WO2011012693A1 - Mutant methylglyoxal synthase (mgs) for the production of a biochemical by fermentation - Google Patents
Mutant methylglyoxal synthase (mgs) for the production of a biochemical by fermentation Download PDFInfo
- Publication number
- WO2011012693A1 WO2011012693A1 PCT/EP2010/061094 EP2010061094W WO2011012693A1 WO 2011012693 A1 WO2011012693 A1 WO 2011012693A1 EP 2010061094 W EP2010061094 W EP 2010061094W WO 2011012693 A1 WO2011012693 A1 WO 2011012693A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- vai
- mgs
- mutant
- ala
- amino acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
- C12P7/18—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/24—Preparation of oxygen-containing organic compounds containing a carbonyl group
- C12P7/26—Ketones
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/56—Lactic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/03—Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
- C12Y402/03003—Methylglyoxal synthase (4.2.3.3)
Definitions
- MMS Mutant methylglyoxal synthase
- the present invention concerns a method for the production of a biochemical selected among lactic acid, acetol and 1,2-propanediol, comprising culturing a microorganism modified for an improved production of the biochemical selected among lactic acid, acetol and 1,2-propanediol in an appropriate culture medium and recovery of the desired biochemical which may be further purified wherein the microorganism expresses a methylglyoxal synthase (MGS) enzyme which activity is not inhibited by orthophosphate.
- MGS methylglyoxal synthase
- the present invention also relates to a mutant methylglyoxal synthase (MGS) comprising at least one amino acid residue in the protein sequence of the parent enzyme replaced by a different amino acid residue at the same position wherein
- the mutant enzyme has retained more than 50% of the methylglyoxal synthase activity of the parent enzyme and
- Methylglyoxal synthase was discovered and identified as the first enzyme of the methylglyoxal bypass in E. coli. MGS was later found in a wide range of organisms including Gram-negative as well as Gram-positive bacteria and yeast (Cooper (1984)). Methylglyoxal bypass can serve as an alternative pathway for the conversion of triosephosphates to pyruvate during the catabolism of glucose (Cooper and Anderson (1970), Cooper (1984)).
- EMP Embden-Meyerhoff-Parnas
- G3P triosephosphate glyceraldehyde-3 -phosphate
- DHAP dihydroxyacetone phosphate
- MGS which was first purified and characterized in E. coli (Hopper and Cooper (1971 and 1972)) catalyses the conversion of 1 mole of DHAP to 1 mole of MG and 1 mole of orthophosphate (Pi). MGS is very specific for DHAP, which seems to be the only substrate accepted by the enzyme with a good affinity (Affinity constant Km varied from 0.2 to 0.47 mM).
- Several inhibitors of the enzyme were identified: phosphoenolpyruvate (PEP), 3-phosphoglycerate, Pi and pyrophosphate (PPi).
- MGS mutants on positions D20, D71, D91, DlO and H98, always impairing the catalytic rate of the enzyme were characterized and a catalytic mechanism was proposed (Saadat and Harrison (1998), Marks et al (2004)).
- the three dimensional structure of MGS from E. coli was determined after crystallisation of the enzyme (Saadat and Harrison (1999 and 2000)).
- MGS is a homohexamer with 6 identical units of 17 kDa. Phosphate can bind to the active site of MGS and a hypothesis for the transmission of allosteric information through the salt bridges between the monomers was proposed, although no clear evidence was given.
- the first one is the glutathione dependent glyoxalase I-II system (encoded by gloA and g/oB genes) which converts methylglyoxal into D-lactate in two steps (Cooper, 1984).
- the second is the glutathione independent glyoxalase III enzyme which catalyses the conversion of methylglyoxal into D-lactate in one step (Misra et al, 1995).
- the third system is the degradation of methylglyoxal by methylglyoxal reductases, resulting either in acetol or in D- or L-lactaldehyde (Cameron et al, 1998, Bennett and San, 2001).
- L-lactaldehyde can be further converted to L-lactate by the action of aldehyde dehydrogenases e.g. by the enzymes encoded by the aldA or aldB genes (Grabar et al, 2006).
- Lactate produced by one of the three systems can be further transformed into pyruvate by D- or L-lactate dehydrogenases.
- D- or L-lactate dehydrogenases are flavin-linked membrane-bound proteins that are activated only under aerobic conditions (Garvie, 1980).
- D- and L-lactate dehydrogenases are coded respectively by the did and HdD (or lctD) genes in E. coli (Rule et al, 1985, Dong et al, 1993).
- Acetol or lactaldehyde produced by the third system can be converted to 1,2- propanediol by several enzymatic activities, especially glycerol degydrogenase (encoded by gldA gene) or 1,2-propanediol oxidoreductase (encoded by fucO gene) in E. coli (Altaras and Cameron, 2000).
- glycerol degydrogenase encoded by gldA gene
- 1,2-propanediol oxidoreductase encoded by fucO gene
- 1,2-propanediol or propylene glycol a C3 dialcohol
- Propylene glycol has been increasingly used since 1993-1994 as a replacement for ethylene derivatives, which are recognised as being more toxic than propylene derivatives.
- 1,2-propanediol is currently produced by chemical means using a propylene oxide hydration process that consumes large amounts of water.
- Propylene oxide can be produced by either of two processes, one using epichlorhydrin, and the other hydroperoxide. Both routes use highly toxic substances.
- the hydroperoxide route generates byproducts such as te/t-butanol and 1 -phenyl ethanol. For the production of propylene to be profitable, a use must be found for these by-products.
- the chemical route generally produces racemic 1,2-propanediol, whereas each of the two stereoisomers (R)1, 2- propanediol and (S) 1,2-propanediol are of interest for certain applications (e.g. chiral starting materials for specialty chemicals and pharmaceutical products).
- Acetol or hydroxyacetone (1 -hydroxy- 2-propanone) is a C3 keto alcohol. This product is used in vat dyeing process in the textile industry as a reducing agent. It can advantageously replace traditional sulphur containing reducing agents in order to reduce the sulphur content in wastewater, harmful for the environment. Acetol is also a starting material for the chemical industry, used for example to make polyols or heterocyclic molecules. It possesses also interesting chelating and solvent properties.
- Acetol is currently produced mainly by catalytic oxidation or dehydration of 1,2- propanediol. New processes starting from renewable feedstocks like glycerol are now proposed (see DE4128692 and WO 2005/095536). Currently, the production cost of acetol by chemical processes reduces its industrial applications and markets.
- Lactic acid or lactate and its derivatives have a wide range of applications in the food, pharmaceutical, leather and textile industries.
- polylactic acid (PLA) has been developed as a renewable, biodegradable and environmentally friendly plastic and therefore, the demand for lactate is expected to expand.
- Lactate can be produced either by a chemical synthesis or by a biological process.
- a biological process is able to produce the desired stereoisomer, D- or L-lactate with high optical purity, which is an important characteristic for many of its end uses.
- Physical properties and biodegradation rate of PLA can be controlled by manipulating the ratio of the chiral substrates, D- and L- lactate. Therefore, availability of biological processes for the production of optically pure D- and L-lactate is a prerequisite for high quality polymer synthesis.
- Lactic acid bacteria are natural producers of lactate and some can be found to be specific for the D- or L-form. These bacteria have been traditionally used for the production of lactate as specialty chemical (e.g. in US 2004/0005677). However, with the emergence of lactate as commodity chemical for PLA synthesis, more efficient and cost- effective processes are needed. Alternative biocatalysts able to growth in mineral salt medium and to use a range of different sugar substrates are investigated. Yeasts and E. coli combine these characteristics with the availability of a wide range of genetic tools for metabolic engineering.
- the conditions necessary for the enzyme to be active would be a high concentration of its substrate DHAP or a low concentration of Pi.
- G3P dehydrogenase cannot continue to work without one of its substrate and therefore G3P and hence DHAP will accumulate, filling the two conditions for efficient work of MGS.
- methylglyoxal bypass will replace glycolysis for catabolism of triosephosphates.
- glycolysis will operate because the concentration of Pi would be too high and the concentration of DHAP to low for MGS to be active (Cooper (1984), Fergusson et al (1998)). This mechanism allows the microorganism to cope with different situations with regards to Pi.
- glycolysis to ensure the supply of precursors and energy for growth and methylglyoxal bypass for the synthesis of the wanted products.
- a MGS enzyme that has lost its inhibition by phosphate would be a clear advantage.
- the inventors have identified new mutant MGS that had lost allosteric inhibition by phosphate, while keeping most of their specific activity for the conversion of DHAP into MG, as demonstrated in Example 2 by the characterization of purified enzymes. Use of these mutants is a key element in the design of more efficient processes for the production of the products of the methylglyoxal bypass, particularly acetol, 1,2-propanediol and lactate.
- the present invention concerns a method for the production of a biochemical selected among lactic acid, acetol and 1,2-propanediol, comprising culturing a microorganism modified for an improved production of the biochemical selected among lactic acid, acetol and 1,2-propanediol in an appropriate culture medium and recovery of the desired biochemical which may be further purified wherein the microorganism expresses a methylglyoxal synthase (MGS) enzyme which activity is not inhibited by orthophosphate.
- MGS methylglyoxal synthase
- the present invention concerns a mutant methylglyoxal synthase (MGS) comprising at least one amino acid residue in the protein sequence of the parent enzyme replaced by a different amino acid residue at the same position wherein
- the mutant enzyme has retained more than 50% of the methylglyoxal synthase activity of the parent enzyme and
- the methylglyoxal synthase activity of the mutant MGS is not inhibited by orthophosphate as compared to the parent enzyme.
- the invention also concerns a DNA sequence comprising a sequence coding for the mutant MGS of the invention and a microorganism expressing such MGS which activity is not inhibited by orthophosphate, particularly a microorganism comprising a gene coding for the mutant MGS of the invention.
- a "microorganism” means all kind of unicellular organisms, including procaryotic organisms like bacteria, and eucaryotic organisms like yeasts.
- the microorganism is selected among the group consisting of bacteria, yeasts and fungi, more preferentially selected among Enterobacteriaceae, Bacillaceae, Streptomycetaceae, Clostridiaceae and Corynebacteriaceae. More preferentially, the microorganism is a species of Escherichia, Klebsiella, Pantoea, Salmonella, Bacillus, Streptomyces, Clostridium or Corynebacterium.
- the microorganism is selected among the group consisting of Escherichia coli, Klebsiella pneumoniae, Thermo anaerobacterium thermosaccharolyticum, Clostridium sphenoides or Saccharomyces cerevisiae.
- modified microorganism or “modified” or “recombinant” refer to a host cell that has a modification of its genome, e.g., as by addition of nucleic acid not naturally occurring in the organism or by a modification of nucleic acid naturally occurring in the host cell.
- a "microorganism modified for an improved production of the biochemical selected among lactic acid, acetol and 1,2 -propanediol” is a microorganism in which pathways to favour the production of the desired biochemical by conversion of a simple source of carbon have been modified.
- the microorganism modified for such improved production produces more of the desired biochemical than a native, unmodified microorganism.
- Microorganisms modified for the improved production of lactic acid, acetol and propanediol by conversion of methylglyoxal are also disclosed in Cameron et al, 1998, Bennett and San, 2001, Ko et al, 2005 and WO 99/28481, WO 98/37204, WO
- NDE2 GUT2, GPDl, GPD2, PDCl, PDC2, PDC5, PDC6, GLOl ⁇ enhancement of expression of GRE3 gene.
- the DNA sequence coding for a mutant MGS of the invention may be introduced in a vector for the expression and translation of the mutant MGS. It can also be integrated in the chromosome of the said microorganism.
- Integration of the DNA sequence can be done either entirely, or simply by introducing in the native gene of the microorganism, the mutation in the coding sequence by replacing the nucleotide(s) coding for the amino acid to be changed by the nucleotide(s) coding for the amino acid of the mutated protein.
- the microorganism of the invention may additionally comprise a gene coding for an YqhD enzyme which catalytic efficiency towards NADPH is increased.
- An YqhD enzyme "which catalytic efficiency toward NADPH is increased” means that the catalytic efficiency towards NADPH of the YqhD enzyme expressed in the microorganism is higher than the catalytic efficiency towards NADPH of the native YqhD enzyme of the same microorganism.
- the catalytic efficiency is defined as the ratio between the catalytic constant (Kcat) and the Michaelis constant (Km).
- Increase of catalytic efficiency of YqhD enzyme means that the Kcat of the enzyme is increased or that the Km of the enzyme is decreased. In a preferred embodiment the Kcat of the YqhD enzyme is increased and the Km of the YqhD enzyme is decreased.
- the catalytic efficiency towards NADPH of the YqhD enzyme is higher than the efficiency of the native YqhD enzyme of E. coli.
- Such enzyme has preferably an enzymatic activity of at least 50% of the activity of the YqhD of E. coli, more preferably at least 60% of the activity of the YqhD of E. coli.
- the YqhD enzyme is a mutant YqhDS enzyme wherein
- the mutant enzyme has retained more than 50% of the YqhD activity of the parent enzyme and
- the mutant YqhD comprises at least a mutation selected among the group consisting of G149E, G149S and A286T, and combinations thereof.
- the aminoacids positions are given by reference to the YqhD sequence of E. coli. The person skilled in the art shall find the corresponding aminoacids in sequences from other organisms by standard techniques of sequence alignment.
- the microorganism of the invention may additionally comprise a gene coding for a glycerol dehydrogenase (GlyDH) enzyme with reduced inhibition of its activity by NAD+ and/or its substrate and/or its product.
- GlyDH glycerol dehydrogenase
- the inhibition of which activity by NAD+ and/or its substrate and/or its product is reduced means that the inhibition of the activity of the GlyDH enzyme expressed in the microorganism is less inhibited than the activity of the native GlyDH enzyme of the same microorganism.
- the inhibition of the activity of the GlyDH enzyme can be defined by the Inhibition Concentration 50 (IC50) or the Inhibition Constant (Ki) or any other techniques known by the skilled person.
- the reduced inhibition of the activity of the GlyDH enzyme means that the IC50 or the Ki of the GlyDH enzyme of the invention is higher than the IC50 or the Ki of the native GlyDH enzyme.
- the skilled person knows the relation between IC50 and Ki and their meaning on the activity of enzyme among the classic Michaelis-Menten kinetics.
- the activity of the GlyDH enzyme is less inhibited than the native
- the enzyme activity is less inhibited for at least two members of the group consisting of NAD+, the enzyme's substrate and the enzyme's product. More preferably the enzyme activity is less inhibited by the three of
- the enzyme "substrate” is dihydroxyacetone, hydroxy acetone, methylglyoxal, lactaldehyde, glyceraldehyde, glycolaldehyde and derivatives thereof.
- the enzyme "product" is the molecule obtained from the selected substrate by reduction of the carbonyl function.
- the substrate is hydroxyacetone and the product is 1,2-propanediol.
- the GlyDH enzyme is a mutant enzyme, wherein
- the glycerol dehydrogenase activity of the mutant GlyDH is less inhibited by NAD+ and/or by its substrate as compared to the parent enzyme and/or by its product as compared to the parent enzyme.
- the mutant GlyDH preferably comprises at least a mutation selected among the group consisting of Al 6OT and T 120N, and combinations thereof.
- the aminoacids positions are given by reference to the GIdA sequence of E. coli. The person skilled in the art shall find the corresponding aminoacids in sequences from other organisms by standard techniques of sequence alignment.
- MMS Methylglyoxal synthase
- the invention concerns a methylglyoxal synthase (MGS) which activity is not inhibited by orthophosphate a microorganism comprising the same and a method for the production of a desired biochemical by fermentation of said microorganism on a culture medium comprising a simple source of carbon.
- MGS methylglyoxal synthase
- Not inhibited by orthophosphate or "lacking inhibition by orthophosphate” means that no inhibition by orthophosphate is identified in an activity assay, when activity of the enzyme is studied in presence of orthophosphate.
- an activity assay is well known in the art and can be carried out as disclosed in Example 2.
- kinetics of the MGS enzyme of the invention follows Michaelis- Menten kinetics regardless of the presence or absence of orthophosphate.
- Kinetics of the native enzyme follow a Michaelis-Menten model only in the absence of orthophosphate.
- orthophosphate makes the kinetic profile (specific activity over substrate concentration) of the native enzyme to become sigmoidal, which denotes the allosteric inhibition by orthophosphate.
- Such enzyme has preferably a methylglyoxal synthase activity of at least 50% of the activity of the methylglyoxal synthase of E. coli.
- the enzymes may be obtained by various ways known to the person skilled in the art.
- a first approach consists in screening native enzymes of various organisms for their lack of inhibition by orthophosphate.
- a second approach consists in inducing mutation(s) in enzymes of known organisms and selecting the enzymes for their lack of inhibition by orthophosphate.
- Mutations may be induced by methods known in the art such as subjecting the microorganism to mutagenic agents. Another method to induce mutations is to growth the microorganism under selection pressure, with high levels of orthophosphate and identify the microorganism growing under such conditions and select the enzymes obtained for their lack of inhibition by orthophosphate.
- MGS retaining their methylglyoxal synthase activity and lacking inhibition by orthophosphate by selecting strains modified for an improved production lactic acid, acetol and/or 1,2-propanediol cultured under selection pressure as disclosed in WO 2005/073364 and as shown in Example 1.
- the invention concerns particularly mutant methylglyoxal synthase (MGS) comprising at least one amino acid residue in the protein sequence of the parent enzyme replaced by a different amino acid residue at the same position wherein
- the mutant enzyme has retained more than 50% of the activity of the parent enzyme and
- the methylglyoxal synthase activity of the mutant MGS is not inhibited by orthophosphate as compared to the parent enzyme.
- a mutant enzyme means that a mutation was introduced in a protein sequence by a person.
- a mutant enzyme is an enzyme comprising at least one amino acid difference with a parent enzyme.
- any change in amino acids may be introduced, either by directed mutagenesis or random mutagenesis, but also using chimerical enzymes comprising parts of a second enzyme replacing corresponding parts of the parent enzyme.
- the "parent enzyme” is the enzyme prior mutation.
- the parent enzyme may be of any origin, natural, isolated from another organism or synthetic.
- mutant MGS the level of desired activity according to the final use of mutant MGS. Indeed, when a high activity is necessary, the skilled person will choose a mutant having more that 80% of activity, compared to the non mutated parent enzyme, more preferably more that 90% of activity. In other cases, selecting a mutant
- MGS with an activity around and above 50% compared to the parent enzyme may prevent additional modifications in a microorganism, like modifying the promoter to lower the level of expression of the enzyme.
- the amount of orthophosphate was chosen provided that the enzymatic reaction generally occurs in a microorganism.
- not inhibited by orthophosphate as compared to the parent MGS is understood to be at orthophosphate concentrations compatible with the concentrations of orthophosphate in a microorganism growing on a medium comprising orthophosphate at concentrations compatible with the growth of the microorganism.
- the mutant MGS of the invention comprises at least one amino acid residue of an identified region in the native parent MGS replaced by a different amino acid residue at the same position.
- the inventors have identified mutants wherein at least one amino acid residue of one of the following conserveed Regions (CR) in the native parent MGS has been replaced by a different amino acid residue at the same position, the three conserveed Regions CRl,
- XaI represents Ala and VaI, preferably Ala
- Xa2 represents VaI and He
- Xa3 represents Ala and Ser, preferably Ala
- Xa4 represents Ala, Arg, Asn, Gln, Glu, His, Lys, Met and Ser, preferably His and Lys, and
- Xa5 represents Arg, Cys, Gln, Lys, Met and Tyr, preferably Cys and Lys
- Xa6 represents Asp and Pro, preferably Pro,
- Xa7 represents Leu and Met, preferably Leu
- Xa8 represents Asn, Glu, Ser and Thr, preferably Asn and Thr
- Xa9 representsAla, Asn, Pro, Ser and VaI, preferably Ala,
- XlO represents Ala, Leu, Gln, Lys, Met and VaI, preferably Gln and VaI,
- Xl 1 represents Ala and Pro, preferably Pro,
- Xl 2 represents Asp and Glu
- Xl 3 represents Ala, Pro and VaI, preferably Pro, and
- Xl 4 represents He and VaI, preferably VaI
- Xl 5 represents He, Leu and VaI, preferably VaI,
- Xl 6 represents Arg, Gln, His, Trp and Tyr, preferably Trp and Tyr,
- Xl 7 represents Ala, Asn, Arg, Asp, Gln, Glu, Gly, Lys and Ser, preferably Asn,
- Xl 8 represents He, Leu and VaI, preferably He,
- Xl 9 represents Cys, His, He, Leu, Met and VaI, preferably Leu and VaI,
- X20 represents Ala and VaI, preferably Ala
- X21 represents Cys, He, Leu, Met and Thr, preferably Thr, and
- X22 represents Asn and Thr, preferably Asn.
- Amino acids numbers in the present application are given by reference to the proteins of E. coli.
- CRl correspond to amino acids 15 to 23 of E. coli MGS
- CR2 correspond to amino acids 91 to 102 of E. coli MGS
- CR3 correspond to amino acids 111 to 119 of E. coli MGS.
- the mutant MGS can have at least one mutation in one of CRl, CR2 or CR3. It can have at least two mutations in CRl and CR2, in CRl and CR3 or in CR2 and CR3. It can also have at least three mutations in CRl, CR2 and CR3.
- mutated enzyme may have other mutations, but nor related to the identified conserveed Regions CRl, CR2 and CR3. These other non identified mutations have no substantial impact on the mutated enzyme of the invention, provided that:
- the mutant enzyme has retained more than 50% of the methylglyoxal synthase activity of the parent enzyme and
- the methylglyoxal synthase activity of the mutant MGS is not inhibited by orthophosphate as compared to the parent enzyme.
- CR3 in the parent MGS replaced by a different amino acid residue at the same position in the mutant MGS is selected among the group consisting of amino acid Xa4 in CRl, amino acid Xa9 in CR2 and amino acid Xl 9 in CR3 and combinations thereof (CRl & CR2, CRl & CR3, CR2 & CR3 and CRl & CR2 & CR3).
- Xa4 correspond to amino acid 21 in the MGS sequence of E. coli.
- Xa9 corresponds to amino acid 95 in the MGS sequence of E. coli.
- Xl 9 corresponds to amino acid 116 in the sequence of E. coli.
- the mutated MGS of the invention comprises at least one of the mutations selected among the group consisting in H21Q, A95V, Vl 16L, and combinations thereof, the aminoacid positions being given by reference to the MGS sequence of E. coli.
- the mutated MGS of the invention comprises at least one of the following amino acid sequence in conserved regions CRl to CR3
- the mutant MGS of the invention has at least 50% sequence identity compared to the MGS sequence of E. coli, provided that it comprises at least one of the following mutations in CRl and/or CR2:
- Sequence identity is defined after sequence alignment of the MGS sequence of E. coli with the protein sequence to be compared using CLUSTAL W2available on the EBI website (see above) with default parameters. The sequence identity is then calculated with the sequence alignement by the ratio of the number of identical amino acids at the same position with the total number of amino acids in the reference sequence (E. coli).
- the mutant MGS has at least 70% sequence identity.
- the mutant MGS of the invention comprises the sequence selected among the group consisting of MGS identified in SEQ ID NO 1 , SEQ ID NO 2 and SEQ ID NO 3.
- the present invention also concerns a DNA sequence comprising a sequence coding for the mutant MGS of the invention.
- the sequence coding for the mutant MGS of the invention is not a limiting factor by itself. The skilled person can easily obtain the sequence of a native MGS from a microorganism and introduce in the coding sequence the mutation(s) to be introduced in the protein by changing one or more appropriate nucleotide.
- the skilled person can also perform a mutagenesis in the sequence of a microorganism, and isolate the mutated DNA sequence by standard methods.
- Mutations can be introduced by site-directed mutagenesis by usual methods like
- mutagenesis techniques such as use of mutagenic agents (Ultra- Violet rays or chemical agents like nitrosoguanidine (NTG) or ethylmethanesulfonate (EMS)) or use of PCR techniques (DNA shuffling or error-prone PCR).
- mutagenic agents Ultra- Violet rays or chemical agents like nitrosoguanidine (NTG) or ethylmethanesulfonate (EMS)
- PCR techniques DNA shuffling or error-prone PCR.
- sequence of the invention can be isolated, consisting in the coding sequence as defined above, or within a gene comprising regulatory elements upstream and downstream the coding sequence for its expression in a specific organism.
- sequence can also be present in a vector, for its replication (replication vector) or for the expression and translation of the mutated protein of the invention in a microorganism (expression vector).
- replication vector replication vector
- expression vector expression vector
- Said genes and vectors are also part of the invention.
- the DNA sequence of the invention is in a microorganism with regulatory elements allowing expression and translation of the mutated MGS of the invention.
- the invention also concerns a method for the production of a biochemical selected among lactic acid, acetol and 1,2-propanediol by fermentation comprising culturing a microorganism of the invention, modified for an improved production of lactic acid, acetol and/or 1,2-propanediol and recovery of the biochemical.
- the recovered lactic acid and/or acetol and/or 1,2- propanediol is purified.
- the production is done by fermentation in a batch, fed-batch or continuous process, according to processes known to the person skilled in the art of microorganisms fermentation.
- the production is done by fermentation in a fed- batch process.
- the microorganism is cultured on an appropriate culture medium.
- An "appropriate culture medium” means a medium of known molecular composition adapted to the growth of the micro-organism.
- said medium contains at least a source of phosphorus and a source of nitrogen.
- Said appropriate medium is for example a mineral culture medium of known set composition adapted to the bacteria used, containing at least one carbon source.
- Said appropriate medium may also designate any liquid comprising a source of nitrogen and/or a source of phosphorus, said liquid being added and/or mixed to the source of sucrose.
- the mineral growth medium for Enterobacteriaceae can thus be of identical or similar composition to M9 medium
- the carbon source 'glucose' can be replaced in this medium by any other carbon source, in particular by sucrose or any sucrose-containing carbon source such as sugarcane juice or sugar beet juice.
- carbon source or "carbon substrate” means any carbon source capable of being metabolized by a microorganism wherein the substrate contains at least one carbon atom.
- the carbon source is selected among the group consisting of glucose, sucrose, mono- or oligosaccharides, starch or its derivatives or glycerol and mixtures thereof.
- microorganisms used in the method of the present invention can be modified to be able to grow on specific carbon sources when the non modified microorganism cannot grow on the same source of carbon, or grow at to low rates. These modifications may be necessary when the source of carbon is a byproduct of biomass degradation such as by-products of sugarcane including; filter cake from clarification of raw juice and different kind of molasses.
- Figure 1 represents the alignment of 36 protein sequences of MGS of various sources. The sequences were obtained from the UniProt Knowledge Base (The UniProt consortium (2008)) and the alignment made using MUSCLE with default parameters.
- Figure 2 represents the metabolic pathways for the production of lactic acid, acetol and 1,2-propanediol in the microorganisms of the invention.
- Figure 3 represents the analysis on SDS 4-15% gradient polyacrylamide gel the different purification steps of the protein mgsA* V116L.
- Lane 1 Molecular weight marker
- Lane 2 Crude extract
- Lane 3 supernatant of the 1 st ammonium sulphate precipitation
- Lane 4 pellet of the 2 nd ammonium sulphate precipitation
- Lane 5 Resource
- Example 1 Evolution of 3 modified strains of E. coli MG1655 in chemostat culture and identification of 3 mutant MGS enzymes in the evolved clones:
- strain 2 The construction of the strains E. coli MG 1655 lpd* AtpiA, ApflAB, AadhE, ldhA::Km, AgIoA, AaIdA, AaIdB, Aedd (strain 1), E. coli MG1655 lpd* AtpiA, ApflAB, AadhE, AldhA:: Cm, AgIoA, AaIdA, AaIdB, Aedd (strain 2) and E.
- strain 3 coli MG 1655 lpd* AtpiA, ApflAB, AadhE, AldhA, AgIoA, AaIdA, AaIdB, Aedd, AarcA, Andhr.Km (strain 3) were previously described in patent application WO 2005/073364 for strain 1 and in patent application WO 2008/116852 for strains 2 and 3.
- the 3 strains were cultivated in continuous culture, either under anaerobic conditions, or under microaerobic conditions (1% oxygen) in the culture medium MPG (given in patent application WO 2008/116852) with 0.42 or 0.84 g/1 sodium nitrate, with excess glucose (from 20 g/1 initially with addition if the glucose becomes exhausted).
- the temperature was set at 37°C
- the pH was regulated at 6.5 by addition of base and the dilution rate of the chemostat was set between 0.04 h -1 and 0.08 h -1 .
- Example 2 Production, purification and characterization of native MGS and 3 mutant MGS (H21Q, A95V & Vl 16L)
- the plasmid was built to obtain the overexpression of the native protein (without His-tag).
- the gene mgsA (sequence 1025780-1026238) was PCR amplified from genomic DNA of E. coli MG 1655 using the following oligonucleotides :
- caccatggaactgacgactcgca (SEQ ID NO 4)
- the fragment amplified was directly cloned into the pETIOl from the "Champion pET Directional TOPO Expression Kits” (invitrogen®).
- the plasmid built was named pETTOPO-mgs.4.
- the three mutant MGS bear the mutations H21Q, A95V or Vl 16L.
- the plasmids for the overexpression of the three mutant proteins were built by directed mutagenesis in the plasmid pETTOPO-mgsA using Quickchange site-directed mutagenesis kit from stratagene®.with the oligonucleotides given in Table 4.
- Table 4 Oligonucleotides used for the site-directed mutagenesis of mgsA
- the 3 plasmids obtained were named pETTOPO-mg ⁇ *(A95V), pETTOPO- mgsA*( ⁇ 16L) and pETTOPO-mg ⁇ *(H21Q).
- the strain used to carry out the overexpression was deleted for the mgsA gene.
- Protocol 1 Introduction of a PCR product for recombination and selection of the recombinants (FRT system).
- the oligonucleotides chosen and given in Table 5 for replacement of a gene or an intergenic region were used to amplify either the chloramphenicol resistance cassette from the plasmid pKD3 or the kanamycin resistance cassette from the plasmid pKD4 (Datsenko, K.A. & Wanner, B.L. (2000)).
- the PCR product obtained was then introduced by electroporation into the recipient strain bearing the plasmid pKD46 in which the system ⁇ Red ( ⁇ , ⁇ ,.exo) expressed greatly favours homologous recombination.
- the antibiotic- resistant trans formants were then selected and the insertion of the resistance cassette was checked by PCR analysis with the appropriate oligonucleotides given in Table 6.
- Protocol 2 Transduction with phage Pl for deletion of a gene
- the deletion of the chosen gene by replacement of the gene by a resistance cassette (kanamycin or chloramphenicol) in the recipient E. coli strain was performed by the technique of transduction with phage Pl.
- the protocol was in two steps, (i) the preparation of the phage lysate on the strain MG1655 with a single gene deleted and (ii) the transduction of the recipient strain by this phage lysate. Preparation of the phage lysate
- E. coli recipient strain in LB medium E. coli recipient strain in LB medium.
- Control tubes 100 ⁇ l cells
- Tube test 100 ⁇ l of cells + 100 ⁇ l phages Pl of strain MG1655 with a single gene deleted.
- the antibiotic-resistant trans formants were then selected and the insertion of the deletion was checked by a PCR analysis with the appropriate oligonucleotides given in Table 6.
- E. coli BL21 star (DE3) AmgsA ::Cm.
- the plasmids p ⁇ OFO-mgsA, pETTOPO-mgs.4*(A95V), pETTOPO- mgsA* (V 116L), pETTOPO-?Mgx4*(H21Q) were transformed by electroporation in the strain E. coli BL21 star (DE3) AmgsA::Cm and the strains obtained were named, respectively:
- AmgsA ::Cm pETTOPO-/wg&4*(A95V), BL21 star (DE3) AmgsAv.Cm pETTOPO- mgsA*(yi l6L) and BL21 star (DE3) AmgsA::Cm pETTOPO-/wg&4*(H21Q) were cultivated at 37°C under aerobic conditions in 2 1 baffled Erlenmeyer flasks with 500 ml LB medium with 2.5 g/1 glucose. The flasks were agitated at 200 rpm on an orbital shaker. When the optical density measured at 550 nm reached 0.5 units, the flasks were incubated at 25°C.
- the production of MGS proteins was induced by adding 500 ⁇ M IPTG in the cultures.
- the biomass was harvested by centrifugation when the cultures reached an optical density above 3.5 units. The supernatant was discarded and the pellet was stored at - 20°C before use.
- a coupled activity assay adapted from Hopper and Cooper (1972) was used to determine the enzyme activity.
- Dihydroxyacetone phosphate (DHAP) is converted to methylglyoxal (MG) by MGS.
- MG is coupled to the formation of S-D- lactoylglutathione by the non enzymatic formation to the thio hemi-acetal with glutathione and the subsequent isomerisation of the complex by glyoxalase I.
- the rate of increase in absorbance at 240 nm, corresponding to S-D-lactoylglutathione formation and thus to MG formation was measured at 30°C on a spectrophotometer.
- the standard assay mixture consisted of 1.5mM DHAP, 1.5 mM glutathione, 50 mM Imidazole (pH 7.0), 2 units of yeast glyoxalase I and 30 ⁇ l of MGS sample in a total volume of 1000 ⁇ l.
- Control assay lacking the MGS sample was run in parallel and the value measured for the control was subtracted to the assay to take into account non-specific formation of MG or S-D- lactoylglutathione.
- Initial velocities were measured by following the increase in absorbance att 240 nm over time after addition of MGS sample.
- a unit MGS activity was defined as the formation of l ⁇ mol of MG/min under the conditions of the assay. Specific enzyme activity was expressed as units per mg of protein.
- the four proteins MgsA, MgsA*(V116L), MgsA*(H21Q), MgsA*(A95V) were purified using the same protocol. This protocol was adapted from Hooper and Cooper (1972).
- Imidazole ImM Potassium Phosphate pH 7, and a protease inhibitor cocktail.
- Cells were sonicated on ice (Branson sonifier, 70W) in a Rosett cell RZ3 during six cycles of 30 sec with 30 sec intervals. Cells debris were removed by centrifugation at 1200Og for 30 min at
- fractions which contain the MGS protein were pooled and dialysed against 50 mM Imidazole, ImM Potassium Phosphate, 10OmM NaCl pH 8 overnight.
- the dialysed pool was applied to a 1.7ml Mono Q column (GE Healthcare) equilibrated with 50 mM Imidazole, ImM Potassium Phosphate, 10OmM NaCl pH 8.To avoid column overload, 4 runs were done. For each run, the column was washed with 10 column volumes of 50 mM Imidazole, ImM Potassium Phosphate, 10OmM NaCl pH 8. Proteins were eluted with a gradient of 20 column volumes from 0.1 M to 0.5 M sodium chloride. After elution, the column was washed with 1 column volume of a gradient form 0.5M to IM sodium chloride and with 5 column volumes of IM sodium chloride. The flow rate of the column was 1.5 ml/min and 2 ml fractions were collected.
- the concentrated fractions from the Mono Q column were loaded onto a Superdex 200 10/300 GL column (GE Healthcare) equilibrated with 50 mM Imidazole, ImM Potassium Phosphate, 350 mM NaCl pH 7. Four runs were realised. The flow rate of the column was 0.5 ml/min and 0.5 ml fractions were collected. The MGS protein was eluted with about 13,5 ml of buffer. The expression and purification of the mutant MGS were remarkably similar to that of the wild type enzyme. There were no differences in the oligomerisation state between the native mgsA and the mutated mgsA*.
- the pool of each purification step was analysed on a SDS 4-15% gradient polyacrylamide gel (Fig. 3). This gel shows the purity increased along the purification step. After the superdex 200 column, the protein was almost 90% pure. The final pool showed two major bands at about 17 kDa corresponding to the protein MgsA and at about 70 kDa corresponding to the BSA used to stabilize the enzyme.
- Kinetic constants (Km, kcat and kcat/Rm) for the four purified enzymes were determined using the activity assay previously described. At least six DHAP concentrations between 0.08 mM and 1.5mM were analysed for each enzyme. For all kinetics, initial velocity was determined in triplicate for all DHAP concentrations.
- the purified protein stored at 4°C in 50 mM Imidazole, ImM Potassium Phosphate, 350 mM NaCl, 0.1 mg/ml BSA pH 7 was diluted in 50 mM Imidazole, 10% glycerol, 0.1 mg/ml BSA pH 7.
- Specific activity for each MGS is directly calculated from the kcat value. Specific activity of MgsA and MgsA*(H21Q) were similar. Specific activity of MgsA*(A95V) represented 75% of the specific activity of MgsA. Specific activity of MgsA* (V 116L) represented 50% of the specific activity of MgsA. The mutations were not detrimental for the activity of the enzyme.
- the kinetic parameters (Km, kcat and kcat/Rm) of the four purified enzymes (MgsA, MgsA*(V116L), MgsA*(H21Q) and MgsA*(A95V)) stored at 4°C in 50 mM Imidazole, ImM Potassium Phosphate, 350 mM NaCl, 0.1 mg/ml BSA pH 7 were determined in presence of different concentration of potassium phosphate in the activity assay (0.2mM, 0.3mM, ImM orthophosphate (Pi)). Before the activity assay, the protein is diluted in 50 mM Imidazole, 10% glycerol, 0.1 mg/ml BSA pH 7. To determine precisely these kinetic parameters, all measures of initial velocities were done in triplicate for at least six concentrations in substrate (DHAP) between 0.08 mM and 1.5mM.
- DHAP concentration in substrate
- Example 3 Construction of two E. coli 1,2-propanediol producer strains expressing wildtype or modified MGS and assessment of 1,2-propanediol production
- the gene gloA was inactivated in strain E. coli MG 1655 by inserting a chloramphenicol antibiotic cassette and deleting most of the gene concerned using the technique described in protocol 1 with the oligonucleotides given in Table 5. The deletion was checked by a PCR analysis with the appropriate oligonucleotides given in Table 6. The resulting strain was named E. coli MG 1655 AgIoAv. Cm.
- the resulting strain was named E. coli MG1655 Aedd-eda::Km.
- Protocol 2 Transduction with phage P 1 for deletion of a gene
- E. coli recipient strain in LB medium E. coli recipient strain in LB medium.
- Control tubes 100 ⁇ l cells
- the antibiotic-resistant trans formants were then selected and the insertion of the deletion was checked by a PCR analysis with the appropriate oligonucleotides given in Table 6.
- the deletion was checked by a PCR analysis with the appropriate oligonucleotides given in Table 6 as well as the other deletions already present in the strain.
- the resulting strain was named E. coli AgloA::Cm, Aedd-eda::Km.
- Protocol 3 Elimination of resistance cassettes (FRT system)
- the chloramphenicol and/or kanamycin resistance cassettes were eliminated according to the following technique.
- the plasmid pCP20 carrying the FLP recombinase acting at the FRT sites of the chloramphenicol and/or kanamycin resistance cassettes was introduced into the strain by electroporation. After serial culture at 42°C, the loss of the antibiotic resistance cassettes was checked by PCR analysis with the oligonucleotides given in Table 5.
- the strain obtained was named E. coli MG 1655 AgIoA Aedd-eda. 1.4. Construction of the modified strain E. coli MG1655 Aedd-eda AgIoA, AaldAr.Cm
- the gene aldA was inactivated in strain E. coli MG 1655 by inserting a chloramphenicol antibiotic cassette and deleting most of the gene concerned using the technique described in protocol 1 with the oligonucleotides given in Table 5. The deletion was checked by a PCR analysis with the appropriate oligonucleotides given in Table 6. The resulting strain was named E. coli MG 1655 AaIdAv. Cm.
- the resulting strain was named E. coli MG 1655 Aedd-eda AgIoA, AaIdA:: Cm.
- the gene aldB was inactivated in strain E. coli MG 1655 by inserting a Kanamycin antibiotic cassette and deleting most of the gene concerned using the technique described in protocol 1 with the oligonucleotides given in Table 5. The deletion was checked by a PCR analysis with the appropriate oligonucleotides given in Table 6.
- the resulting strain was named E. coli MG1655 AaIdBvKm.
- the resulting strain was named E. coli MG1655 Aedd-eda AgIoA, AaldAr. Cm, AaIdBvKm. 1.6. Construction of the modified strain E. coli MG1655 Aedd-eda AgIoA, AaIdA, AaIdB
- the antibiotic resistance cassettes were eliminated in the strain E. coli MG 1655 Aedd-eda AgIoA, AaldAr. Cm, AaIdBwKm according to Protocol 3.
- the strain obtained was named E. coli MG1655 Aedd-eda AgIoA, AaIdA, AaIdB. 1.7. Construction of the modified strain E. coli MG1655 Aedd-eda
- the gene arcA was inactivated in strain E. coli MG 1655 by inserting a Kanamycin antibiotic cassette and deleting most of the gene concerned using the technique described in Protocol 1 with the oligonucleotides given in Table 5. The deletion was checked by a PCR analysis with the appropriate oligonucleotides given in Table 6.
- the resulting strain was named E. coli MG1655 AarcAwKm.
- the strain obtained was named E. coli MG 1655 Aedd-eda AgIoA, AaIdA, AaId,
- AarcA Km.
- the gene ndh was inactivated in strain E. coli MG 1655 by inserting a chloramphenicol resistance cassette and deleting most of the gene concerned using the technique described in Protocol 1 with the oligonucleotides given in Table 5. The deletion was checked by a PCR analysis with the appropriate oligonucleotides given in Table 6. The resulting strain was named E. coli MG 1655 AndhwCm. 1.8.2. Construction of the modified strain E. coli MG1655 Aedd-eda AgIoA, AaIdA, AaIdB, AarcAy.Km, Andhr.Cm
- the strain obtained was named E. coli MG 1655 Aedd-eda AgIoA, AaIdA, AaId, AarcAy.Km, Andhr. Cm.
- the antibiotic resistance cassette was eliminated in the strain E. coli MG 1655 Aedd-eda AgIoA, AaIdA, AaIdB, AarcA:: ⁇ Lm, Andhr.Cm according to Protocol 3.
- the strain obtained was named E. coli MG 1655 Aedd-eda AgIoA, AaIdA, AaIdB, AarcA, Andh.
- the plasmid pMElOlVBOl was derived from plasmid pMElOl and harbors a multiple cloning site containing recognition site sequences specific for the rare restriction endonucleases Nhel, SnaBl, Pad, BgIW, Avrll, Sacll and Agel following by the adc transcription terminator of Clostridium acetobutylicum ATCC 824.
- the plasmid pMElOl was constructed as follows.
- the plasmid pCL1920 (Lerner & Inouye, 1990, NAR 18, 15 p 4631 - GenBank AX085428) was PCR amplified using the oligonucleotides PMElOlF and PMElOlR and the BstZni-Xmnl fragment from the vector pTrc99A (Amersham Pharmacia Biotech, Piscataway, NJ) harboring the lad gene and the trc promoter was inserted into the amplified vector.
- PMElOlR (SEQ ID NO 13): agcttagtaaagccctcgctag
- a synthetic double-stranded nucleic acid linker comprising the multicloning site and adc transcriptional terminator was used to generate pMElOlVBOl.
- Two 100 bases oligonucleotides that complement flanked by Ncol or Hindl ⁇ l digested restriction sites were annealed.
- the 100-base pair product was subcloned into Ncol I Hindlll digested plasmid pME 101 to generate pME 10 IVBO 1.
- pMElOlVBOl consisting of 100 bases (SEQ ID NO 14):
- pMElOlVBOl 2 consisting of 100 bases (SEQ ID NO 15):
- pSCB-yqhD The PCR amplified fragment was cloned in pSCB (strataclone®).
- the resulting plasmid was named pSCB-yqhD.
- a directed mutagenesis was performed on this plasmid with the following oligonucleotides : yqhD*G149EmutDirF (consisting of 45 pb, ggttcagaatccaacgcagaagcggtgatAtcccgtaaaccacaggc, (SEQ ID NO 18) and yqhD*G149EmutDirR (consisting of 45 pb gcctgtggttttacgggaTatcaccgcttctgcgttggattctgaacc, (SEQ ID NO 19).
- the two oligonucleotides were homologous to the region 3153803 to 3153850. In bold face letter, bases which were changed to create the mutation G149E and capital letter, the base which were changed to create EcoRN restriction site.
- the resulted plasmid was named pSCB- yqhD*(GU9E).
- the gene gldA PCR amplified from genomic DNA of E. coli MG 1655 using the oligonucleotides gldA F and gldA R was cloned in pSCB (Strataclone®). The resulting plasmid was named pSCB-gldA.
- a directed mutagenesis was performed on this plasmid with the following oligonucleotides: gldA* Al 60TmutDirF (consisting of 45 pb, gacaccaaaatcgtcgctggcacacctgcacgtctgCtagcggcg, SEQ ID NO 20) and gldA*A160TmutDirR (consisting of 45 pb cgccgctaGcagacgtgcaggtgtgccagcgacgattttggtgtc, SEQ ID NO 21).
- the two oligonucleotides are homologous to the region 4136602 to 4136558. In bold face letter, bases which were changed to create the mutation A 160T and underlined letter, the base which were change to create EcoEN restriction site.
- the resulted plasmid was named pSCB-g/dL4 *(A160T).
- the pSCB-g/ ⁇ i4*(A160T) was cut with the restriction enzymes ⁇ vrll and Sad and the fragment containing gldA* (A 160T) was cloned into the avrll/Sacl sites of the vector pME101VB01-jg/zD*(G149E).
- the resulting plasmid was named pME101VB01- j;g/zD*(G149S)-g/dL4*(A160T).
- the plasmid pMEl0l ⁇ B0l-yqhD-gldA *(A160T) was introduced by electroporation into the strain E. coli MG1655 AgIoA, Aedd-eda, AaIdA, AaIdB, AarcA, Andh.
- the strain obtained was named E. coli MG 1655 AgIoA, Aedd-eda, AaIdA, AaIdB, AarcA, Andh (pME101VB01-yqhD*(G149E)-gldA*(A160T). 1.11. Construction of the modified strain E. coli MG1655 mgsA*(H21Q)::Km
- the fragment obtained was introduced into the strain MG 1655 rpsL* (built as described in Heermann et al.) according to Protocol 1.
- the strain obtained was checked by PCR and sequence analysis.
- the strain obtained is named E. coli mgsA*(H21Q)::rpsL-NQO.
- the deletion of the cassette rpsL-Neo was performed according to Protocol 1.
- the fragment transformed was obtained by the restriction with Ncol and S ⁇ cl of the plasmid pETTOPO-mgs ⁇ *(H21 Q).
- the modification was checked by PCR using oligonucleotides described in Table 6.
- a kanamycin resistance cassette was introduced in 3' of mgsA*(H21Q) open reading frame (ORF) using the following primers :
- mgsA : :Km F consisting of 100 bp : (SEQ ID NO 24)
- mgsA ::Km R consisting of 100 bp : (SEQ ID NO 25)
- the fragment obtained was introduced into the strain MG 1655 mgsA*(H21Q) according to Protocol 1.
- the strain obtained was checked by PCR.
- the strain obtained was named E. coli mgsA*(m ⁇ Q)::Km
- a kanamycin resistance cassette was introduced in 3' of mgsA open reading frame using the following primers : as shown in SEQ ID NO 24 and SEQ ID NO 25.
- the fragment obtained was introduced into the strain MG 1655 according to Protocol 1.
- the strain obtained was checked by PCR.
- the strain obtained was named E. coli mgsA : :Km 2.2.2 Construction of the modified strain E. coli MG1655 mgsA::Km, AgIoA, Aedd-eda, AaIdA, AaIdB, AarcA, Andh (pME101VB01-yqhD*(G149E)-gldA*(A160T))
- the replacement of the mgsA with the mgsA::Km into the strain E. coli Aedd-eda AgIoA, AaIdA, AaIdB, AarcA, Andh (pME101VB01-yqhD*(G149E)-gldA*(A160T)) was performed by the technique of transduction with phage Pl.
- the modifications mgsA::Km and the others deletion were checked using the oligonucleotides described in Table 6.
- the resulting strain was named E. coli MG1655 mgsA::Km, AgIoA, Aedd-eda, AaIdA, AaIdB, AarcA, Andh (pME101VB01-yqhD*(G149E)-gldA*(A160T)). 3. Assessment of 1,2-propanediol production in two E. coli isogenic strains differing only in the mgsA alleles
- the two strains described above were cultivated in an Erlenmeyer flask assay (500 ml flasks with 50 ml of medium) under aerobic conditions in minimal medium MMLl lPGl lOO (see composition in Table 9) with 20 g/1 glucose as sole carbon source. Spectinomycin was added at a concentration of 50 mg/1.
- Table 9 composition of minimal medium MMLl IPG 1 100.
- the pH of the medium was adjusted to 6.8 with sodium hydroxide
- the culture was carried out at 37°C and the pH was maintained by buffering the culture medium with MOPS.
- 1,2-propanediol and residual glucose in the fermentation broth were analysed by HPLC using a Biorad HPX 97H column for the separation and a refractometer for the detection. The yields of 1,2-propanediol over glucose were then calculated.
- Table 10 production of 1,2-propanediol in minimal medium with glucose as carbon source.
- ND means 'not detected' - n is the number of repetitions of the same experiment -
- the figures given are the mean and standard deviation of the figures obtained for n repetitions.
- the strain with wild-type MGS does not produce any 1,2-propanediol due to the inhibition by inorganic phosphate.
- the E. coli strain with a mutant MGS clearly produces 1,2-propanediol, confirming together with the above findings that strains with mutant MGS that are insensitive to inhibition by inorganic phosphate can produce 1,2-propanediol in the presence of inorganic phosphate.
- Example 4 Production of 1,2-propanediol by E. coli with a mutant MGS, a mutant YqhD and a mutant GlyDH on glucose and sucrose
- the plasmid pKJLlOl.l (Robeis et al. (2002), J. Bacteriol. 184:5307-5316) was digested by EcoRl.
- the fragment containing the cscBKAR gene was cloned in pBBRlMCS5 (Kovach et al. (1995), Gene, 166 175-176) also digested by EcoRI.
- the resulted plasmid was named pBBRlMCS ⁇ -cscBKAR.
- the plasmids pME101-VB01- ⁇ AD*(G149E>g/ci4*(A160T) and pBBRlMCS5- cscBKAR were introduced by electroporation in the strain E. coli MG 1655 mgsA *(H21Q), Aedd-eda, AgIoA, AaIdA, AaIdB, AarcA, Andh.
- the culture was carried out at 37°C and the pH was maintained by buffering the culture medium with MOPS.
- 1,2-propanediol and residual glucose or sucrose in the fermentation broth were analysed by HPLC using a Biorad HPX 97H column for the separation and a refractometer for the detection. The yields of 1,2-propanediol over glucose or sucrose were then calculated.
- Table 11 production of 1,2-propanediol in minimal medium with glucose or sucrose as carbon source.
- n is the number of repetitions of the same experiment -
- the figures given are the mean and standard deviation of the figures obtained for n repetitions.
- the production of 1,2-propanediol in a E. coli strain with a mutant MGS was improved on sucrose as sole carbon source as compared with glucose.
- Example 5 Construction of two E. coli acetol producer strains expressing wildtype or modified MGS and assessment of acetol production
- the gene gldA was inactivated in strain E. coli MG 1655 by inserting a Kanamycin antibiotic cassette and deleting most of the gene concerned using the technique described in Protocol 1 with the oligonucleotides given in Table 5. The deletion was checked by a PCR analysis with the appropriate oligonucleotides given in Table 5.
- the resulting strain was named E. coli MG1655 AgIdAwKm.
- the deletion was checked by a PCR analysis with the appropriate oligonucleotides given in
- the resulting strain was named E. coli MG 1655 Aedd-eda AgIoA, AaIdA, AaIdB, AgldA::Km
- the antibiotic resistance cassette was eliminated in the strain E. coli MG 1655 Aedd-eda AgIoA, AaIdA, AaIdB, AgldAy.Km according to Protocol 3.
- the loss of the antibiotic resistance cassette was checked by PCR analysis with the oligonucleotides given in Table 6.
- the presence of the modifications previously built in the strain was also checked using the oligonucleotides given in Table 6.
- the strain obtained was named E. coli MG 1655 Aedd-eda AgIoA, AaIdA, AaIdB, AgIdA.
- the modification was checked by a PCR analysis with the appropriate oligonucleotides given in Table 6.
- the resulting strain was named E. coli MG1655 PtrcOl- gapAv. Cm.
- the strain obtained was named E. coli MG 1655 PtrcO ⁇ -gapA ⁇ cm Aedd-eda AgIoA, AaIdA, AaIdB, AgIdA.
- the plasmid pMElOl ⁇ BOl-yqhD*(Gl 49E) was introduced by electroporation into the strain E. coli MG1655 PtvcO ⁇ -gapA::cm Aedd-eda AgIoA, AaIdA, AaIdB, AgIdA.
- the strain obtained was named E. coli MG 1655 PtrcO ⁇ -gapA::cm, AgIoA, Aedd-eda, AaIdA, AaIdB, AgIdA ⁇ xME ⁇ -VB& ⁇ -yqKD*(G149E).
- the resulting strain was named E. coli MG1655 mgsA*(H21Q)::Km Ptvc0l-gapA::cm Aedd-eda AgIoA, AaIdA, AaIdB, AgIdA pME ⁇ 0 ⁇ -YB0 ⁇ -yqhD*(G149E).
- Construction of the modified strain E. call MGIG55 PtrcQl-gapA ⁇ cm, mgsAnKm AeM-eda, AgIoA, AaIdA, AtUdB, AgMA, (pME101-VB01-jgAZ
- the mgsAi'.Km was constructed in the strain E, coli MGl 655 Pirc01-gapA;:cm A ⁇ dd-eda, AgIoA 1 AaIdA, AaIdB, AgIdA (pMElQl-VBQl-yqhD*(Gl49E)) as previously described.
- the two strains described above were cultivated in an Erlenmeyer flask assay (500 ml flasks with 50 ml of medium) under aerobic conditions in minimal medium MMLllPGl_100 (see composition in Table 9) with 20 g/1 glucose as sole carbon source. Spectinomycin was added at a concentration of 50 mg/1.
- the culture was carried out at 37 0 C and the pH was maintained by buffering the culture medium with MOPS,
- acetol and residual glucose in the fermentation broth were analysed by HPLC using a Biorad HPX °7H column for the separation and a r ⁇ fractomet ⁇ r for the detection. The yields of acetol over glucose or sucrose were then calculated.
- Table . 12 production of acetol in minimal medium with glucose as carbon source.
- ii is the number of culiui-es of different clones of the same strain -
- the figures given are the mean and standard deviation of the figures obtained for n cultures.
- the plasmid pBBR IMC S 5 -cscBKA was introduced by electroporation in the strain E. coli MG1655 Ptrc01-gapA::cm, mgsA *(H21Q::Km), Aedd-eda AgIoA, AaIdA, AaIdB, AgIdA pMElOl-VBOl-j ⁇ /iZ)* ⁇ )
- the resulted strain was named E. coli MG1655 PtrcOl-gapA ::cm, mgsA *(H21Q)::Km, Aedd-eda AgIoA, AaIdA, AaIdB, AgIdA ⁇ ME ⁇ Q ⁇ -NBQ ⁇ -yqhD*(G149E) pBBRlMCS5- cscBKAR.
- Example 7 Construction of two E. coli lactate producer strains expressing wildtype or modified MGS and assessment of lactate production
- the deletion is checked by a PCR analysis with the appropriate oligonucleotides given in table 6 as well as the others deletions present in the strain.
- the loss of the antibiotic resistance cassettes is checked by PCR analysis with the oligonucleotides given in Table 6.
- the presence of the modifications previously built in the strain is also checked using the oligonucleotides given in Table 6.
- the strain obtained is named E. coli MG1655 PtrcOl-gapA, Aedd-eda.
- the strain obtained is named E. coli MG1655 AyqhDwKm.
- the deletion of the gene yqhD by replacement of the gene by a Kanamycin resistance cassette in the strain E. coli MG 1655 PtrcOl -gap A Aedd-eda is performed using the transduction technique with phage Pl described in Protocol 2.
- the deletion is checked by a PCR analysis with the appropriate oligonucleotides given in table 6.
- the strain obtained is named E. coli PtrcOl -gap A, Aedd-eda, AyqhD: /Km.
- the gene did is inactivated by inserting a chloramphenicol antibiotic resistance cassette and deleting most of the gene concerned using the technique described in Protocol 2 with the oligonucleotides given in Table 5.
- the deletion is checked by a PCR analysis with the appropriate oligonucleotides given in table 6.
- the strain obtained is named E. coli MG 1655 AdldwCm.
- the resulting strain is named E. coli MG 1655 PtrcOl -gap A, Aedd-eda, AyqhDwKm, Adldv.Cm.
- the strain obtained is named E. coli MG 1655 PtrcOl -gap A, Aedd-eda, AyqhD,
- the gene HdD is inactivated by inserting a chloramphenicol antibiotic resistance cassette and deleting most of the gene concerned using the technique described in Protocol 2 with the oligonucleotides given in Table 5. The deletion is checked by a PCR analysis with the appropriate oligonucleotides given in Table 6.
- the strain obtained is named E. coli MG 1655 AlldD::Cm.
- the resulting strain is named E. coli MG 1655 PtrcOl -gap A, Aedd-eda, AyqhD, AdId, AlldD::Cm.
- the chloramphenicol resistance cassette is then eliminated according to Protocol 3.
- the strain obtained is named E. coli MG 1655 PtrcOl -gap A, Aedd-eda, AyqhD, AdId, AlIdD. 1.5. Construction of the modified strain E. coli MG1655 PtrcOl-g ⁇ p ⁇ , Aedd- eda, AyqhD, AdId, AHdD (pJB137-Pg ⁇ p ⁇ -pps ⁇ ) (pME101-VB01-je ⁇ /£/)
- the plasmids pJB137 '-P gapA-pps A and pMElOl-VBOl-yedU are introduced by electroporation in the strain E. coli MG 1655 PtrcOl -gapA, Aedd-eda, AyqhD, AdId, AlIdD.
- the mutation mgsA*(H21Q) is constructed in the strain E. coli MG 1655 PtrcOl - gapA, Aedd-eda, AyqhD, AdId, AlIdD as previously described in Example 3.
- the plasmids pJB137 '-P gapA-pps A and pMElOl-VBOl-yedU, are introduced by electroporation in the strain E. coli MG 1655 PtrcOl -gap A, mgsA*(H2 ⁇ Q), Aedd-eda, AyqhD, AdId, AUdD.
- Example 8 Construction of two Saccharomyces cerevisiae 1,2-propanediol producer strains and assessment of 1,2-propanediol production
- the S. cerevisiae strain used was CEN.PK2-1C (MATa; ura3-52; trpl-289; Ieu2-3,112; his3 Al; MAL2-8C; SUC2) from Euroscarf.
- the gene GPD2 was inactivated by transforming the strain CEN.PK2-1C with a PCR fragment corresponding to pTDH3-gldA*(A160T)-CYCt-pTEFl-ble-TEFlt cassette, built using the "short flanking homology" (SFH) method described by Guldener et al. (1996).
- SFH short flanking homology
- the pTDH3-gldA*(A160T)-CYCt-pTEFl-ble-TEFlt cassette was constructed using long
- pTDFB and CYCt were amplified from the plasmid p406TDH3 (Addgene) using pTDFB/
- gldA*(A160T)- was amplified from pSCB gldA*(A160T)- using primers gldA / TDH3F and gldA /CYCtR.
- pTEFl-b Ie-TEF It was amplified from the plasmid pUG66 from Euroscarf using Zeo/CYCt F and ZEO/GPD2 R as primers.
- 100 ng of each fragment was used in a PCR experiment without primers, using low annealing conditions allowing their simultaneous fusion.
- the unpurified product obtained in this step was used as a matrix a in a PCR experiment at high Tm, using pTDFB/ GPD2 F and ZEO/GPD2 R primers having an extension of 40 bp homologous to the 40 first and 40 last bp of the GPD2 locus (Table 13).
- This fragments was integrated in the GPD2 locus, replacing the GPD2 open reading frame.
- the transformation method used was the lithium acetate method described by Schiestl and Gietz (1989).
- the strain CENPK, Agpd2, gldA*(A160T ) was selected on YEPD rich medium (1% bacto yeast extract, 2% bactopeptone, 2% glucose) supplemented with 75 ⁇ g/ml of phleomycin (Cayla, France).
- the integration of gldA*(A160T) and the deletion of GPD2 gene were confirmed by PCR on genomic DNA extracted, using GPD2 ver F and GPD2 ver R primers (Table 13).
- the pTEFl- yqhD-CYCt-pTEFl-natl-TEFlt cassette or pTEFl-yqhD* (G149E) -CYCt- pTEFl-natl-TEFlt cassette were constructed using long PCR-based fusion of several fragments.
- pTEFl and CYCt were amplified from the plasmid p405TEFl (Addgene) using pTEFl/
- yqhD and yqhD* were amplified respectively from pSCB-yqhD and pSCB yqhD*
- pTEFl-natl-TEFlt was amplified from the plasmid pAG35 from Euroscarf using
- the unpurified product obtained in this step was used as a matrix in a PCR experiment with at high Tm, using pTEFl/ LEU2 F and Natl/Leu2 primers having an extension of 40 bp homologous to the 40 first and 40 last bp of the LEU2 locus (Table 14).
- the transformation method used was the lithium acetate method.
- gldA*(A160T ) was transformed either by pTEFl- yqhD-CYCt-pTEFl-natl-TEFlt cassette or by pTEFl-yqhD* (G149E)-CYCt-pTEFl-natl-TEFlt to obtained CENPK, Agpd2, gldA* (A160T), yqhD and CENPK, Agpd2, gldA* (A160T), yqhD* (G149E).
- Trans formants were selected on YEPD rich medium (1% bacto yeast extract, 2% bactopeptone, 2% glucose) supplemented with 50 ⁇ g/ml of nourseothricine (Weber bioagents, Germany).
- the integration of yqhD or yqhD* (G 149E) were confirmed by PCR on genomic DNA extracted, using YQHD ver F and YQHD ver R primers (Table 14). This resulted in the heterologous expression of yqhD and yqhD* (G 149E).
- the resulting strains were named CENPK Agpd2, gldA*(A160T), yqhD and CENPK Agpd2, gldA*(A160T), yqhD*(G149E).
- the two strains used was CENPK, Agpd2, gldA*(A160T), yqhD or CENPK, Agpd2, gldA*(A160T), yqhD*, previously built.
- the gene TPIl was inactivated by transforming the strains with a PCR fragment corresponding to a pTEFl-hph-TEFlt-pPGKl-msgA*(H21Q) cassette using the "short flanking homology" (SFH) method.
- the pTEFl-hph-TEFlt-pPGKl-msgA*(H21Q) cassette was constructed using long PCR- based fusion of several fragments.
- the pTEFl-hph-TEFlt-pPGKl were amplified from the plasmid pAG35pPGA7 constructed from pAG35 (Euroscarf) using PGK1/TPI1F and PGKl/ mgsAR
- mgsA*(H21Q) was amplified from pETTOPO mgsA*(H21Q) using the primers mgsA/ PGKlF and mgsA/TPI R as primers.
- the unpurified product obtained in this step was used as a matrix in a PCR experiment at high Tm, using PGK1/TPI1F and mgsA/TPI R primers having an extension of 40 bp homologous to the 40 first and 40 last bp of the TPIl locus (Table 15).
- This fragment was integrated in the TPIl locus, replacing TPIl open reading frame.
- the transformation method used is the lithium acetate method.
- the strain CENPK, Agpd2, gldA*(A160T), yqhD and the strain CENPK, Agpd2, gldA*(A160T), yqhD* (G149E) was transformed by pTEFl-hph-TEFlt-pPGKl-msgA*(H21Q) cassette to obtained CENPK, Agpd2, Atpil, gldA*(A160T), yqhD* (G419E), msgA*(H21Q), CENPK, Agpd2, Atpil, gldA*(A16 Trans formants were selected on YEPD rich medium (1% bacto yeast extract, 2% bactopeptone, 2% glucose) supplemented with 250 ⁇ g/ml of hygromycin (Sigma- Aldrich).
- strain CENPK, Agpd2, Atpil, gldA*(A160T), yqhD, msgA*(H21Q) described above and the control strain CEN.PK2-1C were cultivated in batch culture, under anaerobic or aerobic conditions in minimal medium (SD medium 0.67% of Yeast nitrogen base without amino acid (DIFCO)) containing either 5% of glucose or 5% of sucrose as sole carbon source.
- minimal medium SD medium 0.67% of Yeast nitrogen base without amino acid (DIFCO)
- Minimal medium was supplemented with 50 mg/1 of uracil, 250 mg/1 of leucine, 50 mg/L of histidine and 50 mg/L of tryptophan. Cultures were grown at 28°C under agitation at 225 rpm.
- Aerobic cultures were carried out in shake flask of 250 ml containing 50 ml of medium. Anaerobic cultures were carried out in penicillin flask of 100 ml containing 90 ml of medium.
- 1,2-propanediol in the fermentation broth were analysed by gas chromatography/mass spectrometry (GC/MS) with an Agilent 7890A Series gas chromotograph coupled to an Agilent 5975C Series mass selective detector (EI) and a HP INNO Wax column.
- GC/MS gas chromatography/mass spectrometry
- EI Agilent 5975C Series mass selective detector
- HP INNO Wax column HP INNO Wax column.
- Residual glucose or sucrose in the fermentation broth were analysed by HPLC using a Biorad HPX 97H column for the separation and a refractometer for the detection. The yields of 1,2-propanediol over glucose or sucrose were then calculated.
- Table 16 production of 1,2-propanediol in minimal medium in aerobic or anaerobic conditions with glucose or sucrose as carbon source.
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201080043839.3A CN102575235B (zh) | 2009-07-30 | 2010-07-30 | 用于通过发酵生产生物化学品的突变甲基乙二醛合酶(mgs) |
| CA2767962A CA2767962C (en) | 2009-07-30 | 2010-07-30 | Mutant methylglyoxal synthase (mgs) for the production of a biochemical by fermentation |
| US13/387,095 US8497102B2 (en) | 2009-07-30 | 2010-07-30 | Mutant methylglyoxal synthase (MGS) for the production of a biochemical by fermentation |
| IN302DEN2012 IN2012DN00302A (https=) | 2009-07-30 | 2010-07-30 | |
| JP2012522178A JP5913099B2 (ja) | 2009-07-30 | 2010-07-30 | 発酵による生化学物質生産のための変異型メチルグリオキサールシンターゼ(mgs) |
| BR112012002153A BR112012002153A2 (pt) | 2009-07-30 | 2010-07-30 | metilglioxal sintase mutante (mgs) para a produção de material bioquímico por fermentação |
| EP10737072.8A EP2459710B1 (en) | 2009-07-30 | 2010-07-30 | Mutant methylglyoxal synthase (mgs) for the production of a biochemical by fermentation |
| KR1020127005195A KR101771266B1 (ko) | 2009-07-30 | 2010-07-30 | 발효에 의한 생화학물질의 생산을 위한 돌연변이체 메틸글리옥살 신타제 (mgs) |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US23007609P | 2009-07-30 | 2009-07-30 | |
| EP09166815 | 2009-07-30 | ||
| EP09166815.2 | 2009-07-30 | ||
| US61/230,076 | 2009-07-30 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2011012693A1 true WO2011012693A1 (en) | 2011-02-03 |
Family
ID=41014566
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2010/061094 Ceased WO2011012693A1 (en) | 2009-07-30 | 2010-07-30 | Mutant methylglyoxal synthase (mgs) for the production of a biochemical by fermentation |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US8497102B2 (https=) |
| EP (1) | EP2459710B1 (https=) |
| JP (1) | JP5913099B2 (https=) |
| KR (1) | KR101771266B1 (https=) |
| CN (1) | CN102575235B (https=) |
| BR (1) | BR112012002153A2 (https=) |
| CA (1) | CA2767962C (https=) |
| IN (1) | IN2012DN00302A (https=) |
| WO (1) | WO2011012693A1 (https=) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2532751A1 (en) | 2011-06-10 | 2012-12-12 | Metabolic Explorer | Use of inducible promoters in the fermentative production of 1,2-propanediol |
| WO2012172050A1 (en) | 2011-06-15 | 2012-12-20 | B.R.A.I.N. Biotechnology Research And Information Network Ag | New means and methods for producing propanediol |
| CN102994577A (zh) * | 2012-10-26 | 2013-03-27 | 上海交通大学 | 微生物细胞转化法生产丙酮醇的方法 |
| WO2013052604A1 (en) * | 2011-10-04 | 2013-04-11 | University Of Florida Research Foundation, Inc. | Variants of glycerol dehydrogenase having d-lactate dehydrogenase activity and uses thereof |
| WO2017042602A1 (en) | 2015-09-10 | 2017-03-16 | Metabolic Explorer | New lactaldehyde reductases for the production of 1,2-propanediol |
| EP3342873A1 (en) | 2016-12-29 | 2018-07-04 | Metabolic Explorer | Conversion of methylglyoxal into hydroxyacetone using enzymes and applications thereof |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2015528312A (ja) * | 2012-09-14 | 2015-09-28 | ミリアント・コーポレイションMyriant Corporation | 低pH条件下での発酵による有機酸の生産 |
| JP6446807B2 (ja) * | 2014-03-26 | 2019-01-09 | 三菱ケミカル株式会社 | 微生物を用いた有機化合物の製造方法 |
| KR102488646B1 (ko) * | 2020-04-02 | 2023-01-16 | 서강대학교산학협력단 | 스트렙-태그를 포함하는 오셔니써머스 프로펀더스 dsm 14977 균주 유래 초고내열성 메틸글라이옥살 합성효소 및 이를 이용한 메틸글라이옥살의 제조 방법 |
| KR102489629B1 (ko) * | 2020-04-02 | 2023-01-18 | 서강대학교산학협력단 | 스트렙-태그를 포함하는 클로스트리디움 디피실리 630 균주 유래 메틸글라이옥살 합성효소 및 이를 이용한 메틸글라이옥살의 제조 방법 |
| CN119709808B (zh) * | 2025-03-03 | 2025-07-25 | 天津科技大学 | 一种以蔗糖为原料合成乳酸单体的方法 |
Citations (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE3336051A1 (de) | 1983-10-04 | 1985-04-25 | Maizena Gmbh, 2000 Hamburg | Verfahren zur herstellung von 1,2-propandiol, insbesondere d(-)-1,2-propandiol |
| US5076896A (en) | 1988-06-13 | 1991-12-31 | Henkel Kommanditgesellschaft Auf Aktien | Process for the separation of propylene glycol from fatty alcohols |
| DE4128692A1 (de) | 1991-08-29 | 1993-03-04 | Henkel Kgaa | Verfahren zum herstellen von acetol |
| WO1998037204A1 (en) | 1997-02-19 | 1998-08-27 | Wisconsin Alumni Research Foundation | Microbial production of 1,2-propanediol from sugar |
| WO1999028481A1 (en) | 1997-02-19 | 1999-06-10 | Wisconsin Alumni Research Foundation | Microbial production of hydroxyacetone and 1,2-propanediol |
| WO2003102152A2 (en) | 2002-05-30 | 2003-12-11 | Cargill Dow Llc | Methods and materials for the production of lactic acid in yeast |
| US20040005677A1 (en) | 2002-07-05 | 2004-01-08 | Eddington John M. | Novel lactobacillus strains and use thereof in fermentation process for L-lactic acid production |
| WO2004087936A1 (en) | 2003-04-02 | 2004-10-14 | Cj Corp. | Method of producing 1,2-propanediol using klebsiella pneumoniae |
| WO2005033324A1 (ja) | 2003-09-30 | 2005-04-14 | Mitsui Chemicals, Inc. | D−乳酸菌生産用生体触媒 |
| US20050112737A1 (en) | 2003-11-20 | 2005-05-26 | A. E. Staley Manufacturing Co. | Lactic acid producing yeast |
| WO2005073364A2 (fr) | 2004-01-12 | 2005-08-11 | Metabolic Explorer | Microorganisme evolue pour la production de 1,2-propanediol |
| WO2005095536A2 (en) | 2004-03-25 | 2005-10-13 | Suppes Galen J | Method of producing lower alcohols from glycerol |
| EP1760156A2 (en) | 2005-08-10 | 2007-03-07 | University Of Florida Research Foundation, Inc. | Materials and methods for efficient lactic acid production |
| WO2007074066A1 (en) | 2005-12-29 | 2007-07-05 | Basf Se | A process for separating propylene glycol from aqueous compositions |
| WO2008116852A1 (en) | 2007-03-23 | 2008-10-02 | Metabolic Explorer | New micro-organisms for the production of 1,2-propanediol obtained by a combination of evolution and rational design. |
| WO2008116851A1 (en) | 2007-03-23 | 2008-10-02 | Metabolic Explorer | Metabolically engineered microorganism useful for the production of acetol |
| WO2008116849A1 (en) | 2007-03-23 | 2008-10-02 | Metabolic Explorer | New micro-organisms for the production of acetol obtained by a combination of evolution and rational design. |
| WO2008116848A1 (en) | 2007-03-23 | 2008-10-02 | Metabolic Explorer | Metabolically engineered microorganism useful for the production of 1,2-propanediol |
-
2010
- 2010-07-30 CN CN201080043839.3A patent/CN102575235B/zh active Active
- 2010-07-30 JP JP2012522178A patent/JP5913099B2/ja not_active Expired - Fee Related
- 2010-07-30 CA CA2767962A patent/CA2767962C/en active Active
- 2010-07-30 IN IN302DEN2012 patent/IN2012DN00302A/en unknown
- 2010-07-30 US US13/387,095 patent/US8497102B2/en active Active
- 2010-07-30 BR BR112012002153A patent/BR112012002153A2/pt not_active Application Discontinuation
- 2010-07-30 WO PCT/EP2010/061094 patent/WO2011012693A1/en not_active Ceased
- 2010-07-30 KR KR1020127005195A patent/KR101771266B1/ko active Active
- 2010-07-30 EP EP10737072.8A patent/EP2459710B1/en not_active Not-in-force
Patent Citations (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE3336051A1 (de) | 1983-10-04 | 1985-04-25 | Maizena Gmbh, 2000 Hamburg | Verfahren zur herstellung von 1,2-propandiol, insbesondere d(-)-1,2-propandiol |
| US5076896A (en) | 1988-06-13 | 1991-12-31 | Henkel Kommanditgesellschaft Auf Aktien | Process for the separation of propylene glycol from fatty alcohols |
| DE4128692A1 (de) | 1991-08-29 | 1993-03-04 | Henkel Kgaa | Verfahren zum herstellen von acetol |
| WO1998037204A1 (en) | 1997-02-19 | 1998-08-27 | Wisconsin Alumni Research Foundation | Microbial production of 1,2-propanediol from sugar |
| WO1999028481A1 (en) | 1997-02-19 | 1999-06-10 | Wisconsin Alumni Research Foundation | Microbial production of hydroxyacetone and 1,2-propanediol |
| WO2003102152A2 (en) | 2002-05-30 | 2003-12-11 | Cargill Dow Llc | Methods and materials for the production of lactic acid in yeast |
| WO2003102201A2 (en) | 2002-05-30 | 2003-12-11 | Cargill Dow Llc | Methods and materials for the production of d-lactic acid in yeast |
| US20040005677A1 (en) | 2002-07-05 | 2004-01-08 | Eddington John M. | Novel lactobacillus strains and use thereof in fermentation process for L-lactic acid production |
| WO2004087936A1 (en) | 2003-04-02 | 2004-10-14 | Cj Corp. | Method of producing 1,2-propanediol using klebsiella pneumoniae |
| WO2005033324A1 (ja) | 2003-09-30 | 2005-04-14 | Mitsui Chemicals, Inc. | D−乳酸菌生産用生体触媒 |
| US20050112737A1 (en) | 2003-11-20 | 2005-05-26 | A. E. Staley Manufacturing Co. | Lactic acid producing yeast |
| WO2005073364A2 (fr) | 2004-01-12 | 2005-08-11 | Metabolic Explorer | Microorganisme evolue pour la production de 1,2-propanediol |
| WO2005095536A2 (en) | 2004-03-25 | 2005-10-13 | Suppes Galen J | Method of producing lower alcohols from glycerol |
| EP1760156A2 (en) | 2005-08-10 | 2007-03-07 | University Of Florida Research Foundation, Inc. | Materials and methods for efficient lactic acid production |
| WO2007074066A1 (en) | 2005-12-29 | 2007-07-05 | Basf Se | A process for separating propylene glycol from aqueous compositions |
| WO2008116852A1 (en) | 2007-03-23 | 2008-10-02 | Metabolic Explorer | New micro-organisms for the production of 1,2-propanediol obtained by a combination of evolution and rational design. |
| WO2008116851A1 (en) | 2007-03-23 | 2008-10-02 | Metabolic Explorer | Metabolically engineered microorganism useful for the production of acetol |
| WO2008116849A1 (en) | 2007-03-23 | 2008-10-02 | Metabolic Explorer | New micro-organisms for the production of acetol obtained by a combination of evolution and rational design. |
| WO2008116848A1 (en) | 2007-03-23 | 2008-10-02 | Metabolic Explorer | Metabolically engineered microorganism useful for the production of 1,2-propanediol |
Non-Patent Citations (35)
| Title |
|---|
| "The UniProt consortium", NUCLEIC ACIDS RES., vol. 36, 2008, pages D190 - 195 |
| ALTARAS NE; CAMERON DC, BIOTECHNOL. PROG., vol. 16, 2000, pages 940 - 946 |
| ARCH. MICROBIOL., vol. 170, pages 209 - 219 |
| BENNETT GN; SAN KY, APPL. MICROBIOL. BIOTECHNOL., vol. 55, 2001, pages 1 - 9 |
| BOOTH I R: "E. coli methylglyoxal synthase structural gene, partial", EMBL NUCLEOTIDE SEQU HOST- EMBL NUCLEOTIDE SEQU, 18 February 1998 (1998-02-18), XP002101308 * |
| CAMERON D C ET AL: "METABOLIC ENGINEERING OF PROPANEDIOL PATWAYS", BIOTECHNOLOGY PROGRESS, AMERICAN INSTITUTE OF CHEMICAL ENGINEERS, US, vol. 14, no. 1, 1 January 1998 (1998-01-01), pages 116 - 125, XP002939239, ISSN: 8756-7938 * |
| CAMERON DC; ALTARAS NE; HOFFMAN ML; SHAW AJ, BIOTECHNOL. PROG., vol. 14, 1998, pages 116 - 125 |
| COOPER RA, ANNU. REV. MICROBIOL, vol. 38, 1984, pages 49 - 68 |
| COOPER RA, ANNU. REV. MICROBIOL., vol. 38, 1984, pages 49 - 68 |
| COOPER RA; ANDERSON A, FEBS LETT., vol. 11, 1970, pages 273 - 276 |
| DATTA R; HENRY M, J. CHEM. TECHNOL. BIOTECHNOL., vol. 81, 2006, pages 1119 - 1129 |
| DONG JM; TAYLOR JS; LATOUR DJ; IUCHI S; LIN ECC, J. BACTERIOL., vol. 175, 1993, pages 6671 - 6678 |
| FERGUSON GP; TOTMEYER S; MACLEAN MJ; BOOTH IR, ARCH. MICROBIOL., vol. 170, 1998, pages 209 - 219 |
| GARVIE EI, MICROBIOL. REV., vol. 44, 1980, pages 106 - 139 |
| GRABAR TB; ZHOU S; SHANMUGAM KT; YOMANO LP; INGRAM LO, BIOTECHNOL. LETT., vol. 28, 2006, pages 1527 - 1535 |
| GULDENER, U. ET AL., NUCLEIC ACIDS RES., vol. 24, 1996, pages 2519 - 24 |
| HOPPER DJ; COOPER RA, BIOCHEM. J., vol. 128, 1972, pages 321 - 329 |
| HOPPER DJ; COOPER RA, FEBS LETT, vol. 13, 1971, pages 213 - 216 |
| JAHREIS ET AL., J. BACTERIOL., vol. 184, 2002, pages 5307 - 5316 |
| KO J; KIM I; YOO S; MIN B; KIM K; PARK C, J. BACTERIOL., vol. 187, 2005, pages 5782 - 5789 |
| KOVACH ET AL., GENE, vol. 166, 1995, pages 175 - 176 |
| MARKS GREGORY T ET AL: "Mutagenic studies on histidine 98 of methylglyoxal synthase: Effects on mechanism and conformational change", BIOCHEMISTRY, vol. 43, no. 13, 6 April 2004 (2004-04-06), pages 3802 - 3813, XP002544342, ISSN: 0006-2960 * |
| MARKS GT; SUSLER M; HARRISON DHT, BIOCHEMISTRY, vol. 43, 2004, pages 3802 - 3813 |
| MISRA K; BANERJEE AR; RAY S; RAY M, BIOCHEM. J., vol. 305, 1995, pages 999 - 1003 |
| RULE GS; PRATT EA; CHIN CCQ; WOLD F; HO C, J. BACTERIOL., vol. 161, 1985, pages 1059 - 1068 |
| SAADAT D; HARRISON DHT, BIOCHEMISTRY, vol. 37, 1998, pages 10074 - 10086 |
| SAADAT D; HARRISON DHT, BIOCHEMISTRY, vol. 39, 2000, pages 2950 - 2960 |
| SAADAT D; HARRISON DHT, STRUCTURE, vol. 7, 1999, pages 309 - 317 |
| SAADAT DANA ET AL: "Identification of catalytic bases in the active site of Escherichia coli methylglyoxal synthase: Cloning, expression, and functional characterization of conserved aspartic acid residues", BIOCHEMISTRY, vol. 37, no. 28, 14 July 1998 (1998-07-14), pages 10074 - 10086, XP002544341, ISSN: 0006-2960 * |
| SAADAT DANA ET AL: "Mirroring perfection: The structure of methylglyoxal synthase complexed with the competitive inhibitor 2-phosphoglycolate", BIOCHEMISTRY, AMERICAN CHEMICAL SOCIETY, EASTON, PA.; US, vol. 39, no. 11, 21 March 2000 (2000-03-21), pages 2950 - 2960, XP002471900, ISSN: 0006-2960 * |
| SAADAT DANA ET AL: "The crystal structure of methylglyoxal synthase from Escherichia coli", STRUCTURE (LONDON), vol. 7, no. 3, 15 March 1999 (1999-03-15), pages 309 - 317, XP002544343, ISSN: 0969-2126 * |
| SCHIESTL, R. H.; GIETZ, R. D., CURR GENET., vol. 16, 1989, pages 339 - 46 |
| SHEVCHUK, N. A. ET AL., NUCLEIC ACIDS RES., vol. 32, 2004, pages E19 |
| TOTEMEYER S; BOOTH NA; NICHOLS WW; DUNBAR B; BOOTH IR, MOL. MICROBIOL., vol. 27, 1998, pages 553 - 562 |
| WASEWAR KL, CHEM. BIOCHEM. ENG. Q., vol. 19, 2005, pages 159 - 172 |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2532751A1 (en) | 2011-06-10 | 2012-12-12 | Metabolic Explorer | Use of inducible promoters in the fermentative production of 1,2-propanediol |
| WO2012172050A1 (en) | 2011-06-15 | 2012-12-20 | B.R.A.I.N. Biotechnology Research And Information Network Ag | New means and methods for producing propanediol |
| WO2013052604A1 (en) * | 2011-10-04 | 2013-04-11 | University Of Florida Research Foundation, Inc. | Variants of glycerol dehydrogenase having d-lactate dehydrogenase activity and uses thereof |
| CN104204197A (zh) * | 2011-10-04 | 2014-12-10 | 美国佛罗里达大学研究基金会公司 | 具有d-乳酸脱氢酶活性的甘油脱氢酶变体及其用途 |
| US9745556B2 (en) | 2011-10-04 | 2017-08-29 | University Of Florida Research Foundation, Incorporated | Variants of glycerol dehydrogenase having D-lactate dehydrogenase activity and uses thereof |
| CN102994577A (zh) * | 2012-10-26 | 2013-03-27 | 上海交通大学 | 微生物细胞转化法生产丙酮醇的方法 |
| CN102994577B (zh) * | 2012-10-26 | 2015-01-21 | 上海交通大学 | 微生物细胞转化法生产丙酮醇的方法 |
| WO2017042602A1 (en) | 2015-09-10 | 2017-03-16 | Metabolic Explorer | New lactaldehyde reductases for the production of 1,2-propanediol |
| US10731137B2 (en) | 2015-09-10 | 2020-08-04 | Metabolic Explorer | Lactaldehyde reductases for the production of 1,2-propanediol |
| EP3342873A1 (en) | 2016-12-29 | 2018-07-04 | Metabolic Explorer | Conversion of methylglyoxal into hydroxyacetone using enzymes and applications thereof |
| WO2018122388A1 (en) | 2016-12-29 | 2018-07-05 | Metabolic Explorer | Conversion of methylglyoxal into hydroxyacetone using novel enzymes and applications thereof |
| US10889840B2 (en) | 2016-12-29 | 2021-01-12 | Metabolic Explorer | Conversion of methylglyoxal into hydroxyacetone using novel enzymes and applications thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| JP5913099B2 (ja) | 2016-04-27 |
| EP2459710B1 (en) | 2016-11-09 |
| EP2459710A1 (en) | 2012-06-06 |
| CN102575235B (zh) | 2015-05-20 |
| KR101771266B1 (ko) | 2017-08-24 |
| US8497102B2 (en) | 2013-07-30 |
| CN102575235A (zh) | 2012-07-11 |
| KR20120047276A (ko) | 2012-05-11 |
| IN2012DN00302A (https=) | 2015-05-08 |
| CA2767962C (en) | 2017-11-28 |
| JP2013500032A (ja) | 2013-01-07 |
| US20120122166A1 (en) | 2012-05-17 |
| BR112012002153A2 (pt) | 2015-09-15 |
| CA2767962A1 (en) | 2011-02-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8497102B2 (en) | Mutant methylglyoxal synthase (MGS) for the production of a biochemical by fermentation | |
| US8969053B2 (en) | Mutant YqhD enzyme for the production of a biochemical by fermentation | |
| CA2688450C (en) | Microorganisms and methods for production of 1,2-propanediol and acetol | |
| EP2313489B1 (en) | Production method | |
| EP2925873B1 (en) | 3-hydroxypropionic acid production by recombinant yeasts | |
| US20150064759A1 (en) | Modified microorganism and methods of using same for producing 2-propanol and1-propanol and/or 1,2-propanediol | |
| WO2009115497A1 (en) | Polypeptide having glyoxalase iii activity, polynucleotide encoding the same and uses thereof | |
| CN101287833A (zh) | 酵母和l-乳酸的制造方法 | |
| US8980604B2 (en) | Mutant glycerol dehydrogenase (GlyDH) for the production of a biochemical by fermentation | |
| AU2019319045A1 (en) | Microorganisms with improved 1,3-propanediol and butyric acid production | |
| US20150240264A1 (en) | Methods for co-production of a terpene, succinate and hydrogen | |
| EP2265716A1 (en) | Polypeptide having glyoxalase iii activity, polynucleotide encoding the same and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 201080043839.3 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 10737072 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 302/DELNP/2012 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2767962 Country of ref document: CA |
|
| REEP | Request for entry into the european phase |
Ref document number: 2010737072 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010737072 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13387095 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2012522178 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1201000324 Country of ref document: TH |
|
| ENP | Entry into the national phase |
Ref document number: 20127005195 Country of ref document: KR Kind code of ref document: A |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112012002153 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112012002153 Country of ref document: BR Kind code of ref document: A2 Effective date: 20120130 |