WO2011009104A1 - Nucleic acid analysis - Google Patents

Nucleic acid analysis Download PDF

Info

Publication number
WO2011009104A1
WO2011009104A1 PCT/US2010/042365 US2010042365W WO2011009104A1 WO 2011009104 A1 WO2011009104 A1 WO 2011009104A1 US 2010042365 W US2010042365 W US 2010042365W WO 2011009104 A1 WO2011009104 A1 WO 2011009104A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
biological sample
extraction
rna
microvesicles
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2010/042365
Other languages
English (en)
French (fr)
Inventor
Leileata M. Russo
Kevin C. Miranda
Johan Skog
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
General Hospital Corp
Original Assignee
General Hospital Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP10800649.5A priority Critical patent/EP2454588B1/en
Priority to IN866DEN2012 priority patent/IN2012DN00866A/en
Priority to BR112012001077-8A priority patent/BR112012001077A2/pt
Priority to CN201080041496.7A priority patent/CN102498397B/zh
Priority to KR1020187006847A priority patent/KR20180029105A/ko
Priority to JP2012520829A priority patent/JP5909444B2/ja
Priority to CA2768371A priority patent/CA2768371A1/en
Priority to HK12111737.1A priority patent/HK1173213B/en
Priority to DK10800649.5T priority patent/DK2454588T3/en
Application filed by General Hospital Corp filed Critical General Hospital Corp
Priority to HK12111815.6A priority patent/HK1171083B/xx
Priority to ES10800649.5T priority patent/ES2547715T3/es
Priority to SG2012003141A priority patent/SG177677A1/en
Priority to AU2010273928A priority patent/AU2010273928A1/en
Publication of WO2011009104A1 publication Critical patent/WO2011009104A1/en
Priority to US13/294,144 priority patent/US20120142001A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D249/00Heterocyclic compounds containing five-membered rings having three nitrogen atoms as the only ring hetero atoms
    • C07D249/02Heterocyclic compounds containing five-membered rings having three nitrogen atoms as the only ring hetero atoms not condensed with other rings
    • C07D249/081,2,4-Triazoles; Hydrogenated 1,2,4-triazoles
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/12Antidiuretics, e.g. drugs for diabetes insipidus
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • C12N15/1017Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by filtration, e.g. using filters, frits, membranes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present invention relates to the general fields of nucleic acid analysis in human or other animal subjects, particularly the procurement and analysis of high quality nucleic acids from a biological sample, and in particular, from microvesicles.
  • Exosomes are reported as having a diameter of approximately 30-100 nm and are shed from many different cell types under both normal and pathological conditions (Thery et al., 2002). Exosomes are classically formed from the inward invagination and pinching off of the late endosomal membrane. This results in the formation of a multivesicular body (MVB) laden with small lipid bilayer vesicles (-40-100 nm in diameter), each of which contains a sample of the parent cell's cytoplasm (Stoorvogel et al., 2002). Fusion of the MVB with the cell membrane results in the release of these exosomes from the cell, and their delivery into the blood, urine or other bodily fluids.
  • MVB multivesicular body
  • microvesicles are more heterogeneous in size than exosomes, and like exosomes, also contain a sample of the parent cell's cytoplasm. Exosomes and shedding microvesicles co-isolate using ultracentrifugation and ultrafiltration isolation techniques and will, therefore, be collectively referred to here as microvesicles.
  • the present invention provides compositions of high quality nucleic acid extractions from microvesicles and other biological samples, methods of making such extractions, and methods of using these high quality nucleic acids in various applications.
  • the invention is a novel nucleic acid extraction from one or more microvesicles isolated from a eukaryotic biological sample, wherein 18S rRNA and 28S rRNA are detectable in the extraction.
  • the quantitative ratio of 18S rRNA to 28S rRNA detectable in the novel extractions is within the range of approximately 1 : 1 to approximately 1 :2; and is preferably approximately 1:2.
  • Biological samples from which the novel extraction may be obtained include, among other things, any bodily fluid, preferably urine, serum or plasma, and preferably, are from a mammal, particularly a human.
  • the novel nucleic acid extraction may further comprise a nucleic acid extraction having an RNA Integrity Number (in all cases, as obtained on an Agilent BioAnalyzer or an equivalent thereof) of greater than or equal to 5 and/or may further comprise a nucleic acid yield from 20 ml of biological sample of greater than or equal to 50 pg/ml.
  • the novel nucleic acid extraction may further comprise an RNA Integrity Number of greater than or equal to 3 and/or may further comprise a nucleic acid yield from 1 ml of biological sample is greater than or equal to 50 pg/ml.
  • the invention is a novel profile of nucleic acid from one or more microvesicles isolated from a eukaryotic biological sample, wherein 18S rRNA and 28S rRNA are detectable in the profile.
  • the quantitative ratio of 18S rRNA to 28S rRNA detectable in the novel profile is within the range of approximately 1 : 1 to
  • Biological samples from which the novel profile may be obtained include, among other things, any bodily fluid, preferably urine, serum or plasma, and preferably, is from a mammal, particularly a human.
  • the novel profile may further comprise an RNA Integrity Number of greater than or equal to 5 and/or may further comprise a nucleic acid yield from 20 ml of biological sample of greater than or equal to 50 pg/ml.
  • the novel profile may further comprise an RNA Integrity Number of greater than or equal to 3 and/or may further comprise a nucleic acid yield from 1 ml of biological sample is greater than or equal to 50 pg/ml.
  • the invention is a method of evaluating the quality of a nucleic acid extraction from microvesicles isolated from a eukaryotic biological sample, comprising the steps of: (a) extracting RNA from microvesicles; and (b) measuring the quality of the RNA by determining the quantity of 18S and 28S rRNA in the extraction.
  • the quantitative ratio of 18S rRNA to 28S rRNA determined in the novel method is within the range of approximately 1: 1 to approximately 1 :2; and is preferably
  • Bio samples on which the novel method may be performed include, among other things, any bodily fluid, preferably urine, serum or plasma, and preferably, is from a mammal, particularly a human.
  • any bodily fluid preferably urine, serum or plasma, and preferably, is from a mammal, particularly a human.
  • the novel method may further result in the extraction of nucleic acid having an RNA Integrity Number of greater than or equal to 5 and/or may further result in a nucleic acid yield from 20 ml of biological sample of greater than or equal to 50 pg/ml.
  • the novel method may further result in the extraction of nucleic acid having an RNA Integrity Number of greater than or equal to 3 and/or may further result in a nucleic acid yield from 1 ml of biological sample is greater than or equal to 50 pg/ml.
  • the invention is a method of obtaining nucleic acid from a biological sample, comprising the steps of: (a) obtaining a biological sample; (b) performing an extraction enhancement operation on the biological sample; and (c) extracting nucleic acid from the biological sample.
  • the extraction enhancement operation is comprised of: (a) the addition of one or more enhancement agents to the biological sample; or (b) the performance of one or more enhancement steps prior to nucleic acid extraction; or (c) a combination of enhancement agents and enhancement steps.
  • the enhancement agents may include: (i) RNase inhibitor; (ii) protease; (iii) reducing agent; (iv) decoy substrate, such as synthetic RNA; (v) soluble receptor; (vi) small interfering RNA; (vii) RNA binding molecule, such as anti-RNA antibody, chaperone protein, or an RNase inhibitory protein; (ix) RNase denaturing substance, such as high osmolarity solution or detergent.
  • the extraction enhancement steps may include: (x) washing; (xi) size-separating RNase from the sample; (xii) effecting RNase denaturation through a physical change, such as by decreasing temperature, or executing a freeze/thaw cycle.
  • the novel method may be performed on a biological sample including, among other things, any bodily fluid, preferably urine, serum or plasma, and preferably, is from a mammal, particularly a human.
  • a derivative is obtained from the biological sample and subjected to the extraction enhancement operation before extracting nucleic acid.
  • the derivative is a microvesicle fraction from the biological sample.
  • the microvesicle fraction is obtained by a filtration concentration technique, however other known isolation techniques may be utilized as well.
  • the derivative may be treated with a ribonuclease, deoxyribonuclease, or a combination thereof, prior to performance of the enhancement extraction operation.
  • the extraction enhancement operation includes the addition of an RNase inhibitor to the biological sample, or to the derivative, prior to extracting nucleic acid; preferably the RNase inhibitor has a concentration of greater than 0.027 AU (IX) for a sample equal to or more than l ⁇ l; alternatively, greater than or equal to 0.135 AU (5X) for a sample equal to or more than l ⁇ l; alternatively, greater than or equal to 0.27 AU (10X) for a sample equal to or more than l ⁇ l; alternatively, greater than or equal to 0.675 AU (25X) for a sample equal to or more than l ⁇ l; and alternatively, greater than or equal to 1.35 AU (50X) for a sample equal to or more than l ⁇ l, wherein the IX protease concentration refers to an enzymatic condition wherein 0.027 AU or more protease is used to treat microvesicles isolated from l ⁇ l or more bodily fluid; the 5X protease concentration refers
  • the invention is a novel kit for obtaining nucleic acids from microvesicles, comprising in one or more containers: (a) a nucleic acid extraction enhancement agent; (b) DNase, RNase, or both; and (c) a lysis buffer.
  • the novel kit may further comprise instructions for using the kit.
  • the nucleic acid extraction enhancing agent may include: (a) RNase inhibitor; (b) protease; (c) reducing agent; (d) decoy substrate; (e) soluble receptor; (f) small interfering RNA; (g) RNA binding molecule; (h) RNase denaturing substance; or (i) any combination of any of the foregoing agents as a mixture or individually.
  • the invention is a novel method of analyzing RNA from microvesicles, comprising the steps of: (a) obtaining a sample of microvesicles; (b) treating the sample with DNase to eliminate all or substantially all of any DNA located outside of or on the surface of the microvesicles in the sample; (c) extracting RNA from the sample; and (d) analyzing the extracted RNA.
  • the novel method may be performed on a biological sample including, among other things, any bodily fluid, preferably urine, serum or plasma, and preferably, is from a mammal, particularly a human.
  • the invention is a novel method for diagnosing, monitoring, or treating a subject, comprising the steps of: (a) isolating a microvesicle fraction from a urine sample from a subject; (b) detecting the presence or absence of a biomarker within the microvesicle fraction; wherein the biomarker is selected from the group consisting of (i) a species of nucleic acid, (ii) the level of expression of a nucleic acid, (iii) a nucleic acid variant, and (iv) any combination of any of the foregoing; and wherein the biomarker is associated with the presence or absence of a disease or other medical condition, or the viability of a treatment option.
  • the biomarker is an mRNA transcript; for instance, the mRNA transcript may be selected from the group consisting of : NPHS2 (podocin), LGALSl (Galectin-1), HSPG2 (heparin sulfate proteoglycan); CUBN (cubilin), LRP2 (megalin), AQPl (aquaporin 1), CA4 (carbonic anydrase 4), CLCN5 (chloride channel protein 5), BDKRBl (bradykinin Bl receptor), CALCR (calcitonin receptor), SCNNlD (amiloride-sensitive sodium channel subunit delta), SLC12A3 (thiazide-sensitive sodium- chloride cotransporter), AQP2 (aquaporin 2), ATP6V1B1 (V-ATPase Bl subunit), SLC 12Al (kidney-specific Na-K-Cl symporter via RT-PCR of RiboAmped mRNA); more preferably
  • the biomarker and disease or other medical condition are selected from the group consisting of: (a) NPHS2 (podocin) and glomerular disease, such as steroid-resistant nephritic syndrome; (b) CUBN (cubilin) and proteinuria , such as in Imerslund-Grasbeck syndrome; and (c) AQP2 (aquaporin 2) and diabetes insipidus.
  • the invention is an isolated polynucleotide molecule comprising a first nucleotide sequence that is at least 90% identical to a second nucleotide sequence selected from the group consisting of SEQ ID NOS: 1-29; an isolated
  • polynucleotide comprising a segment of a nucleotide sequence selected from SEQ ID NOS: 1-29; or an isolated polynucleotide comprising a sequence of at least 13 nucleotides that are the same as any 13-nucleotide sequence in any one of SEQ ID NOS: 1-29.
  • the foregoing polynucleotide molecules may be a deoxyribonucleotide or a ribonucleotide.
  • the invention is a vector comprising any of the foregoing isolated nucleic acid molecules.
  • the invention is a host cell comprising any of the foregoing vectors or any of the foregoing isolated nucleic acid molecules.
  • the invention is a novel method of assessing the quality of a nucleic acid extraction from a biological sample, comprising: (a) providing a biological sample; (b) obtaining an extraction of nucleic acids from the biological sample; (c) measuring the amount of a polynucleotide molecule comprising a segment having a nucleotide sequence selected from SEQ NOS: 1-29 in the extraction; and (d) comparing the amount of the polynucleotide molecule against a standard to assess the quality of the nucleic acid extraction.
  • the novel method may be performed on any biological sample, for example, a bodily fluid, in particular, urine, serum or plasma, preferably from a mammal such as a human.
  • the standard used to assess the quality of the nucleic acid extraction may be derived by measuring the amount of a polynucleotide molecule comprising a segment having the nucleotide sequence selected from SEQ NOS: 1- 29 in nucleic acid extractions from more than 5 biological samples.
  • FIGURE 1 frames a to f, are electron microscopy pictures of urinary multivesicular bodies.
  • Multivesicular bodies can be identified in various regions of the nephron and collecting duct (see arrows).
  • Scale bar 200 nm for a, c, d, e, f; 500 nm for b.
  • FIGURE 2 is an electron microscopy picture of isolated urinary micro vesicles.
  • FIGURE 3 is a plot depicting RNA profiles generated with a method of
  • FIGURE 4 is a plot depicting RNA profiles generated with a method of ultracentrifugation. An Agilent BioAnalyzer was used to generate the plot.
  • FIGURE 5 is a pair of plots depicting RNA profiles generated with a three step pre-processing method of x300g spin, xl7,000g spin, and 0.8 ⁇ m filtration (A), or with a one step pre-processing method of only a 0.8 ⁇ m filtration (B), in each case followed by ultracentrifugation.
  • An Agilent BioAnalyzer was used to generate the plots.
  • FIGURE 6 is a pair of plots depicting RNA profiles generated with a three- step pre-processing method of x300g spin, xl7,000g spin, and 0.8 ⁇ m filtration (A), or with a one step pre-processing method of only a 0.8 ⁇ m filtration (B), in each case followed by filtration concentration.
  • An Agilent BioAnalyzer was used to generate the plots.
  • FIGURE 7 is a flow chart depicting a new method of nucleic acid extraction from urine with an extraction enhancement operation.
  • FIGURE 8 is a pair of plots depicting RNA profiles generated with methods using 5X versus 1OX concentrated proteases.
  • Microvesicles were isolated via filtration concentrators from 20ml urine samples.
  • Plot A represents the profile obtained with 5X protease.
  • Plot B represents the profile obtained with 1OX protease.
  • a lX protease concentration refers to an enzymatic condition wherein 0.027 AU or more protease is used to treat microvesicles isolated from l ⁇ l or more bodily fluid.
  • a 5X protease concentration refers to an enzymatic condition wherein 0.135 AU or more protease is used to treat microvesicles isolated from l ⁇ l or more bodily fluid.
  • One mAU is the protease activity that releases folin-positive amino acids and peptides corresponding to 1 ⁇ mol tyrosine per minute.
  • FIGURE 9 is a pair of plots depicting RNA profiles generated with methods using 25X versus 50X concentrated proteases. Microvesicles were isolated via filtration concentrators from 40ml urine samples. Plot A represents the profile obtained with 25X protease. Plot B represents the profile obtained with 50X protease. IX protease refers to 0.027 AU. One mAU is the protease activity that releases folin-positive amino acids and peptides corresponding to 1 ⁇ mol tyrosine per minute.
  • FIGURE 10 is a plot depicting the RNA profile of melanoma serum, Sample
  • FIGURE 11 is a plot depicting the RNA profile of melanoma serum, Sample
  • FIGURE 12 is a plot depicting the RNA profile of melanoma serum, Sample
  • FIGURE 13 is a plot depicting the RNA profile of melanoma serum, Sample
  • FIGURE 14 is a plot depicting the RNA profile of a melanoma serum, Sample
  • FIGURE 15 is a plot depicting the RNA profile of a melanoma serum, Sample
  • FIGURE 16 is a plot depicting the RNA profile of normal serum, Sample 7.
  • FIGURE 17 is a plot depicting the RNA profile of a normal serum, Sample 8.
  • the final concentration of the RNase inhibitor is 1.6 units/ ⁇ l microvesicle suspension buffer.
  • FIGURE 18 is a plot depicting the RNA profile of normal serum, Sample 9.
  • the final concentration is of the RNase inhibitor 1.6 units/ ⁇ l microvesicle suspension buffer.
  • FIGURE 19 is a plot depicting the RNA profile of normal serum, Sample 10.
  • the final concentration of the RNase inhibitor is 1.6 units/ ⁇ l microvesicle suspension buffer.
  • FIGURE 20 is a plot depicting the RNA profile of normal serum, Sample 11.
  • the final concentration of the RNase inhibitor is 3.2 units/ ⁇ l microvesicle suspension buffer.
  • FIGURE 21 is a plot depicting the RNA profile of normal serum, Sample 12.
  • the final concentration of the RNase inhibitor is 3.2 units/ ⁇ l microvesicle suspension buffer.
  • FIGURE 22 is a flow chart depicting a new method of nucleic acid extraction from a biological sample using an extraction enhancement operation.
  • FIGURE 23 is a pair of plots depicting RNA profiles generated with methods with or without DNase treatment.
  • DNA not located inside the microvesicles was removed by DNase digestion of the microvesicle pellet isolated from urine samples prior to lysis and nucleic acid extraction.
  • D - profile with DNase digestion using MirVana Kit Note the changes in small RNA peak height and area indicated by the arrow in. D suggests that there are some carry-over of DNA into the sample following phenol/chloroform based extraction
  • FIGURE 24 is a pair of plots depicting RNA profiles generated with methods with or without DNase treatment. DNA not located inside the microvesicles was removed by
  • DNase digestion of the microvesicle pellet isolated from serum samples prior to lysis and nucleic acid extraction A - profile without DNase digestion.
  • B profile with DNase digestion.
  • C A pseudo gel showing "apoptotic body"-like ladders which might co-isolate with serum-derived microvesicles.
  • FIGURE 25 is a pair of plots depicting RNA profiles generated with methods with or without RNase treatments. RNA not located inside the micro-vesicles was removed by RNase digestion of the microvesicle pellet isolated from urine samples prior to lysis and nucleic acid extraction. A- profile without RNase digestion. B - profile with RNase digestion.
  • FIGURE 26 is a pair of plots depicting RNA profiles generated from urinary microvesicles and rat kidney tissue. A - profile from rat kidney tissue. B - profile from urinary microvesicles.
  • FIGURE 27 is a pair of plots depicting RNA profiles generated from urinary microvesicles and rat kidney tissue using methods that can enrich small RNA extraction.
  • FIGURE 28 is a pair of plots depicting RNA profiles generated from whole urine exclusive of microvesicles, which are not captured by the isolation technique, with or without DNase treatments.
  • FIGURE 29 is a pair of plots depicting RNA profiles generated from urinary microvesicles.
  • B- nucleic acids isolated from microvesicles with DNase treatments are examples of the following the isolation technique, with or without DNase treatments.
  • FIGURE 30 is a pair of plots depicting RNA profiles generated from nucleic acids extracted from the pellet formed during the 300g spin.
  • FIGURE 31 is a pair of plots depicting RNA profiles generated from nucleic acids extracted from the pellet formed during the 17,00Og spin.
  • FIGURE 32 is a pair of plots depicting RNA profiles generated from microvesicles that underwent RNase and DNase digestion on the outside prior to
  • microvesicle lysis with or without intra-microvesicular RNase digestion.
  • FIGURE 33 is a pair of plots depicting RNA profiles generated from microvesicles that underwent RNase and DNase digestion on the outside prior to
  • microvesicle lysis and intra-microvesicular RNase digestion without or without intra- microvesicular DNase digestion.
  • the peak just after 20s is reduced compared the matching peak in plot A. The reduction suggests that a small amount of DNase digestible material is present within exosomes.
  • FIGURE 34 A) are BioAnalyzer generated 'Pseudo gel' profiles of the positive identification of RiboAmp amplified mRNA transcripts for beta-actin and GAPDH in urinary microvesicles by RT-PCR;
  • B) is an illustration of the nephron and collecting duct highlighting its six functionally distinct regions.
  • FIGURE 35 represents BioAnalyzer generated pseudo gel profiles of the identification of mRNA transcripts encoding specific genes from regions 1 and 2 of the nephron and collecting duct detected by RT-PCR of RiboAmped mRNA from urinary microvesicles, specifically: 1. Glomerulus: NPHS2 - podocin, LGALSl - Galectin-1 , HSPG2 - heparan sulfate proteoglycan 2. Proximal Tubule: CUBN - cubilin, LRP2 - megalin, AQPl - aquaporin 1, CA4 - carbonic anhydrase 4, CLCN5 - chloride channel protein 5.
  • FIGURE 36 represents BioAnalyzer generated pseudo gel profiles of the identification of mRNA transcripts encoding specific genes from regions 3-6 of the nephron and collecting duct detected by RT-PCR of RiboAmped mRNA from urinary microvesicles, specifically: 3. Thin Descending Limb: BDKRBl - bradykinin Bl receptor. 4. Medullary Thick Ascending Limb: CALCR - calcitonin receptor, SCNNlD - amiloride-sensitive sodium channel subunit delta. 5. Distal Convoluted Tubule: SLC12A3 - thiazi de-sensitive sodium-chloride cotransporter. 6. Collecting Ducts: AQP2 - aquaporin 2, ATP6V1B1 - vATPase Bl subunit, SLC12A1 - Kidney-specific Na-K-Cl symporter.
  • FIGURE 37 A) is a pair of BioAnalyzer pseudo gels depicting the expression of the V-ATPase Bl subunit and AQP2 mRNA by RT-PCR in V-ATPase Bl KO (Bl -/-) and wild type (Bl +/+) mice;
  • B) is a pair of charts depicting the expression of the V-ATPase B2 subunit in urinary microvesicles and kidney cells from V-ATPase Bl KO (Bl -/-) and wild type (Bl +/+) mice by real-time PCR analysis.
  • "NS" not statistically significant.
  • FIGURE 38 is a trio of plots depicting RNA profiles generated from urinary microvesicles. Urinary microvesicles were not washed or treated with any extraction enhancer before the microvesicle membranes were broken for nucleic acid extraction. Three samples were used in this group of extractions. The profiles are shown in A, B and C, respectively.
  • FIGURE 39 is a trio of plots depicting RNA profiles generated from urinary microvesicles.
  • Urinary microvesicles were not washed but were treated with a RNase inhibitor, RNase-In (Promega), before the microvesicle membranes were broken for nucleic acid extraction. Three samples were used in this group of extractions. The profiles are shown in A, B and C, respectively.
  • FIGURE 40 is a trio of plots depicting RNA profiles generated from urinary microvesicles. Urinary microvesicles were washed but were not treated with any RNase inhibitor before the microvesicle membranes were broken for nucleic acid extraction. Three samples were used in this group of extractions. The profiles are shown in A, B and C, respectively.
  • FIGURE 41 is a trio of plots depicting RNA profiles generated from urinary microvesicles. Urinary microvesicles were washed and treated with RNase inhibitor before microvesicle membranes were broken for nucleic acid extraction. Three samples were used in this group of extractions. The profiles are shown in A, B and C, respectively.
  • FIGURE 42 is a list of chromosome regions in which there were more than
  • FIGURE 43 is a list of primers used for PCR reaction to amply sequences in
  • chromosome regions as indicated.
  • chrl. -1.91625366.91625741 refers to the region on human chromosome 1 between nucleotide nos. 91625366 and 91625741.
  • the primer pair used to amplify this region was "tccagctcacgttccctatt IL and ccaggtggggagtttgact IR". Primers run from 5' to 3' as they go from left to right.
  • FIGURE 44 is a pair of BioAnalyzer pseudo gels depicting the result of PCR amplification of 10 spike-rich chromosome regions. The numbering of the lanes at the top of each frame corresponds to the numbering of the chromosome regions shown in Figure 43.
  • A a nucleic acid extraction from urinary microvesicles was used as a template for the PCR.
  • B a nucleic acid extraction from renal tissue was used as a template for the PCR.
  • FIGURES 45-73 are plots depicting the spikes in 29 chromosome regions.
  • the regions are indicated at the top of each plot.
  • the plot in Figure 46 refers to the region of "chrl. -1.91625366.91625741," which is the region on human chromosome 1 between nucleotide nos. 91625366 and 91625741.
  • Microvesicles are shed by eukaryotic cells, or budded off of the plasma membrane, to the exterior of the cell. These membrane vesicles are heterogeneous in size with diameters ranging from about 10 nm to about 5000 nm.
  • the small microvesicles (approximately 10 to 1000 nm, and more often approximately 10 to 200 nm in diameter) that are released by exocytosis of intracellular multivesicular bodies are referred to in the art as "exosomes.”
  • the compositions, methods and uses described herein are equally applicable to microvesicles of all sizes; preferably 10 to 800 nm; and more preferably 10 to 200 nm.
  • exosome also refers to protein complexes containing exoribonucleases which are involved in mRNA degradation and the processing of small nucleolar RNAs (snoRNAs), small nuclear RNAs (snRNAs) and ribosomal RNAs (rRNA) (Liu et al., 2006; van Dijk et al., 2007).
  • snoRNAs small nucleolar RNAs
  • snRNAs small nuclear RNAs
  • rRNA ribosomal RNAs
  • the present invention is partly based on the discovery that adverse factors can prevent an effective extraction of nucleic acids from a biological sample and that novel and unexpected agents and steps may be used to mitigate or remove the adverse factors, thereby dramatically improving the quality of the extracted nucleic acids.
  • one aspect of this invention are novel methods for extracting high quality nucleic acids from a biological sample.
  • the high quality extractions obtained by the novel methods described herein are characterized by high yield and high integrity, making the extracted nucleic acids useful for various applications in which high quality nucleic acid extractions are preferred.
  • the novel methods include, for example, the steps of obtaining a biological sample, mitigating or removing the adverse factors that prevent an effective extraction of nucleic acids from a biological sample, and extracting nucleic acids from the biological sample followed, optionally, by nucleic acid analysis.
  • Applicable biological samples include, for example, a cell, a group of cells, fragments of cells, cell products including for example microvesicles, cell cultures, bodily tissues from a subject, or bodily fluids.
  • the bodily fluids can be fluids isolated from anywhere in the body of the subject, preferably a peripheral location, including but not limited to, for example, blood, plasma, serum, urine, sputum, spinal fluid, pleural fluid, nipple aspirates, lymph fluid, fluid of the respiratory, intestinal, and genitourinary tracts, tear fluid, saliva, breast milk, fluid from the lymphatic system, semen, cerebrospinal fluid, intra- organ system fluid, ascitic fluid, tumor cyst fluid, amniotic fluid and combinations thereof.
  • a biological sample may sometimes come from a subject.
  • the term "subject” is intended to include all animals shown to or expected to have microvesicles.
  • the subject is a mammal, a human or nonhuman primate, a dog, a cat, a horse, a cow, other farm animals, or a rodent (e.g. mouse, rat, guinea pig, etc.).
  • the term “subject” and “individual” are used interchangeably herein.
  • a biological sample may optionally be processed to obtain a biological sample derivative before, after, or at the same time as, carrying out the step of mitigating or removing the adverse effects.
  • the biological sample derivative may be a cell, cell debris, a membrane vesicle, or a microvesicle.
  • a biological sample is sometimes pre-processed before a biological sample derivative such as a microvesicle is obtained.
  • the pre-processing step is preferred.
  • a urine sample is may be pre-processed to obtain urinary
  • the pre-processing may be achieved by techniques known in the art such as low speed centrifugation and pre-filtration.
  • urine samples may undergo a first centrifugation step of 300g to get rid of large particles in the samples.
  • Urine samples may undergo a second centrifugation step of 17,00Og to get rid of smaller particles in the samples.
  • urine samples may further undergo a pre-filtration step, e.g., a 0.8um pre-filtration step.
  • urine samples may be pre-processed by a - pre-filtration step without first undergoing the one or more of the centrifugation steps.
  • Membrane vesicles may be isolated from a biological sample. In some instances, such isolation may be carried out without pre-processing the biological sample in some instances. In other instances, such isolation may be carried out after the biological sample is pre-processed. The isolation step may be advantageous for high quality nucleic acid extraction from a biological sample.
  • the isolation may give rise to advantages such as: 1) the opportunity to selectively analyze disease- or tumor-specific nucleic acids, which may be obtained by isolating disease- or tumor-specific microvesicles apart from other microvesicles within the fluid sample; 2) significantly higher yield of nucleic acid species with higher integrity as compared to the yield/integrity obtained by extracting nucleic acids directly from the fluid sample; 3) scalability, e.g.
  • the sensitivity can be increased by pelleting more microvesicles from a larger volume of serum; 4) purer nucleic acids in that protein and lipids, debris from dead cells, and other potential contaminants and PCR inhibitors are excluded from the microvesicle pellets before the nucleic acid extraction step; and 5) more choices in nucleic acid extraction methods as microvesicle pellets are of much smaller volume than that of the starting serum, making it possible to extract nucleic acids from these microvesicle pellets using small volume column filters.
  • Methods of isolating microvesicles from a biological sample are known in the art. For example, a method of differential centrifugation is described in a paper by Raposo et al. (Raposo et al, 1996), a paper by Skog et. al.(Skog et al, 2008) and a paper by Nilsson et. al.(Nilsson et al., 2009). Methods of anion exchange and/or gel permeation chromatography are described in US Patent Nos. 6,899,863 and 6,812,023. Methods of sucrose density gradients or organelle electrophoresis are described in U.S. Patent No. 7,198,923.
  • a method of magnetic activated cell sorting is described in a paper by Taylor and Gercel- Taylor (Taylor and Gercel-Taylor, 2008).
  • a method of nanomembrane ultrafiltration concentration is described in a paper by Cheruvanky et al. (Cheruvanky et al., 2007).
  • microvesicles can be identified and isolated from bodily fluid of a subject by a newly developed microchip technology that uses a unique microfluidic platform to efficiently and selectively separate tumor-derived microvesicles (Chen et al.).
  • a newly developed microchip technology that uses a unique microfluidic platform to efficiently and selectively separate tumor-derived microvesicles (Chen et al.).
  • the microvesicles isolated from a bodily fluid are enriched for those originating from a specific cell type, for example, lung, pancreas, stomach, intestine, bladder, kidney, ovary, testis, skin, colorectal, breast, prostate, brain, esophagus, liver, placenta, fetus cells.
  • a specific cell type for example, lung, pancreas, stomach, intestine, bladder, kidney, ovary, testis, skin, colorectal, breast, prostate, brain, esophagus, liver, placenta, fetus cells.
  • surface molecules may be used to identify, isolate and/or enrich for microvesicles from a specific donor cell type (Al- Nedawi et al., 2008; Taylor and Gercel-Taylor, 2008).
  • microvesicles originating from distinct cell populations can be analyzed for their nucleic acid content.
  • tumor (malignant and non-malignant) microvesicles carry tumor-associated surface antigens and may be detected, isolated and/or enriched via these specific tumor-associated surface antigens.
  • the surface antigen is epithelial-cell-adhesion-molecule (EpCAM), which is specific to microvesicles from carcinomas of lung, colorectal, breast, prostate, head and neck, and hepatic origin, but not of hematological cell origin (Balzar et al., 1999; Went et al., 2004).
  • the surface antigen is CD24, which is a glycoprotein specific to urine microvesicles (Keller et al., 2007).
  • the surface antigen is selected from a group of molecules such as CD70, carcinoembryonic antigen (CEA), EGFR, EGFRvIII and other variants, Fas ligand, TRAIL, transferrin receptor, p38.5, p97 and HSP72.
  • tumor specific microvesicles may be characterized by the lack of surface markers, such as CD80 and CD86.
  • the isolation of microvesicles from specific cell types can be accomplished, for example, by using antibodies, aptamers, aptamer analogs or molecularly imprinted polymers specific for a desired surface antigen.
  • the surface antigen is specific for a cancer type.
  • the surface antigen is specific for a cell type which is not necessarily cancerous.
  • U.S. Patent No. 7,198,923. As described in, e.g., U.S. Patent Nos. 5,840,867 and 5,582,981, WO/2003/050290 and a publication by Johnson et al.
  • aptamers and their analogs specifically bind surface molecules and can be used as a separation tool for retrieving cell type-specific microvesicles.
  • Molecularly imprinted polymers also specifically recognize surface molecules as described in, e.g., US Patent Nos. 6,525,154, 7,332,553 and 7,384,589 and a publication by Bossi et al. (Bossi et al., 2007) and are a tool for retrieving and isolating cell type-specific microvesicles.
  • Bossi et al. Bossi et al.
  • a step of removing nucleic acids that are not inside the microvesicle is sometimes performed.
  • Methods of removing nucleic acids are well known in the art.
  • an enzyme digestion step may be performed.
  • Such enzymes may be a type of ribonuclease that catalyzes the enzymatic digestion of ribonucleic acids or a type of deoxyribonuclease that catalyzes the enzymatic digestion of deoxyribonucleic acids.
  • the novel nucleic acid extraction methods include a step of removing or mitigating adverse factors that prevent high quality nucleic acid extraction from a biological sample.
  • adverse factors are heterogeneous in that different biological samples may contain various species of such adverse factors.
  • factors such as excessive extra-microvesicle DNA may affect the quality of nucleic acid extractions from such samples and contaminate DNA extracted from within
  • the extraction enhancement operation may involve the addition of nucleic acid extraction enhancement agents to the biological sample or derivative.
  • extraction enhancement agents as defined here may include, but are not limited to, a commercially available RNase inhibitor such as Superase-In (Ambion Inc.), RNaseIN (Promega Corp.), or other agents that function in a similar fashion; a protease; a reducing agent; a decoy substrate such as a synthetic RNA; a soluble receptor that can bind RNase; a small interfering RNA (siRNA); a RNA binding molecule, such as an anti-RNA antibody, or a chaperone protein; a RNase denaturing substance, such as a high osmolarity solution, a detergent, or a combination thereof.
  • a commercially available RNase inhibitor such as Superase-In (Ambion Inc.), RNaseIN (Promega Corp.), or other agents that function in a similar fashion
  • a protease such as Superase-In (
  • enhancement agents may exert their functions in various ways, for example, but not limited to, through inhibiting RNase activity (e.g., RNase inhibitors), through a ubiquitous degradation of proteins (e.g., proteases), or through a chaperone protein (e.g., a RNA-binding protein) that binds and protects RNAs.
  • RNase activity e.g., RNase inhibitors
  • a ubiquitous degradation of proteins e.g., proteases
  • a chaperone protein e.g., a RNA-binding protein
  • the extraction enhancement operation may involve the performance of one or more process steps.
  • Such processes include extensive or substantially thorough washing of nucleic acid-containing components of the sample, such as
  • microvesicles size separation of RNases from the biological sample; denaturation of proteins in the biological sample by various techniques including, but not limited to, generating a particular pH condition, a temperature condition, (e.g., the maintenance of a decreasing or lower temperature), freeze/thaw cycles, and combinations thereof.
  • RNA integrity number is the product of a software tool designed to estimate the integrity of total RNA samples.
  • the software automatically assigns an integrity number to an eukaryote total RNA sample.
  • sample integrity is not determined by the ratio of the 18S and 28S ribosomal bands, but by the entire electrophoretic trace of the RNA sample. This includes the presence or absence of degradation products.
  • the assigned RTN is independent of sample concentration, instrument, and analyst, and can serve as a standard for RNA integrity.
  • the performance of an extraction enhancement operation will improve the quantity or yield of extracted nucleic acid.
  • an extraction enhancement operation as described herein, one may obtain a nucleic acid yield of greater than or equal to 50 pg/ml from a 20 ml low protein biological sample such as urine.
  • Novel high quality nucleic acid extractions obtained by the methods described herein may display a combination of the detection of 18S and 28S rRNA, preferably in a ratio of approximately 1 : 1 to approximately 1:2; and more preferably, approximately 1:2; a RNA integrity number of greater than or equal to 5 for a low protein biological sample, or greater than or equal to 3 for a high protein biological sample; and a nucleic acid yield of greater than or equal to 50 pg/ml from a 20 ml low protein biological sample or a 1 ml high protein biological sample.
  • RNA degradation can seriously affect downstream assessment of the extracted RNA, such as in gene expression and mRNA analysis, as well as analysis of non-coding RNA such as small RNA and micro RNA.
  • the novel methods described herein enable one to extract high quality nucleic acids from a biological sample such as microvesicles so that an accurate analysis of gene expression and mutational level within the exosomes can be carried out.
  • a biological sample such as microvesicles
  • an extraction enhancing agent the amount and integrity of RNA isolated from urinary microvesicles is increased significantly.
  • Another aspect of this invention provides methods of extracting high quality small RNA from a biological sample such as urine.
  • Small RNA such as miRNA is particularly susceptible to degradation and loss during the process of nucleic acid extraction.
  • a high concentration of protease is used to remove or mitigate adverse factors that prevent high quality extraction of small RNAs.
  • a method to extract nucleic acid, particularly small RNA uses 25X and 50X protease as extraction enhancing agent and is able to obtain significantly increased amounts of small RNA.
  • expressions such as 5X, 10X, 25X and 50X mean 5 times, 10 times, etc. the activity level of protease currently used or recommended in commercially available nucleic acid extraction kits such as the QIAamp MinElute Virus Spin Kit.
  • nucleic acid molecules can be isolated from a biological sample using any number of procedures that are well-known in the art. Persons of skill will select a particular isolation procedure as being appropriate for the particular biological sample. Examples of methods for extraction are provided in the Examples section herein. In some instances, with some techniques, it may also be possible to analyze the nucleic acid without extraction from the microvesicle.
  • the extracted nucleic acids are analyzed directly without an amplification step.
  • Direct analysis may be performed with different methods including, but not limited to, nanostring technology.
  • NanoString technology enables identification and quantification of individual target molecules in a biological sample by attaching a color coded fluorescent reporter to each target molecule. This approach is similar to the concept of measuring inventory by scanning barcodes.
  • Reporters can be made with hundreds or even thousands of different codes allowing for highly multiplexed analysis.
  • the technology is described in a publication by Geiss et al. (Geiss et al., 2008) and is incorporated herein by reference for this teaching.
  • nucleic acid of the microvesicle it may be beneficial or otherwise desirable to amplify the nucleic acid of the microvesicle prior to analyzing it.
  • Methods of nucleic acid amplification are commonly used and generally known in the art, many examples of which are described herein. If desired, the amplification can be performed such that it is quantitative. Quantitative amplification will allow quantitative determination of relative amounts of the various nucleic acids, to generate a profile as described below.
  • the extracted nucleic acid is RNA.
  • the RNA is then preferably reverse-transcribed into complementary DNA (cDNA) before further amplification.
  • cDNA complementary DNA
  • Such reverse transcription may be performed alone or in combination with an amplification step.
  • RT-PCR reverse transcription polymerase chain reaction
  • Nucleic acid amplification methods include, without limitation, polymerase chain reaction (PCR) (US Patent No. 5,219,727) and its variants such as in situ polymerase chain reaction (US Patent No.
  • nucleic acids present in the microvesicles are quantitative and/or qualitative.
  • amounts (expression levels), either relative or absolute, of specific nucleic acids of interest within the microvesicles are measured with methods known in the art (described below).
  • species of specific nucleic acids of interest within the microvesicles, whether wild type or variants, are identified with methods known in the art.
  • the invention disclosed here also includes as a novel composition of matter, a nucleic acid extraction from microvesicles in which 18S and 28S rRNA is detectable in the extraction.
  • nucleic acid extractions may be achieved using the novel nucleic acid extraction method disclosed in this invention.
  • a high quality nucleic acid extraction from microvesicles in a biological sample is desirable in many instances.
  • a tissue sample is not easily accessible.
  • a brain tumor sample can not usually be obtained without brain surgery. Instead, a microvesicle sample from the brain tumor patient serum is easily accessible.
  • nucleic acids in microvesicles secreted by tissue cells are used to substitute nucleic acids from tissue cells
  • it is desirable to obtain high quality nucleic acids which, like those obtained from tissue cells directly, contain detectable quality controls, such as 18S and 28S rRNA.
  • high quality small RNA is desirable.
  • Nucleic acid extractions disclosed herein contain such high quality small RNA together with 18S and 28S rRNA.
  • Such high quality small RNA is important for the accurate assessment of nucleic acids for various purposes, e.g., the expression level of a particular miRNA.
  • the invention disclosed here further includes a novel, high-quality profile of nucleic acids from microvesicles in a biological sample.
  • profiles are generated by analyzing nucleic acid extractions that contain 18S and 28S rRNA.
  • Such profiles may be obtained with the novel methods disclosed herein.
  • High quality nucleic acid profiles are highly desirable for many uses, such as for use as a biomarker for a medical condition or therapy selection. It is desirable in that such profiles are consistent between samples. Such consistency can hardly be achieved without high quality nuclei acid extractions.
  • a profile of nucleic acids can be obtained by analyzing nucleic acids in microvesicles that are secreted by those cells of origin.
  • Such microvesicles can be isolated from an easily accessible biological sample, e.g., urine, serum or plasma.
  • Such profiles of nucleic acids many include small RNAs, messenger RNA, microRNA, non-coding RNAs or a combination thereof.
  • such profiles of nucleic acids may be combined with other biomarkers to more accurately achieve certain results.
  • the profile of nucleic acids for instance can be a collection of genetic aberrations, which is used herein to refer to the nucleic acid amounts as well as nucleic acid variants within the microvesicles.
  • genetic aberrations include, without limitation, over-expression of a gene (e.g., oncogenes) or a panel of genes, under-expression of a gene (e.g., tumor suppressor genes such as p53 or RB) or a panel of genes, alternative production of splice variants of a gene or a panel of genes, gene copy number variants (CNV) (e.g.
  • DNA double minutes DNA double minutes
  • nucleic acid modifications e.g., methylation, acetylation and phosphorylations
  • single nucleotide polymorphisms SNPs
  • chromosomal rearrangements e.g., inversions, deletions and duplications
  • mutations insertions, deletions, duplications, missense, nonsense, synonymous or any other nucleotide changes
  • nucleic acid modifications can be assayed by methods described in, e.g., US Patent No. 7,186,512 and patent publication
  • methylation profiles may be determined by Illumina DNA Methylation OMA003 Cancer Panel.
  • SNPs and mutations can be detected by hybridization with allele-specific probes, enzymatic mutation detection, chemical cleavage of mismatched heteroduplex (Cotton et al., 1988), ribonuclease cleavage of mismatched bases (Myers et al., 1985), mass spectrometry (US Patent Nos.
  • nucleic acid sequencing single strand conformation polymorphism (SSCP) (Orita et al., 1989), denaturing gradient gel electrophoresis (DGGE)(Fischer and Lerman, 1979a; Fischer and Lerman, 1979b), temperature gradient gel electrophoresis (TGGE) (Fischer and Lerman, 1979a; Fischer and Lerman, 1979b), restriction fragment length polymorphisms (RFLP) (Kan and Dozy, 1978a; Kan and Dozy, 1978b), oligonucleotide ligation assay (OLA), allele-specific PCR (ASPCR) (US Patent No.
  • DGGE denaturing gradient gel electrophoresis
  • TGGE temperature gradient gel electrophoresis
  • RFLP restriction fragment length polymorphisms
  • OPA oligonucleotide ligation assay
  • ASPCR allele-specific PCR
  • gene expression levels may be determined by the serial analysis of gene expression (SAGE) technique (Velculescu et al., 1995).
  • SAGE serial analysis of gene expression
  • Example 1 Renal cells contain multivesicular bodies
  • TEM Transmission Electron Microscopy
  • the sample slices were rinsed in 0.1 M sodium cacodylate buffer, post- fixed in 1.0% osmium tetroxide in cacodylate buffer for 1 h at room temperature, rinsed in buffer again, then rinsed in distilled water (dEtO) and stained, en bloc, in an aqueous solution of 2.0% uranyl acetate for 1 hour at room temperature.
  • the samples were rinsed in distilled water and dehydrated through a graded series of ethanol to 100%.
  • the samples were infiltrated with Epon resin (Ted Pella, CA) by overnight immersion in a 1 : 1 solution of Epon: ethanol. The following day samples were placed in fresh Epon for several hours and embedded in Epon overnight at 60 0 C.
  • TEM transmission electron microscope
  • MVB Multivesicular bodies
  • Example 2 Microvesicles exist in urine
  • the filtrate then underwent ultracentrifugation at 118,000g for 70 min at 4°C, the supernatant was removed and the microvesicle-containing pellet was washed in PBS and re-pelleted at 118,000g for 70 min at 4°C.
  • filtration concentration was also used to isolate microvesicles from pre-processed samples.
  • the filtrate concentrator (10OkDa MWCO) (Millipore, MA) was prepared according to the manufacturer's instructions. Pre-processed filtrate was added to the filtration concentrator and centrifuged at 4,00Og for 4 min at RT. A 15 ml PBS wash step was included.
  • microvesicles sometimes aggregate together or remain singular in the TEM image.
  • Example 3 Ultracentrifugation is replaceable with filtration concentrator for purposes of microvesicle isolation
  • RNA extraction similar to the ultracentrifugation method We pre-processed 75 ml urine by centrifugation at 300g for 10 minutes at 4°C and 17,00Og for 20 minutes at 4°C, and then filtered through a 0.8 ⁇ m filter as detailed in Example 2. We then isolated microvesicles via a 10OkDa MWCO filtration concentrator (Millipore, MA) and via ultracentrifugation both with RNase digestion, respectively, and with and without DNase digestion to remove extra- micro vesicular nucleic acid contamination. As shown in Figures 3 and 4, the
  • Example 4 Sample pre-processing with only a 0.8um pre-flltration step is sufficient for purpose of microvesicle isolation
  • Example 5 Nucleic acid extraction from urinary microvesicles with methods that include removal or mitigation of adverse factors
  • urine samples 100 were pre- processed by filtering through a 0.8 ⁇ m filter membrane 110.
  • the microvesicles in the filtrates were then isolated either by ultracentrifugation or by filtration concentration 120, with details similar to those described in Example 2.
  • the isolated microvesicles were then subjected to RNase and/or DNase digestion to remove nucleic acids not contained inside the microvesicles 130.
  • the microvesicles were resuspended in 1 ⁇ l/ml RNase A (DNase and protease free) (Fermentas, MD) in PBS and incubated for 1 hr at 37°C.
  • RNase A DNase and protease free
  • the samples were re-pelleted at 118,000g for 70 min in PBS.
  • DNase I digestion the pellet was resuspended in 500 ⁇ l PBS and DNase I (RNase free)(Qiagen, CA) diluted in RDD buffer (according to manufacture's instructions) and incubated at room temperature for 10 min.
  • the samples were re-pelleted at 118,000g for 70 min in PBS.
  • RNase A and DNase I digestion of microvesicles isolated via filtration concentrators the same concentration of RNase and DNase was used and incubations were carried out in the filtration concentrators.
  • a step of extraction enhancement 140 was then performed, e.g., three resuspension/wash steps with 15 ml of PBS alone, or coupled with a protease treatment. After microvesicles were isolated, digested with nucleases and treated with protease, nucleic acids were extracted 150. The RNA extraction was performed using the RNeasy Micro kit (Qiagen, CA) according to the manufacturer's instructions. Briefly, 350 ⁇ l RLT buffer (with 10 ⁇ l beta- mercaptoethanol per ml RLT) was used to lyse exosomes and 16 ⁇ l nuclease- free water was used for elution.
  • the RNeasy Plus Micro kit (Qiagen, CA) is designed to remove genomic DNA (gDNA) and was carried out according to the manufacturer's instructions and eluted in 16 ⁇ l nuclease-free water.
  • gDNA genomic DNA
  • RNeasy Plus Micro kit the miRNA isolation method was followed according to the manufacturer's instructions. Isolated RNA was analyzed 160 on a RNA Pico 6000 chip (Agilent, CA) using a Agilent BioAnalyzer (Agilent, CA) which generated an electrophoretic profile and corresponding 'pseudo gel' of the sample.
  • RNA extraction from urine microvesicles increases as more protease is used to treat microvesicles before breaking the membrane of microvesicles.
  • nucleic acids from microvesicles in 20 ml urine were extracted using the above improved method except that the RNA extraction was performed using the Qiagen Qiamp minelute virus spin kit.
  • the urine sample was concentrated with filtration concentration and eluted in 200 ⁇ l PBS.
  • IX protease as 0.027 AU; 5X protease as 0.135 AU; 1OX protease as 0.27 AU; 25X protease as 0.675 AU; and 50X as 1.35 AU.
  • nucleic acid extractions can also be obtained from serum microvesicles.
  • serum from both melanoma and normal patient sera and used RNase inhibitor cocktail SUPERase-InTM (Ambion, Inc.) to treat microvesicle pellets by resuspension.
  • RNase inhibitor cocktail SUPERase-InTM Ambion, Inc.
  • the microvesicle isolation method was ultracentrifugation and the microvesicle pellets were treated with DNase for 20 minutes at room temperature.
  • RNA yield is 543 pg/ ⁇ l, 607 pg/ ⁇ l, 1084 pg/ ⁇ l, 1090 pg/ ⁇ l
  • RNA integrity assessed by the 28s/18s ratio being 1.7, 1.8, 1.3, and 0.6, respectively.
  • RNA yield for the two melanoma serum samples is 3433pg/ ⁇ l and 781pg/ ⁇ l and the 28S/18S ratio is 1.4 and 1.5, respectively.
  • Example 7 Use of extraction enhancement agents for nucleic acid extraction from a biological sample
  • An enhancement operation 210 is then performed, e.g., an appropriate amount of extraction enhancer is added to the serum and the mixture is incubated for 30 minutes at 37°C.
  • Nucleic acids from the treated serum are then extracted using regular extraction methods such as detailed in Example 5 220 and analyzed using Agilent BioAnalyzer 230. Such extraction is expected to produce high quality nucleic acids from the biological sample.
  • Example 8 Urinary microvesicles are contaminated by free, extra-microvesicle, non- cellular DNA
  • the extra nucleic acids from the untreated sample were likely from DNase susceptible "apoptotic bodies” because DNase susceptible "apoptotic bodies”-like ladders were seen as shown in the pseudo gel in Figure 24 C.
  • the amount of the free, extra-microvesicle, non-cellular DNA varied between subjects but the size of this DNA was in the range of approximately 25 to 1500 base pairs.
  • Example 9 Urinary microvesicles are mostly not contaminated by free, extra- microvesicle, non-cellular RNA
  • the curve of the RNase untreated sample (A) mostly overlapped with the curve of the RNase treated sample (B), suggesting there is no free extra-microvesicle, non-cellular RNA associated with the isolated microvesicles. This may be due to the presence of ribonucleases in urine.
  • Example 10 Nucleic acid profiles are similar in urinary microvesicles and renal cells measured by Agilent BioAnalyzer.
  • urinary microvesicles also contained similar small RNA profiles to those obtained from renal cells. As shown in Figure
  • both urinary microvesicles (B) and renal tissue (A) contained small RNAs (about 25-200 base pairs) and shared similar patterns.
  • Example 11 RNA profiles in urinary microvesicles are different from those from whole urine.
  • RNA profiles in urinary microvesicles are different from those from whole urine.
  • RNA from whole urine was isolated using the ZR urine RNA isolation kit (Zymo Research, CA) according to the manufacturer's instructions. To remove DNA from the Zymo processed sample, the eluted RNA was resuspended in 350 ⁇ l RLT buffer and processed via the RNeasy Plus Micro kit, which used DNase to eliminate associated DNA, and eluted in 16 ⁇ l nuclease free water.
  • RNA profile from microvesicles from the same urine sample was generally very different from the profile from the whole urine extraction. In the microvesicle profile, there were 18S and 28S peaks. In addition, RNA from microvesicles was more abundant than that from the whole urine.
  • RNA profiles from urinary microvesicles is more similar to renal cell profiles than to profiles from whole urine. Further, the integrity of RNA extraction from microvesicles was at least 10 times better than that from whole urine.
  • Example 12 Urinary microvesicles contain both RNA and DNA.
  • Urinary microvesicles contain mRNA transcripts encoding specific genes from various regions of the nephron and collecting duct.
  • nucleic acid profiles are similar in urinary microvesicles and renal cells measured by Agilent BioAnalyzer.
  • microvesicles contain mRNA transcripts encoding specific genes from various regions of the nephron and collecting duct.
  • Urinary microvesicles were isolated from 200 ml urine from four human subjects (23 to 32 years of age) and were digested with RNase and DNase prior to exosome lysis and RNA extraction as detailed in Example 5. The extracted RNA underwent two rounds of mRNA amplification using RiboAmp (Molecular Devices, CA).
  • Figure 34B We examined 15 transcripts characteristic of various regions of the nephron and collecting duct ( Figure 34B). These included proteins and receptors implicated in various renal diseases including podocin from the glomerulus, cubilin from the proximal tubule and aquaporin 2 from the collecting duct.
  • PCR primers were: ACTB UTR, forward 5'-
  • GAPDH EX forward 5'-ACACCCACTCCTCCACCTTT-S ', reverse 5'- TGCTGTAGCCAAATTCGTTG-3';
  • NPHS2 UTR forward 5'-
  • AACTTGGTTCAGATGTCCCTTT-3' reverse 5 '-CAATGATAGGTGCTTGTAGGAAG- 3';
  • LGALSl EX forward 5 '-GGAAGTGTTGCAGAGGTGTG-S ', reverse 5'- TTGATGGCCTCCAGGTTG-3';
  • HSPG2 UTR 5'-AAGGCAGGACTCACGACTGA-S ', reverse 5'-ATGGCACTTGAGCTGGATCT-S ' ;
  • CUBN EX forward 5'- CAGCTCTCCATCCTCTGGAC-3', reverse 5'-CCGTGCATAATCAGCATGAA-S ' ;
  • LRP2 EX forward 5 '-CAAAATGGAATCTCTTCAAACG-S ', reverse 5'- GTCGCAGCAACACTTTCCTT-3';
  • AQPl UTR forward 5'- TTACGCAGGTATTTAGAAGCAGAG-S', reverse 5'- AGGGAATGGAGAAGAGAG
  • GTGGTTGCCTTCCTGGTCT-3' reverse 5 '-ATGAAGTCCTCCCAAAAGCA-S ';
  • CALCR UTR forward 5 '-ATTTTGCCACTGCCTTTCAG-S ', reverse 5'- ATTTTCTCTGGGTGCGCTAA-3';
  • SCNNlD UTR forward 5'-
  • ATP6V1B1 EX forward 5 '-AGGCAGTAGTTGGGGAGGAG-S ', reverse 5'- CGAGCGGTTCTCGTAGGG-S'; SLC 12Al EX, forward 5'-
  • UTR refers to primers designed in the UTR and "EX” refers primers designed across exons.
  • the PCR protocol was 5 min at 94°C; 40 s at 94°C; 30 s at 55°C; 1 min at 65°C for 30 cycles; and 68°C for 4 min.
  • the primers used were: AQP2: forward 5 '-GCCACCTCCTTGGGATCTATT-S ', reverse 5 '-TCATCAAACTTGCCAGTGACAAC- 3'; V-ATPase Bl subunit: forward 5'-CTGGCACTGACCACGGCTGAG -3', reverse 5'- CCAGCCTGTGACTGAGCCCTG -3'.
  • the PCR protocol was 5 min at 94°C; 40 s at 94°C, 30 s at 55°C, 1 min at 65°C for 30 cycles; and 68°C for 4 min.
  • region 1 Glomerulus NPHS2 - podocin, LGALSl - Galectin-1 , and HSPG2 - heparan sulfate proteoglycan
  • region 2 Proximal Tubule CUBN - cubilin, LRP2 - megalin, AQP 1 - aquaporin 1 , CA4 - carbonic anhydrase 4, and CLCN5 - chloride channel protein 5 (Figure 35); region 3 Thin Descending Limb: BDKRBl - bradykinin Bl receptor ( Figure 36); region 4 Medullary Thick Ascending Limb: CALCR - calcitonin receptor, and SCNNlD - amiloride-sensitive sodium channel subunit delta ( Figure 36); region 5 Distal Convoluted Tubule: SLC12A3
  • microvesicles containing mRNA are released from all regions of the nephron and collecting duct, and microvesicles can be a novel non-invasive source of nucleic acid biomarkers for renal diseases.
  • Example 14 Some mRNA transcripts inside urinary microvesicles are specific to renal cells
  • transcripts in microvesicles should be specific to renal cells.
  • V-ATPase B 1 subunit was absent.
  • the absence of V-ATPase B 1 subunit leads to renal acidosis in the mice (Finberg KE, Wagner CA, Bailey MA, et ah, The Bl-subunit of the H(+) ATPase is required for maximal urinary acidification. Proc Natl Acad Sci USA 102:13616-13621, 2005).
  • RNAlater Qiagen, CA
  • RNAlater Qiagen, CA
  • Mouse kidney samples were processed via the RNeasy Mini kit (Qiagen, CA) with the inclusion of the DNA digestion step.
  • RNA extracted from mouse urinary microvesicles was denatured for 5 minutes at 65 0 C and subjected to first strand cDNA synthesis as described in the Qiagen Sensiscript protocol (Qiagen, MD).
  • Sensiscript reverse transcription oligo-dT primers were used at a final concentration of l ⁇ M (Applied Biotech).
  • the resulting cDNA was used in the TaqMan PreAmp Master Mix Kit according to manufactures guide using 14 preamplification cycles (Applied Biosystems, CA). The preamplification product was then diluted 1 :20 with IX TE buffer (Promega, WI). The resulting cDNA was then used as a template for real-time PCR according to Taqman
  • Preamplification guide (Applied Biosystems, CA). Mouse kidney RNA concentration was measured on a SmartSpec 3000 (Bio-Rad, CA) and all samples were diluted to 90 ng/ ⁇ l. Mouse kidney RNA was denatured for 5 minutes at 65 0 C and subjected to first strand cDNA synthesis as described in the Qiagen Omniscript protocol (Qiagen, MD). In the Omniscript reverse transcription oligo-dT primers were used at a final concentration of l ⁇ M (Applied Biosystems, CA) and 1 ⁇ l of the resulting cDNA was then used per well in the subsequent real-time PCR reaction.
  • the real-time PCR reaction was carried out using TaqMan Gene Expression Master Mix and Expression Assays (Mouse GAPD Part Number 4352339E and mouse Atp6vlb2 assay id Mm00431996_mH) on an ABI 7300 Real Time PCR System (Applied Biosystems, CA).
  • V-ATPase Bl subunit and aquaporin 2 (AQP2) mRNA using RT-PCR.
  • Panel A V-ATPase Bl subunit transcript was not detected in both the kidney and urinary microvesicle samples from double mutant mice (Bl-/-), which is consistent with the fact that V-ATPase Bl subunit gene was knocked out in these mice.
  • V-ATPase Bl subunit transcript was present in the kidney and microvesicle samples from the wild-type mice (B1/+/+).
  • AQP2 mRNA was readily detected in both the kidney and the microvesicle sample from mice with both the Bl knockout or wild-type mice, which is expected because the V-ATPase B 1 subunit deletion does not affect the expression of AQP2.
  • Panel B the expression level of V-ATPase B2 subunit in microvesicles from the Bl knockout was not statistically different from the level in microvesicles from the wild-type mice. Such was also true for the expression level of V-ATPase B2 subunit in kidney cell from the knockout mice in comparison with the level in kidney cells from the wild-type mice.
  • transcripts present in kidney cells can be detected in urinary microvesicles secreted by the kidney cells, and transcripts absent in kidney cells can not be detected in urinary microvesicles secreted by the kidney cell. Accordingly, transcripts in urinary microvesicles are specific to renal cells and are noninvasive biomarkers for renal cells transcripts.
  • Urinary microvesicles contain non-coding RNA transcripts
  • Urinary microvesicles were isolated and nucleic acids were extracted according to the above method detailed in Example 5. We performed a deep-sequencing of urinary microvesicle RNAs and found that there were random areas on certain chromosomes that exhibited extreme transcription. When plotted transcript number versus position on the chromosome, these transcripts appeared as "Spikes.” These transcripts were more abundantly expressed than well-know endogenous markers such as GAPDH or actin, and were generally in non-coding regions of the chromosome. The relatively high expression levels of these spike sequences suggest that these sequences may also serve important roles in chromosome activation and cellular regulation.
  • PCR was performed according to the following program: initial denaturing at 95°C for 8 minutes; 30 cycles of three steps of denaturing at 95°C for 40 seconds, annealing at 55°C for 30 seconds, and elongation at 65°C for 1 minute; final elongation at 68 0 C for 5 minutes; and on hold at 4°C before BioAnalyzer analysis of the reaction.
  • initial denaturing at 95°C for 8 minutes 30 cycles of three steps of denaturing at 95°C for 40 seconds, annealing at 55°C for 30 seconds, and elongation at 65°C for 1 minute; final elongation at 68 0 C for 5 minutes; and on hold at 4°C before BioAnalyzer analysis of the reaction.
  • Figure 44 the amplification of each of these 10 regions gave positive results using templates in both human urinary microvesicles (A) and human kidney cells (B), suggesting that these spike transcripts were indeed present within microvesicles and human kidney cells.
  • spike transcripts can be used to assess the quality of an nucleic acid extraction from a biological sample.
  • the amount of any of the spike transcripts can be used to assess the quality of nucleic acids from urinary microvesicles in place of common markers such as GAPDH or ACTIN polynucleotide molecules.
  • the amount of GAPDH or ACTIN RNA in urinary microvesicles was so low that an extra- amplification step, e.g., a RiboAMP, was required for measuring their amount.
  • the amount of any one of the spike transcripts was so high that no extra-amplification step was necessary. Therefore, the use of these spike transcripts can make the assessment of nucleic acid extraction quality more efficient and simpler.
  • another aspect of the inventions described herein is a novel method of assessing the quality of a nucleic acid extraction from a biological sample, e.g., a human urine sample.
  • the method can be accomplished by extracting nucleic acids from a biological sample, measuring the amount of any of the spike transcripts, and compare the amount to a standard that has been establish for the particular biological sample.
  • the establishment of such standard can be, for example, an average amount of such spike transcript extracted from 10 normal human urine samples performed by an experienced biotechnology professional.
  • Bossi A., F. Bonini, A.P. Turner, and S.A. Piletsky. 2007. Molecularly imprinted polymers for the recognition of proteins: the state of the art. Biosens Bioelectron. 22: 1131-7. Chen, C, J. Skog, CH. Hsu, R.T. Lessard, L. Balaj, T. Wurdinger, B.S. Carter, X.O.
  • CD24 is a marker of exosomes secreted into urine and amniotic fluid. Kidney Int. 72: 1095-102.
  • Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers. Nat Cell Biol. 10:1470-6.
  • RNA Exosome- mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol. 9:654-9. van Dijk, EX., G. Schilders, and GJ. Pruijn. 2007. Human cell growth requires a functional cytoplasmic exosome, which is involved in various mRNA decay pathways. RNA.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Diabetes (AREA)
  • Animal Behavior & Ethology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Saccharide Compounds (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
PCT/US2010/042365 2008-02-01 2010-07-16 Nucleic acid analysis Ceased WO2011009104A1 (en)

Priority Applications (14)

Application Number Priority Date Filing Date Title
DK10800649.5T DK2454588T3 (en) 2009-07-16 2010-07-16 Nucleic acid
BR112012001077-8A BR112012001077A2 (pt) 2009-07-16 2010-07-16 extração de ácido nucleico, métodos para avaliar a qualidade de uma extração de ácido nucleico e de uma amostra biológica, para ober ácido nucleico a partir de uma amostra biológica, para analisar rna de microvesículas e para diagnosticar e monitorar um indivíduo, e, kit
CN201080041496.7A CN102498397B (zh) 2009-07-16 2010-07-16 核酸分析
KR1020187006847A KR20180029105A (ko) 2009-07-16 2010-07-16 핵산 분석
JP2012520829A JP5909444B2 (ja) 2009-07-16 2010-07-16 核酸分析
CA2768371A CA2768371A1 (en) 2009-07-16 2010-07-16 Methods for isolation of microvesicles and extraction of nucleic acids therefrom
HK12111737.1A HK1173213B (en) 2009-07-16 2010-07-16 Nucleic acid analysis
EP10800649.5A EP2454588B1 (en) 2009-07-16 2010-07-16 Nucleic acid analysis
HK12111815.6A HK1171083B (en) 2009-07-16 2010-07-16 Nucleic acid analysis
IN866DEN2012 IN2012DN00866A (cg-RX-API-DMAC7.html) 2009-07-16 2010-07-16
ES10800649.5T ES2547715T3 (es) 2009-07-16 2010-07-16 Análisis de ácido nucleico
SG2012003141A SG177677A1 (en) 2009-07-16 2010-07-16 Nucleic acid analysis
AU2010273928A AU2010273928A1 (en) 2009-07-16 2010-07-16 Nucleic acid analysis
US13/294,144 US20120142001A1 (en) 2008-02-01 2011-11-10 Method for isolation of nucleic acid containing particles and extraction of nucleic acids therefrom

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US22602509P 2009-07-16 2009-07-16
US22610609P 2009-07-16 2009-07-16
US61/226,106 2009-07-16
US61/226,025 2009-07-16

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/838,413 Continuation-In-Part US20110195426A1 (en) 2008-02-01 2010-07-16 Nucleic acids analysis

Publications (1)

Publication Number Publication Date
WO2011009104A1 true WO2011009104A1 (en) 2011-01-20

Family

ID=43449850

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/042365 Ceased WO2011009104A1 (en) 2008-02-01 2010-07-16 Nucleic acid analysis

Country Status (13)

Country Link
US (3) US20110195426A1 (cg-RX-API-DMAC7.html)
EP (1) EP2454588B1 (cg-RX-API-DMAC7.html)
JP (3) JP5909444B2 (cg-RX-API-DMAC7.html)
KR (2) KR20180029105A (cg-RX-API-DMAC7.html)
CN (2) CN102498397B (cg-RX-API-DMAC7.html)
AU (1) AU2010273928A1 (cg-RX-API-DMAC7.html)
BR (1) BR112012001077A2 (cg-RX-API-DMAC7.html)
CA (1) CA2768371A1 (cg-RX-API-DMAC7.html)
DK (1) DK2454588T3 (cg-RX-API-DMAC7.html)
ES (1) ES2547715T3 (cg-RX-API-DMAC7.html)
IN (1) IN2012DN00866A (cg-RX-API-DMAC7.html)
SG (2) SG2014014617A (cg-RX-API-DMAC7.html)
WO (1) WO2011009104A1 (cg-RX-API-DMAC7.html)

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012031008A2 (en) 2010-08-31 2012-03-08 The General Hospital Corporation Cancer-related biological materials in microvesicles
WO2012155014A1 (en) 2011-05-11 2012-11-15 Exosome Diagnostics, Inc. Nucleic acid extraction from heterogeneous biological materials
WO2013028788A1 (en) 2011-08-22 2013-02-28 Exosome Diagnostics, Inc. Urine biomarkers
EP2475988A4 (en) * 2009-09-09 2013-03-06 Gen Hospital Corp USE OF MICROVESICLES IN THE ANALYSIS OF NUCLEIC ACID PROFILES
WO2013071239A1 (en) * 2011-11-10 2013-05-16 Exosome Diagnostics, Inc. Cerebrospinal fluid assay
JP2013528063A (ja) * 2010-06-11 2013-07-08 日立化成株式会社 腎機能の特徴を決定する方法
US20130295574A1 (en) * 2010-11-10 2013-11-07 Exosome Diagnostics, Inc. Method for Isolation of Nucleic Acid Containing Particles and Extraction of Nucleic Acids Therefrom
WO2014055775A1 (en) 2012-10-03 2014-04-10 Exosome Diagnostics, Inc. Use of microvesicles in diagnosis, prognosis, and treatment of medical diseases and conditions
WO2014057128A2 (en) 2012-10-11 2014-04-17 Vin-De-Bona Trading Company Pte Ltd Method of painting microvesicles
EP2670868A4 (en) * 2011-01-31 2015-05-06 Esoterix Genetic Lab Llc PROCESS FOR ENRICHING MICROPARTICLES OR NUCLEIC ACIDS BY MEANS OF BONDING MOLECULES
WO2015153732A2 (en) 2014-04-01 2015-10-08 Cornell University Use of double-stranded dna in exosomes: a novel biomarker in cancer detection
WO2016172598A1 (en) * 2015-04-22 2016-10-27 The Broad Institute Inc. Exosomes and uses thereof
EP3134524A4 (en) * 2014-04-22 2017-11-29 Trovagene, Inc. Concentrating nucleic acids in urine
US10301681B2 (en) 2013-08-06 2019-05-28 Exosome Diagnostics, Inc. Methods of treating a subject with a high gleason score prostate cancer
WO2019116234A1 (en) * 2017-12-12 2019-06-20 Nestec S.A. Methods for determining microbiome ribosomal rna composition changes
US10607717B2 (en) 2013-11-06 2020-03-31 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Method for subtyping lymphoma types by means of expression profiling
WO2020106853A1 (en) 2018-11-20 2020-05-28 Exosome Diagnostics, Inc. Compositions and methods for internal controls of microvesicle isolations
US11136627B2 (en) 2012-08-30 2021-10-05 Exosome Diagnostics, Inc. Controls for nucleic acid assays
US11155874B2 (en) 2009-09-09 2021-10-26 The General Hospital Corporation Use of microvesicles in analyzing mutations
US11174503B2 (en) 2016-09-21 2021-11-16 Predicine, Inc. Systems and methods for combined detection of genetic alterations
US11266736B2 (en) 2008-04-17 2022-03-08 Vin De Bona Trading Company Pte Ltd Method of painting micro vesicles
US11702702B2 (en) 2016-04-15 2023-07-18 Predicine, Inc. Systems and methods for detecting genetic alterations
US11899024B2 (en) 2017-07-12 2024-02-13 Exosome Diagnostics, Inc. Treatment and diagnosis of parkinson's disease using isolated and enriched populations of biofluid-derived extracellular vesicles

Families Citing this family (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007103572A2 (en) * 2006-03-09 2007-09-13 Aethlon Medical, Inc. Extracorporeal removal of microvesicular particles
EP2717989B1 (en) 2011-06-10 2018-05-30 Hitachi Chemical Co., Ltd. Vesicle capturing devices and methods for using same
CN104736724A (zh) * 2012-10-05 2015-06-24 日立化成株式会社 尿液外泌小体mRNA和使用其检测糖尿病型肾病的方法
ES2949637T3 (es) 2013-03-13 2023-10-02 Univ Miami Método de aislamiento y purificación de microvesículas a partir de sobrenadantes de cultivos celulares y fluidos biológicos
US9662649B2 (en) 2013-05-06 2017-05-30 Hitachi Chemical Company America, Ltd. Devices and methods for capturing target molecules
WO2015082372A1 (en) * 2013-12-02 2015-06-11 Albert-Ludwigs-Universität Freiburg Process for the diagnosis of cancer by using exosomes
CN104031915A (zh) * 2014-06-17 2014-09-10 复旦大学附属肿瘤医院 用于结直肠癌预后的基因片段及其应用
US10266895B2 (en) 2014-11-05 2019-04-23 Hitachi Chemical Company Ltd. Exosomes and microvesicles in intestinal luminal fluids and stool and use of same for the assessment of inflammatory bowel disease
JP6631852B2 (ja) 2014-11-12 2020-01-15 日立化成株式会社 臓器障害を診断するための方法および装置
GB2539497A (en) 2015-06-19 2016-12-21 Airbus Operations Ltd A Rotational Joint For An Aircraft Folding Wing
DE112016003948T5 (de) 2015-08-31 2018-05-09 City Of Sapporo Molekulare verfahren zum beurteilen einer urothelialen erkrankung
CN109642229A (zh) * 2016-05-13 2019-04-16 外来体诊断公司 从生物液体分离细胞外囊泡和共分离无细胞dna的自动和手动方法
WO2018213392A1 (en) 2017-05-17 2018-11-22 Exosome Diagnostics, Inc. Microvesicle nucleic acids and/or proteins and uses thereof as markers of renal transplant rejection
JP7069587B2 (ja) * 2017-07-31 2022-05-18 東ソー株式会社 分析機器の洗浄方法
JP7444386B2 (ja) * 2018-06-07 2024-03-06 株式会社Lsiメディエンス ヒト尿からのマイクロベシクルの分離方法及び分析方法
CN109856259A (zh) * 2018-12-29 2019-06-07 南通大学附属医院 一种血清胰腺癌外泌体特异蛋白及其再验证过程
CN114958834A (zh) * 2020-03-09 2022-08-30 中山大学 一种adar蛋白细胞内高效结合底物及应用
EP4158065A1 (en) 2020-05-29 2023-04-05 Exosome Diagnostics, Inc. Use of microvesicle signature for the diagnosis and treatment of kidney transplant rejection
IL300361A (en) 2020-08-15 2023-04-01 Regeneron Pharma will fall into obesity in patients with variants of nucleic acid compounds encoding the calcitonin receptor
WO2023288130A1 (en) 2021-07-16 2023-01-19 Exosome Diagnostics, Inc. Methods of detecting sjögren's syndrome using salivary exosomes
EP4479561A1 (en) 2022-02-18 2024-12-25 Exosome Diagnostics, Inc. Use of microvesicle signatures in the identification and treatment of renal disorders
CN114480656B (zh) * 2022-03-07 2023-12-26 温州医科大学附属眼视光医院 Slc12a3和/或slc12a9在作为葡萄膜黑色素瘤治疗和预后检测指标中的应用
EP4584397A1 (en) 2022-09-07 2025-07-16 Exosome Diagnostics, Inc. Methods of detecting sjögren's syndrome using salivary exosomes

Citations (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5219727A (en) 1989-08-21 1993-06-15 Hoffmann-Laroche Inc. Quantitation of nucleic acids using the polymerase chain reaction
US5538871A (en) 1991-07-23 1996-07-23 Hoffmann-La Roche Inc. In situ polymerase chain reaction
US5556773A (en) 1993-08-06 1996-09-17 Yourno; Joseph Method and apparatus for nested polymerase chain reaction (PCR) with single closed reaction tubes
US5582981A (en) 1991-08-14 1996-12-10 Gilead Sciences, Inc. Method for identifying an oligonucleotide aptamer specific for a target
US5639611A (en) 1988-12-12 1997-06-17 City Of Hope Allele specific polymerase chain reaction
US5639606A (en) 1993-04-06 1997-06-17 The University Of Rochester Method for quantitative measurement of gene expression using multiplex competitive reverse transcriptase-polymerase chain reaction
US5840867A (en) 1991-02-21 1998-11-24 Gilead Sciences, Inc. Aptamer analogs specific for biomolecules
US6004755A (en) 1998-04-07 1999-12-21 Incyte Pharmaceuticals, Inc. Quantitative microarray hybridizaton assays
US6525154B1 (en) 2000-07-20 2003-02-25 The Regents Of The University Of California Molecular imprinting for the recognition of peptides in aqueous solution
WO2003023065A1 (en) 2001-09-06 2003-03-20 Syngenta Participations Ag Dna methylation patterns
WO2003050290A2 (en) 2001-11-15 2003-06-19 Board Of Regents The University Of Texas System Phosphoromonothioate and phosphorodithioate oligonucleotide aptamer chip for functional proteomics
US6812023B1 (en) 2000-04-27 2004-11-02 Anosys, Inc. Methods of producing membrane vesicles
US6893837B2 (en) 2001-08-23 2005-05-17 The Regents Of The University Of California Frozen tissue microarray technology for analysis RNA, DNA, and proteins
US6899863B1 (en) 1999-01-27 2005-05-31 Anosys, Inc., Institute Curie Method for preparing membrane vesicles
US6913879B1 (en) 2000-07-10 2005-07-05 Telechem International Inc. Microarray method of genotyping multiple samples at multiple LOCI
US6994960B1 (en) 1997-05-28 2006-02-07 The Walter And Eliza Hall Institute Of Medical Research Nucleic acid diagnostics based on mass spectrometry or mass separation and base specific cleavage
US7074563B2 (en) 1995-03-17 2006-07-11 Sequenom, Inc. Mass spectrometric methods for detecting mutations in a target nucleic acid
WO2006113590A2 (en) 2005-04-15 2006-10-26 Cedars-Sinai Medical Center Flow-cytometric heteroduplex analysis for detection of genetic alterations
US7186512B2 (en) 2002-06-26 2007-03-06 Cold Spring Harbor Laboratory Methods and compositions for determining methylation profiles
US7198893B1 (en) 1996-11-06 2007-04-03 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US7198923B1 (en) 1999-11-18 2007-04-03 Novartis Vaccines And Diagnostics, Inc. Method for the preparation of purified HCV RNA by exosome separation
US7332553B2 (en) 2000-01-28 2008-02-19 Mip Technologies Ab Functional monomers for molecular recognition and catalysis
US7364848B2 (en) 2002-09-02 2008-04-29 Pamgene B.V. Integrated microarray analysis
US7378245B2 (en) 2002-09-06 2008-05-27 State Of Oregon Acting By And Through The State Board Of Higher Education On Behalf Of The University Of Oregon Methods for detecting and localizing DNA mutations by microarray
US7384589B2 (en) 2003-08-01 2008-06-10 Lawrence Livermore National Security, Llc Nanoscale molecularly imprinted polymers and method thereof
WO2009036236A1 (en) * 2007-09-14 2009-03-19 The Ohio State University Research Foundation Mirna expression in human peripheral blood microvesicles and uses thereof

Family Cites Families (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PT938320E (pt) * 1996-03-26 2010-09-22 Michael S Kopreski Método que permite a utilização de arn extracelular extraído de plasma ou de soro para detectar, monitorizar ou avaliar o cancro
US6204375B1 (en) * 1998-07-31 2001-03-20 Ambion, Inc. Methods and reagents for preserving RNA in cell and tissue samples
US20040241176A1 (en) * 2000-04-27 2004-12-02 Ap Cells. Inc. Method of producing membrane vesicles
CA2414782C (en) * 2001-05-11 2012-10-09 Regents Of The University Of Minnesota Intron associated with myotonic dystrophy type 2 and methods of use
WO2002099064A2 (en) * 2001-06-05 2002-12-12 Gene Logic, Inc. Rna purification methods
EP1498144A1 (en) * 2003-07-15 2005-01-19 Universite Pierre Et Marie Curie Paris Vi Extracellular vesicles from non-pathogenic amoebae useful as vehicle for transferring a molecule of interest to an eukaryotic cell
US8021847B2 (en) * 2004-06-02 2011-09-20 Proxy Life Science Holdings, Inc. Microvesicle-based compositions and methods
WO2005121369A2 (en) * 2004-06-02 2005-12-22 Sourcepharm, Inc. Rna-containing microvesicles and methods therefor
KR20070058441A (ko) * 2004-07-01 2007-06-08 유니버시티 오브 피츠버그 오브 더 커먼웰쓰 시스템 오브 하이어 에듀케이션 면역억제성 엑소솜
US20060223072A1 (en) * 2005-03-31 2006-10-05 Boyes Barry E Methods of using a DNase I-like enzyme
WO2006119439A2 (en) * 2005-05-03 2006-11-09 Althea Technologies, Inc. Compositions and methods for the analysis of degraded nucleic acids
CA2643322C (en) * 2006-02-24 2015-07-21 Novartis Ag Microparticles containing biodegradable polymer and cationic polysaccharide for use in immunogenic compositions
JP2008035779A (ja) * 2006-08-07 2008-02-21 Mitsubishi Rayon Co Ltd 核酸の分解度を測定する方法と核酸アレイ
US20080287669A1 (en) * 2007-05-16 2008-11-20 Braman Jeffrey C Methods and compositions for identifying compounds useful in nucleic acid purification
EP2613149B1 (en) * 2007-07-25 2014-09-17 University Of Louisville Research Foundation, Inc. Exosome-associated microRNA as a diagnostic marker
JP5769417B2 (ja) * 2007-08-16 2015-08-26 ザ ロイヤル インスティチューション フォー ザ アドバンスメント オブ ラーニング/マギル ユニバーシティ 腫瘍細胞由来微小胞
EP2198296B1 (en) * 2007-09-05 2015-11-11 Laurentian University Method of using tumour rna integrity to measure response to chemotherapy in cancer patients
KR20100127768A (ko) * 2008-02-01 2010-12-06 더 제너럴 하스피탈 코포레이션 의학적 질환 및 병태의 진단, 예후, 및 치료에 있어서 미세소포체의 용도

Patent Citations (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5639611A (en) 1988-12-12 1997-06-17 City Of Hope Allele specific polymerase chain reaction
US5219727A (en) 1989-08-21 1993-06-15 Hoffmann-Laroche Inc. Quantitation of nucleic acids using the polymerase chain reaction
US5840867A (en) 1991-02-21 1998-11-24 Gilead Sciences, Inc. Aptamer analogs specific for biomolecules
US5538871A (en) 1991-07-23 1996-07-23 Hoffmann-La Roche Inc. In situ polymerase chain reaction
US5582981A (en) 1991-08-14 1996-12-10 Gilead Sciences, Inc. Method for identifying an oligonucleotide aptamer specific for a target
US5639606A (en) 1993-04-06 1997-06-17 The University Of Rochester Method for quantitative measurement of gene expression using multiplex competitive reverse transcriptase-polymerase chain reaction
US5556773A (en) 1993-08-06 1996-09-17 Yourno; Joseph Method and apparatus for nested polymerase chain reaction (PCR) with single closed reaction tubes
US7074563B2 (en) 1995-03-17 2006-07-11 Sequenom, Inc. Mass spectrometric methods for detecting mutations in a target nucleic acid
US7198893B1 (en) 1996-11-06 2007-04-03 Sequenom, Inc. DNA diagnostics based on mass spectrometry
US6994960B1 (en) 1997-05-28 2006-02-07 The Walter And Eliza Hall Institute Of Medical Research Nucleic acid diagnostics based on mass spectrometry or mass separation and base specific cleavage
US6004755A (en) 1998-04-07 1999-12-21 Incyte Pharmaceuticals, Inc. Quantitative microarray hybridizaton assays
US6899863B1 (en) 1999-01-27 2005-05-31 Anosys, Inc., Institute Curie Method for preparing membrane vesicles
US7198923B1 (en) 1999-11-18 2007-04-03 Novartis Vaccines And Diagnostics, Inc. Method for the preparation of purified HCV RNA by exosome separation
US7332553B2 (en) 2000-01-28 2008-02-19 Mip Technologies Ab Functional monomers for molecular recognition and catalysis
US6812023B1 (en) 2000-04-27 2004-11-02 Anosys, Inc. Methods of producing membrane vesicles
US6913879B1 (en) 2000-07-10 2005-07-05 Telechem International Inc. Microarray method of genotyping multiple samples at multiple LOCI
US6525154B1 (en) 2000-07-20 2003-02-25 The Regents Of The University Of California Molecular imprinting for the recognition of peptides in aqueous solution
US6893837B2 (en) 2001-08-23 2005-05-17 The Regents Of The University Of California Frozen tissue microarray technology for analysis RNA, DNA, and proteins
WO2003023065A1 (en) 2001-09-06 2003-03-20 Syngenta Participations Ag Dna methylation patterns
WO2003050290A2 (en) 2001-11-15 2003-06-19 Board Of Regents The University Of Texas System Phosphoromonothioate and phosphorodithioate oligonucleotide aptamer chip for functional proteomics
US7186512B2 (en) 2002-06-26 2007-03-06 Cold Spring Harbor Laboratory Methods and compositions for determining methylation profiles
US7364848B2 (en) 2002-09-02 2008-04-29 Pamgene B.V. Integrated microarray analysis
US7378245B2 (en) 2002-09-06 2008-05-27 State Of Oregon Acting By And Through The State Board Of Higher Education On Behalf Of The University Of Oregon Methods for detecting and localizing DNA mutations by microarray
US7384589B2 (en) 2003-08-01 2008-06-10 Lawrence Livermore National Security, Llc Nanoscale molecularly imprinted polymers and method thereof
WO2006113590A2 (en) 2005-04-15 2006-10-26 Cedars-Sinai Medical Center Flow-cytometric heteroduplex analysis for detection of genetic alterations
WO2009036236A1 (en) * 2007-09-14 2009-03-19 The Ohio State University Research Foundation Mirna expression in human peripheral blood microvesicles and uses thereof

Non-Patent Citations (41)

* Cited by examiner, † Cited by third party
Title
ABRAVAYA, K.; J.J. CARRINO; S. MULDOON; H.H. LEE: "Detection of point mutations with a modified ligase chain reaction (Gap-LCR).", NUCLEIC ACIDS RES., vol. 23, 1995, pages 675 - 82, XP002210106
AL-NEDAWI, K.; B. MEEHAN; J. MICALLEF; V. LHOTAK; L. MAY; A. GUHA; J. RAK: "Intercellular transfer of the oncogenic receptor EGFRvIII by microvesicles derived from tumour cells", NAT CELL BIOL., vol. 10, 2008, pages 619 - 24, XP002526161, DOI: doi:10.1038/ncb1725
BALZAR, M.; M.J. WINTER; C.J. DE BOER; S.V. LITVINOV.: "The biology of the 17-1A antigen (Ep-CAM).", JMOL MED., vol. 77, 1999, pages 699 - 712, XP000925817, DOI: doi:10.1007/s001099900038
BOSSI, A.; F. BONINI; A.P. TURNER; S.A. PILETSKY: "Molecularly imprinted polymers for the recognition of proteins: the state of the art.", BIOSENS BIOELECTRON, vol. 22, 2007, pages 1131 - 7, XP005730920, DOI: doi:10.1016/j.bios.2006.06.023
CHEN, C.; J. SKOG; C.H. HSU; R.T. LESSARD; L. BALAJ; T. WURDINGER; B.S. CARTER; X.O. BREAKEFIELD; M. TONER; D. IRIMIA: "Microfluidic isolation and transcriptome analysis of serum microvesicles.", LAB CHIP., vol. 10, pages 505 - 11
CHERUVANKY, A.; H. ZHOU; T. PISITKUN; J.B. KOPP; M.A. KNEPPER; P.S. YUEN; R.A. STAR.: "Rapid isolation of urinary exosomal biomarkers using a nanomembrane ultrafiltration concentrator.", AM JPHYSIOL RENAL PHYSIOL., vol. 292, 2007, pages F1657 - 61, XP002736097, DOI: doi:10.1152/ajprenal.00434.2006
COCUCCI, E.; G. RACCHETTI; J. MELDOLESI: "Shedding microvesicles: artefacts no more", TRENDS CELL BIOL., vol. 19, 2009, pages 43 - 51, XP025913007, DOI: doi:10.1016/j.tcb.2008.11.003
COTTON, R.G.; N.R. RODRIGUES; R.D. CAMPBELL: "Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations.", PROC NATL ACAD SCI US A., vol. 85, 1988, pages 4397 - 401, XP002086182, DOI: doi:10.1073/pnas.85.12.4397
FINBERG KE; WAGNER CA; BAILEY MA ET AL.: "The BI-subunit of the H(+) A TPase is required for maximal urinary acidification", PROC NATL ACAD SCI USA, vol. 102, 2005, pages 13616 - 13621
FINBERG KE; WAGNER CA; BAILEY MA ET AL.: "The BI-subunit of the H(+) ATPase is required for maximal urinary acidification", PROC NATL ACAD SCI USA, vol. 102, 2005, pages 13616 - 13621
FISCHER, S.G.; L.S. LERMAN: "Length-independent separation of DNA restriction fragments in two-dimensional gel electrophoresis", CELL, vol. 16, 1979, pages 191 - 200, XP023910996, DOI: doi:10.1016/0092-8674(79)90200-9
FISCHER, S.G.; L.S. LERMAN: "Two-dimensional electrophoretic separation of restriction enzyme fragments of DNA", METHODS ENZYMOL., vol. 68, 1979, pages 183 - 91, XP009066767, DOI: doi:10.1016/0076-6879(79)68013-8
GEISS, G.K.; R.E. BUMGARNER; B. BIRDITT; T. DAHL; N. DOWIDAR; D.L. DUNAWAY; H.P. FELL; S. FERREE; R.D. GEORGE; T. GROGAN: "Direct multiplexed measurement of gene expression with color-coded probe pairs", NAT BIOTECHNOL., vol. 26, 2008, pages 317 - 25, XP002505107, DOI: doi:10.1038/NBT1385
GUATELLI, J.C.; K.M. WHITFIELD; D.Y. KWOH; K.J. BARRINGER; D.D. RICHMAN; T.R. GINGERAS: "Isothermal, in vitro amplification of nucleic acids by a multienzyme reaction modeled after retroviral replication", PROC NATL ACAD SCI USA., vol. 87, 1990, pages 1874 - 8
HAHN, P.J.: "Molecular biology of double-minute chromosomes.", BIOESSAYS, vol. 15, 1993, pages 477 - 84, XP002908185, DOI: doi:10.1002/bies.950150707
HUNTER ET AL.: "Detection of microRNA Expression in Human Peripheral Blood Microvesicles", PLOS ONE, vol. 3, no. 11, November 2008 (2008-11-01), pages E3694, XP008149486 *
JOHNSON, S.; D. EVANS; S. LAURENSON; D. PAUL; A.G. DAVIES; P.K. FERRIGNO; C. WALTI.: "Surface-immobilized peptide aptamers as probe molecules for protein detection", ANAL CHEM., vol. 80, 2008, pages 978 - 83, XP002536007, DOI: doi:10.1021/AC701688Q
KAN, Y.W.; A.M. DOZY: "Antenatal diagnosis of sickle-cell anaemia by D.N.A. analysis of amniotic-fluid cells", LANCET, vol. 2, 1978, pages 910 - 2
KAN, Y.W.; A.M. DOZY: "Polymorphism of DNA sequence adjacent to human beta-globin structural gene: relationship to sickle mutation", PROC NATL ACAD SCI USA., vol. 75, 1978, pages 5631 - 5, XP009021082, DOI: doi:10.1073/pnas.75.11.5631
KELLER, S.; C. RUPP; A. STOECK; S. RUNZ; M. FOGEL; S. LUGERT; H.D. HAGER; M.S. ABDEL-BAKKY; P. GUTWEIN; P. ALTEVOGT: "CD24 is a marker of exosomes secreted into urine and amniotic fluid.", KIDNEY INT., vol. 72, 2007, pages 1095 - 102, XP009106564, DOI: doi:10.1038/sj.ki.5002486
KWOH, D.Y.; G.R. DAVIS; K.M. WHITFIELD; H.L. CHAPPELLE; L.J. DIMICHELE; T.R. GINGERAS: "Transcription-based amplification system and detection of amplified human immunodeficiency virus type 1 with a bead-based sandwich hybridization format", PROC NATL ACAD SCI USA, vol. 86, 1989, pages 1173 - 7, XP000368676, DOI: doi:10.1073/pnas.86.4.1173
LANDEGREN, U.; R. KAISER; J. SANDERS; L. HOOD: "A ligase-mediated gene detection technique", SCIENCE, vol. 241, 1988, pages 1077 - 80, XP000676556, DOI: doi:10.1126/science.3413476
LI, J.; L. WANG; H. MAMON; M.H. KULKE; R. BERBECO; G.M. MAKRIGIORGOS: "Replacing PCR with COLD-PCR enriches variant DNA sequences and redefines the sensitivity of genetic testing", NAT MED, vol. 14, 2008, pages 579 - 84, XP055001155, DOI: doi:10.1038/nm1708
LIU, Q.; J.C. GREIMANN; C.D. LIMA: "Reconstitution, activities, and structure of the eukaryotic RNA exosome", CELL, vol. 127, 2006, pages 1223 - 37
MIELE, E.A.; D.R. MILLS; F.R. KRAMER: "Autocatalytic replication of a recombinant RNA.", JMOL BIOL., vol. 171, 1983, pages 281 - 95, XP024020805, DOI: doi:10.1016/0022-2836(83)90094-3
MYERS, R.M.; Z. LARIN; T. MANIATIS: "Detection of single base substitutions by ribonuclease cleavage at mismatches in RNA:DNA duplexes", SCIENCE, vol. 230, 1985, pages 1242 - 6, XP001022204, DOI: doi:10.1126/science.4071043
NAKAZAWA, H.; D. ENGLISH; P.L. RANDELL; K. NAKAZAWA; N. MARTEL; B.K. ARMSTRONG; H. YAMASAKI.: "UV and skin cancer: specific p53 gene mutation in normal skin as a biologically relevant exposure measurement", PROC NATL ACAD SCI USA., vol. 91, 1994, pages 360 - 4
NILSSON ET AL.: "Prostate cancer-derived urine exosomes: a novel approach to biomarkers for prostate cancer", BRITISH JOURNAL OF CANCER, vol. 100, 28 April 2009 (2009-04-28), pages 1603 - 1607, XP008149487 *
NILSSON, J.; J. SKOG; A. NORDSTRAND; V. BARANOV; L. MINCHEVA-NILSSON; X.O. BREAKEFIELD; A. WIDMARK: "Prostate cancer-derived urine exosomes: a novel approach to biomarkers for prostate cancer.", BR J CANCER, vol. 100, 2009, pages 1603 - 7, XP008149487, DOI: doi:10.1038/sj.bjc.6605058
ORITA, M.; H. IWAHANA; H. KANAZAWA; K. HAYASHI; T. SEKIYA: "Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms", PROC NATL ACAD SCI USA., vol. 86, 1989, pages 2766 - 70, XP000310584
RAPOSO, G.; H.W. NIJMAN; W. STOORVOGEL; R. LIEJENDEKKER; C.V. HARDING; C.J. MELIEF; H.J. GEUZE: "B lymphocytes secrete antigen-presenting vesicles", JEXP MED., vol. 183, 1996, pages 1161 - 72, XP002060486, DOI: doi:10.1084/jem.183.3.1161
See also references of EP2454588A4
SKOG, J.; T. WURDINGER; S. VAN RIJN; D.H. MEIJER; L. GAINCHE; M. SENA-ESTEVES; W.T. CURRY, JR.; B.S. CARTER; A.M. KRICHEVSKY; X.O.: "Glioblastoma microvesicles transport RNA and proteins that promote tumour growth and provide diagnostic biomarkers", NAT CELL BIOL., vol. 10, 2008, pages 1470 - 6, XP002633335, DOI: doi:10.1038/ncb1800
STEEMERS, F.J.; W. CHANG; G. LEE; D.L. BARKER; R. SHEN; K.L. GUNDERSON: "Whole-genome genotyping with the single-base extension assay", NAT METHODS, vol. 3, 2006, pages 31 - 3, XP009155366, DOI: doi:10.1038/nmeth842
STOORVOGEL, W.; M.J. KLEIJMEER; H.J. GEUZE; G. RAPOSO: "The biogenesis and functions of exosomes.", TRAFFIC., vol. 3, 2002, pages 321 - 30
TAYLOR, D.D.; C. GERCEL-TAYLOR: "MicroRNA signatures of tumor-derived exosomes as diagnostic biomarkers of ovarian cancer", GYNECOL ONCOL., vol. 110, 2008, pages 13 - 21, XP022795052, DOI: doi:10.1016/j.ygyno.2008.04.033
THERY, C.; L. ZITVOGEL; S. AMIGORENA: "Exosomes: composition, biogenesis and function", NAT REV IMMUNOL., vol. 2, 2002, pages 569 - 79, XP001127450
VALADI, H.; K. EKSTROM; A. BOSSIOS; M. SJOSTRAND; J.J. LEE; J.O. LOTVALL: "Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells", NAT CELL BIOL., vol. 9, 2007, pages 654 - 9
VAN DIJK, E.L.; G. SCHILDERS; G.J. PRUIJN: "Human cell growth requires a functional cytoplasmic exosome, which is involved in various mRNA decay pathways", RNA, vol. 13, 2007, pages 1027 - 35
VELCULESCU, V.E.; L. ZHANG; B. VOGELSTEIN; K.W. KINZLER: "Serial analysis of gene expression", SCIENCE, vol. 270, 1995, pages 484 - 7, XP001024449, DOI: doi:10.1126/science.270.5235.484
WENT, P.T.; A. LUGLI; S. MEIER; M. BUNDI; M. MIRLACHER; G. SAUTER; S. DIRNHOFER: "Frequent EpCam protein expression in human carcinomas.", HUM PATHOL., vol. 35, 2004, pages 122 - 8, XP002592037, DOI: doi:10.1016/S0046-8177(03)00502-1

Cited By (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11266736B2 (en) 2008-04-17 2022-03-08 Vin De Bona Trading Company Pte Ltd Method of painting micro vesicles
US11519036B2 (en) 2009-09-09 2022-12-06 The General Hospital Corporation Use of microvesicles in analyzing nucleic acid profiles
EP3461912A1 (en) * 2009-09-09 2019-04-03 The General Hospital Corporation Use of microvesicles in analyzing nucleic acid profiles
US11155874B2 (en) 2009-09-09 2021-10-26 The General Hospital Corporation Use of microvesicles in analyzing mutations
EP2475988A4 (en) * 2009-09-09 2013-03-06 Gen Hospital Corp USE OF MICROVESICLES IN THE ANALYSIS OF NUCLEIC ACID PROFILES
US10407728B2 (en) 2009-09-09 2019-09-10 The General Hospital Corporation Use of microvesicles in analyzing nucleic acid profiles
JP2013528063A (ja) * 2010-06-11 2013-07-08 日立化成株式会社 腎機能の特徴を決定する方法
WO2012031008A2 (en) 2010-08-31 2012-03-08 The General Hospital Corporation Cancer-related biological materials in microvesicles
US10793914B2 (en) 2010-08-31 2020-10-06 The General Hospital Corporation Cancer-related biological materials in microvesicles
US20210207124A1 (en) * 2010-11-10 2021-07-08 Exosome Diagnostics, Inc. Method for isolation of nucleic acid containing particles and extraction of nucleic acids therefrom
EP2638057A4 (en) * 2010-11-10 2014-04-30 Exosome Diagnostics Inc METHOD FOR ISOLATING NUCLEIC ACID-CONTAINING PARTICLES AND EXTRACTIONING NUCLEIC ACIDS THEREOF
US20130295574A1 (en) * 2010-11-10 2013-11-07 Exosome Diagnostics, Inc. Method for Isolation of Nucleic Acid Containing Particles and Extraction of Nucleic Acids Therefrom
US12312582B2 (en) * 2010-11-10 2025-05-27 Exosome Diagnostics, Inc. Method for isolation of nucleic acid containing particles and extraction of nucleic acids therefrom
AU2017203231B2 (en) * 2010-11-10 2019-01-24 Exosome Diagnostics, Inc. Method For Isolation Of Nucleic Acid Containing Particles And Extraction Of Nucleic Acids Therefrom
US10988755B2 (en) 2010-11-10 2021-04-27 Exosome Diagnostics, Inc. Method for isolation of nucleic acid containing particles and extraction of nucleic acids therefrom
AU2011326366B2 (en) * 2010-11-10 2017-02-23 Exosome Diagnostics, Inc. Method for isolation of nucleic acid containing particles and extraction of nucleic acids therefrom
EP2670868A4 (en) * 2011-01-31 2015-05-06 Esoterix Genetic Lab Llc PROCESS FOR ENRICHING MICROPARTICLES OR NUCLEIC ACIDS BY MEANS OF BONDING MOLECULES
US20160237422A1 (en) * 2011-05-11 2016-08-18 Exosome Diagnostics, Inc. Nucleic acid extraction from heterogeneous biological materials
WO2012155014A1 (en) 2011-05-11 2012-11-15 Exosome Diagnostics, Inc. Nucleic acid extraction from heterogeneous biological materials
US11407991B2 (en) * 2011-05-11 2022-08-09 Exosome Diagnostics, Inc. Nucleic acid extraction from heterogeneous biological materials
EP3569607A1 (en) 2011-05-11 2019-11-20 Exosome Diagnostics, Inc. Nucleic acid extraction from heterogeneous biological materials
WO2013028788A1 (en) 2011-08-22 2013-02-28 Exosome Diagnostics, Inc. Urine biomarkers
EP3492606A1 (en) 2011-08-22 2019-06-05 Exosome Diagnostics, Inc. Urine biomarkers
US20150038335A1 (en) * 2011-11-10 2015-02-05 Exosome Diagnostics, Inc. Cerebrospinal fluid assay
WO2013071239A1 (en) * 2011-11-10 2013-05-16 Exosome Diagnostics, Inc. Cerebrospinal fluid assay
US10174361B2 (en) * 2011-11-10 2019-01-08 Exosome Diagnostics, Inc. Cerebrospinal fluid assay
US11136627B2 (en) 2012-08-30 2021-10-05 Exosome Diagnostics, Inc. Controls for nucleic acid assays
US12018334B2 (en) 2012-08-30 2024-06-25 Exosome Diagnostics, Inc. Controls for nucleic acid assays
WO2014055775A1 (en) 2012-10-03 2014-04-10 Exosome Diagnostics, Inc. Use of microvesicles in diagnosis, prognosis, and treatment of medical diseases and conditions
WO2014057128A2 (en) 2012-10-11 2014-04-17 Vin-De-Bona Trading Company Pte Ltd Method of painting microvesicles
US10301681B2 (en) 2013-08-06 2019-05-28 Exosome Diagnostics, Inc. Methods of treating a subject with a high gleason score prostate cancer
EP3495509A1 (en) 2013-08-06 2019-06-12 Exosome Diagnostics, Inc. Urine biomarker cohorts, gene expression signatures, and methods of use thereof
US11574704B2 (en) 2013-11-06 2023-02-07 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Method for subtyping lymphoma types by means of expression profiling
US10607717B2 (en) 2013-11-06 2020-03-31 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Method for subtyping lymphoma types by means of expression profiling
WO2015153732A2 (en) 2014-04-01 2015-10-08 Cornell University Use of double-stranded dna in exosomes: a novel biomarker in cancer detection
EP3134524A4 (en) * 2014-04-22 2017-11-29 Trovagene, Inc. Concentrating nucleic acids in urine
WO2016172598A1 (en) * 2015-04-22 2016-10-27 The Broad Institute Inc. Exosomes and uses thereof
US11702702B2 (en) 2016-04-15 2023-07-18 Predicine, Inc. Systems and methods for detecting genetic alterations
US11174503B2 (en) 2016-09-21 2021-11-16 Predicine, Inc. Systems and methods for combined detection of genetic alterations
US11899024B2 (en) 2017-07-12 2024-02-13 Exosome Diagnostics, Inc. Treatment and diagnosis of parkinson's disease using isolated and enriched populations of biofluid-derived extracellular vesicles
WO2019116234A1 (en) * 2017-12-12 2019-06-20 Nestec S.A. Methods for determining microbiome ribosomal rna composition changes
WO2020106853A1 (en) 2018-11-20 2020-05-28 Exosome Diagnostics, Inc. Compositions and methods for internal controls of microvesicle isolations
US12258587B2 (en) 2018-11-20 2025-03-25 Exosome Diagnostics, Inc. Compositions and methods for internal controls of microvesicle isolations

Also Published As

Publication number Publication date
DK2454588T3 (en) 2015-09-28
JP2017131244A (ja) 2017-08-03
IN2012DN00866A (cg-RX-API-DMAC7.html) 2015-07-10
EP2454588B1 (en) 2015-07-15
KR20120037992A (ko) 2012-04-20
SG2014014617A (en) 2014-05-29
AU2010273928A2 (en) 2012-02-09
CN102498397A (zh) 2012-06-13
EP2454588A4 (en) 2012-12-12
US20110195426A1 (en) 2011-08-11
JP5909444B2 (ja) 2016-04-26
ES2547715T3 (es) 2015-10-08
HK1171083A1 (zh) 2013-03-15
SG177677A1 (en) 2012-02-28
AU2010273928A1 (en) 2012-02-09
EP2454588A1 (en) 2012-05-23
JP2016116512A (ja) 2016-06-30
CN102498397B (zh) 2016-04-06
CN105779436A (zh) 2016-07-20
KR20180029105A (ko) 2018-03-19
US20160348095A1 (en) 2016-12-01
JP2012533308A (ja) 2012-12-27
US20170114389A1 (en) 2017-04-27
CA2768371A1 (en) 2011-01-20
BR112012001077A2 (pt) 2020-08-11
HK1173213A1 (en) 2013-05-10

Similar Documents

Publication Publication Date Title
EP2454588B1 (en) Nucleic acid analysis
EP3529374B1 (en) Sequencing and analysis of exosome associated nucleic acids
EP3455355B1 (en) Automated and manual methods for isolation of extracellular vesicles and co-isolation of cell-free dna from biofluids
US20250290062A1 (en) Method for isolation of nucleic acid containing particles and extraction of nucleic acids therefrom
CN105734128B (zh) 微泡在医学疾病和病况的诊断、预后以及治疗中的用途
US20120142001A1 (en) Method for isolation of nucleic acid containing particles and extraction of nucleic acids therefrom
US20200149036A1 (en) Methods to distinguish rna and dna in a combined preparation
AU2017219022A1 (en) Nucleic acid analysis
HK1173213B (en) Nucleic acid analysis
HK1171083B (en) Nucleic acid analysis
HK1158705B (en) Use of microvesicles in diagnosis, prognosis and treatment of medical diseases and conditions

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 201080041496.7

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10800649

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2012520829

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2010273928

Country of ref document: AU

Ref document number: 2768371

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 866/DELNP/2012

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2010273928

Country of ref document: AU

Date of ref document: 20100716

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20127003940

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2010800649

Country of ref document: EP

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112012001077

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112012001077

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20120116