WO2010143919A2 - Il-6에 의해 매개되는 질환 또는 라이노바이러스 감염성 질환의 예방 또는 치료를 위한 방법 및 조성물 - Google Patents

Il-6에 의해 매개되는 질환 또는 라이노바이러스 감염성 질환의 예방 또는 치료를 위한 방법 및 조성물 Download PDF

Info

Publication number
WO2010143919A2
WO2010143919A2 PCT/KR2010/003791 KR2010003791W WO2010143919A2 WO 2010143919 A2 WO2010143919 A2 WO 2010143919A2 KR 2010003791 W KR2010003791 W KR 2010003791W WO 2010143919 A2 WO2010143919 A2 WO 2010143919A2
Authority
WO
WIPO (PCT)
Prior art keywords
composition
disease
glucoside
quercetin
extract
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2010/003791
Other languages
English (en)
French (fr)
Other versions
WO2010143919A3 (ko
Inventor
김영국
최정호
이경
최순용
김관회
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Research Institute of Bioscience and Biotechnology KRIBB
Original Assignee
Korea Research Institute of Bioscience and Biotechnology KRIBB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Korea Research Institute of Bioscience and Biotechnology KRIBB filed Critical Korea Research Institute of Bioscience and Biotechnology KRIBB
Publication of WO2010143919A2 publication Critical patent/WO2010143919A2/ko
Publication of WO2010143919A3 publication Critical patent/WO2010143919A3/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/16Antivirals for RNA viruses for influenza or rhinoviruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/30Extraction of the material
    • A61K2236/33Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/30Extraction of the material
    • A61K2236/39Complex extraction schemes, e.g. fractionation or repeated extraction steps
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2236/00Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
    • A61K2236/50Methods involving additional extraction steps
    • A61K2236/51Concentration or drying of the extract, e.g. Lyophilisation, freeze-drying or spray-drying

Definitions

  • the present invention provides a disease mediated by IL-6 by inhibiting the signaling system specifically induced by IL-6, using a hawthorn extract or quercetin 3-glucoside-7-rhamnoside isolated therefrom.
  • a method and composition for the prevention or treatment of rhinovirus infectious diseases are provided.
  • Human rhinovirus is a common cold-induced virus that, unlike the influenza virus, causes symptoms such as nasal congestion, runny nose, sneezing, cough, sore throat, chills, headache, and boredom. It is known to cause or worsen acute respiratory diseases such as asthma and chronic bronchitis. It also causes pneumonia, sinusitis and otitis media.
  • human rhinovirus positive patients are known to have symptoms such as decreased lung function, increased eosinophil and lymphocyte count, and eosinophil infiltration in bronchial mucosa. There was a relationship between positive human rhinoviruses, the number of white blood cells in peripheral blood, and the number of polymorphonuclear lymphocytes, respectively.
  • bronchial mucosa samples were taken from 30 asthma groups (among them, 7 aspirin-sensitive asthma cases) and 23 control groups, and analyzed using in situ reverse transcriptase polymerase chain reaction (RT-PCR).
  • RT-PCR in situ reverse transcriptase polymerase chain reaction
  • the human rhinovirus infection rate was 22% in the control group and 73% in the asthma group, and there was a statistically significant difference (P ⁇ 0.001) between the two groups.
  • the staining pattern of the specimen is divided into exactly two types, with the scope of staining being limited to the mucosal surface and having a distinctly outlined dot shape, and a 'diffusion' type appearing throughout the sample but not limited to it.
  • IL-6 inflammatory cytokine interleukin-6
  • Cytokines are polypeptides or glycoproteins involved in cell proliferation, differentiation, activation, etc. secreted by various kinds of cells in vivo and play an important role in immune and inflammatory responses. Symptoms of various autoimmune and inflammatory diseases vary widely, but one of the common etiologies is the production of several cytokines that regulate immune responses, tissue damage and recovery. The expression of inflammatory cytokines IL-1 ⁇ , IL- ⁇ , TNF ⁇ , IL-6, IL-12 is increased in lesion tissue of inflammatory diseases.
  • TNF ⁇ , IL-1, IL-6, IL-10, IFN ⁇ , IFN ⁇ are increased in the serum of lupus patients, and TNF ⁇ , IL-1, IL-2, IL-6 in the salivary glands of patients with Shegran syndrome. , IL-10, TGF ⁇ expression has been reported.
  • IL-6 is a cytokine that is important in representative inflammatory diseases, autoimmune diseases and cancer cells, and performs various functions in various organs.
  • IL-6 is known to be expressed in many cell types and is typically involved in various biological functions such as immune response, inflammation, hematopoietic process, cell proliferation and differentiation (Naka et al. 2002).
  • the action of IL-6 is mediated by receptors.
  • IL-6 first binds to IL-6R, and the complex of IL-6 and IL-6R in turn binds to two gp130s to form an active receptor complex that initiates signaling into the cell.
  • Janus Kinases 2 (JAK2) is activated by transphosphorylation.
  • Activated JAK2 phosphorylates several tyrosine residues in the receptor cytoplasmic domains, which are signal transducers and STAT3 with SH 2 or other phosphotyrosine binding motifs. It acts as a docking site for proteins in the cytoplasm, such as activators of transcription.
  • STAT3 which binds to the cytoplasmic region of the receptor, is phosphorylated by JAK2 and then released from the receptor.
  • Activated STAT3s bind to each other in the cytoplasm to form a homodimer or heterodimer, then enter the nucleus and bind to the recognition sequence of the target gene to increase transcription ( Levy, DE, et al., Nat Rev Mol Cell Biol , 2002, 3, 651-62, Darnell, JE, Jr, Science , 1997, 277, 1630-1635).
  • STAT3 an intermediary messenger of the IL-6 signaling pathway, has been linked to several myeloma, breast carcinoma, prostate cancer, brain tumors, head and neck carcinoma, melanoma, leukemia and lymphomas, especially chronic myelogenous leukemia and multiple myeloma. It has been reported to be involved in forms of cancer (Niu et al . , Cancer Res. , 1999, 59, 5059-5063). Cells derived from both rat and human prostate cancer have been found to have structurally activated STAT3, which has been shown to affect some acute leukemias (Gouilleux-Gruart, V. et al., Leuk .
  • Lymphoma 1997, 28, 83-88
  • STAT3 has been shown to be structurally phosphorylated on serine residues in chronic lymphocytic leukemia (Frank, DA et al . , J. Clin. Invest. , 1997, 100, 3140-3148).
  • STAT3 has been shown to be structurally active in myeloma tumor cells, in both myeloid mononuclear cells and cultures from patients with multiple myeloma.
  • STAT3 signaling has been shown to be essential for the survival of myeloma tumor cells by conferring resistance to apoptosis (Catlett-Falcone, R. et al., Immunity , 1999, 10, 105-115).
  • Hippophae rhamnoides is a plant of the family Liliaceae, a shrub that resembles a willow tree and grows female and female separately. It grows in various regions within 2-69 degrees east longitude and 27-69 degrees north latitude. The mountain is called Seabuckthorn by common name, grows up to 2.5m in height, and leaves are narrow in width and silver underside. Fruits are ball-shaped, orangeish yellow, about 8mm in diameter. It is found in the sand dunes along the eastern and southeastern coasts of England, and is also prevalent in mountainous regions in Europe and Asia. It is a plant that lives in low temperature and barren areas such as China's Inner Mongolia and Russia's Siberia and Canada's backcountry.
  • Flavonoids have antiviral effects against herpes and adenoviruses, and biflavonoid compounds such as robustaflavones have been reported to have inhibitory effects against influenza viruses ( Planta Medica , Vol. 65, pp 120-125). However, the antiviral effect was not excellent.
  • the present inventors have endeavored to develop an agent capable of preventing or treating infectious diseases of rhinoviruses and inhibiting IL-6 signaling system to effectively prevent or treat diseases mediated by IL-6.
  • the extract or quercetin 3-glucoside-7-rhamnoside compound isolated therefrom has antiviral activity and activity that inhibits IL-6 signaling system, confirming that it can effectively prevent or treat such diseases.
  • the present invention has been completed.
  • the present invention provides a disease mediated by IL-6 by inhibiting the signaling system specifically induced by IL-6, using a hawthorn extract or quercetin 3-glucoside-7-rhamnoside isolated therefrom. It is an object of the present invention to provide methods and compositions for the prevention or treatment of rhinovirus infectious diseases.
  • the present invention provides a method of treating a disease mediated by IL-6, comprising administering to a patient a therapeutically effective amount of Hippophae rhamnoides extract.
  • the present invention provides a method for treating a disease mediated by IL-6, comprising administering to a patient a therapeutically effective amount of quercetin 3-glucoside-7-rhamnoside represented by the following formula (1): Provide a method of treatment.
  • the present invention provides a method of treating rhinovirus infectious disease, comprising administering to a patient a therapeutically effective amount of Hippophae rhamnoides extract.
  • the present invention comprises the step of administering to a patient a therapeutically effective amount of a Quecetin 3-glucoside-7-rhamnoside represented by the formula (1), a method for treating rhinovirus infectious disease To provide.
  • the present invention provides a composition for preventing or treating a disease mediated by IL-6, including an extract of Hippophae rhamnoides .
  • the present invention provides a composition for the prevention or treatment of diseases mediated by IL-6 comprising a quercetin 3-glucoside-7-rhamnoside represented by Formula 1 as an active ingredient.
  • the present invention provides a composition for the prevention or treatment of rhinovirus infectious disease comprising an extract of Hippophae rhamnoides .
  • the present invention provides a composition for the prevention or treatment of rhinovirus infectious disease comprising a quercetin 3-glucoside-7-rhamnoside represented by the formula (1) as an active ingredient.
  • the therapeutic methods and compositions of the present invention utilize the extract of the hawthorn or quercetin 3-glucoside-7-rhamnoside, which acts as an important mediator of the signaling process causing inflammatory disease, autoimmune disease or cancer. Inhibiting the binding of the IL-6 receptor has the effect of preventing and treating diseases mediated by IL-6.
  • the treatment methods and compositions of the present invention using a hawthorn extract or quercetin 3-glucoside-7-rhamnoside isolated from the same, prevents or treats rhinovirus infectious diseases by antiviral effects on rhinoviruses.
  • the IL-6 signaling system can inhibit the exacerbation of rhinovirus infectious diseases.
  • the compound of the present invention is a low-molecular compound, not a protein, it is more effective in the pharmaceutical industry than the neutralizing antibody of the protein used as a conventional medicine.
  • 1 is a molecular weight spectrum of quercetin 3-glucoside-7-rhamnoside according to the present invention.
  • Figure 2 shows the hydrogen nuclear magnetic resonance spectrum (DMSO d- 6, 300MHz) of the quercetin 3-glucoside-7-rhamnoside according to the present invention.
  • Figure 3 shows the carbon nuclear magnetic resonance spectrum (DMSO d- 6, 75MHz) of the quercetin 3-glucoside-7-rhamnoside according to the present invention.
  • Figure 4 shows the DEPT spectrum (DMSO d- 6, 75 MHz) of quercetin 3-glucoside-7-rhamnoside according to the present invention.
  • the present invention provides a method of treating a disease mediated by IL-6, comprising administering to a patient a therapeutically effective amount of Hippophae rhamnoides extract.
  • the present invention provides a composition for preventing or treating a disease mediated by IL-6, including an extract of Hippophae rhamnoides .
  • the hawthorn extract of the present invention may preferably be an extract of hawthorn fruit or leaves, but is not limited thereto.
  • the hawthorn extract may be extracted with water, methanol, ethanol, lower alcohols such as C 1 to C 4 or a mixed solvent thereof.
  • the extract is extracted with ethanol, most preferably the extract is 10 to 100% ethanol extract.
  • the extract of the present invention may include any one or more of the extract obtained by the extraction treatment, the dilution or concentrate of the extract, the dried product obtained by drying the extract, and these modifiers or purified products.
  • the present invention provides a method for treating a disease mediated by IL-6, comprising administering to a patient a therapeutically effective amount of quercetin 3-glucoside-7-rhamnoside represented by the following formula (1): Provide a method of treatment.
  • the present invention is mediated by IL-6 comprising a quercetin 3-O-glucoside-7-rhamniside represented by Formula 1 as an active ingredient. It provides a composition for the prevention or treatment of diseases.
  • the quercetin 3-glucoside-7-rhamnoside compound of the present invention is preferably obtained by extracting, separating and purifying from the hawthorn tree, but is not limited thereto. That is, the compound may be obtained by extraction, separation, and purification from other raw materials, may be prepared by a known synthesis method, or may be used as a commercial reagent.
  • the present invention provides a method for separating and purifying quercetin 3-glucoside-7-rhamnoside from the hawthorn as another aspect.
  • the method of separation and purification is as follows.
  • an ethanol extract is prepared from the hawthorn, and concentrated under reduced pressure to obtain a fraction.
  • chromatography is performed on the fraction using methanol as a solvent to obtain an active fraction having an IL-6 signaling system inhibitory activity.
  • the active fraction is separated by high performance liquid chromatography to obtain quercetin 3-glucoside-7-rhamnoside.
  • the hawthorn extract or quercetin 3-glucoside-7-rhamnoside of the present invention inhibited IL-6 signaling. Therefore, it is effective in preventing or treating a disease mediated by IL-6.
  • IL-6 is a cytokine that is important in representative inflammatory diseases, autoimmune diseases and cancer cells, and performs various functions in various organs. IL-6 is known to be expressed in many cell types and is typically involved in various biological functions such as immune response, inflammation, hematopoietic process, cell proliferation and differentiation.
  • IL-6-mediated disease may be inflammatory disease, autoimmune disease and cancer, and specifically, asthma, psoriasis, atopy, osteoporosis, lupus, Crohn's disease, vascular stenosis, cancer metastasis, transplant rejection, arthritis , Alzheimer's, myeloma, breast carcinoma, prostate cancer, brain tumor, head and neck carcinoma, melanoma, leukemia, multiple myeloma.
  • the present invention is not limited thereto, and diseases related to inflammatory diseases, autoimmune diseases or cancers, which are commonly known, may be included in the scope of the present invention.
  • the present invention provides a composition for the prevention or treatment of rhinovirus infectious diseases, including the hawthorn extract or quercetin 3-glucoside-7-rhamnoside.
  • the invention provides a method of treating rhinovirus infectious disease, comprising administering to a patient a therapeutically effective amount of said hawthorn extract or quercetin 3-glucoside-7-rhamnoside. to provide.
  • the hawthorn extract or quercetin 3-glucoside-7-rhamnoside of the present invention can not only inhibit the proliferation of rhinoviruses, but also inhibit the exacerbation of rhinovirus infectious diseases by inhibiting IL-6 signaling system. Can be.
  • rhinovirus infectious disease includes infectious disease caused by rhinoviruses.
  • the disease includes acute respiratory diseases such as common cold, asthma, chronic bronchitis, pneumonia, sinusitis, otitis media, and cold symptoms include nasal congestion, runny nose, sneezing, cough, sore throat, chills, headache, and boredom. One or more of the symptoms.
  • prophylaxis or treatment of a disease includes the prevention, complete or partial treatment of the disease. It also includes reducing symptoms, improving symptoms, alleviating symptoms of pain, and reducing the incidence of disease.
  • the hawthorn extract or quercetin 3-glucoside-7-rhamside inhibited IL-6 mediated reporter gene expression in a concentration-dependent manner at each concentration as a result of IL-6 reactive STAT3 reporter gene analysis.
  • the 50% inhibition concentration was 43.37 ⁇ g / ml.
  • the hawthorn extract or quercetin 3-glucoside-7-rhamside is Comparing cell growth rate (%) (Equation 1) and anti-proliferative activity (%) (Equation 2), the results showed that 25% or more of the extracts of the hawthorn were higher than Genistin and Ribavirin.
  • the purely isolated active substance quercetin 3-glucoside-7-rhamnoside showed more than 180-fold inhibition of virus growth.
  • the effective dose is generally 1 to 100 mg / day, preferably 5 to 20 mg / day, per kg of adult patient. Dosage levels for a particular patient may vary as appropriate depending on gender, age, health condition, diet, time of administration, method of administration, drug mixture and severity of disease. Therefore, the above dosage does not limit the scope of the present invention in any aspect.
  • the quercetin 3-glucoside-7-rhamside compound can be used in the form of a pharmaceutically acceptable salt, and includes all salts, hydrates and solvates prepared by conventional methods.
  • salts are acid addition salts formed with pharmaceutically acceptable free acids.
  • Acid addition salts are prepared by conventional methods, for example by dissolving a compound in an excess of aqueous acid solution and precipitating the salt using a water miscible organic solvent (eg, methanol, ethanol, acetone or acetonitrile). Equivalent molar amounts of the compound and acid or alcohol (eg, glycol monomethylether) in water can be heated and the mixture can then be evaporated to dryness or the precipitated salts can be suction filtered.
  • a water miscible organic solvent eg, methanol, ethanol, acetone or acetonitrile
  • inorganic acids and organic acids may be used as the free acid, and hydrochloric acid, bromic acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc. may be used as the inorganic acid, and citric acid, acetic acid, lactic acid, tartaric acid ( tartaric acid), maleic acid, fumaric acid, formic acid, propionic acid, oxalic acid, trifluoroacetic acid, benzoic acid, gluconic acid, methanesulfonic acid, glycolic acid, succinic acid, 4-toluenesulfonic acid, galluxuronic acid, m Main acid, glutamic acid or aspartic acid, etc. can be used, but it is not limited to these.
  • Bases can also be used to make pharmaceutically acceptable metal salts.
  • Alkali metal or alkaline earth metal salts are obtained, for example, by dissolving a compound in an excess of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and then evaporating and drying the filtrate.
  • the metal salt it is particularly suitable to prepare sodium, potassium or calcium salt, but is not limited thereto.
  • Corresponding silver salts can also be obtained by reacting alkali or alkaline earth metal salts with a suitable silver salt (eg, silver nitrate).
  • composition according to the present invention may be administered in various oral or parenteral dosage forms at the time of clinical administration, and when formulated, diluents and excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants are usually used. To use.
  • Solid form preparations for oral administration include tablets, troches, lozenges, aqueous or oily suspensions, prepared powders or granules, emulsions, hard or soft capsules, syrups or elixirs, and the like.
  • Binders such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose or gelatin for preparation in formulations such as tablets and capsules; Excipients such as dicalcium phosphate; Disintegrants such as corn starch or sweet potato starch; Lubricants such as magnesium stearate, calcium stearate, sodium stearyl fumarate or polyethylene glycol wax.
  • a liquid carrier such as fatty oil.
  • Parenteral administration may also be subcutaneous, intravenous, intramuscular or intrathoracic infusion.
  • the compound of Formula 1 is prepared as a solution or suspension by mixing a stabilizer, a buffer, a sterile aqueous solution, a non-aqueous solvent, a suspension, an emulsion, a lyophilized agent, a suppository, and the like, and an ampoule.
  • the non-aqueous solvent and suspending agent vegetable oils such as propylene glycol, polyethylene glycol and olive oil, injectable esters such as ethyl oleate and the like can be used.
  • the base of the suppository witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.
  • composition comprising the hawthorn extract or quercetin 3-glucoside-7-rhamnoside of the present invention may be a food composition.
  • Ingredients commonly added in food production include, for example, proteins, carbohydrates, fats, nutrients, seasonings and flavoring agents.
  • carbohydrates described above include monosaccharides (eg, glucose, fructose, etc.), disaccharides (eg, maltose, sucrose, oligosaccharides, etc.) and polysaccharides (eg, dextrins, cyclodextrins).
  • other sugars such as xylitol, sorbitol, and erythritol.
  • flavoring agents natural flavoring agents (e.g., stevia extracts such as taumartin, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (e.g., saccharin, aspartame, etc.) can be used.
  • natural flavoring agents e.g., stevia extracts such as taumartin, rebaudioside A, glycyrrhizin, etc.
  • synthetic flavoring agents e.g., saccharin, aspartame, etc.
  • the concentrated fraction was dissolved in methanol, and then chromatographed by using methanol as a solvent in Sephadex LH-20. Then, an active fraction having an activity that inhibits IL-6 signaling system was collected and concentrated under reduced pressure.
  • the active fraction was subjected to high performance liquid chromatography (column: C18, flow rate: 1.5 mL / min, 220 nm detection) using a water-methanol (40% methanol) eluting solvent. At this time, the active fraction was separated for 17 minutes of holding time, and dried under reduced pressure to obtain 998 mg of the compound represented by the formula (1).
  • Example 1 the physical and chemical properties of the purely isolated and purified compound were analyzed.
  • ESI-MS electrospray ionization mass spectrometry, Fisons VG Quattro 400 mass spectrometer, USA
  • NMR nuclear magnetic resonance
  • the properties of the compound according to the present invention are attached to the container in a thin film form, and the mass spectrometry (M + H) + of the compound is Measured at 611 m / z, (M + Na) + was measured at 633 m / z molecular weight of the compound represented by the formula (1) was confirmed as 610, the molecular formula was estimated to C 27 H 3 0O 16 (Fig. 1).
  • the compound was dissolved in DMSO d- 6, placed in a 5 mm NMR tube, and hydrogen and carbon nuclear magnetic resonance were measured.
  • the peak of each solvent was measured as an internal standard or based on the peak of TMS (tetramethylsilane).
  • Hydrogen nuclear magnetic resonance spectra (FIG. 2), carbon nuclear magnetic resonance spectra (FIG. 3), DEPT spectra (FIG. 4) were analyzed to examine the structure of the compound.
  • the compound was quercetin 3-glucoside-7-rhamnoside. (As identified by Romani A. et al 2000, J. Agric Food. Chem 48 (9) 4091-4096).
  • pSTAT3-TA-Luc plasmid (Clontech, Palo Alto, Calif.) was used as template.
  • Oligonucleotides [AGAGGGTAAC GGTACC GTGCTTCCCGAA CGTTGCTTCC (contains Kpn I site): SEQ ID NO: 1] and oligonucleotides [GTACGCAAGG CTCGAG CTACGTTCGGGAAGCAACGTTC (contains Xho I site): SEQ ID NO: 2] are respectively a forward primer and a reverse primer ),
  • the STAT3 DNA binding sequence was amplified with a thermocycler.
  • the amplified PCR product was cloned, isolated and inserted into the Kpn I / Xho I site of the pSTAT3-TA-Luc plasmid. And a pSTAT3-TA-Luc6 construct was prepared that enables enhanced STAT3 reporter gene assay over pSTAT-3-TA-Luc, including at least eight copies of the STAT3 DNA binding sequence.
  • IL-6 reactive STAT3 reporter gene analysis was performed on 10% FBS (Foetal Bovine Serum) (v / v), kanamycin sulfate (kanamycin sulfate) and sodium hydrogen carbonate (NaHCO 3 ) in HepG2 cells (ATCC; HB-8065). ) Using a DMEM culture medium containing 2.0g / l, it was incubated at 37 °C 5% CO 2 conditions. HepG2 cells were dispensed at 5 ⁇ 10 4 cells / well in 96 well plates and grown to 80% fusion.
  • FBS Fetal Bovine Serum
  • kanamycin sulfate kanamycin sulfate
  • NaHCO 3 sodium hydrogen carbonate
  • Transfected cells were cultured under 1% BSA / DMEM under nutritional deficiency (serum starvation), treated with hawthorn extract or quercetin 3-glucoside-7-rhamnoside for 1 hour, and then IL-3 was added to Time incubation. Rinse with PBS, add 50 ⁇ l of lysis buffer (promega luciferase assay system) and stir for 1 minute. Then, 30-100 ⁇ l of luciferase assay (promega luciferase assay system) was added thereto and measured in 5 minutes with a luminometer.
  • lysis buffer promega luciferase assay system
  • Table 1 shows the degree of inhibition of IL-6 mediated luciferase at different concentrations of quercetin 3-glucoside-7-rhamnoside (100, 30, 10, 3 or 1 ⁇ g / ml).
  • the concentration of the compound inhibiting by 50% was 43.37 ⁇ g / ml.
  • Rhinovirus (rhinovirus) was used to measure the virus proliferation inhibitory effect on the hawthorn extract or quercetin 3-glucoside-7-rhamnoside obtained in Example 1.
  • the rhinoviruses were infected with HeLa cells to proliferate.
  • HeLa cells were cultured in a 37 ° C. incubator using MEM medium medium containing 10% of pediatric serum.
  • the medium used for virus growth and antiviral activity was culture medium containing 20 mM MgCl 2 in 1% serum.
  • HeLa cells 2 ⁇ 10 4 HeLa cells were placed in each well of a 96 well plate and incubated for 24 hours. After 24 hours, the culture supernatant of each well was removed, and rhinovirus infection solution titrated with TCID 50 was added to each well.
  • test substances were administered to each well such that the final concentration was 100, 10, 1 or 0.1 ⁇ g / ml, respectively.
  • Viral proliferation inhibition for each sample was measured after 48 hours by the SRB assay (Choi et al., 2009). 100 ⁇ l of 70% acetone was added to each well, and then left at ⁇ 20 ° C. for 1 hour and washed several times with distilled water. After drying at room temperature, 100 ⁇ l of 0.4% (w / v) sulforhodamine B (SRB) solution dissolved in 1% (v / v) acetic acid was added and stained for 30 minutes.
  • SRB sulforhodamine B
  • Each treatment group was labeled as a group not treated with virus (A), a group treated only with test substance (B), a group treated with virus only (C), and a group treated with a virus and test substance (D).
  • Comparative cell growth rate (%) (Equation 1) and proliferative inhibitory activity (%) for virus (Equation 2) were calculated for the samples.
  • ethanol extract of the hawthorn, quercetin 3-glucoside-7-rhamnoside, quercetin, rutin, quercetin 3-rhamnoside, quercetin 3-glucoside, genistin, and ribavirin were used as the test material.
  • the values calculated from the mean and standard deviation of the three experimental results under the same conditions are presented.
  • the cytotoxicity of the test material was compared with cells of wells without test material at concentrations of 100, 10, 1 or 0.1 ⁇ g / ml.
  • Table 2 below shows the experimental results of the virus growth inhibitory ability (HRV3 virus in the HeLa cell line) of the hawthorn extract or quercetin 3-glucoside-7-rhamnoside.
  • CPE sample concentration
  • antiviral activity CC 50 IC 50 being.
  • d means that the IC 50 value is not measured within the concentration of the test substance for this experiment due to a maximum inhibition of 50% or less.
  • SD rats used in this test had a temperature of 23 ⁇ 3 ° C, a relative humidity of 50 ⁇ 10%, a lighting time of 12 hours (6 am to 6 pm), the number of ventilations 10 to 20 times / hour and illuminance
  • the animal was bred in the laboratory animal building of Korea Research Institute of Bioscience and Biotechnology, set at ⁇ 300 lux.
  • the test subjects all wore working clothes, hoods, masks and gloves that had been autoclaved (121 ° C., 20 minutes).
  • Rats were housed in polycarbonate shoeboxes (260W ⁇ 410L ⁇ 200Hmm) during the period of acclimation and quarantine, and one by a wire box (205W ⁇ 350L ⁇ 175Hmm) during the administration and observation periods. During the trial period, breeding boxes were identified by labeling with test and animal numbers.
  • the quercetin 3-glucoside-7-rhamnoside compound administered showed no toxicity change to 10 mg / kg in rats, and the minimum lethal dose (LD 50 ) for oral administration was determined to be 10 mg / kg or more.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Pulmonology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Biotechnology (AREA)
  • Botany (AREA)
  • Medical Informatics (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Immunology (AREA)
  • Dermatology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

본 발명은 산자나무 추출물 또는 이로부터 분리된 화합물을 IL-6에 의해 매개되는 질환 또는 라이노바이러스 감염성 질환의 예방 또는 치료에 사용하는 용도에 관한 것으로, 보다 자세하게는 산자나무 추출물 또는 이로부터 분리된 퀘세틴 3-글루코사이드-7-람노사이드를 이용하는, 특이적으로 IL-6에 의해 유도되는 신호전달체계를 저해하여 IL-6에 의해 매개되는 질환을 예방하고 치료할 수 있음은 물론, 라이노바이러스의 감염성 질환을 예방하고 치료할 수 있는 방법 및 조성물에 관한 것이다.

Description

IL-6에 의해 매개되는 질환 또는 라이노바이러스 감염성 질환의 예방 또는 치료를 위한 방법 및 조성물
본 발명은 산자나무 추출물 또는 이로부터 분리된 퀘세틴 3-글루코사이드-7-람노사이드를 이용하여, 특이적으로 IL-6에 의해 유도되는 신호전달체계를 저해하여 IL-6에 의해 매개되는 질환 또는 라이노바이러스 감염성 질환의 예방 또는 치료를 위한 방법 및 조성물에 관한 것이다.
인간 라이노바이러스(HRV)는 일반 감기(common cold)를 유발하는 바이러스로서, 독감(인플루엔자) 바이러스와는 달리, 코막힘, 콧물, 재채기, 기침, 인후통, 오한, 두통, 권태감 등의 증상을 유발하고 천식, 만성기관지염 등의 급성 호흡질환을 유발시키거나 악화시키기도 하는 것으로 알려져 있다. 또한, 폐렴, 축농증, 중이염을 일으키기도 한다. 또한, 인간 라이노바이러스 양성 환자는 폐기능 저하, 호산구와 림프구수 증가, 기관지 점막에 호산구가 침윤되는 등의 증상이 나타나는 것으로 알려져 있다. 인간 라이노바이러스 양성과 말초혈중의 많은 백혈구의 수, 많은 다형핵 림프구의 수 사이에 각각 관련성이 나타났다.
특히 인간 라이노바이러스와 천식의 관계가 알려져 있으며, 천식 환자와 비천식 환자 각각에서 기관지 점막 생검 표본을 채취하여 비교한 결과, 하기도 조직에서 인간 라이노바이러스가 발견되는 빈도는 비천식군에 비해 천식군에서 유의하게 높았으며, 인간 라이노바이러스의 존재와 천식의 임상적 중증도에도 상관관계가 있고, 인간 라이노바이러스가 하기도의 만성 염증에 관여하고 있다는 보고가 있다.
구체적으로, 천식군 30례(이 중, 아스피린 감수성 천식 7례)와 대조군 23례에서 기관지 점막 표본을 채취하고, 정밀도 높은 검사법인 in situ 역전사 폴리머라제 연쇄반응(RT-PCR)을 이용하여 분석한 결과, 인간 라이노바이러스 감염률은 대조군이 22%인데 비해 천식군은 73%로 양쪽군 사이에 통계학적으로 유의차(P<0.001)가 나타났다. 이 검사법에서는 표본의 염색 패턴이 정확히 2종류로 나뉘었는데, 염색 범위가 점막 표면에 한정되고 윤곽이 뚜렷한 점 모양인 '국한'형과 표본 전체에 나타나고 일부에 한정되지 않는 '확산'형이다.
최근 인간 라이노바이러스의 유전자지도가 완성되었다고 보고되었다. 미국 위슨콘신 대학 메디슨, 메릴랜드대학, 크레이그 벤터연구소가 공동연구한 결실로 인간 라이노바이러스 99종의 변종의 유전자 지도를 완성하였다. 인간 라이노바이러스는 체내에서 2개의 변종이 동시에 한 환자를 감염시켜 환자의 체내에서 유전물질을 서로 교환하여 완전히 새로운 변종을 만드는 등 의외로 복잡하다는 것을 알아내었다. 결국 인간 라이노바이러스는 크게 A, B, C 그룹으로 나눌 수 있고, 그 중에서 C 그룹은 폐 말단까지 침투한다고 보고되었다. 바이러스 변종이 많아 변종 하나하나에 대한 백신을 만드는 것은 어렵지만, 바이러스 내부성분은 변종에 관계없이 매우 비슷하다는 사실을 밝혀 공통적인 요인을 타겟으로 감기치료제의 개발가능성을 시사하였다.
한편, 인간 라이노바이러스에 의하여 유발된 호흡기 질환을 가진 환자들에서 증상의 악화는 염증성 사이토카인인 인터루킨-6 (IL-6) 의 농도 상승과 연관되어 있다.
사이토카인은 생체 내 여러 종류의 세포에서 분비하여 세포 증식, 분화, 활성화 등에 관여하는 폴리펩타이드나 글리코프로테인으로 면역 및 염증반응에 중요한 역할을 한다. 여러 종류의 자가 면역질환 및 염증 질환들의 증상은 무척 다양하지만 병인기전의 공통점 중의 하나로 면역 반응이나 조직의 손상, 회복을 조절하는 여러 사이토카인의 생성을 들 수 있다. 염증 질환의 병변조직에서 염증성 사이토카인인 IL-1α, IL-β, TNFα, IL-6, IL-12 등의 발현이 증가 되어 있다. 또한, 루푸스 환자의 혈청에서는 TNFα, IL-1, IL-6, IL-10, IFNα, IFNγ 등이 증가되어있으며, 쉐그랜 증후군 환자의 타액선에서도 TNFα, IL-1, IL-2, IL-6, IL-10, TGFβ의 발현이 보고되었다.
특히, IL-6는 대표적인 염증성 질환, 자가 면역질환 및 암세포에서도 중요하게 관여하는 사이토카인으로서 여러 장기에서 다양한 기능을 수행한다. IL-6는 많은 세포 종류에서 발현됨이 알려져 있으며, 대표적으로 면역반응, 염증, 조혈과정, 세포의 증식 및 분화 등 다양한 생물학적 기능에 관련되어 있다(Naka 등 2002). IL-6의 작용은 수용체에 의하여 매개되는데 2가지 종류의 수용체, 즉 IL-6에 특이한 수용체인 IL-6R과 IL-6 패밀리의 공통수용체인 gp130가 IL-6의 복합수용체로서 작용한다. IL-6은 먼저 IL-6R과 결합하게 되고, IL-6과 IL-6R의 복합체는 다시 2개의 gp130과 결합하여 활성의 수용체 복합체를 형성하여 세포 내로의 신호전달을 개시한다. 야누스 키나제 2(Janus Kinases 2, JAK2)는 인산전이(transphosphorylation)에 의하여 활성화된다. 활성화된 JAK2에 의해 수용체 세포질 영역(cytoplasmic domains)의 여러 티로신 잔기(tyrosine residues)가 인산화(phosphorylation)되고, 이것은 SH2나 다른 포스포티로신 바인딩 모티프(phosphotyrosine binding motif)를 가지고 있는 STAT3(signal transducers and activators of transcription 3)와 같은 세포질 내 단백질의 도킹 사이트(docking site) 역할을 하게 된다. 수용체의 세포질 영역에 결합한 STAT3는 JAK2에 의해 인산화된 후 수용체에서 떨어져 나온다. 활성화된 STAT3들은 세포질 내에서 서로 결합하여 호모다이머(homodimer) 또는 헤테로다이머(heterodimer)를 이룬 후 핵(nucleus) 내로 들어가 타겟 유전자의 인식 서열(recognition sequence)에 결합하여 전사(transcription)를 증가시킨다(Levy, D.E., 등, Nat Rev Mol Cell Biol, 2002, 3, 651-62, Darnell, J.E., J.r., Science, 1997, 277, 1630-1635).
특히, IL-6 시그널링 패쓰웨이(signaling pathway)의 중간 전달자인 STAT3는 골수종, 유방 암종, 전립선 암, 뇌 종양, 두경부 암종, 흑색종, 백혈병 및 림프종, 특히 만성 골수성 백혈병 및 다발성 골수종을 포함하여 여러 형태의 암에 관여하는 것으로 보고되었다(Niu 등, Cancer Res., 1999, 59, 5059-5063). 쥐 및 인간의 전립선 암 양쪽에서 유래된 세포들은 구조적으로 활성화된 STAT3을 갖는 것으로 밝혀졌으며, STAT3는 일부 급성 백혈병(Gouilleux-Gruart, V. 등, Leuk.Lymphoma, 1997, 28, 83-88) 및 T 세포 림프종(Yu,C.L.등, J.Immunol., 1997, 159, 5206-5210)에서 구조적으로 활성화되는 것으로 밝혀졌다. 흥미롭게도, STAT3은 만성 림프성 백혈병에서 세린 잔기 위에 구조적으로 인산화 되는 것으로 밝혀졌다(Frank,D.A. 등, J.Clin.Invest., 1997, 100, 3140-3148). STAT3은 다발성 골수종을 가진 환자로부터의 골수 단핵 세포 및 배양액 양쪽 모두에서, 골수종 종양 세포에서 구조적으로 활성인 것으로 밝혀졌다. 이러한 세포는 Fas-매개 세포고사(apoptosis)에 내성이고 높은 수준의 Bcl-xL을 발현한다. STAT3 시그널링은 세포고사에 대한 내성을 부여함으로써 골수종 종양 세포의 생존을 위해 필수적인 것으로 밝혀졌다(Catlett-Falcone,R. 등, Immunity, 1999, 10, 105-115).
산자나무(Hippophae rhamnoides)는 보리수과의 식물로서, 버드나무를 닮은 관목으로 암수가 따로 자란다. 동경 2-69도와 북위 27-69도 내의 여러 지역에서 자생하는데, 산자나무는 일반명으로 씨벅턴(Seabuckthorn)으로 불리고, 키가 2.5m까지 자라며, 잎은 너비가 좁고 아랫면이 은색이다. 열매는 공 모양이고 오렌지 빛이 도는 노란색이며 지름이 8㎜ 정도이다. 영국 동부와 남동부 해안의 모래언덕에 많으며, 유럽과 아시아의 산악지대에도 널리 퍼져 있다. 중국의 내몽고지역과 러시아의 시베리아지역 캐나다의 오지 등 저온이며 척박한 지역에서도 서식하는 식물이다.
여러 연구자들에 의하여 산자나무의 유효성분에 관련된 연구가 많이 진행되어 왔다. 특히, 산자나무 열매에서 각종 천연 바타민(A, B, C, E, P, K)의 함량이 정량, 정성분석되었으며, 각종 아미노산들의 함량 및 각종 유용금속류의 함유량이 분석되었다. 또한, 각종 영양소의 함유량에 관한 연구와 산자나무 열매를 식품으로 이용하기 위한 기초자료로 열매관련 물성 연구가 진행되었다(J. Agric. Food Chem., Vol.47, pp 3480~3488). 그리고 중국을 중심으로 하여, 산자나무 Hippophae rhamnoides ssp. sinensis 15종, Hippophae rhamnoides ssp. yunnanensis 7종, Hippophae rhamnoides ssp. wolongensis 5종, Hippophae rhamnoides ssp. stellatopilosa 4종, Hippophae rhamnoides ssp. tibetana 3종에서 유래한 여러 가지 플라보노이드들을 HPLC 표준화작업에 의해 12종의 플라보노이드로 분류하여 이들의 다양성이 보고되었다(J. of Chromatography A, Chu Chen, 1154, pp 250~259). 그리고 중국을 중심으로 여러 지역에서 자생하고 있는 각종 산자나무들로부터 성분 분리연구를 수행하여 분리된 12종의 플라보노이드들의 함량이 비교되었으며, 퀘세틴 3-O-소포로사이드-7-람노사이드, 퀘세틴 3-O-루티노사이드, 퀘세틴 3-O-글루코사이드, 퀘세틴, 캄페롤 3-O-소포로사이드-7-람노사이드, 캄페롤 7-O-람노사이드, 캄페롤, 이소르함네틴, 이소르함네틴 3-O-소포로사이드-7-람노사이드, 이소르함네틴 3-O-루티노사이드, 이소르함네틴 3-O-글루코사이드, 이소르함네틴 3-O-글루코사이드-7-람노사이드에 대하여 보고되었다.
식물 유래 플라보노이드나 당화 플라보노이드의 약리 활성에 대해서는 많이 알려져 있다(Journal of antimicrobial chemotherapy, L. C. Chiang, W. Chiang, M. C. Liu and C. C. Lin, Vol. 52, pp 194~198, 2003). 플라보노이드는 헤르페스 바이러스나 아데노바이러스 등에 대하여 항바이러스 효과가 있으며, 로부스타플라본(robustaflavone) 등과 같은 바이플라보노이드계 화합물는 인플루엔자 바이러스 등에 저해 효과가 있는 것으로 보고되고 있으나(Planta Medica, Vol. 65, pp 120~125), 항바이러스 효과가 탁월하게 나타나지는 않았다.
이에, 본 발명자는 라이노바이러스의 감염성 질환을 예방 또는 치료할 수 있고 IL-6 신호전달체계를 저해하여 IL-6에 의해 매개되는 질환을 효과적으로 예방 또는 치료할 수 있는 제제를 개발하기 위해 노력한 결과, 산자나무 추출물 또는 이로부터 분리된 퀘세틴 3-글루코사이드-7-람노사이드 화합물이 항바이러스 활성 및 IL-6 신호전달체계를 저해하는 활성을 가지고 있어, 상기와 같은 질환을 효과적으로 예방 또는 치료할 수 있음을 확인하고 본 발명을 완성하였다.
본 발명은 산자나무 추출물 또는 이로부터 분리된 퀘세틴 3-글루코사이드-7-람노사이드를 이용하여, 특이적으로 IL-6에 의해 유도되는 신호전달체계를 저해하여 IL-6에 의해 매개되는 질환 또는 라이노바이러스 감염성 질환의 예방 또는 치료를 위한 방법 및 조성물을 제공함에 본 발명의 목적이 있다.
하나의 양태로서, 본 발명은 산자나무(Hippophae rhamnoides) 추출물의 치료학적으로 유효한 양을 환자에게 투여하는 단계를 포함하는, IL-6 에 의해 매개되는 질환을 치료하는 방법을 제공한다.
또한 하나의 양태로서, 본 발명은 하기 화학식 1로 표시되는 퀘세틴 3-글루코사이드-7-람노사이드의 치료학적으로 유효한 양을 환자에게 투여하는 단계를 포함하는, IL-6 에 의해 매개되는 질환을 치료하는 방법을 제공한다.
[화학식 1]
Figure PCTKR2010003791-appb-I000001
다른 하나의 양태로서, 본 발명은 산자나무(Hippophae rhamnoides) 추출물의 치료학적으로 유효한 양을 환자에게 투여하는 단계를 포함하는, 라이노바이러스 감염성 질환을 치료하는 방법을 제공한다.
또한 다른 하나의 양태로서, 본 발명은 상기 화학식 1로 표시되는 퀘세틴 3-글루코사이드-7-람노사이드의 치료학적으로 유효한 양을 환자에게 투여하는 단계를 포함하는, 라이노바이러스 감염성 질환을 치료하는 방법을 제공한다.
하나의 양태로서, 본 발명은 산자나무(Hippophae rhamnoides) 추출물을 포함하는 IL-6에 의해 매개되는 질환의 예방 또는 치료용 조성물을 제공한다.
또한 하나의 양태로서, 본 발명은 상기 화학식 1로 표시되는 퀘세틴 3-글루코사이드-7-람노사이드를 유효성분으로 포함하는 IL-6에 의해 매개되는 질환의 예방 또는 치료용 조성물을 제공한다.
다른 하나의 양태로서, 본 발명은 산자나무(Hippophae rhamnoides) 추출물을 포함하는 라이노바이러스 감염성 질환의 예방 또는 치료용 조성물을 제공한다.
또한 다른 하나의 양태로서, 본 발명은 상기 화학식 1로 표시되는 퀘세틴 3-글루코사이드-7-람노사이드를 유효성분으로 포함하는 라이노바이러스 감염성 질환의 예방 또는 치료를 위한 조성물을 제공한다.
본 발명의 치료 방법 및 조성물은 산자나무 추출물 또는 이로부터 분리된 퀘세틴 3-글루코사이드-7-람노사이드를 이용하여, 염증성질환, 자가면역질환 또는 암을 유발하는 신호전달과정의 중요한 매개자로 작용하는 IL-6 수용체의 결합을 억제하여 IL-6에 의해 매개되는 질환을 예방하고 치료할 수 있는 효과가 있다.
또한, 본 발명의 치료 방법 및 조성물은 산자나무 추출물 또는 이로부터 분리된 퀘세틴 3-글루코사이드-7-람노사이드를 이용하여, 라이노바이러스에 대한 항바이러스 효과에 의해 라이노바이러스 감염성 질환의 예방 또는 치료의 효과를 가짐은 물론 IL-6 신호전달체계 저해에 의해 라이노바이러스 감염성 질환의 악화를 억제할 수 있다.
또한, 본 발명의 화합물은 단백질이 아닌 저분자 화합물이기 때문에, 기존의 의약품으로 사용되는 단백질의 중화항체보다 의약산업에 이용성이 크다는 효과가 있다.
도 1은 본 발명에 따른 퀘세틴 3-글루코사이드-7-람노사이드의 분자량측정 스펙트럼이다.
도 2는 본 발명에 따른 퀘세틴 3-글루코사이드-7-람노사이드의 수소핵자기공명 스펙트럼(DMSO d-6, 300MHz)을 나타낸 것이다.
도 3은 본 발명에 따른 퀘세틴 3-글루코사이드-7-람노사이드의 탄소핵자기공명 스펙트럼(DMSO d-6, 75MHz)을 나타낸 것이다.
도 4는 본 발명에 따른 퀘세틴 3-글루코사이드-7-람노사이드의 DEPT 스펙트럼(DMSO d-6, 75MHz)을 나타낸 것이다.
하나의 양태로서, 본 발명은 산자나무(Hippophae rhamnoides) 추출물의 치료학적으로 유효한 양을 환자에게 투여하는 단계를 포함하는, IL-6 에 의해 매개되는 질환을 치료하는 방법을 제공한다.
다른 하나의 양태로서, 본 발명은 산자나무(Hippophae rhamnoides) 추출물을 포함하는 IL-6에 의해 매개되는 질환의 예방 또는 치료용 조성물을 제공한다.
본 발명의 상기 산자나무 추출물은 바람직하게 산자나무 열매 또는 잎의 추출물일 수 있으며, 이에 제한되는 것은 아니다.
본 발명에서, 상기 산자나무 추출물은 물, 메탄올, 에탄올, 부탄올과 같은 C1 내지 C4의 저급알콜 또는 이들의 혼합용매로 추출한 것일 수 있다. 바람직하게는 상기 산자나무 추출물은 에탄올로 추출한 것이며, 가장 바람직하게는 상기 산자나무 추출물은 10 내지 100% 에탄올 추출물이다. 또한, 본 발명의 상기 추출물은 추출처리에 의해 얻어지는 추출액, 추출액의 희석액 또는 농축액, 추출액을 건조하여 얻어지는 건조물 및 이들 조정제물 또는 정제물 중 어느 하나 이상을 포함할 수 있다.
다른 하나의 양태로서, 본 발명은 하기 화학식 1로 표시되는 퀘세틴 3-글루코사이드-7-람노사이드의 치료학적으로 유효한 양을 환자에게 투여하는 단계를 포함하는, IL-6 에 의해 매개되는 질환을 치료하는 방법을 제공한다.
화학식 1
Figure PCTKR2010003791-appb-C000001
또다른 하나의 양태로서, 본 발명은 상기 화학식 1로 표시되는 퀘세틴 3-글루코사이드-7-람노사이드(quercetin 3-O-glucoside-7-rhamniside)를 유효성분으로 포함하는 IL-6에 의해 매개되는 질환의 예방 또는 치료용 조성물을 제공한다.
본 발명의 퀘세틴 3-글루코사이드-7-람노사이드 화합물은 산자나무로부터 추출, 분리, 정제하여 얻는 것이 바람직하지만, 이에 제한되지는 않는다. 즉, 상기 화합물은 다른 원료로부터 추출, 분리, 정제하여 얻을 수도 있으며, 공지의 합성방법으로 제조될 수도 있고, 시판되는 시약으로도 사용할 수 있다.
한편, 본 발명은 또 다른 하나의 양태로서, 산자나무로부터 퀘세틴 3-글루코사이드-7-람노사이드를 분리, 정제하는 방법을 제공한다. 분리, 정제하는 방법은 구체적으로 다음과 같다.
우선, 산자나무로부터 에탄올 추출물을 제조하고, 감압농축하여 분획물을 수득한다. 그리고 상기 분획물에 대해 메탄올을 용매로 사용하여 크로마토그래피를 수행함으로써 IL-6 신호전달체계 저해활성을 갖는 활성분획을 수득한다. 마지막으로 상기 활성분획을 고속액체크로마토그래피로 분리하여 퀘세틴 3-글루코사이드-7-람노사이드를 얻는다.
본 발명의 상기 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드는 IL-6 신호전달체계를 저해하였다. 따라서, IL-6에 의해 매개되는 질환의 예방 또는 치료하는데 효과가 있다.
IL-6는 대표적인 염증성 질환, 자가 면역질환 및 암세포에서도 중요하게 관여하는 사이토카인으로 여러 장기에서 다양한 기능을 수행한다. IL-6는 많은 세포 종류에서 발현됨이 알려져 있으며, 대표적으로 면역반응, 염증, 조혈과정, 세포의 증식 및 분화 등 다양한 생물학적 기능에 관련되어 있다.
본 발명에서 “IL-6에 의해 매개되는 질환”은 염증성질환, 자가면역질환 및 암일 수 있으며, 구체적으로는 천식, 건선, 아토피, 골다공증, 루푸스, 크론씨병, 혈관협착, 암전이, 이식거부, 관절염, 알쯔하이머, 골수종, 유방암종, 전립선암, 뇌종양, 두경부암종, 흑색종, 백혈병, 다발성 골수종 중 어느 하나 이상일 수 있다. 그러나 이에 한정하는 것은 아니고, 통상적으로 주지된 염증성질환, 자가면역질환 또는 암에 관련된 질환들도 본 발명의 범위에 포함될 수 있다.
또 다른 하나의 양태로서, 본 발명은 상기 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드를 포함하는, 라이노바이러스 감염성 질환의 예방 또는 치료용 조성물을 제공한다.
또다른 하나의 양태로서, 본 발명은 상기 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드의 치료학적으로 유효한 양을 환자에게 투여하는 단계를 포함하는, 라이노바이러스 감염성 질환을 치료하는 방법을 제공한다.
본 발명의 상기 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드는 특히 라이노바이러스의 증식을 억제할 수 있을 뿐만 아니라, IL-6 신호전달체계 저해에 의해 라이노바이러스 감염성 질환의 악화를 억제할 수 있다.
본 발명에서 “라이노바이러스 감염성 질환”은 라이노바이러스에 의한 감염성 질환을 포함한다. 상기 질환은 일반 감기(common cold), 천식, 만성기관지염 등의 급성 호흡질환, 폐렴, 축농증, 중이염을 포함하며, 감기의 증상은 코막힘, 콧물, 재채기, 기침, 인후통, 오한, 두통, 권태감 등의 증상 중 하나 또는 그 이상을 포함한다.
본 발명에서 “질환의 예방 또는 치료”란, 상기 질환의 예방, 완전한 또는 부분적인 치료를 포함한다. 이는 또한 증상의 감소, 증상의 개선, 증상의 고통 경감, 질환의 발생율 감소를 포함한다.
본 발명의 구체적인 실시예에서 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드는 IL-6 반응성 STAT3 리포터 유전자 분석 결과, 각 농도에서 농도 의존적으로 IL-6 매개성 리포터 유전자 발현을 저해하였으며, 50% 저해하는 농도는 43.37 ㎍/㎖ 이었다.
본 발명의 구체적인 실시예에서 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드는 비교 세포 성장률(%)(수학식 1)과 바이러스에 대한 증식억제능(%)(수학식 2) 계산 결과, 비교약제로 사용한 제니스틴(Genistin)과 리바비린(Ribavirin)보다 산자나무 추출물에서 25배 이상, 순수 분리된 활성물질 퀘세틴 3-글루코사이드-7-람노사이드는 180배 이상의 바이러스 증식 억제능이 나타났다.
또한, 본 발명의 구체적인 실시예에서 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드를 투여한 동물에서는 주목할 만한 임상증상이 나타나거나 폐사된 동물은 관찰되지 않았다. 또한, 체중변화, 혈액검사, 혈액생화학적 검사, 부검소견 등에서도 독성변화는 관찰되지 않았다.
본 발명의 상기 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드를 포함하는 조성물은 약제학적 조성물일 수 있다.
본 발명의 상기 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드를 투여할 때, 유효용량은 일반적으로 성인환자 체중 1kg 당 1 내지 100mg/일이고, 바람직하게는 5 내지 20mg/일이다. 특정 환자에 대한 투여용량 수준은 성별, 연령, 건강상태, 식이, 투여시간, 투여방법, 약제혼합 및 질환의 중증도에 따라 적절하게 변화될 수 있다. 따라서, 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다.
본 발명에서, 상기 퀘세틴 3-글루코사이드-7-람노사이드 화합물은 약학적으로 허용 가능한 염의 형태도로 사용될 수 있으며, 통상의 방법에 의해 제조되는 모든 염, 수화물 및 용매화물이 포함된다.
염으로는 약학적으로 허용가능한 유리산(free acid)에 의해 형성된 산부가염이 유용하다. 산 부가염은 통상의 방법, 예를 들어 화합물을 과량의 산 수용액에 용해시키고, 이 염을 수혼화성 유기 용매(예를 들어, 메탄올, 에탄올, 아세톤 또는 아세토니트릴)를 사용하여 침전시켜서 제조한다. 동 몰량의 화합물 및 물 중의 산 또는 알콜(예를 들어, 글리콜 모노메틸에테르)을 가열하고, 이어서 상기 혼합물을 증발시켜 건조시키거나, 또는 석출된 염을 흡인 여과시킬 수 있다.
이때, 유리산으로는 무기산과 유기산을 사용할 수 있는데, 무기산으로는 염산, 브롬산, 인산, 황산, 질산, 주석산 등을 사용할 수 있고, 유기산으로는 구연산(citric acid), 초산, 젖산, 주석산(tartaric acid), 말레인산, 푸마르산(fumaric acid), 포름산, 프로피온산(propionic acid), 옥살산, 트리플루오로아세트산, 벤조산, 글루콘산, 메탄술폰산, 글리콜산, 숙신산, 4-톨루엔술폰산, 갈룩투론산, 엠본산, 글루탐산 또는 아스파르트산 등을 사용할 수 있으며, 이들에 제한되지 않는다.
또한, 염기를 사용하여 약학적으로 허용가능한 금속염을 만들 수 있다. 알칼리 금속 또는 알칼리 토금속염은, 예를 들어 화합물을 과량의 알칼리 금속 수산화물 또는 알칼리 토금속 수산화물 용액 중에 용해시키고, 비용해 화합물 염을 여과한 후 여액을 증발, 건조시켜 얻는다. 이때, 금속염으로서는 특히 나트륨, 칼륨 또는 칼슘염을 제조하는 것이 제약상 적합하나 이들에 제한되는 것은 아니다. 또한, 이에 대응하는 은염은 알칼리 금속 또는 알칼리 토금속 염을 적당한 은염(예를 들어, 질산은)과 반응시켜 얻을 수 있다.
본 발명에 따른 약제 조성물은 임상 투여시에 경구 또는 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제 및 계면활성제 등의 희석제 및 부형제를 사용하여 조제한다.
경구투여를 위한 고형제제에는 정제, 트로키제(troches), 로렌지(lozenge), 수용성 또는 유성현탁액, 조제분말 또는 과립, 에멀젼, 하드 또는 소프트 캡슐, 시럽 또는 엘릭실제(elixirs) 등이 포함된다. 정제 및 캡슐 등의 제형으로 제제하기 위해 락토오스, 사카로오스, 솔비톨, 만니톨, 전분, 아밀로펙틴, 셀룰로오스 또는 젤라틴과 같은 결합제; 디칼슘 포스페이트와 같은 부형제; 옥수수 전분 또는 고구마 전분과 같은 붕괴제; 스테아린산 마그네슘, 스테아린산 칼슘,스테아릴푸마르산 나트륨 또는 폴리에틸렌글리콜 왁스와 같은 윤활유가 함유된다. 캡슐 제형의 경우, 상기에서 언급한 물질 이외에도 지방유와 같은 액체 담체를 함유한다.
또한, 비경구 투여는 피하주사, 정맥주사, 근육 내 주사 또는 흉부 내주사 주입방식일 수 있다. 비경구 투여용 제형으로 제제화하기 위해서, 상기 화학식 1의 화합물을 안정제, 완충제, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제 및 좌제 등을 혼합하여 용액 또는 현탁액으로 제조하고, 이를 앰플이나 바이알의 단위 투여형으로 제제한다. 비수성용제 및 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜 및 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.
본 발명의 상기 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드를 포함하는 조성물은 식품 조성물일 수 있다.
식품 제조 시에 통상적으로 첨가되는 성분은 예를 들어, 단백질, 탄수화물, 지방, 영양소, 조미제 및 향미제를 포함한다. 상술한 탄수화물의 예는 모노사카라이드(예를 들어, 포도당, 과당 등), 디사카라이드(예를 들어, 말토스, 슈크로스, 올리고당 등) 및 폴리사카라이드(예를 들어, 덱스트린, 사이클로덱스트린 등)와 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 향미제로서 천연 향미제(예를 들어, 타우마틴, 레바우디오시드 A, 글리시르히진 등과 같은 스테비아 추출물) 및 합성 향미제(예를 들어, 사카린, 아스파르탐 등)를 사용할 수 있다.
본 명세서 및 청구범위에 사용된 용어나 단어는 통상적이거나 사전적인 의미로 한정해서 해석되어서는 아니되며, 발명자는 그 자신의 발명을 가장 최선의 방법으로 설명하기 위해 용어의 개념을 적절하게 정의할 수 있다는 원칙에 입각하여 본 발명의 기술적 사상에 부합하는 의미와 개념으로 해석되어야만 한다.
따라서, 본 명세서에 기재된 실시예와 도면에 도시된 구성은 본 발명의 가장 바람직한 일 실시예에 불과할 뿐이고 본 발명의 기술적 사상을 모두 대변하는 것은 아니므로, 본 출원시점에 있어서 이들을 대체할 수 있는 다양한 균등물과 변형예들이 있을 수 있음을 이해하여야 한다.
이하, 본 발명은 다음 실시예에 의거하여 더욱 상세히 설명하겠는바, 본 발명이 이에 한정되는 것은 아니다.
실시예 1 : 퀘세틴 3-글루코사이드-7-람노사이드의 분리 및 정제
건조시킨 산자나무 열매 1kg에 100% 에탄올 4L를 가하고, 빛이 차단된 실온에서 72시간 동안 추출하여 에탄올 추출물을 제조한 후, 이를 감압농축하여 분획물을 수득하였다. 실제로 동물실험을 하기 위한 활성물질을 추출할 때에는 95% 주정을 이용하여 서늘하고 어두운 장소에서 72시간 동안 추출한 후, 감압농축하여 실험에 사용하였다.
순수한 활성물질을 분리하기 위하여, 상기 농축된 분획물을 메탄올에 용해시킨 후, 세파덱스 LH-20(sephadex LH-20)에 메탄올을 용매로 사용하여 크로마토그래피를 수행하였다. 그런 다음 IL-6 신호전달체계를 저해하는 활성을 갖는 활성분획을 모아 감압농축하였다.
상기 활성분획을 물-메탄올(40% 메탄올) 용출용매를 이용하여 고속 액체 크로마토그래피(컬럼: C18, 유속: 1.5㎖/분, 220nm 검출)를 수행하였다. 이때, 유지시간 17분대에 활성분획을 분리하고, 감압건조하여 화학식 1로 표시되는 화합물 998㎎을 얻었다.
실시예 2 : 퀘세틴 3-글루코사이드-7-람노사이드의 이화학적 특성 분석
상기 실시예 1에서 순수하게 분리, 정제된 화합물의 이화학적인 특성을 분석하였다. 상기 화합물의 분자량을 측정하기 위하여 ESI-MS(electrospray ionization mass spectrometry, Fisons VG Quattro 400 mass spectrometer, USA)를 이용하였으며, 구조를 규명하기 위하여 핵자기공명(NMR) 방법을 이용하였다.
상기 화합물에 대하여 물질의 성상, 분자량, 분자식 및 질량을 분석한 결과, 본 발명에 따른 화합물의 이화학적인 특성으로 성상은 용기에 박막형태로 붙어있고, 화합물의 질량분석치(M+H)+는 611m/z로 측정되었으며, (M+Na)+는 633m/z로 측정되어 화학식 1로 표시되는 화합물의 분자량은 610으로 확인되었으며, 분자식은 C27H30O16로 추정되었다(도 1).
상기 화합물을 DMSO d-6에 녹여 5㎜의 NMR 튜브 내에 넣고, 수소 및 탄소 핵자기공명을 측정하였다. 각 용매의 피이크를 내부 표준물질로 하거나 TMS (tetramethylsilane)의 피이크를 기준으로 하여 측정하였다.
수소 핵자기공명 스펙트럼(도 2), 탄소 핵자기공명 스펙트럼(도 3), DEPT 스펙트럼(도 4)을 분석하여 상기 화합물의 구조를 조사한 결과, 상기 화합물은 퀘세틴 3-글루코사이드-7-람노사이드(Romani A. et al 2000, J. Agric Food. Chem 48(9) 4091-4096에서 규명)와 일치하였다.
실시예 3 : 산자나무 추출물 및 퀘세틴 3-글루코사이드-7-람노사이드의 IL-6 저해활성 검정
pSTAT3-TA-Luc 플라스미드(Clontech, Palo Alto, CA)를 주형으로 사용하였다. 올리고뉴클레오티드 [AGAGGGTAACGGTACCGTGCTTCCCGAA CGTTGCTTCC (Kpn I 사이트 함유): 서열번호 1]와 올리고뉴클레오티드 [GTACGCAAGG CTCGAGCTACGTTCGGGAAGCAACGTTC (Xho I 사이트 함유): 서열번호 2]를 각각 정방향 프라이머(forward primer)와 역방향 프라이머(reverse primer)로 사용하여, STAT3 DNA 바인딩 시퀀스를 써모싸이클러(thermocycler)로 증폭하였다.
증폭한 PCR 생성물을 클로닝하고, 분리한 다음 pSTAT3-TA-Luc 플라스미드의 Kpn I/Xho I 사이트에 삽입하였다. 그리고 적어도 8개의 STAT3 DNA 바인딩 시퀀스 카피를 포함하여 pSTAT-3-TA-Luc보다 향상된 STAT3 리포터 유전자 분석(reporter gene assay)을 가능하게 하는 pSTAT3-TA-Luc6 컨스트럭트(construct)를 제조하였다.
IL-6 반응성 STAT3 리포터 유전자 분석은 HepG2 세포(ATCC;HB-8065)에 10% FBS(Foetal Bovine Serum)(v/v), 카나마이신 설페이트(kanamycin sulfate) 60.0㎎/ℓ 및 탄산수소나트륨(NaHCO3) 2.0g/ℓ가 포함된 DMEM 배양액을 사용하여, 37℃에서 5% CO2의 조건으로 배양하였다. 96웰 플레이트에 5×104셀/웰로 HepG2 세포를 분주하여 80% 융합되도록 키웠다. 이후 무혈청 배지 50㎕로 교환하고, 0.1㎍ pSTAT3-TA-Luc6 컨스트럭트와 0.3㎕ 리포펙타민(lipofectamin reagent)의 혼합액을 각 웰에 첨가하여 3시간 반응시킴으로써 pSTAT3-TA-Luc6 컨스트럭트를 트랜스펙션(분리된 핵산의 세포에의 감염)시켰다.
이후, 배지를 깨끗한 배양배지 200㎕로 바꾸어 24시간 배양하여 일시적인 트렌스펙션을 마무리하였다. 트렌스펙션된 세포를 1% BSA/DMEM으로 영양이 부족한 상태에서 배양(serum starvation)하고, 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드를 1시간 처리한 후 IL-6를 첨가하여 3시간 배양하였다. PBS로 씻어내고, 라이시스 버퍼(promega luciferase assay system) 50㎕를 넣고, 1분간 교반해주었다. 그리고 여기에 30 내지 100㎕의 루시페라아제 물질(promega luciferase assay system)을 넣고 루미노미터(luminometer)로 5분 안에 측정하였다.
하기 표 1에 퀘세틴 3-글루코사이드-7-람노사이드의 각기 다른 농도(100, 30, 10, 3 또는 1㎍/㎖)에 대해 IL-6 매개성 루시페라아제가 저해되는 정도를 나타내었다.
표 1
시험물질 농도(㎍/㎖) 평균(RLU) ± 표준편차(stdv) 억제률(%)
퀘세틴 3-글루코사이드-7-람노사이드 100 13922.12 26.9 56.37
30 19528.98 993.5 35.56
10 22723.56 1133.5 23.71
3 25679.02 284.3 12.75
1 29048.29 1830.0 0.24
상기 표 1을 통해 확인할 수 있듯이, 실시예 1에서 수득한 퀘세틴 3-글루코사이드-7-람노사이드를 처리한 경우, 상기 화합물은 각 농도에서 농도 의존적으로 IL-6 매개성 루시페라아제를 저해하였으며, 계산에 의하면 50% 저해하는 상기 화합물의 농도는 43.37㎍/㎖이었다.
실시예 4 : 산자나무 추출물 및 퀘세틴 3-글루코사이드-7-람노사이드의 바이러스 증식 억제능 평가
상기 실시예 1에서 얻은 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드에 대한 바이러스 증식억제능을 측정하기 위해 라이노바이러스(rhinovirus)를 사용하였다.
라이노바이러스를 HeLa 세포에 감염시켜 증식배양시켰는데, HeLa 세포는 소아태아혈청이 10% 포함된 MEM medium 배지를 사용하여, 37℃ 배양기에서 배양하였다. 그리고 바이러스 증식배양 및 항바이러스능 측정에 사용된 배지는 1% 혈청에 20mM의 MgCl2가 포함된 배양배지를 사용하였다.
HeLa 세포 2×104개를 96웰 플레이트의 각 웰에 넣고 24시간 배양하였다. 24시간 후에 각 웰의 배양 상등액을 제거하고, TCID50으로 적정된 라이노바이러스 감염용액을 각 웰에 첨가하였다.
그런 다음, 각각 최종농도가 100, 10, 1 또는 0.1㎍/㎖가 되도록 각 웰에 시험물질을 투여하였다. 각 시료에 대한 바이러스 증식 억제능은 48시간 후에 살아있는 세포를 SRB 분석법(Choi 등, 2009)으로 측정하였다. 각 웰에 70% 아세톤을 100㎕씩 첨가한 후, 1시간 동안 -20℃에 방치하고 증류수로 수회 세척하였다. 실온에서 건조시킨 후, 1%(v/v) 아세트산에 녹인 0.4%(w/v) SRB(sulforhodamine B) 용액 100㎕를 첨가해 30분 동안 염색시켰다. 세포와 결합하지 않은 SRB 염색액은 1%(v/v) 아세트산으로 수회 세척한 다음 다시 건조시켰다. 10mM 트리스 용액(pH 10.5) 100㎕를 각 웰에 가하여 세포와 결합되어 있는 염색제를 충분히 녹인 후 562nm에서 흡광도를 측정하였다.
각 처리군은 바이러스를 처리하지 않은 군(A), 시험물질만 처리한 군(B), 바이러스만 처리한 군(C), 바이러스와 시험물질을 같이 처리한 군(D)으로 표기하였으며, 각각의 시료에 대한 비교 세포 성장률(%)(수학식 1)과 바이러스에 대한 증식억제능(%)(수학식 2)을 계산하였다. 이때, 시험물질로는 산자나무 에탄올 추출물, 퀘세틴 3-글루코사이드-7-람노사이드, 퀘세틴, 루틴, 퀘세틴 3-람노사이드, 퀘세틴 3-글루코사이드, 제니스틴, 리바비린을 사용하였다.
동일한 조건에서 수행한 세번의 실험결과 수치에 대한 평균과 표준편차로 계산한 값을 제시하였다. 시험물질의 세포독성능은 100, 10, 1 또는 0.1㎍/㎖의 농도에서 시험물질을 가하지 않은 웰의 세포와 비교하였다.
[규칙 제91조에 의한 정정 29.07.2010] 
수학식 1
Figure WO-DOC-MATHS-1
[규칙 제91조에 의한 정정 29.07.2010] 
수학식 2
Figure WO-DOC-MATHS-2
하기 표 2에 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드의 바이러스 증식 억제능(HeLa 세포주 내의 HRV3 바이러스)에 관한 실험결과를 나타내었다.
표 2
시험물질 CC50 a IC50 b TIc
산자나무 에탄올 추출물 >100 3.35±3.08 >29.85
퀘세틴 3-글루코사이드-7-람노사이드 >100 0.53±0.12 >188.68
퀘세틴 >100 N.D.d -
루틴 >100 N.D.d -
퀘세틴 3-람노사이드 >100 N.D.d -
퀘세틴 3-글루코사이드 >100 N.D.d -
제니스틴 >100 91.55±0.88 >1.09
리바비린 >100 86.34±4.09 >1.16
[주] IC50 결과는 독립적인 실험으로 세번 반복하여 얻은 평균치임.
a : HeLa 세포를 50% 줄이는 시료의 농도(/㎖)임.
b : 세포 병변을 50% 줄이는 시료의 농도(CPE)(/㎖)임.
c : 항 바이러스능 = CC50 / IC50임.
d : 50% 이하의 최대 억제율로 인하여 본 실험에 대한 상기 시험물질의 농도 내에서 IC50 값이 측정되지 않음을 의미함.
상기 표 2를 통해 확인할 수 있듯이, 실시에 1에서 수득한 산자나무 추출물과 이로부터 분리,정제된 퀘세틴 3-글루코사이드-7-람노사이드에 의한 바이러스 증식 억제능을 측정하기 위하여 라이노바이러스를 HeLa 세포에 감염시켜서 증식 배양하는 중에 시료를 농도별로 처리하여 바이러스 증식 억제능을 측정한 결과, 비교약제로 사용한 제니스틴(Genistin)과 리바비린(Ribavirin)보다 산자나무 추출물에서 25배 이상, 순수 분리된 활성물질 퀘세틴 3-글루코사이드-7-람노사이드는 180배 이상의 바이러스 증식 억제능이 나타났다.
실시예 5 : 산자나무 추출물 및 퀘세틴 3-글루코사이드-7-람노사이드의 실험용 생쥐에 대한 경구투여 급성독성 시험
본 시험에 사용된 SD계 랫트(rat)는 온도 23±3℃, 상대습도 50±10%, 조명시간 12시간(오전 6시~오후 6시), 환기횟수 10~20회/시간 및 조도 150~300룩스(Lux)로 설정된 한국생명공학연구원 실험동물동에서 사육되었다. 시험 실시자들은 모두 고압증기멸균(121℃, 20분)된 작업복, 두건, 마스크 및 장갑 등을 착용하고 작업하였다.
랫트는 순화, 검역기간 동안에는 폴리카보네이트제 구두통형 사육상자(260W×410L×200H㎜)에 수용되었으며, 투여 및 관찰기간 중에는 와이어사육상자(205W×350L×175H㎜)에 한마리씩 수용되었다. 시험기간 중 사육상자는 시험번호 및 동물번호를 기입한 라벨지를 붙여 식별하였다.
6주령의 특정병원성부재(SPF) SD계 랫트를 군당 다섯마리로 나누어, 본 발명의 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드를 0.5% 메틸셀룰로오즈 용액에 현탁하여 10mg/kg의 용량으로 단회 경구투여 하였다. 투여 후, 동물의 폐사여부, 임상증상, 체중변화를 관찰하였고, 혈액학적 검사와 혈액생화학적 검사를 실시하였으며, 부검하여 육안으로 복강장기와 흉강장기의 이상여부를 관찰하였다.
그 결과, 본 발명의 산자나무 추출물 또는 퀘세틴 3-글루코사이드-7-람노사이드를 투여한 동물에서는 주목할 만한 임상증상이 나타나거나 폐사된 동물은 관찰되지 않았다. 또한, 체중변화, 혈액검사, 혈액생화학적 검사, 부검소견 등에서도 독성변화는 관찰되지 않았다.
투여한 상기 퀘세틴 3-글루코사이드-7-람노사이드 화합물은 랫트에서 10mg/kg까지 독성변화를 나타내지 않았으며, 경구 투여 최소 치사량(LD50)은 10mg/kg 이상으로 판단되었다.
본 발명은 이상에서 살펴본 바와 같이 바람직한 실시예를 들어 도시하고 설명하였으나, 상기한 실시예에 한정되지 아니하며 본 발명의 정신을 벗어나지 않는 범위 내에서 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자에 의해 다양한 변경과 수정이 가능할 것이다.

Claims (21)

  1. 산자나무(Hippophae rhamnoides) 추출물의 치료학적으로 유효한 양을 환자에게 투여하는 단계를 포함하는, IL-6 에 의해 매개되는 질환을 치료하는 방법.
  2. 제 1항에 있어서, 상기 IL-6에 의해 매개되는 질환은 염증성질환, 자가면역질환 또는 암인 방법.
  3. 제 2항에 있어서, 상기 IL-6에 의해 매개되는 질환은 천식, 건선, 아토피, 골다공증, 루푸스, 크론씨병, 혈관협착, 암전이, 이식거부, 관절염, 알쯔하이머, 골수종, 유방암종, 전립선암, 뇌종양, 두경부암종, 흑색종, 백혈병, 다발성 골수종 중 어느 하나 이상인 방법.
  4. 하기 화학식 1로 표시되는 퀘세틴 3-글루코사이드-7-람노사이드의 치료학적으로 유효한 양을 환자에게 투여하는 단계를 포함하는, IL-6 에 의해 매개되는 질환을 치료하는 방법.
    [화학식 1]
    Figure PCTKR2010003791-appb-I000002
  5. 제 4항에 있어서, 상기 퀘세틴 3-글루코사이드-7-람노사이드는 산자나무로부터 분리된 것인 방법.
  6. 제 4항에 있어서, 상기 IL-6에 의해 매개되는 질환은 염증성질환, 자가면역질환 또는 암인 방법.
  7. 제 6항에 있어서, 상기 IL-6에 의해 매개되는 질환은 천식, 건선, 아토피, 골다공증, 루푸스, 크론씨병, 혈관협착, 암전이, 이식거부, 관절염, 알쯔하이머, 골수종, 유방암종, 전립선암, 뇌종양, 두경부암종, 흑색종, 백혈병, 다발성 골수종 중 어느 하나 이상인 방법.
  8. 산자나무(Hippophae rhamnoides) 추출물의 치료학적으로 유효한 양을 환자에게 투여하는 단계를 포함하는, 라이노바이러스 감염성 질환을 치료하는 방법.
  9. 하기 화학식 1로 표시되는 퀘세틴 3-글루코사이드-7-람노사이드의 치료학적으로 유효한 양을 환자에게 투여하는 단계를 포함하는, 라이노바이러스 감염성 질환을 치료하는 방법.
    [화학식 1]
    Figure PCTKR2010003791-appb-I000003
  10. 산자나무(Hippophae rhamnoides) 추출물을 포함하는 IL-6에 의해 매개되는 질환의 예방 또는 치료용 조성물.
  11. 제10항에 있어서, 상기 추출물은 에탄올 추출물인 조성물.
  12. 하기 화학식 1로 표시되는 퀘세틴 3-글루코사이드-7-람노사이드를 유효성분으로 포함하는 IL-6에 의해 매개되는 질환의 예방 또는 치료용 조성물.
    [화학식 1]
    Figure PCTKR2010003791-appb-I000004
  13. 제 12항에 있어서, 상기 퀘세틴 3-글루코사이드-7-람노사이드는 산자나무(Hippophae rhamnoides)로부터 분리된 것인 조성물.
  14. 제10항 내지 제13항 중 어느 한 항에 있어서, 상기 IL-6에 의해 매개되는 질환은 염증성질환, 자가면역질환 또는 암인 조성물.
  15. 제14항에 있어서, 상기 IL-6에 의해 매개되는 질환은 천식, 건선, 아토피, 골다공증, 루푸스, 크론씨병, 혈관협착, 암전이, 이식거부, 관절염, 알쯔하이머, 골수종, 유방암종, 전립선암, 뇌종양, 두경부암종, 흑색종, 백혈병, 다발성 골수종 중 어느 하나 이상인 조성물.
  16. 제10항 내지 제13항 중 어느 한 항에 있어서, 상기 조성물은 식품용인 조성물.
  17. 산자나무(Hippophae rhamnoides) 추출물을 포함하는 라이노바이러스 감염성 질환의 예방 또는 치료용 조성물.
  18. 제17항에 있어서, 상기 추출물은 에탄올 추출물인 조성물.
  19. 하기 화학식 1로 표시되는 퀘세틴 3-글루코사이드-7-람노사이드를 유효성분으로 포함하는 라이노바이러스 감염성 질환의 예방 또는 치료를 위한 조성물.
    [화학식 1]
    Figure PCTKR2010003791-appb-I000005
  20. 제 19항에 있어서, 상기 퀘세틴 3-글루코사이드-7-람노사이드는 산자나무로부터 분리된 것인 조성물.
  21. 제17항 내지 제20항 중 어느 한 항에 있어서, 상기 조성물은 식품용인 조성물.
PCT/KR2010/003791 2009-06-12 2010-06-11 Il-6에 의해 매개되는 질환 또는 라이노바이러스 감염성 질환의 예방 또는 치료를 위한 방법 및 조성물 Ceased WO2010143919A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020090052446A KR101186264B1 (ko) 2009-06-12 2009-06-12 산자나무 추출물 또는 이로부터 분리된 화합물을 포함하는 il-6으로 매개되는 질환 또는 라이노바이러스 감염성 질환의 예방 또는 치료용 조성물
KR10-2009-0052446 2009-06-12

Publications (2)

Publication Number Publication Date
WO2010143919A2 true WO2010143919A2 (ko) 2010-12-16
WO2010143919A3 WO2010143919A3 (ko) 2011-04-14

Family

ID=43309391

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2010/003791 Ceased WO2010143919A2 (ko) 2009-06-12 2010-06-11 Il-6에 의해 매개되는 질환 또는 라이노바이러스 감염성 질환의 예방 또는 치료를 위한 방법 및 조성물

Country Status (2)

Country Link
KR (1) KR101186264B1 (ko)
WO (1) WO2010143919A2 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IT202000026566A1 (it) * 2020-11-06 2022-05-06 Herbal E Antioxidant Derivatives Srl Ed In Forma Abbreviata H&Ad Srl Combinazioni di antivirali e antimicrobici naturali, loro uso e formulazioni che le contengono

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101334348B1 (ko) * 2011-12-21 2013-11-29 한국생명공학연구원 바이러스 억제 활성을 갖는 플라보노이드 화합물

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7166435B2 (en) * 2001-08-06 2007-01-23 The Quigley Corporation Compositions and methods for reducing the transmissivity of illnesses
CA2539534A1 (en) * 2003-09-22 2005-04-07 Genyous Biomed International Inc. Hippophae rhamnoides compositions for cancer therapy

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IT202000026566A1 (it) * 2020-11-06 2022-05-06 Herbal E Antioxidant Derivatives Srl Ed In Forma Abbreviata H&Ad Srl Combinazioni di antivirali e antimicrobici naturali, loro uso e formulazioni che le contengono

Also Published As

Publication number Publication date
KR20100133747A (ko) 2010-12-22
WO2010143919A3 (ko) 2011-04-14
KR101186264B1 (ko) 2012-09-27

Similar Documents

Publication Publication Date Title
Banzouzi et al. Studies on medicinal plants of Ivory Coast: Investigation of Sida acuta for in vitro antiplasmodial activities and identification of an active constituent
Han et al. Novel carbohydrate modified berberine derivatives: synthesis and in vitro anti-diabetic investigation
CN113491703B (zh) 苯乙醇苷类化合物及其组合物在制备防治新冠病毒感染的药物中的应用
Calzada et al. Additional antiprotozoal flavonol glycosides of the aerial parts of Helianthemum glomeratum
WO2013058484A2 (ko) 인제난 타입의 디테르펜 화합물 및 이를 포함하는 바이러스 감염 질환의 치료 또는 예방용 약학적 조성물
WO2012023660A1 (ko) 크레이스토카릭스 오페르쿠라투스로부터 얻은 조류, 돼지 인플루엔자 및 신종플루에 대한 항바이러스제
KR100720151B1 (ko) 항바이러스 활성을 갖는 플라보노이드 화합물
US20240287014A1 (en) Biflavone compound against i-type herpes simplex virus, and preparation method therefor and use thereof
WO2011049348A2 (ko) 울금으로부터 얻은 조류, 돼지 인플루엔자 및 신종플루에 대한 항바이러스제
WO2018128408A1 (ko) 바이칼레인을 유효성분으로 포함하는 천식 또는 아토피 등의 알러지성 질환의 예방 또는 치료용 약학 조성물
CN101394858A (zh) 肠道α-葡萄糖苷酶抑制剂及其分离方法和用途
WO2011043631A2 (ko) 호장근 추출물, 이의 분획물 또는 스틸벤계 화합물을 포함하는 감기의 예방 및 치료용 약학 조성물
WO2016167385A1 (ko) 석송강 추출물 또는 이로부터 분리된 화합물을 포함하는 알츠하이머병의 예방 또는 치료용 조성물-ⅱ
WO2018208128A1 (ko) 틸리아닌을 유효성분으로 포함하는 파킨슨 질환의 예방 또는 치료용 약학적 조성물
WO2013062247A2 (ko) 포볼 타입의 디테르펜 화합물 및 이를 포함하는 바이러스 감염 질환의 치료 또는 예방용 약학적 조성물
Tchebou et al. Exploring Cassia mimosoïdes as a promising natural source of steroids with potent anti-cancer, urease inhibition, and antimicrobial properties
WO2010143919A2 (ko) Il-6에 의해 매개되는 질환 또는 라이노바이러스 감염성 질환의 예방 또는 치료를 위한 방법 및 조성물
WO2022186608A1 (ko) 해삼 생식선 추출물 또는 이로부터 유래된 화합물의 항암 용도
CN106518629A (zh) 甘草叶的活性成分及其结构和用途
KR101220519B1 (ko) 산자나무 추출물 또는 이로부터 분리된 화합물을 포함하는 il-6으로 매개되는 질환 또는 라이노바이러스 감염성 질환의 예방 또는 치료용 조성물
WO2023182540A1 (ko) 바이러스성 질환 예방 및 개선용 조성물
WO2018088777A1 (ko) 감태 추출물 또는 이로부터 분리한 플로로탄닌계 화합물을 유효성분으로 포함하는 인플루엔자의 예방 또는 치료용 조성물
CN100590119C (zh) 一种抗肿瘤化合物红波罗花碱a及其制备方法和应用
WO2021150076A1 (ko) 만성폐쇄성 폐질환의 예방 또는 치료용 약학적 조성물 또는 건강기능식품
WO2025048505A1 (ko) 신규 유산균 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10786402

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10786402

Country of ref document: EP

Kind code of ref document: A2