ri 9 are independently selected from the group consisting of hydrogen and hydroxyl.
  • Y is O, Rio and Rn, are independently selected from the group consisting of hydroxyl and -COCH 3 ;
  • R 13 is hydrogen or CH 3 .
  • R 2 , R 4 R5, Re, Rs and R9 are each hydrogen, Ri , R3, and R7 are each hydroxyl.
  • a RSK specific inhibitory compound comprising a compound of the general structure of Formula III.
  • Ri, and R 3 are independently selected from the group consisting of hydroxyl, - OCORi 4 , -CORi 4 , and Ci-C 4 alkoxy;
  • R5, R ⁇ , R7, Rs and R9 are independently selected from the group consisting of hydrogen, halo, hydroxyl, -0C0R M , -COR M , Ci-C 4 alkyl and Ci-C 4 alkoxy;
  • Rn and R20 are independently selected from the group consisting of hydroxyl, - NHOCORi 4 , -OCORi 4 , -C0R H and Ci-C 4 alkoxy;
  • X is selected from the group consisting of O, NH, CH 2 , and CF 2 ;
  • Y is selected from the group consisting of O and NRi 5;
  • Ri 4 is selected from the group consisting of hydrogen, and C 1 -C 4 alkyl
  • Ri5 is selected from the group consisting of hydrogen, halo, hydroxyl, Ci-C 4 alkyl and Ci-C 4 alkoxy.
  • X is O or CH 2 ;
  • Rio, Rn and R 2 o are independently selected from the group consisting of hydroxyl, - NHOCORi 4 , and -COR] 4 , wherein at least one of Rio, Rn and R 2 o is hydroxyl.
  • R 5 , R 6 , R 8 andRg are each hydrogen
  • Ri, R 3 and R7 are each hydroxyl
  • R 2 o is - COCH3
  • one of Rio and Rn is -COCH3 and the other is hydroxyl.
  • R5, R5, Rs and Rg are independently selected from the group consisting of hydrogen, halo, hydroxyl, -OCOR H , -COR H , Ci-C 4 alkyl and Ci-C 4 alkoxy;
  • Rio, Rn and R 2 0 are independently selected from the group consisting of -COR H and hydroxyl, and R H is selected from the group consisting of hydrogen and C 1 -C 4 alkyl. In one embodiment at least one of Rio, Rn and R 2 0 is hydroxyl. In a further embodiment R5, K ⁇ , Rs and R9 are each hydrogen and R 2 0 is -COCH 3 and at least one of Rio and Rn is hydroxyl. In a further embodiment R 2 0 is -COCH3 and one of Rio and Rn is -COCH3 and the other is hydroxyl.
  • the administered RSK specific inhibitor comprises a compound having the structure of Formula IV, and more particularly the RSK inhibitor has the structure:
  • Rio, Rn and R 2 0 are independently selected from the group consisting of OH, OCOR 8 , COR 8 , NHOCOR 8 and Ci-C 4 alkoxy.
  • at least one of Ri 0 , Rn and R 2 0 is -COCH3 and at least one of Rio, Rn and R 2 0 is hydroxyl.
  • R 2 0 is -COCH3 and one of Rio and Rn is -COCH3 and the other is hydroxyl.
  • endosome/phagosome maturation as a means of circumventing a host's cells ability to destroy and remove the pathogen from the cell.
  • RSK activity is involved in endosomal/phagosomal maturation and that that pathogenic inhibition of endosome/phagosome maturation requires RSK activity.
  • inhibition of RSK activity as detailed herein has been found to decrease the pathogen's ability to impede endosome/phagosome maturation and can improve the host organism's ability to resist and/or mitigate pathogen infections. More particularly, the present application discloses that an inhibitor of RSK activity protects the host-cell's cytoskeleton from pathogen- induced actin reorganization, and furthermore that a RSK inhibitor reduces the viability of internalized Y. pseudotuberculosis (see Fig 4A) through an indirect mechanism (see Fig. 4B).
  • the present invention provides compositions and methods for inhibiting native RSK activity in the cells of a potential host organism as a means of interfering with the ability of a pathogen to avoid the microbicidal machinery of the host.
  • the infective capabilities of the pathogenic organism are reduced.
  • Current anti-infective agents target the pathogen with antibiotics or anti-adhesion therapeutics.
  • the class of anti-infective agents disclosed herein target the host cell signaling events required by the pathogen to establish and maintain infection.
  • the present invention encompasses compositions and methods useful for providing protection by targeting the host rather than the pathogen.
  • the host is a human.
  • One aspect of the present disclosure encompasses the use of inhibitors of RSK activity, as novel anti- infective agents. More particularly, in one embodiment a composition and method for inhibiting the ability of intracellular pathogens to initiate or maintain an infection is provided, wherein the targeted pathogen has the capacity to impede endosomal/phagosomal maturation.
  • the method comprises administering an anti-infective pharmaceutical composition that comprises an inhibitor of RSK activity and a pharmaceutically acceptable carrier.
  • the RSK inhibiting fiavonoid-like compound comprises a compound of the general structure of Formula I: wherein Ri, R 2 , R3, R 4 , R5, Re, R 7 , Rs and R9 are independently selected from the group consisting of hydrogen, halo, hydroxyl, -OCOR 14 , -COR 14 , C 1 -C 4 alkyl and C 1 -C 4 alkoxy;
  • Rio and Rn are independently selected from the group consisting of hydrogen, halo, hydroxyl, -NHOCORi 4 , -OCOR H , -COR 14 and Ci-C 4 alkoxy;
  • R 12 is selected from the group consisting OfC 2 -C 4 alkyl, C 1 -C 4 alkoxy, and [Ci-C 4 alkyl]CH 2 R 18 ;
  • Ri 3 is selected from the group consisting of hydrogen, hydroxyl, and
  • n are independently an integer from 0-3;
  • X is selected from the group consisting of O, CH 2 , and CF 2 ;
  • Y is selected from the group consisting of O, NR 15 , and CR ⁇ R 17 ;
  • R H is selected from the group consisting of hydrogen, and Ci-C 4 alkyl
  • Ri6 and Rn are independently selected from the group consisting of hydrogen, halo, hydroxyl, Ci-C 4 alkyl and C 1 -C 4 alkoxy, and
  • Ri 5, Ri 8 and Ri 9 are independently selected from the group consisting of hydrogen and hydroxyl.
  • the RSK inhibitory compound comprises a compound of Formula I wherein R 2 and R 4 are each hydrogen, Ri , R3,and R7 are each hydroxyl, R5, R ⁇ , Rs and R9 are independently selected from the group consisting of hydrogen, fluorine, hydroxyl, -OCORi 4 , - CORi 4 and Ci-C 4 alkoxy,
  • Rio and Rn are independently selected from the group consisting of hydrogen, hydroxyl, -OCORi 4 , and -CORi 4 ;
  • Ri 2 is selected from the group consisting of propyl, propyloxy, and -(CH 2 ) 2 CH 2 Ri 8 ;
  • Rn is selected from the group consisting of hydrogen, hydroxyl, and -CRisRi9;
  • X is selected from the group consisting of O, CH 2 , and CF 2 ;
  • Y is selected from the group consisting of O, NR 1 5, and CRi ⁇ R 17 ;
  • R H is selected from the group consisting of hydrogen, and Ci-C 4 alkyl
  • Ri6 and Rn are independently selected from the group consisting of hydrogen, halo, hydroxyl and Ci -C 4 alkoxy, and
  • Ri 5, Ri 8 and Ri 9 are independently selected from the group consisting of hydrogen and hydroxyl.
  • Y is O and Ri 3 is hydrogen or CH 3 .
  • Ri 0 and Rn are independently selected from the group consisting of hydroxyl and -COCH 3 ;
  • Rj 2 is propyl or -(CH 2 ) 2 CH 2 Ri ⁇ ;
  • R 1 3 is hydrogen or CH 3 , Y is O; and
  • Ris is hydroxyl.
  • R 1 5 is hydrogen or Ci-C 4 alkyl and Ri6 and Rn are independently selected from the group consisting of hydrogen, hydroxyl and Ci-C 4 alkoxy.
  • the RSK inhibitory compound comprises a compound of Formula I wherein X is CH 2 or CF 2 ; Y is O; R 1 3 is -CHR 1 9 and at least one of Rio and Rn is hydroxyl.
  • X is CH 2 or CF 2 ; Y is O; Rio and Rn, are independently selected from the group consisting of hydroxyl and -COCH 3 ; Ri 2 is propyl or -(CH 2 ) 2 CH 2 Ri 8 ; Ri3 is -CHR19; and Ris is hydroxyl.
  • R15 is hydrogen or Ci-C 4 alkyl and Ri 6 and Rn are independently selected from the group consisting of hydrogen, hydroxyl and Ci-C 4 alkoxy.
  • Ri, and R 3 are independently selected from the group consisting of hydroxyl, - OCORi 4 , -CORi 4 , and Ci-C 4 alkoxy;
  • R5, R ⁇ , R 7 , R ⁇ and R9 are independently selected from the group consisting of hydrogen, halo, hydroxyl, -0C0R M , -C0R M , Ci-C 4 alkyl and Ci-C 4 alkoxy;
  • Rio and Rn are independently selected from the group consisting of hydrogen, halo, hydroxyl, -NH0C0R M , -OCOR M , -C0R H and Ci-C 4 alkoxy;
  • Ri 3 is selected from the group consisting of hydrogen, hydroxyl, and
  • n are independently an integer from 0-3;
  • X is selected from the group consisting of O, NH, CH 2 , and CF 2 ;
  • Y is selected from the group consisting of O and NRi 5;
  • Ri 4 is selected from the group consisting of hydrogen, and Ci-C 4 alkyl
  • Ri 5, Ri 8 and Ri 9 are independently selected from the group consisting of hydrogen and hydroxyl.
  • Y is O, Rio and Rn, are independently selected from the group consisting of hydroxyl and -COCH3; R 1 3 is hydrogen or CH3.
  • R 2 , R 4 R5, Re, Rs and Rg are each hydrogen, Ri , R3, and R7 are each hydroxyl.
  • a RSK specific inhibitory compound comprising a compound of the general structure of Formula III.
  • Ri, and R3 are independently selected from the group consisting of hydroxyl, -
  • R5, Re, R 7 , R ⁇ and R9 are independently selected from the group consisting of hydrogen, halo, hydroxyl, -0C0R H , -COR 14 , Ci-C 4 alkyl and Ci-C 4 alkoxy;
  • Rn and R 2 o are independently selected from the group consisting of hydroxyl, - NHOCORi 4 , -OCORi 4 , -CORi 4 and Ci-C 4 alkoxy;
  • X is selected from the group consisting of O, NH, CH 2 , and CF 2 ;
  • Y is selected from the group consisting of O and NRi 5;
  • R H is selected from the group consisting of hydrogen, and Ci-C 4 alkyl
  • Ri5 is selected from the group consisting of hydrogen, halo, hydroxyl, C 1 -C 4 alkyl and Ci -C 4 alkoxy.
  • X is O or CH 2 ;
  • Rio, Rn and R20 are independently selected from the group consisting of hydroxyl, - NHOCOR H , and -COR 14 , wherein at least one of Rio, Rn and R 2 0 is hydroxyl.
  • R 5 , R 6 , R 8 andRg are each hydrogen
  • Ri, R 3 and R7 are each hydroxyl
  • R 2 0 is - COCH 3
  • one of Rio and Rn is -COCH 3 and the other is hydroxyl.
  • R 5 , Rg, Rs and R 9 are independently selected from the group consisting of hydrogen, halo, hydroxyl, -OCOR H , -CORi 4 , Ci-C 4 alkyl and Ci-C 4 alkoxy;
  • Rio, Rn and R20 are independently selected from the group consisting of -CORi 4 and hydroxyl, and Ri 4 is selected from the group consisting of hydrogen and Ci-C 4 alkyl.
  • Ri 4 is selected from the group consisting of hydrogen and Ci-C 4 alkyl.
  • at least one of Rio, Rn and R 2 0 is hydroxyl.
  • R 5 , R 6 , R 8 and R9 are each hydrogen and R20 is -COCH3 and at least one of Rio and Rn is hydroxyl.
  • R 2 o is -COCH 3 and one of Rio and Rn is -COCH 3 and the other is hydroxyl.
  • the administered RSK specific inhibitor comprises a compound having the structure of Formula IV, and more particularly the RSK inhibitor has the structure:
  • Rio, Rn and R20 are independently selected from the group consisting of OH, OCOR 8 , COR 8 , NHOCOR 8 and Ci-C 4 alkoxy.
  • at least one of Ri 0 , Rn and R 2 0 is -COCH3 and at least one of Rio, Rn and R 2 0 is hydroxyl.
  • R 2 0 is -COCH3 and one of Rio and Rn is -COCH3 and the other is hydroxyl.
  • the RSK inhibitory compounds can be formulated into pharmaceutical compositions by combining them with an appropriate pharmaceutically acceptable carrier using standard techniques known to those skilled in the art.
  • the compositions may further comprise additional anti-microbial and antibacterial components.
  • Anti-microbial agents suitable for use in accordance with the present invention are known to those skilled in the art and include antibiotics, both natural and synthetic derivatives as well as other compounds known to have anti-microbial activity (see for example US Patent no: 7,358,359, the disclosure of which is incorporated herein by reference).
  • a pharmaceutically acceptable anti-microbial agent is combined with a RSK inhibitor to treat an established infection by an intercellular pathogen or to treat a patient prophylactically to prevent the establishment of an infection by an intercellular pathogen.
  • the combination therapy can be administered simultaneously by administering a single composition comprising a known antimicrobial agent and a RSK inhibitor or the anti-microbial agent can be administered prior to or after the administration of the RSK inhibitor.
  • the antimicrobial agent is
  • the two agents are each administered within 12 hours, 8 hours, 4 hours, 2 hours or 1 hour of each other.
  • a method of inhibiting the proliferation of cancer cells comprises the steps of administering a compound of the general structure of Formula I, II, III, IV or V.
  • the composition comprises compounds of the general structure of Formula IV are administered to inhibit the proliferation of neoplastic cells and to treat cancer.
  • the RSK inhibitory SLO 101 analogs can be used in a novel method of inhibiting endothelial cell migration. Inhibition of endothelial cell migration inhibits the ability of endothelial cells to conduct the initial steps needed for angiogenesis, leading to alleviation of the symptoms and restoration of the health of patients suffering from diseases associated with inappropriate angiogenic activity.
  • a composition comprising a RSK inhibitory SLOlOl analog is placed in contact with endothelial cells of a patient in need of reduced angiogenic activity.
  • pharmaceutical compositions comprising a RSK specific inhibitor can be used to treat diseases as diverse as arthritis, diabetic retinopathy, and cancer.
  • the RSK specific inhibitory compound comprises a compound of the general structure of Formula I:
  • Ri, R 2 , R3, R 4 , R5, R5, R7, Rs and R9 are independently selected from the group consisting of hydrogen, halo, hydroxyl, -OCOR14, -COR14, Ci-C 4 alkyl and Ci-C 4 alkoxy;
  • Rio and Rn are independently selected from the group consisting of hydrogen, halo, hydroxyl, -NHOCORi 4 , -OCOR M , -COR H and Ci-C 4 alkoxy;
  • R12 is selected from the group consisting OfC 2 -C 4 alkyl, Ci-C 4 alkoxy, and [C1-C4 alkyl]CH 2 R 18 ;
  • Ri 3 is selected from the group consisting of hydrogen, hydroxyl, and
  • n are independently an integer from 0-3;
  • X is selected from the group consisting of O, CH 2 , and CF 2 ;
  • Y is selected from the group consisting of O, NRi 5, and CRi 6Ri 7 ;
  • R H is selected from the group consisting of hydrogen, and Ci-C 4 alkyl
  • Ri6 and Ri 7 are independently selected from the group consisting of hydrogen, halo, hydroxyl, Ci-C 4 alkyl and Ci-C 4 alkoxy, and
  • Ri 5, Ri 8 and Ri 9 are independently selected from the group consisting of hydrogen and hydroxyl.
  • the RSK inhibitory compound comprises a compound of Formula I wherein R 2 and R 4 are each hydrogen, Ri , R3,and R7 are each hydroxyl, R5, Re, Rs and R9 are independently selected from the group consisting of hydrogen, fluorine, hydroxyl, -OCORi 4 , - CORi 4 and Ci-C 4 alkoxy,
  • Rio and Rn are independently selected from the group consisting of hydrogen, hydroxyl, -OCOR H , and -COR H ;
  • Ri 2 is selected from the group consisting of propyl, propyloxy, and -(CH 2 ) 2 CH 2 Ri 8 ;
  • Ri3 is selected from the group consisting of hydrogen, hydroxyl, and -CR18R19;
  • X is selected from the group consisting of O, CH 2 , and CF 2 ;
  • Y is selected from the group consisting of O, NRi 5, and CR ⁇ Ri 7 ;
  • Ri 4 is selected from the group consisting of hydrogen, and Ci-C 4 alkyl
  • Ri6 and Ri 7 are independently selected from the group consisting of hydrogen, halo, hydroxyl and Ci-C 4 alkoxy, and
  • Ri 5, Ri 8 and Ri 9 are independently selected from the group consisting of hydrogen and hydroxyl.
  • Y is O and Ri 3 is hydrogen or CH 3 .
  • Ri 0 and Rn are independently selected from the group consisting of hydroxyl and -COCH3; Ri 2 is propyl or -(CH 2 ) 2 CH 2 Ris; R13 is hydrogen or CH3, Y is O; and Ri8 is hydroxyl.
  • R 4 5 is hydrogen or Ci-C 4 alkyl and Ri ⁇ and Rn are independently selected from the group consisting of hydrogen, hydroxyl and Ci -C 4 alkoxy.
  • the RSK inhibitory compound comprises a compound of Formula I wherein X is CH 2 or CF 2 ; Y is O; R 1 3 is -CHR 1 9 and at least one of Rio and Rn is hydroxyl.
  • X is CH 2 or CF 2 ; Y is O; Rio and Rn, are independently selected from the group consisting of hydroxyl and -COCH3; R 12 is propyl or
  • Ri3 is -CHRi 9 ; and Ris is hydroxyl.
  • Ri 5 is hydrogen or Ci-C 4 alkyl and Ri 6 and Ri 7 are independently selected from the group consisting of hydrogen, hydroxyl and Ci-C 4 alkoxy.
  • Ri, and R 3 are independently selected from the group consisting of hydroxyl, - OCORi 4 , -COR 14 , and C]-C 4 alkoxy;
  • R5, R ⁇ , R-7, Rs and R ⁇ > are independently selected from the group consisting of hydrogen, halo, hydroxyl, -OCOR H , -CORi 4 , Ci-C 4 alkyl and Ci-C 4 alkoxy;
  • Rio and Rn are independently selected from the group consisting of hydrogen, halo, hydroxyl, -NHOCORi 4 , -OCORi 4 , -C0R H and Ci-C 4 alkoxy;
  • Ri 3 is selected from the group consisting of hydrogen, hydroxyl, and
  • n are independently an integer from 0-3;
  • X is selected from the group consisting of O, NH, CH 2 , and CF 2 ;
  • Y is selected from the group consisting of O and NRi 5;
  • Ri 4 is selected from the group consisting of hydrogen, and Ci-C 4 alkyl; and Ri 5, Ri 8 and Ri 9 are independently selected from the group consisting of hydrogen and hydroxyl.
  • Y is O, Rio and Rn, are independently selected from the group consisting of hydroxyl and -COCH 3 ; R 13 is hydrogen or CH 3 .
  • R 2 , R 4 R5, Rs, Rs and Rg are each hydrogen, Ri , R3, and R7 are each hydroxyl.
  • a RSK specific inhibitory compound comprising a compound of the general structure of Formula III.
  • Ri, and R 3 are independently selected from the group consisting of hydroxyl, - OCORi 4 , -CORi 4 , and Ci-C 4 alkoxy;
  • R5, R ⁇ , R7, Rs and R ⁇ > are independently selected from the group consisting of hydrogen, halo, hydroxyl, -OCOR M , -COR M , Ci-C 4 alkyl and Ci-C 4 alkoxy;
  • Rio, Rn and R20 are independently selected from the group consisting of hydroxyl, - NHOCORi 4 , -OCOR H , -COR H and Ci-C 4 alkoxy;
  • X is selected from the group consisting of O, NH, CH 2 , and CF 2 ;
  • Y is selected from the group consisting of O and NRi 5 ;
  • Ri 4 is selected from the group consisting of hydrogen, and Ci-C 4 alkyl
  • Ri5 is selected from the group consisting of hydrogen, halo, hydroxyl, Ci-C 4 alkyl and Ci-C 4 alkoxy.
  • X is O or CH 2 ;
  • Rio, Rn and R 2 o are independently selected from the group consisting of hydroxyl, - NHOCORi 4 , and -COR] 4 , wherein at least one of Rio, Rn and R 2 o is hydroxyl.
  • R 5 , R 6 , R 8 andRg are each hydrogen
  • Ri, R 3 and R7 are each hydroxyl
  • R 2 o is - COCH3
  • one of Rio and Rn is -COCH3 and the other is hydroxyl.
  • a RSK specific inhibitory compound is provided comprising a compound of Formula IV:
  • R 5 , R 6 , R 8 and Rg are independently selected from the group consisting of hydrogen, halo, hydroxyl, -OCORi 4 , -CORi 4 , Ci-C 4 alkyl and Ci-C 4 alkoxy;
  • Rio, Rn and R 2 0 are independently selected from the group consisting of -CORi 4 and hydroxyl, and Ri 4 is selected from the group consisting of hydrogen and Ci-C 4 alkyl.
  • at least one of Rio, Rn and R20 is hydroxyl.
  • R5, R ⁇ , Rs and R9 are each hydrogen and R 2 0 is -COCH3 and at least one of Rio and Rn is hydroxyl.
  • R 2 0 is -COCH3 and one of Rio and Rn is -COCH3 and the other is hydroxyl.
  • the administered RSK specific inhibitor comprises a compound having the structure of Formula IV, and more particularly the RSK inhibitor has the structure:
  • Ri 0 , Rn and R 2 0 are independently selected from the group consisting of OH, OCOR 8 , COR 8 , NHOCOR 8 and Ci-C 4 alkoxy.
  • at least one of Ri 0 , Rn and R20 is -COCH3 and at least one of Rio, Rn and R20 is hydroxyl.
  • R20 is -COCH3 and one of Rio and Rn is -COCH3 and the other is hydroxyl.
  • SLOlOl derivative RSK inhibitors disclosed herein can be formulated as pharmaceutical compositions and administered to a mammalian host such as a human patient in a variety of forms adapted to the chosen route of administration, i.e., orally or parenterally, by intravenous, intramuscular, topical or subcutaneous routes.
  • the present compounds may be systemically administered, e.g., orally, in combination with a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable edible carrier. They may be enclosed in hard or soft shell gelatin capsules, may be compressed into tablets, or may be incorporated directly with the food of the patient's diet.
  • a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable edible carrier.
  • the active compound may be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like.
  • Such compositions and preparations should contain at least 0.1% of active compound.
  • the percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 60% of the weight of a given unit dosage form.
  • the amount of active compound in such therapeutically useful compositions is such that an effective dosage level will be obtained.
  • the tablets, troches, pills, capsules, and the like may also contain the following:
  • binders such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring may be added.
  • a liquid carrier such as a vegetable oil or a polyethylene glycol.
  • Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form.
  • tablets, pills, or capsules may be coated with gelatin, wax, shellac or sugar and the like.
  • a syrup or elixir may contain the active compound, sucrose or fructose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor.
  • any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed.
  • the active compound may be incorporated into sustained- release preparations and devices.
  • the active compound may also be administered intravenously or intraperitoneally by infusion or injection.
  • Solutions of the active compound or its salts can be prepared in water, optionally mixed with a nontoxic surfactant.
  • Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes.
  • the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage.
  • the liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof.
  • the proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • Sterile injectable solutions are prepared by incorporating the active compound in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilization.
  • the one method of preparation includes vacuum drying and the freeze drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile- filtered solutions.
  • the present compounds may be applied in pure form, i.e., when they are liquids. However, it will generally be desirable to administer them to the skin as compositions or formulations, in combination with a dermatologically acceptable carrier, which may be a solid or a liquid.
  • Useful solid carriers include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like.
  • Useful liquid carriers include water, alcohols or glycols or water-alcohol/glycol blends, in which the present compounds can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants.
  • Adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use.
  • the resultant liquid compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using pump-type or aerosol sprayers.
  • Thickeners such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like, for application directly to the skin of the user.
  • Examples of useful dermato logical compositions which can be used to deliver the compounds of formula I to the skin are known to the art; for example, see Jacquet et al. (U.S. Pat. No. 4,608,392), Geria (U.S. Pat. No. 4,992,478), Smith et al. (U.S. Pat. No. 4,559,157) and Wortzman (U.S. Pat. No. 4,820,508).
  • Useful dosages of the novel RSK inhibitors disclosed herein can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art; for example, see U.S. Pat. No. 4,938,949.
  • the concentration of the novel RSK inhibitors disclosed herein in a liquid composition will be from about 0.1-25 wt-%, preferably from about 0.5-10 wt-%.
  • concentration in a semi-solid or solid composition such as a gel or a powder will be about 0.1-5 wt-%, preferably about 0.5-2.5 wt-%.
  • the amount of the compound, or an active salt or derivative thereof, required for use in treatment will vary not only with the particular salt selected but also with the route of administration, the nature of the condition being treated and the age and condition of the patient and will be ultimately at the discretion of the attendant physician or clinician.
  • a suitable dose will be in the range of from about 0.5 to about 100 mg/kg, e.g., from about 10 to about 75 mg/kg of body weight per day, such as 3 to about 50 mg per kilogram body weight of the recipient per day, preferably in the range of 6 to 90 mg/kg/day, most preferably in the range of 15 to 60 mg/kg/day.
  • the compound is conveniently administered in unit dosage form; for example, containing 5 to 1000 mg, conveniently 10 to 750 mg, most conveniently, 50 to 500 mg of active ingredient per unit dosage form.
  • the active ingredient should be administered to achieve peak plasma concentrations of the active compound of from about 0.5 to about 75 ⁇ M, preferably, about 1 to 50 ⁇ M, most preferably, about 2 to about 30 ⁇ M. This may be achieved, for example, by the intravenous injection of a 0.05 to 5% solution of the active ingredient, optionally in saline, or orally administered as a bolus containing about 1-100 mg of the active ingredient.
  • Desirable blood levels may be maintained by continuous infusion to provide about 0.01-5.0 mg/kg/hr or by intermittent infusions containing about 0.4-15 mg/kg of the active
  • the desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four or more sub-doses per day.
  • the sub-dose itself may be further divided, e.g., into a number of discrete loosely spaced administrations; such as multiple inhalations from an insufflator or by application of a plurality of drops into the eye.
  • an "instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the composition of the invention for its designated use.
  • the instructional material of the kit of the invention may, for example, be affixed to a container which contains the composition or be shipped together with a container which contains the composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the composition be used cooperatively by the recipient.
  • the method of the invention includes a kit comprising a novel RSK inhibitor disclosed herein and an instructional material which describes administering the inhibitor or a composition comprising the inhibitor to a cell or a subject.
  • a kit comprising a (preferably sterile) solvent suitable for dissolving or suspending the composition of the invention prior to administering the compound to a cell or a subject is known to those skilled in the art, such as a kit comprising a (preferably sterile) solvent suitable for dissolving or suspending the composition of the invention prior to administering the compound to a cell or a subject.
  • a kit comprising a (preferably sterile) solvent suitable for dissolving or suspending the composition of the invention prior to administering the compound to a cell or a subject.
  • the subject is a human.
  • TBDPS tert-butyldiphenylsilyl
  • THF tetrahydrofuran
  • EDCl l-(3-dimethylaminopropyl)-3-ethylcarbodiimide
  • DMAP 4-dimethylaminopyridine
  • TSOH 4-toluene sulfonic acid
  • DMF dimethylformamide
  • Bn benzyl
  • MTBE methyl tert-butyl ether.
  • R 0 H or OTBDPS
  • Synthesis of the Aglycone moiety of the SLOlOl analogs can be prepared as described in Scheme I or II of Example 1 or as described in Example 2.
  • the first route as outlined in Scheme IV involves a direct coupling of the desired aglycone (with the required protecting groups) and a suitably protected sugar/cyclitol coupling partner which can be coupled via a direct glycosylation (SNl or SN2)/cyclitolization reaction (SN2). The product of this coupling is then deprotected as required.
  • the second route as outlined in Scheme 2 involves a direct coupling to the desired aglycone (with the required protecting groups) and a suitably protected pyranone/Enone coupling partner which can be coupled via a Pd-catalyzed glycosylation/cyclitolization reaction.
  • the pyranone/enone product of this coupling is then converted into a pyran product with the appropriate C-4 functionality.
  • this product can be prepared from the aglycone and a suitably protected pyran/cyclohexene coupling partner which can be coupled via a related Pd-catalyzed glycosylation/cyclitolization reaction.
  • the C2/C3 functionality can be installed via post-glycosylation transformations and any protecting groups can be removed.
  • Carbasugars have been known as sugar mimics, in which the ring oxygen of the sugar moiety was replaced with a methylene group. This substitution imparts stability to the sugar moiety reducing acid and enzymatic hydrolysis and thus provides substantially improved overall bio stability.
  • eEF2 eukaryotic elongation factor
  • RSK phosphorylates and inactivates EF2K in response to mitogenic stimulations, which leads to a decrease in eEF2 phosphorylation (Wang, et al. Embo J 20:4370-9).
  • eEF2 is phosphorylated by the active EF2K.
  • mitogens such as phorbol dibutyrate (PDB) results in reduced phosphorylation of eEF2 due to inactivation of EF2K by RSK. Therefore, the phosphorylation state of eEF2 is an indicator of RSK activity.
  • PDB phorbol dibutyrate
  • SLOlOl increases peEF2 levels because RSK no longer inhibits EF2K. The levels of total eEF2 were not altered by any of the treatments.
  • SLOlOl inhibits RSK activity in J774A.1 cells and the phosphorylation state of eEF2 can be used to detect RSK inhibition the macrophages.
  • LPS activation of macrophages results in secretion of factors that stimulate the innate immune system.
  • J774A.1 cells were treated with 1 ⁇ g/ml LPS (Escherichia coli 0111 :B4, Sigma L4391) and 60 ⁇ M SLOlOl or vehicle. Twenty- four hours after LPS treatment the cells were lysed as previously described (Traish, et al., 1998. J. Biol. Chem. 273 : 13317-13323) in preparation for immunoblot analysis.
  • RSK inhibition modifies the pattern of factors expressed upon LPS exposure by altering expression of specific LPS-induced genes. It was previously shown that RSK activity is required for phorbol ester induced COX-2 expression in human fibroblasts (Cieslik, et al., 2005. J Biol Chem 280:18411-7). As demonstrated herein, RSK activity is required for LPS-stimulated iNOS expression. Thus, RSK activity is essential for induction of at least two factors integral to the inflammatory response of macrophages to LPS-challenge.
  • RSK inhibitors will be useful therapeutic agents for reducing the development of septicemia as well as for treating diseases associated with chronic inflammation such as rheumatoid arthritis, inflammatory bowel syndrome, atherosclerosis, multiple sclerosis, asthma, and diabetes.
  • SLOlOl interferes with the ability of Y. pseudotuberculosis to impede
  • SLOlOl treatment of macrophages is anticipated to result in fewer bacteria surviving internalization into the host cell. As seen in Fig. 4A, fewer live bacteria are extracted from cells treated with SLOlOl relative to the bacteria extracted from vehicle-treated macrophages. Furthermore, as shown by the data of Fig. 4B, SLOlOl does not directly affect the growth of Y. pseudotuberculosis. Thus, SLOlOl- treatment interferes with accumulation of the actin ring around the early endosome and most likely functions to inhibit infection by restoring function to the microbicidal machinery of the host cell.
  • SLOlOl represents one member of a novel class of anti- infective agents that protect the host by interfering with the ability of the pathogen to disrupt or avoid the microbicidal machinery of the host cell.
  • SLOlOl has the potential to provide protection from a number of intracellular pathogens that survive in the host cell by inhibiting endosome/phagosome maturation including those organisms listed in Table 1.
  • MCF-7 human breast cancer cell line
  • MCF-7 and MCF-IOA cells were pre-incubated with vehicle, 50 ⁇ M U0126 or the indicated concentration of SLOlOl-I for 3 hr (Fig. 8D).
  • Cells were treated with 500 nM PDB for 30 min prior to lysis. Protein concentration of lysates was measured and lysates were electrophoresed, transferred and immunoblotted. Equal loading of lysate is demonstrated by the anti-Ran immunoblot.
  • SLOlOl-I phorbol dibutyrate (PDB)-induced pi 40 phosphorylation as does 50 ⁇ M UO 126, a MEK inhibitor.
  • PDB phorbol dibutyrate
  • SLOlOl-I does not effect the phosphorylation of RSK2, as indicated by the reduced electrophoretic mobility of RSK2, nor the activation of MAPK, as detected by the anti-active MAPK antibody (see Fig. 8D). Therefore, SLOlOl-I does not inhibit upstream kinases necessary for PDB-stimulated RSK phosphorylation, namely MAPK, MEK, Raf and PKC.
  • SLOlOl-I could inhibit the growth rate of MCF-7 cells, which are more representative of human cancers than the Ha-Ras transformed cell line. Remarkably, SLOlOl-I inhibited proliferation of MCF-7 cells but had no effect on the growth of the normal breast cell line, MCF-IOA (Fig. 8A), even though SLOlOl-I prevented the PDB-induced pl40 phosphorylation in MCF-IOA cells (Fig. 8D). Furthermore, SLOlOl-I inhibits the growth rate of MCF-7 cells at an efficacy that parallels its ability to suppress RSK activity in vivo.
  • siRNA short, interfering RNAs
  • Glutathione-S-transferase (GST)-fusion protein (1 g) containing the sequence RRRLASTNDKG (SEQ ID NO: 3, for serine/threonine kinase assays) or
  • VSVSETDDYAEIIDEEDTFT (SEQ ID NO: 4, for tyrosine kinase assays) was adsorbed in the wells of LumiNunc 96-well polystyrene plates (MaxiSorp surface treatment). The wells were blocked with sterile 3% tryptone in phosphate buffered saline and stored at 4 0 C for up to 6 months.
  • Kinase (5 nM) in 70 ⁇ l of kinase buffer (5 mM -glycerophosphate pH 7.4, 25 mM HEPES pH 7.4, 1.5 mM DTT, 30 mM MgCl 2 , 0.15 M NaCl) was dispensed into each well.
  • HRP-conjugated anti-rabbit antibody 211-035-109, Jackson ImmunoResearch Laboratories were used to detect serine phosphorylation of the substrate.
  • anti-phospho -tyro sine antibody (RC20, BD Transduction Laboratories) was used for phospho -tyrosine detection. His-tagged active RSK and FAK were expressed in Sf9 cells and purified using NiNTA resin (Qiagen). Baculovirus was prepared using the Bac-to-Bac® baculo virus expression system (Invitrogen). PKA was bacterially expressed and activated as described (Anal. Biochem. 245, 115-122 (1997)). Active Mskl and p70 S6 kinase was purchased from Upstate Biotechnology. Immunoprecipitation and kinase assays were performed as previously described (Poteet-Smith et al., J Biol. Chem, 274, 22135-22138 (1999) using the immobilized GST-fusion proteins and ELISAs as above.
  • CellTiter-GloTM assay reagent Promega according to manufacturer's protocol.
  • cells were seeded at 2.5 XlO 5 cells/well in 12 well cell culture clusters. After 24 hr, the cells were serum starved for 24 hr then incubated with compound or vehicle for 3 hr prior to a 30 min PDB stimulation. Cells were lysed as previously described( J. Biol. Chem. 273, 13317-13323 (1998)). The lysates were normalized for total protein,
  • MCF-7 cells were seeded at a density of 1.25X10 4 cells per well in 24 well cell culture clusters. After 24 hr, fresh medium was added containing 25 nM oligonucleotide and transfection reagent according to manufacturer's protocol. The transfection medium was replaced after 24 hr. Cells were incubated for an additional 48 hr prior to cell viability measurement.
  • Prostate cancer is the second most common cancer in men and approximately one in six men will be diagnosed with the disease.
  • Early stage prostate cancer is frequently dependent on the hormone, androgen. Androgen action is mediated through interaction with the androgen receptor, a member of the superfamily of ligand-activated transcription factors. Inhibition of androgen receptor activity by pharmacological or surgical interventions that reduce androgen concentration can result in prostate tumor regression.
  • the tumors become androgen- independent, which often leads to a fatal outcome.
  • Treatment options are confined to conventional chemotherapy because of the lack of specific drug targets associated with androgen- independent prostate cancer. Thus, elucidation of the mechanisms that result in the transition of prostate cancer from an androgen-dependent to androgen-independent state will greatly facilitate the identification of more effective therapies.
  • mitogen-activated protein kinase AMAP-activated protein kinase (MAPK) activity has been correlated to prostate cancer progression in human tumors. This enhanced activity is most likely due to the increase in growth factors and receptors that are known to occur. Activation of growth factor receptors enhance MAPK activity via a kinase cascade that is regulated by the small GTP -binding protein, p21Ras.
  • the biological actions of the RSKs are not well characterized partly because until recently there were no known inhibitors of RSK that did not also inhibit MAPK activity.
  • SLOlOl-I The first RS K- specific inhibitor, SLOlOl-I has now been isolated. As described in Examples 9 and 10, SLOlOl-I inhibits the proliferation of the breast cancer cell line, MCF-7, without preventing the proliferation of a normal breast cell line, MCF- 1 OA. Furthermore, in NIH 3T3 fibroblasts, SLOlOl reduces the growth of a Ha-Ras- transformed line but not of the untransformed parental cells. It is believed that SLOlOl specifically inhibits the growth of transformed cells because transformed cells preferentially depend on the RSK pathway to regulate proliferation. These results provide the first demonstration that the RSK family through the regulation of its downstream effectors is involved in the control of cancer cell proliferation.
  • RSK Relatively few downstream effectors of RSK have been identified.
  • RSK is known to phosphorylate and regulate the activity of a number of transcription factors, the pro-apoptotic protein, BAD, and the mitotic checkpoint kinase, BUB 1. Determining which RSK substrates play a key role in cancer cell proliferation will undoubtedly lead to the discovery of novel drug targets for cancer therapy.
  • RSKl and RS K2 expression were also examined in 4 prostate cancers, 5 normal and 5 benign hyperplastic (BPH) samples.
  • BPH benign hyperplastic
  • the cancer tissues have higher levels of RSK expression than the normal and BPH tissue with the exception of one normal sample.
  • this sample was removed from tissue that was adjacent to cancerous tissue.
  • phosphorylation of pi 40 could be detected in normal prostate tissues except for the one normal tissue that also contained a higher level of RSKl expression. Under the electrophoretic conditions used in this experiment the phosphorylated pi 40 migrates as a doublet.
  • the cancerous tissue was obtained from tumors with Gleason scores >7, which indicates that the samples are of advanced prostate cancers.
  • the breast and prostate lysates were also immunoblotted with anti-pan ERK antibody, which recognizes both the active and inactive forms of p42 and p44 MAPK.
  • the relative levels of p42 and p44 MAPK varied considerably between the samples but did not correlate with the extent of RSK overexpression.
  • RSK overexpression is not merely a reflection of overexpression of various members of the MAPK pathway.
  • RSK2 Overexpression of the isoform 2 of the RSK family (RSK2) also enhances the transcriptional activity of the estrogen receptor (ERa) and the androgen receptor (AR).
  • ERa estrogen receptor
  • AR androgen receptor
  • MCF-7 cells a human breast cancer cell line. Additionally, RSK2 enhances the ligand-dependent and ligand-independent ER-mediated transcription in MCF-7 cells, a human breast cancer cell line. Additionally, RSK2 enhances the ligand-dependent and
  • HUVEC HUVEC were cells were subcultured to confluence in 35-mm plates. One hour prior to wounding, the cells were treated with vehicle or 60 ⁇ M SLOlOl. Scratches were made in the monolayer of cells using sterile, disposable micropipette tips. Images were captured - 2 hr, 10 hr, and 20 hr after wounding. By 10 hr after wounding, the vehicle-treated cells at the wound edge have migrated toward the wound.
  • RSK-specif ⁇ c inhibitor SLOlOl
  • Gaps in the monolayer behind the wound edge are apparent.
  • the SLO 101 -treated cells have recovered from the wounding, however they show little signs of polarization toward the wound and no involvement of the cells behind the wound edge.
  • the vehicle-treated cells have migrated into the wound yet the gaps are still present behind the wound edge.
  • the cells at the wound edge in the SLOlOl-treated well appear to have increased in size to fill the wound rather than migrate into the wound and the mono layered cells behind the wound edge remain tightly packed unlike the vehicle-treated cells. Accordingly the data support the premise that RSK inhibitors are useful tools to stop endothelial cell migration.
  • HUVEC cells were seeded at a density of 3 x 10 5 cells per 35 mm dish and were maintained in complete growth medium. Twenty-four hours after plating, the cells were incubated for an additional 2 hr in the presence or absence of 60 ⁇ M SLO 101. After the 2 hr incubation in the presence or absence of SLO 101 , a subset of cells from each group was challenged with 500 nM phorbol dibutyrate for 30 min to maximally stimulate RSK activity.
  • the cells were harvested and lysates prepared for SDS-PAGE and immunoblot analysis.
  • the phosphorylation state of ppl40 was determined using a phospho- specific antibody generated against the phosphorylated peptide - LAS(P)TND. Equal loading of lysate is demonstrated by the Ran immunoblot.
  • SLOlOl treatment was observed to reduced the phosphorylation of ppl40. Basal phosphorylation of ppl40 induced by complete growth medium is eliminated by SLOlOl treatment. SLOlOl treatment also inhibited activation of RSK by PDB-challenge. Thus, SLO 101 inhibits RSK activity in the HUVEC cells.
  • CaLu-I cells were sub-cultured to confluence in 35-mm plates. One hour prior to wounding, the cells were treated with vehicle or 60 ⁇ M SLOlOl . Scratches were made in the monolayer of cells using sterile, disposable micropipette tips. Images were captured either immediately following the wounding, 6 hr, or 24 hours after wounding. At the point of wounding, the cells at the wound edge show increased light refraction indicating damage. By 6 hr after wounding, the vehicle-treated cells at the wound edge present wide lamella (indicated by arrows) extending toward the direction of the wound.
  • the SLOlOl -treated cells have recovered from the wounding as evidenced by reduced refractivity at the wound edge; however, they showed no signs of polarization toward the wound.
  • the vehicle- treated cells have migrated into the wound and are enlarged to re-form the confluent monolayer.
  • the SLO 101 -treated cells have not migrated to close the wound.
  • Reducing RSK expression in the human lung cancer cell line, CaIu- 1 inhibits migration into the wound.
  • CaIu-I cells were transiently trans fected in suspension with either control siRNA, RSKl -specific siRNA, RSK2-specific siRNA or both RSK-I and RSK2-specific siRNA.
  • Custom oligonucleotides to Rskl (AAGAAGCUGGACUUCAGCCGU; SEQ ID NO: 1 and Rsk2 (AACCUAUGGGAGAGGAGGAGA; SEQ ID NO : 2) mRNA (Dharmacon Research Inc.) and LipofectamineTM 2000 (Invitrogen Corporation Carlsbad, CA 92008) transfection reagent were used for the gene silencing studies.
  • the transfection medium was removed and the cells were plated in 6- well tissue-culture clusters. Forty-eight hours after transfection, scratches were made in the monolayer of cells using sterile, disposable micropipette tips. Images were captured - immediately following the wounding, and 19 hours after wounding. The images demonstrate classical wound healing. By 19 hr, the cells transfected with control siRNA have migrated into the wound. However, the cells transfected with either RSKl- or RSK2-specif ⁇ c siRNA demonstrate a reduced ability to migrate into the wound. Interfering with the expression of both RSKl and RSK2 also results in reduced migration. Thus, RSK activity is required for CaIu-I migration. More particularly, the ability of the entire monolayer to respond to the wound is depressed in the SLOlOl-treated cells as well as the siRNA transfected.
  • SLOlOl reduces expression of the angiogenesis marker, VCAM.
  • HUVEC cells were treated in the presence or absence of 1 ⁇ g/ml lipopolysaccharide (LPS) with concomitant treatment with vehicle or SLOlOl. Twenty- four hours after LPS treatment, the cells were harvested with SDS lysis buffer in preparation for SDS-PAGE and immunoblot analysis. Lysates were normalized with regard to protein concentration.
  • LPS lipopolysaccharide
  • HUVEC cells were seeded at a density of 1 x 10 5 cells per well in 24-well culture dishes coated in growth factor-reduced Matrigel (BD Biosciences). The cells were treated with vehicle, 60 ⁇ M SLOlOl or 20 ⁇ M SU1498 (VEGF receptor inhibitor) for 30 minutes prior to stimulation with 10 ng/ml of VEGF. The cells were incubated at 37° C for 20 hours. Images of the cells were captured for analysis of the capillary- like network.
  • HUVEC cells Stimulation of HUVEC cells with VEGF resulted in accumulation of the cells into flat, polymorphous nodes with multiple tube-like connections between nodes.
  • HUVEC cells treated with VEGF in the presence of SLO 101 , the RSK inhibitor were indistinguishable from those treated with SU1498.
  • a few flat nodes with multiple tube-like projections were observed in the SU1498-treated cells and SLO 101 -treated cells, however, the majority of the nodes in the inhibitor-treated cells were rounded with few projections.
  • the results from these experiments support the results obtained in Examples 13-16 indicating that inhibition of RSK activity is sufficient to limit VEGF-induced capillary network formation in HUVEC cells.
  • Kinase assays were performed using immobilized substrate. RSK was incubated in the presence of 500 nM of each SLOlOl derivative compound.
  • the compounds tested include Kaempferol L-rhamnoside (4),Kaempferol L-rhamnoside 4"-acetate (5), Kaempferol L- rhamnoside 2",4"-diacetate (6), Kaempferol L-rhamnoside 3",4"-diacetate (7), Kaempferol L- rhamnoside 2", 3", 4"-triacetate (8), Kaempferol L-carbarhamnoside 4"-acetate (12),
  • Kaempferol L-carbarhamnoside 2 4"-diacetate (13), Kaempferol L-carbarhamnoside 3", 4"- diacetate (14), Kaempferol -6"ethyl-L-rhamnoside-2",4"-diacetate (15), Kaempferol -6"ethyl- L-rhamnoside-3",4"-diacetate (16), Kaempferol -6"ethyl-L-rhamnoside (17), Kaempferol - 6"ethyl-L-rhamnoside-2", 3", 4"-triacetate (18), Kaempferol -6"ethyl-L-rhamnoside-2"- monoacetate (19), Kaempferol -6"ethyl-L-rhamnoside-4"-monoacetate (20), Kaempferol -6"methyl-L-rhamnoside (21), Kaempferol -6"isopropyl-L-rhamnoside (22).
  • Kinase assays were performed using immobilized substrate. RSK was incubated in the presence of indicated concentrations of each compound. Reactions were initiated by the addition of 10 micromoles/L ATP (final concentration) and terminated after 10 minutes. All assays measured the initial reaction velocity. Extent of immobilized substrate phosphorylation was determined using phosphospecif ⁇ c antibodies in combination with HRP-conjugated secondary antibodies. Maximum and minimum activity is the relative luminescence detected in the presence of vehicle and 200 mmol/L EDTA, respectively. Kinase activity measured in the presence of the compound is presented as the percentage of maximum activity. Points are mean of quadruplicates; bars, SD. The IC50 of each compound is determined to be: # 16, 100 nM; # 14, 220 nM; # 17, 300 nM; #17, 1 ⁇ M; and #4, 13 ⁇ M (See Fig. 10).
  • the disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated by reference herein in their entirety.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Organic Chemistry (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Pulmonology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Saccharide Compounds (AREA)

Abstract

La présente invention concerne une composition comprenant un composé dérivé du SL0101 [kaempférol 3-O-(3",4"-di-O-acétyl-α-L-rhamnopyranoside)] ayant une capacité améliorée à inhiber l'activité de la RSK, par rapport au composé parent. Les composés sont utiles dans le traitement de toute maladie ou pathologie caractérisée ou associée à une activité excessive ou indésirable de la RSK. Par exemple, les inhibiteurs de la RSK selon la présente invention peuvent être utilisés pour réduire la prolifération de cellules néoplasiques ou pour inhiber l'établissement ou le maintien d'une infection pathogène intracellulaire par des pathogènes dont l'effet pathogène dérive en partie de la capacité du pathogène à entraver la maturation endosomale/phagosomale dans la cellule hôte.
PCT/US2010/045440 2009-08-14 2010-08-13 Synthèse et identification de nouveaux inhibiteurs spécifiques de la rsk WO2011019995A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US13/390,389 US9040673B2 (en) 2009-08-14 2010-08-13 Synthesis and identification of novel RSK-specific inhibitors

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US27423609P 2009-08-14 2009-08-14
US61/274,236 2009-08-14

Publications (2)

Publication Number Publication Date
WO2011019995A2 true WO2011019995A2 (fr) 2011-02-17
WO2011019995A3 WO2011019995A3 (fr) 2012-06-21

Family

ID=43586863

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/045440 WO2011019995A2 (fr) 2009-08-14 2010-08-13 Synthèse et identification de nouveaux inhibiteurs spécifiques de la rsk

Country Status (2)

Country Link
US (1) US9040673B2 (fr)
WO (1) WO2011019995A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109020938A (zh) * 2018-08-17 2018-12-18 昆明龙津药业股份有限公司 一种杨梅素的制备方法

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018013761A1 (fr) * 2016-07-13 2018-01-18 The Children's Medical Center Corporation Inhibiteurs de la calmoduline, inhibiteurs de la chk2 et inhibiteurs des rsk permettant le traitement d'affections des ribosomes et de ribosomopathies
CN109847063B (zh) * 2018-12-26 2023-02-28 南方医科大学皮肤病医院（广东省皮肤病医院、广东省皮肤性病防治中心、中国麻风防治研究中心） Rsk信号通路抑制剂在抑制沙眼衣原体感染中的应用
CN110054605A (zh) * 2019-05-31 2019-07-26 北京盛诺基医药科技有限公司 一种淫羊藿素中间体的制备方法
CN110092770A (zh) * 2019-05-31 2019-08-06 北京盛诺基医药科技有限公司 一种黄酮化合物中间体的制备方法
KR102178944B1 (ko) * 2019-09-18 2020-11-13 충남대학교산학협력단 4-하이드록시벤즈알데하이드를 포함하는 톡소포자충 감염증의 예방 또는 치료용 조성물
CN113304164B (zh) * 2021-06-11 2022-04-08 朱峰 山萘苷在制备抗非小细胞肺癌药物中的用途

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009023053A2 (fr) * 2007-05-18 2009-02-19 University Of Virginia Patent Foundation Utilisation d'inhibiteurs de rsk en vue d'empêcher les infections pathogènes intracellulaires
US20090082400A1 (en) * 2007-07-31 2009-03-26 Ving Lee Soluble pyrone analogs methods and compositions

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4559157A (en) 1983-04-21 1985-12-17 Creative Products Resource Associates, Ltd. Cosmetic applicator useful for skin moisturizing
LU84979A1 (fr) 1983-08-30 1985-04-24 Oreal Composition cosmetique ou pharmaceutique sous forme aqueuse ou anhydre dont la phase grasse contient un polyether oligomere et polyethers oligomeres nouveaux
US4820508A (en) 1987-06-23 1989-04-11 Neutrogena Corporation Skin protective composition
US4992478A (en) 1988-04-04 1991-02-12 Warner-Lambert Company Antiinflammatory skin moisturizing composition and method of preparing same
US4938949A (en) 1988-09-12 1990-07-03 University Of New York Treatment of damaged bone marrow and dosage units therefor
US20050233985A1 (en) 2003-06-12 2005-10-20 Smith Jeffrey A Rsk inhibitors and therapeutic uses thereof
AU2003251513A1 (en) 2002-06-12 2003-12-31 University Of Virginia Patent Foundation Rsk inhibitors and therapeutic uses thereof
US8426568B2 (en) 2006-05-22 2013-04-23 University Of Virginia Patent Foundation Rhamnose substituents of SL0101 and therapeutic uses thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009023053A2 (fr) * 2007-05-18 2009-02-19 University Of Virginia Patent Foundation Utilisation d'inhibiteurs de rsk en vue d'empêcher les infections pathogènes intracellulaires
US20090082400A1 (en) * 2007-07-31 2009-03-26 Ving Lee Soluble pyrone analogs methods and compositions

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109020938A (zh) * 2018-08-17 2018-12-18 昆明龙津药业股份有限公司 一种杨梅素的制备方法

Also Published As

Publication number Publication date
US9040673B2 (en) 2015-05-26
US20120245112A1 (en) 2012-09-27
WO2011019995A3 (fr) 2012-06-21

Similar Documents

Publication Publication Date Title
US9040673B2 (en) Synthesis and identification of novel RSK-specific inhibitors
AU2021205040B2 (en) Compounds effective in treating hepatotoxicity and fatty liver diseases and uses thereof
KR101739800B1 (ko) 안드로겐 수용체 조절제의 에스터 유도체 및 그의 이용 방법
US20150133564A1 (en) Novel compound, preparing method thereof, and use thereof as inhibitors of histone demethylase
CN104837812A (zh) 治疗mTOR通路相关的疾病的化合物
US7605241B2 (en) Synthesis of inhibitors of p90Rsk
WO2016076359A1 (fr) Agent anticancéreux comprenant de l'ivermectine ou de la milbémycine d en tant que principe actif
JP6264685B2 (ja) マルチキナーゼ阻害剤、抗癌剤、抗転移剤、薬剤耐性抑制剤、疼痛抑制剤及び止痒薬
WO2009023053A2 (fr) Utilisation d'inhibiteurs de rsk en vue d'empêcher les infections pathogènes intracellulaires
CA2488864A1 (fr) Inhibiteurs rsk et utilisations therapeutiques de ces derniers
JP2003520819A (ja) 新規な化合物
JP7093987B2 (ja) がん遺伝子産物ｙａｐ１／ｔａｚ機能調節剤
US9193715B2 (en) Regulation of cholesterol homeostasis
CN108299360B (zh) 一种平板霉素衍生物及其应用
WO2024051666A1 (fr) Composé glycoside de dibenzylbutyrolactone, son procédé de préparation et son utilisation
US20040171547A1 (en) RhoB as a suppressor of cancer cell growth, cell transformation, and metastasis
US8426568B2 (en) Rhamnose substituents of SL0101 and therapeutic uses thereof
Xiao et al. A phenylpentane derivative from Sanghuangporus vaninii inhibits EMT mediated tumor progression of pancreatic cancer by targeting EGFR
JP2005527560A (ja) Ｃｄｋ阻害剤とドキソルビシンとを含む組合せ
KR20230009454A (ko) 암 줄기 세포 표적화 및 전이 예방을 위한 9-아미노-독시사이클린의 미리스토일 유도체
BG107265A (bg) Производни на хигромицин а за лечение на инфекцииот бактерии и протозои
Romanucci et al. 7-O-tyrosyl Silybin Derivatives as a Novel Set of Anti-Prostate Cancer Compounds
US20070111952A1 (en) Glycosylated triketide delta lactones
WO2024019661A1 (fr) Composés à base de labdane et utilisations de ceux-ci
US20180207123A1 (en) Ceramide derivatives as anticancer agents

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10808808

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 13390389

Country of ref document: US

122 Ep: pct application non-entry in european phase

Ref document number: 10808808

Country of ref document: EP

Kind code of ref document: A2