WO2010085984A1 - Séquences d'acide nucléique et d'acides aminés d'adénovirus simiens, vecteurs les contenant et leurs utilisations - Google Patents
Séquences d'acide nucléique et d'acides aminés d'adénovirus simiens, vecteurs les contenant et leurs utilisations Download PDFInfo
- Publication number
- WO2010085984A1 WO2010085984A1 PCT/EP2009/000672 EP2009000672W WO2010085984A1 WO 2010085984 A1 WO2010085984 A1 WO 2010085984A1 EP 2009000672 W EP2009000672 W EP 2009000672W WO 2010085984 A1 WO2010085984 A1 WO 2010085984A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- amino acid
- adenovirus
- seq
- polynucleotide
- functional derivative
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5256—Virus expressing foreign proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10321—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10334—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10341—Use of virus, viral particle or viral elements as a vector
- C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16111—Human Immunodeficiency Virus, HIV concerning HIV env
- C12N2740/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Definitions
- the present invention relates to novel adenovirus strains with an improved seroprevalence in human.
- the present invention relates to isolated polypeptides of adenoviral capsid proteins such as hexon, penton and fiber protein and fragments thereof and polynucleotides encoding the same.
- a vector comprising the isolated polynucleotide according to the invention and adenoviruses comprising the isolated polynucleotides or polypeptides according to the invention and a pharmaceutical composition comprising said vector, adenovirus, polypeptide and/or polynucleotide.
- the invention also relates to the use of the isolated polynucleotides, the isolated polypeptides, the vector, the adenoviruses and/or the pharmaceutical composition for the therapy or prophylaxis of a disease.
- the adenoviruses comprise a large family of double-stranded DNA viruses found in amphibians, avians, and mammals which have a nonenveloped icosahedral capsid structure (Straus, Adenovirus infections in humans; The Adenoviruses, 451-498, 1984; Hierholzer etal.,J. Infect.Dis.,158 : 804-813,1988; Schnurr and Dondero, Intervirology., 36: 79-83,1993 ; Jong et al., J. Clin. Microbiol., 37 : 3940-3945: 1999).
- adenoviruses can transduce numerous cell types of several mammalian species, including both dividing and nondividing cells, without integrating into the genome of the host cell.
- adenoviral DNA is typically very stable and remains episomal (e. g., extrachromosomal), unless transformation or tumorigenesis has occurred.
- adenoviral vectors can be propagated to high yields in well-defined production systems which are readily amenable to pharmaceutical scale production of clinical grade compositions. These characteristics and their well-characterized molecular genetics make recombinant adenoviral vectors good candidates for use as vaccine carriers.
- the production of recombinant adenoviral vectors may rely on the use of a packaging cell line which is capable of complementing the functions of adenoviral gene products that have been either deleted or engineered to be nonfunctional.
- hAd2 and hAd5 are widely used as the sources of the viral backbone for most of the adenoviral vectors that are used for gene therapy.
- Replication-defective human adenoviral vectors have also been tested as vaccine carriers for the delivery of a variety of immunogens derived from a variety of infectious agents.
- Studies conducted in experimental animals e. g. rodents, canines and nonhuman primates indicate that recombinant replication-defective human adenoviral vectors carrying transgenes encoding immunogens as well as other heterologous antigens elicit both humoral and cell-mediated immune responses against the transgene product.
- adenoviral vectors as vaccine carriers in nonhuman experimental systems by either using immunization protocols that utilizes high doses of recombinant adenoviral vectors that are predicted to elicit immune responses; or by using immunization protocols which employ the sequential administration of adenoviral vectors that are derived from different serotypes but which carry the same transgene product as boosting immunizations (Mastrangeli, et. al., Human Gene Therapy, 7: 79-87 (1996).
- Ad5 human adenovirus type 5
- Ad5-based vectors are extremely efficient in animal models, the presence of a pre-existing immunity in humans against Ad5 wild type virus has been demonstrated in clinical trials to reduce the efficiency of gene transduction.
- a clear reduction of the immunization efficiency was demonstrated in subjects with titers of neutralizing antibodies over 200 enrolled in vaccine clinical trial based on Ad5 vectors.
- the most extensive characterization of an Ad5 vectored vaccine was obtained in the HIV vaccine STEP trial conducted by Merck (Moore JP et al. Science. 2008 May 9;320(5877):753-5).
- the vaccine study was based on the co-injection of 3 Ad5 vectors expressing different HIV antigens as proof of concept study in subjects with high risk of HIV infection. Surprisingly the data revealed an increase of HIV infection rate in vaccinated subjects with anti-Ad5 pre-existing immunity rather then a protective effect. Although the mechanism of this paradoxical observation is not clear yet, the results raised additional questions on the safety and efficiency of vectors based on adenovirus of human origin for vaccine application in healthy subjects. Taken together all results obtained so far in different vaccine and gene therapy clinical trials with Ad5 vectors increased the need for an adenovirus characterized in a very low or absent pre-existing immunity in humans.
- the present invention provides an isolated polynucleotide that encodes an adenoviral fiber protein or a functional derivative thereof and that is selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence according to any of SEQ ID NOs: 14-19;
- the present invention relates to an isolated polynucleotide that encodes an adenoviral hexon protein or a functional derivative thereof and that is selected from the group consisting of:
- a polynucleotide encoding a functional derivative having an amino acid sequence which is at least 95% identical over its entire length to the amino acid sequence of any of SEQ ID NOs: 20-25. Also provided is an isolated polynucleotide that encodes an adenoviral penton protein or a functional derivative thereof and that is selected from the group consisting of:
- polynucleotide encoding a functional derivative having an amino acid sequence which is at least 85% identical over its entire length to the amino acid sequence of any of SEQ ID NOs: 26-31.
- the invention also relates to a polynucleotide comprising at least one of the isolated polynucleotide according to the invention as outlined above.
- the invention further provides an isolated adenoviral capsid polypeptide encoded by the isolated polynucleotide according to the invention or a functional derivative thereof.
- the invention provides a vector comprising the isolated polynucleotide according to the invention.
- a recombinant adenovirus preferably a replication-incompetent adenovirus, comprising an isolated polynucleotide according to the invention and/or at least one isolated adenoviral capsid polypeptide according to the invention.
- a further aspect of the invention is a composition comprising an adjuvant and at least one of the following (i) through (iv):
- the invention further relates to a cell comprising at least one of the following: (i) one or more isolated adenoviral capsid polypeptides according to the invention; (ii) an isolated polynucleotide according to the invention; (iii) a vector according to the invention; (iv) a recombinant adenovirus according to the invention.
- a further aspect of the invention relates to the use of an isolated adenoviral capsid polypeptide according to the invention; an isolated polynucleotide according to the invention; a vector according to the invention; a recombinant adenovirus according to the invention; and/or the composition according to the invention for the therapy or prophylaxis of a disease.
- the terms used herein are defined as described in "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)", Leuenberger, H.G.W, Nagel, B. and Klbl, H. eds.
- the adenoviral genome is well characterized. There is general conservation in the overall organization of the adenoviral genome with respect to specific open reading frames being similarly positioned, e.g. the location of the ElA, ElB, E2A, E2B, E3, E4, LI, L2, L3, L4 and L5 genes of each virus.
- Each extremity of the adenoviral genome comprises a sequence known as an inverted terminal repeat (ITRs), which is necessary for viral replication.
- ITRs inverted terminal repeat
- the virus also comprises a virus-encoded protease, which is necessary for processing some of the structural proteins required to produce infectious virions.
- the structure of the adenoviral genome is described on the basis of the order in which the viral genes are expressed following host cell transduction.
- the viral genes are referred to as early (E) or late (L) genes according to whether transcription occurs prior to or after onset of DNA replication.
- E early
- L late
- the ElA, ElB, E2A, E2B, E3 and E4 genes of adenovirus are expressed to prepare the host cell for viral replication.
- L1-L5 which encode the structural components of the virus particles are activated.
- isolated refers to a molecule which is substantially free of other molecules with which it is naturally associated with. An isolated molecule is thus free of other molecules that it would encounter or contact in a living animal in nature, i.e. outside an experimental setting.
- protein As used herein, the term “protein”, “peptide”, “polypeptide”, “peptides” and “polypeptides” are used interchangeably throughout. These terms refers to both naturally occurring peptides and synthesized peptides that may include naturally or non-naturally occurring amino acids. Peptides can be also chemically modified by modifying a side chain or a free amino or carboxy- terminus of a natural or non-naturally occurring amino acid. This chemical modification includes the addition of further chemical moieties as well as the modification of functional groups in side chains of the amino acids, such as a glycosylation.
- a peptide is a polymer preferably having at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or at least 100 amino acids, most preferably at least 30 amino acids.
- polypeptides and proteins disclosed herein are derived from adenovirus, it is preferred that the molecular mass of an isolated polypeptide or protein as used herein does not exceed 200 kDa.
- vector includes any vectors known to the skilled person including plasmid vectors, cosmid vectors, phage vectors such as lambda phage, viral vectors such as adenovirus (Ad) vectors (e.g., non-replicating Ad5, AdI l, Ad26, Ad35, Ad49, ChAd3, ChAd4, ChAd5, ChAd7, ChAd8, ChAd9, ChAdIO, ChAdI l, ChAdl ⁇ , ChAdl7, ChAdl9, ChAd20 , ChAd22, ChAd24, ChAd26, ChAd30, ChAd31, ChAd37, ChAd38, ChAd44, ChAd63 and ChAd82 vectors or replication-competent Ad4 and Ad7 vectors), adeno-associated virus (AAV) vectors (e.g., AAV type 5), alphavirus vectors (e.g., Venezuelan
- an expression cassette refers to a nucleic acid molecule which comprises at least one nucleic acid sequence that is to be expressed, along with its transcription and translation control sequences. Changing the expression cassette will cause the vector in which it is incorporated to direct the expression of a different sequence or combination of sequences. Because of the restriction sites being preferably engineered to be present at the 5' and 3' ends, the cassette can be easily inserted, removed, or replaced with another cassette.
- an expression cassette includes cis-regulating elements for efficient expression of a given gene, such as promoter, initiation-site and/or polyadenylation-site, as further described below.
- antibody refers to both monoclonal and polyclonal antibodies, i.e., any immunoglobulin protein or portion thereof which is capable of binding an antigen or hapten.
- Antigen-binding portions may be produced by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies.
- antigen-binding portions include Fab, Fab', F(ab') 2 , Fd, Fv, dAb, and complementarity determining region (CDR) variants, single- chain antibodies (scFv), chimeric antibodies, humanized antibodies, diabodies, and polypeptides that contain at least a portion of an antibody that is sufficient to confer specific antigen binding to the polypeptide.
- an immunogen / antigen for inducing/generating an immune response in a mammal in the context of the present invention is termed "priming", and the administration of an immunogen/ antigen for enhancing an immune response against said immunogen/ antigen, e.g. a particular pathogen such as a virion, in a mammal is termed "boosting".
- boosting means that the vector for inducing/generating an immune response (priming) in a mammal and the vector for enhancing the immune response (boosting) in a mammal are different.
- “Heterologous prime-boost” is useful if a subject, e.g. patient has developed antibodies against a first vector and a boosting is required.
- two different adenoviruses may be used, e.g. for vaccination and/or gene therapy.
- a first and a second adenovirus are sufficiently different, if the antibody response induced during priming by the first adenovirus does not prevent more than 70% or preferably more than 80% of the second adenovirus particles administered for boosting from entering the nucleus of cells of the animal that has been subjected to priming and boosting.
- replication-competent recombinant adenovirus refers to an adenovirus which can replicate in a host cell in the absence of any recombinant helper proteins comprised in the cell.
- a "replication-competent" adenovirus comprises the following intact or functional essential early genes: ElA, ElB, E2A, E2B, E3 and E4. Wild type adenoviruses isolated from a particular animal will be replication competent in that animal.
- replication-defective recombinant AdV refers to an adenovirus that has been rendered to be incapable of replication because it has been engineered to comprise at least a functional deletion, or a complete removal of, a gene product that is essential for viral replication, such as one or more of the adenoviral genes selected from El, E2, E3 and E4.
- the recombinant chimpanzee adenoviral vectors of the invention are preferably replication-defective.
- identity refers to the number of residues in the two sequences that are identical when aligned for maximum correspondence. Specifically, the percent sequence identity of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between two aligned sequences divided by the length of the shorter sequence and multiplied by 100.
- Alignment tools that can be used to align two sequences are well known to the person skilled in the art and can, for example, be obtained on the World Wide Web, e.g., ClustalW (www.ebi.ac.uk/clustalw) or Align (http://www.ebi.ac.uk/emboss/align/index.html).
- the alignments between two sequences may be carried out using standard settings, for Align EMBOSS ::needle preferably: Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5.
- Matrix Blosum62
- Gap Open 10.0 Gap Open 10.0
- Gap Extend 0.5 Gap Extend 0.5.
- the "best sequence alignment" between two polypeptides is defined as the alignment that produces the largest number of aligned identical residues.
- Ad An adenovirus
- hAds Human adenoviruses
- Mastadenovirus genus which includes all known human and many Ads of animal (e. g., bovine, porcine, canine, murine, equine, simian and ovine) origin.
- Human adenoviruses are generally divided into six subgroups (A-F) based on a number of biological, chemical, immunological and structural criteria which include hemagglutination properties of rat and rhesus monkey erythrocytes, DNA homology, restriction enzyme cleavage patterns, percentage G+C content and oncogenicity (Straus, 1984, in The Adenoviruses, ed. H. Ginsberg, pps.451-498, New York : Plenus Press, and Horwitz, 1990; in Virology, eds. B. N. Fields and D. M. Knipe, pps. 1679-1721).
- the adenoviral virion has an icosahedral symmetry and, depending on the serotype, a diameter of 60-90 nm.
- the icosahedral capsid comprises three major proteins, hexon (II), penton base (III) and a knobbed fiber (IV) protein (W. C. Russel, J. Gen. Virol., 81: 2573-2604 (2000)).
- One aspect of the preexisting immunity that is observed in humans is humoral immunity, which can result in the production and persistence of antibodies that are specific for adenoviral proteins.
- the humoral response elicited by adenovirus is mainly directed against the three major structural proteins: hexon, penton and fiber.
- adenoviruses are useful in g ⁇ ne-th ⁇ rapy and as vaccines.
- Viral vectors based on chimpanzee adenovirus represent an alternative to the use of human derived Ad vectors for the development of genetic vaccines (Farina SF, J Virol. 2001 Dec;75(23):l 1603-13.; Fattori E, Gene Ther. 2006 Jul;13(14): 1088-96).
- Adenoviruses isolated from chimpanzees are closely related to adenoviruses isolated from humans as demonstrated by their efficient propagation in cells of human origin. However, since human and chimp adenoviruses are close relatives, a serologic cross reactivity between the two virus species can be expected.
- a chimpanzee adenovirus also abbreviated herein as "ChAd” for common chimpanzee adenovirus and "PanAd” for bonobo chimpanzee adenovirus
- ChoAd common chimpanzee adenovirus
- PanAd bonobo chimpanzee adenovirus
- the present invention comprises the unexpected finding that novel chimpanzee adenovirus strains could be isolated, namely ChAd55, ChAd73, ChAd83, ChAdl46, ChAdl47 isolated from the Common Chimpanzee ⁇ Pan troglodytes) and from bonobos ⁇ Pan paniscus) namely PanAdl. All these novel strains show no measurable seroprevalence in humans, i.e. these adenovirus strains represent an exception among chimpanzee adenoviruses described so far in that all human sera tested completely negative for the presence of neutralizing antibodies.
- a neutralizing antibody refers to an antibody that binds to an epitope of the adenovirus and prevents it from producing a productive infection in a host cell or prevents the transduction of a target cell with a replication incompentent vector expressing a transgene, e.g. the adenovirus DNA is capable of entering a host cell. While neutralizing antibodies were observed for all prior- art chimpanzee-derived adenoviruses, the novel adenovirus types ChAd55, ChAd73, ChAd83, ChAd 146, ChAd 147 and PanAdl are characterized by a complete absence of preexisting neutralizing antibody in humans directed against these adenovirus types.
- these adenoviruses provide a valuable medical tool that can e.g. be used for immunization and/or gene therapy.
- the invention provides, in one aspect, novel sequences of adenovirus capsid proteins that represent the most surface exposed adenovirus epitopes, namely of hexon, penton and fiber protein.
- no neutralizing antibodies specific for the viruses according to the invention are comprised in human blood sera.
- one advantage of the aforementioned novel chimpanzee hexon, penton and fiber protein sequences is that the sequences of these proteins can be used to enhance prior art adenoviruses, which have been engineered for e.g. medical purposes.
- the capsid proteins of the present invention can be used to e.g. replace one or more of the major structural capsid proteins or functional fragments thereof of a prior art adenovirus, to obtain improved recombinant adenoviruses with a reduced seroprevalence in humans.
- novel adenoviruses of the invention but also adenoviruses which have been re-engineered as described will not encounter any significant inhibitory immune response in humans when administered, their overall transduction efficiency and infectivity will be enhanced.
- adenoviruses are expected to be, e.g., more effective vaccines as the entry into host cells and the expression of the antigen cassette will not be hampered by any significant titer of neutralizing antibodies, hi addition, as shown in the examples, a potent immune response against HIV gag was elicited even in naive mice vaccinated with a recombinant HIV-gag encoding adenovirus that comprises hexon, penton and fiber proteins of the ChAd55 or PanAdl isolate.
- the immune response elicited by ChAd55-gag and PanAdl-gag adenovirus is comparable with the response observed with the most potent vectors developed so far based on recombinant human Ad5 vector of the prior art expressing HIV gag protein (see data of an ELIspot assay in figure 5 A and5B).
- the humoral response elicited by an adenovirus is mainly directed against the three major adenoviral structural proteins: hexon, penton and fiber, all of which comprise polypeptide sequences that are part of the adenoviral capsid and that are exposed to the outside of the virus particle (see also: Madisch I, et al., J. Virol. 2005 Dec;79(24): 15265-76; and also: Madisch I, et al., J Virol. 2007 Aug;81(15):8270-81; and Pichla-Gollon SL, et al., J. Virol. 2007 Feb;81(4): 1680-9).
- the novel adenovirus isolates of the group of PanAdl, ChAd55, ChAd73, ChAd83, ChAdl46 and ChAdl47 of the present invention share a very similar hexon protein sequence.
- the hypervariable regions (HVRs) are labeled which occur in loops at the top of the hexon molecule that lie on the exterior of the virion and cover a large amount of its surface (see Jophn J. Rux et. Al, J. of Virology, Sept 2003, vol. 77, no.17).
- capsid proteins penton and fiber of the novel chimpanzee adenoviruses The sequence relatedness of the further capsid proteins penton and fiber of the novel chimpanzee adenoviruses is provided in figures 2 and 3. All three structural capsid proteins are expected to contribute to the low seroprevalence and can, thus, be used independently from each other or in combination to suppress the affinity of an adenovirus to preexisting neutralizing antibodies, e.g. to manufacture a recombinant adenovirus with a reduced seroprevalence.
- the invention provides an isolated polynucleotide that encodes an adenoviral fiber protein or a functional derivative thereof and that is selected from the group consisting of:
- a polynucleotide encoding a functional derivative having an amino acid sequence which is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%, more preferably at least 85% and most preferable at least 99% identical over its entire length to the amino acid sequence of any of SEQ ID NOs: 14-19, i.e. SEQ ID NO: 14, 15, 16, 17, 18 or 19.
- adenoviral fiber protein is meant the knobbed fiber (IV) protein comprised in an adenovirus.
- the isolated polynucleotide comprised in the first aspect of the invention encodes a fiber protein or a functional derivative thereof that has the same function as a fiber protein or a fragment thereof in an infectious adenovirus virion.
- a recombinant adenovirus comprising said fiber or functional fiber derivative is capable of entering a host cell. It can be easily determined if a recombinant adenovirus can enter a host cell.
- the recombinant host cell can be washed and lysed and it can be determined whether adenoviral RNA and/or DNA is found in the host cell using, e.g. an appropriate hybridization probe.
- the host cell after having been brought into contact with the recombinant adenovirus may be washed, lysed and probed with adenovirus specific antibodies, e.g. using a Western blot.
- the fiber protein and functional derivative thereof has an affinity to an adenoviral penton protein, such as to SEQ ID NOs: 26-31.
- an adenoviral penton protein such as to SEQ ID NOs: 26-31.
- the average skilled person is well aware of how to test protein-protein affinities.
- a first protein is capable of binding a second protein, such as a penton protein of a chimpanzee derived adenovirus
- ELISA enzyme-linked immunosorbent assay
- FACS fluorescence-activated cell sorting
- adenoviral fiber protein in its glycosylated form is further capable of trimerizing.
- the fiber protein or a fragment thereof encoded by the polynucleotide according to the first aspect of the invention is capable of being glycosylated and/or of forming a trimer.
- the phrase "functional derivative" of a protein or polypeptide generally refers to a modified version of the protein or polypeptide, e.g. one or more amino acids of the protein or polypeptide may be deleted, inserted, modified and/or substituted.
- the derivative is functional, if, as mentioned also above, a chimeric adenovirus comprising the functional derivative in its capsid is capable of infecting a host cell.
- an insertion refers to the insertion of one or more amino acids into the original polypeptide or protein.
- a functional derivative does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100 amino acid changes (i.e. deleted, inserted, modified and/or substituted amino acids).
- Amino acids of the protein or polypeptide may also be modified, e.g. chemically modified.
- the side chain or a free amino or carboxy-terminus of an amino acid of the protein or polypeptide may be modified by e.g. glycosylation, amidation, phosphorylation, ubiquitination, e.t.c.
- the chemical modification can also take place in vivo, e.g. in a host-cell, as is well known in the art.
- a suitable chemical modification motif e.g. glycosylation sequence motif present in the amino acid sequence of the protein will cause the protein to be glycosylated.
- a substitution in a derivative may be a conservative or a non-conservative substitution, preferably a conservative substitution.
- a substitution also includes the exchange of a naturally occurring amino acid with a not naturally occurring amino acid.
- a conservative substitution comprises the substitution of an amino acid with another amino acid having a chemical property similar to the amino acid that is substituted.
- the conservative substitution is a substitution selected from the group consisting of: (i) a substitution of a basic amino acid with another, different basic amino acid; (ii) a substitution of an acidic amino acid with another, different acidic amino acid; (iii) a substitution of an aromatic amino acid with another, different aromatic amino acid; (iv) a substitution of a non-polar, aliphatic amino acid with another, different non-polar, aliphatic amino acid; and (v) a substitution of a polar, uncharged amino acid with another, different polar, uncharged amino acid,
- a basic amino acid is preferably selected from the group consisting of arginine, histidine, and lysine.
- An acidic amino acid is preferably aspartate or glutamate.
- An aromatic amino acid is preferably selected from the group consisting of phenylalanine, tyrosine and tryptophane.
- a non- polar, aliphatic amino acid is preferably selected from the group consisting of glycine, alanine, valine, leucine, methionine and isoleucine.
- a polar, uncharged amino acid is preferably selected from the group consisting of serine, threonine, cysteine, proline, asparagine and glutamine.
- a non-conservative amino acid substitution is the exchange of one amino acid with any amino acid that does not fall under the above-outlined conservative substitutions (i) through (v).
- a functional derivative comprises a deletion
- the derivative one or several amino acids that are present in the reference polypeptide or protein sequence have been removed.
- the deletion may, however, not be so extensive that the derivative comprises less than 200 amino acids in total.
- the hyper variable domains of an adenoviral hexon protein are exposed to the outside of the adenovirus.
- these regions of the adenoviral capsid can be recognized and bound by neutralizing antibodies.
- an adenovirus with a capsid comprising a hexon protein derived from one of the novel adenovirus isolates of the present invention will exhibit an improved, i.e. smaller seroprevalence in humans.
- the invention provides an isolated polynucleotide that encodes an adenoviral hexon protein or a functional derivative thereof and that is selected from the group consisting of:
- the isolated polynucleotide comprised in the second aspect of the invention encodes a hexon protein or a functional derivative thereof that has the same function as a hexon protein or a functional fragment thereof in an infectious adenovirus virion.
- a recombinant adenovirus comprising said hexon or functional derivative thereof is capable of entering a host cell.
- the invention provides an isolated polynucleotide that encodes an adenoviral penton protein or a functional derivative thereof and that is selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence according to any of SEQ ID NOs: 26-31, i.e. SEQ ID NO: 26, 27, 28, 29, 30 or 31;
- a polynucleotide encoding a functional derivative having an amino acid sequence which is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%, more preferably at least 85% and most preferable at least 99% identical over its entire length to the amino acid sequence of any of SEQ ID NOs: 26-31, i.e. SEQ ID NO: 26, 27, 28, 29, 30 or 31.
- the penton protein and functional derivative thereof has an affinity to an adenoviral fiber protein, such as to SEQ ID NOs: 14-19.
- adenoviral penton protein is meant the penton base (III) protein comprised in an adenovirus.
- An adenoviral penton protein is characterized in that it localizes to the corners of the icosahedral symmetry of the capsid.
- the polynucleotide of the first second and/or third aspect of the invention encodes one or more polypeptides wherein a recombinant adenovirus comprising said one or more polypeptides is capable to infect, i.e. enter a host cell.
- a recombinant adenovirus comprising said one or more polypeptides is capable to infect, i.e. enter a host cell.
- the isolated polynucleotide encodes an adenoviral fiber protein with an amino acid sequence according to SEQ ID NO: 14 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%, more preferably at least 85% and most preferable at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 14.
- the isolated polynucleotide encodes an adenoviral hexon protein with an amino acid sequence according to SEQ ID NO: 20 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 95%, 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% identical over its entire length to the amino acid sequence of SEQ ID NO: 20.
- the isolated polynucleotide encodes an adenoviral penton protein with an amino acid sequence according to SEQ ID NO: 26 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% and most preferable at least 99.9% identical over its entire length to the amino acid sequence of SEQ ID NO: 26.
- the isolated polynucleotide encodes an adenoviral fiber protein with an amino acid sequence according to SEQ ID NO: 15 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 98%, 99% or at least 99.9% more preferably at least 99% and most preferable at least 99.9% identical over its entire length to the amino acid sequence of SEQ ID NO: 15.
- the isolated polynucleotide encodes an adenoviral hexon protein with an amino acid sequence according to SEQ ID NO: 21 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 95%, 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% identical over its entire length to the amino acid sequence of SEQ ID NO: 21.
- the isolated polynucleotide encodes an adenoviral penton protein with an amino acid sequence according to SEQ ID NO: 27 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% and most preferable at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 27.
- the isolated polynucleotide encodes an adenoviral fiber protein with an amino acid sequence according to SEQ ED NO: 16 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has the amino acid sequence of SEQ ID NO: 16.
- the isolated polynucleotide encodes an adenoviral hexon protein with an amino acid sequence according to SEQ ID NO: 22 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 95%, 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% identical over its entire length to the amino acid sequence of SEQ ID NO: 22.
- the isolated polynucleotide encodes an adenoviral p ⁇ nton protein with an amino acid sequence according to SEQ ID NO: 28 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% and most preferable at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 28.
- the isolated polynucleotide encodes an adenoviral fiber protein with an amino acid sequence according to SEQ ID NO: 17 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has the amino acid sequence of SEQ ID NO: 17.
- the isolated polynucleotide encodes an adenoviral hexon protein with an amino acid sequence according to SEQ YD NO: 23 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 95%, 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% identical over its entire length to the amino acid sequence of SEQ ID NO: 23.
- the isolated polynucleotide encodes an adenoviral penton protein with an amino acid sequence according to SEQ ID NO: 29 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% and most preferable at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 29.
- Adenovirus ChAd 147 does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is
- the isolated polynucleotide encodes an adenoviral fiber protein with an amino acid sequence according to SEQ ID NO: 18 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%, more preferably at least 85% and most preferable at least 90% identical over its entire length to the amino acid sequence of SEQ ID NO: 18.
- the isolated polynucleotide encodes an adenoviral hexon protein with an amino acid sequence according to SEQ ID NO: 24 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 95%, 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% identical over its entire length to the amino acid sequence of SEQ ID NO: 24.
- the isolated polynucleotide encodes an adenoviral penton protein with an amino acid sequence according to SEQ ID NO: 30 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% and most preferable at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 30.
- the isolated polynucleotide encodes an adenoviral fiber protein with an amino acid sequence according to SEQ ID NO: 19 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%, more preferably at least 85% and most preferable at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 19.
- the isolated polynucleotide encodes an adenoviral hexon protein with an amino acid sequence according to SEQ ID NO: 25 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 95%, 98%, 99%, 99.5%, 99.9% or at least 99.95%, more preferably at least 98% and most preferably at least 99% identical over its entire length to the amino acid sequence of SEQ ID NO: 25.
- the isolated polynucleotide encodes an adenoviral penton protein with an amino acid sequence according to SEQ ID NO: 31 or a functional derivative thereof, wherein the functional derivative (i) does not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 10 deleted, inserted, modified and/or substituted amino acids or (ii) has an amino acid sequence which is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least 99%, more preferably at least 85% and most preferable at least 90% identical over its entire length to the amino acid sequence of SEQ ID NO: 31.
- a fiber, hexon and penton protein contributes each individually to reduce the interaction of said recombinant adenovirus with human and/or rodent neutralizing antibodies. Accordingly, polynucleotides which encode said fiber, hexon and/or penton protein of the present invention are useful to construct enhanced recombinant adenoviruses.
- the invention provides a polynucleotide comprising at least one isolated polynucleotide selected from the group of polynucleotides consisting of a polynucleotide according to the first aspect of the invention, the second aspect of the invention and the third aspect of the invention.
- the polynucleotide according to the fourth aspect of the invention is a polynucleotide selected from the group consisting of:
- a polynucleotide comprising one polynucleotide according to the first, second or third aspect of the invention;
- a polynucleotide comprising a polynucleotide according to the first aspect of the invention and a polynucleotide according to the second aspect of the invention;
- polynucleotide comprising a polynucleotide according to the second aspect of the invention and a polynucleotide according to the third aspect of the invention; and (v) a polynucleotide comprising a polynucleotide according to the first, second and third aspect of the invention; wherein it is preferred that said polynucleotides comprised in the polynucleotide according to (i) through (v) are selected from the same adenovirus isolate, e.g.
- each "functional derivative" does not comprise more than 10 amino acid changes (i.e. deleted, inserted, modified and/or substituted amino acids).
- Table 2 below lists a number of particularly preferred embodiments of the polynucleotide of the fourth aspect of invention outlined above.
- Preferred is a polynucleotide selected from polynucleotides Al through Xl shown in Table 2, wherein the polynucleotide comprises three polynucleotides according to alternative (c) of the first, second and third aspect of the invention, each of which respectively encodes an adenoviral fiber, hexon and penton protein or a functional derivative thereof.
- Table 2 below shows the minimal sequence identity which each of said three encoded proteins has to have over its entire length to the amino acid sequence according to the SEQ ID NO which is also shown in Table 2:
- preferred polynucleotide Al as shown in Table 1 above comprises:
- polynucleotide of the fourth aspect of the invention Preferred is a polynucleotide selected from polynucleotides A2 through L2 selected from Table 3, wherein the polynucleotide comprises three polynucleotides designated, "Polynucleotide 1", “Polynucleotide 2" and “Polynucleotide 3", wherein each respective polynucleotide has at least the indicated sequence identity over its entire length to the corresponding polynucleotide according to the SEQ ID NO shown in Table 3:
- preferred embodiment A2 (“A2 - ChAd55") of Table 3 above is a polynucleotide comprising:
- polynucleotide of the fourth aspect of invention a polynucleotide selected from polynucleotides A3 through F3 shown in Table 4, wherein the polynucleotide encodes an adenoviral fiber, hexon and penton protein according to the indicated SEQ ID NO or a functional derivative thereof, wherein all three proteins and/or encoded functional derivatives in total do not comprise more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or more than 100, preferably not more than 20 deleted, inserted, modified and/or substituted amino acids:
- the polynucleotide consists of or comprises a polynucleotide which is at least 90%, 91%, 92%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9% or 100%, preferably 98% identical over its entire length to a sequence that (i) consists of SEQ ID NO: 13 or to (ii) a sequence that consists of SEQ ID NO: 13 but lacks the genomic regions ElA, ElB, E2A, E2B, E3 and/or E4.
- This polynucleotide may further comprise a polynucleotide sequence encoding for a heterologous protein or an expression cassette comprising such a polynucleotide sequence encoding for a heterologous protein.
- the genomic regions ElA, ElB, E2A, E2B, E3 and/or E4 are preferably not considered in the alignment, i.e. the alignment is done using a sequence that consists of the entire sequence SEQ ID NO: 13 but excluding the genomic regions ElA, ElB, E2A, E2B, E3, E4 and/or any polynucleotide encoding a heterologous polypeptide or expression cassette comprising such polynucleotide.
- the invention further provides an isolated protein encoded by the isolated polynucleotide according to the invention, i.e. an isolated adenoviral capsid polypeptide encoded by the isolated polynucleotide according to the first, second and/or third aspect of the invention or a functional derivative thereof.
- the "functional derivative” does not comprise more than 25 amino acid changes (i.e. deleted, inserted, modified and/or substituted amino acids).
- the invention further relates to a vector comprising an isolated polynucleotide according to the invention.
- the vector does not comprise a gene in a genomic region selected from the group of genomic regions consisting of ElA, ElB, E2A, E2B, E3 and E4, and/or comprises at least one gene of a genomic region selected from the group of ElA, ElB, E2A, E2B, E3 and E4, wherein said at least one gene comprises a deletion and/or mutation which renders the at least one gene non-functional.
- One possibility to render one of these gene products non-functional is to introduce one or more artificial stop-codons (e.g. TAA) into the open reading frame of these genes.
- TAA artificial stop-codons
- a polynucleotide preferably a cDNA, encoding one or more adenoviral proteins of the invention
- a strong promoter to direct transcription, a transcription/translation terminator, and a ribosome-binding site for translational initiation.
- Suitable bacterial promoters are well known in the art, e.g., E. coli, Bacillus sp., and Salmonella, and kits for such expression systems are commercially available.
- eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available.
- the expression vector typically contains a transcription unit or expression cassette that contains all the additional elements required for the expression of the adenoviral protein-encoding nucleic acid in host cells.
- a typical expression cassette thus contains a promoter operatively linked to the nucleic acid sequence encoding the adenoviral protein/polypeptide and signals required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination. Additional elements of the cassette may include, for example enhancers.
- An expression cassette should also contain a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes.
- the particular expression vector used to transport the genetic information into the cell is not particularly critical. Any of the conventional vectors used for expression in eukaryotic or prokaryotic cells may be used. Standard bacterial expression vectors include plasmids such as pBR322 based plasmids, pSKF, pET23D, and fusion expression systems such as GST and LacZ, but there are many more known in the art to the skilled person that can be usefully employed.
- Expression vectors containing regulatory elements from eukaryotic viruses are typically used in eukaryotic expression vectors, e.g. SV40 vectors, papilloma virus vectors, and vectors derived from Epstein-Barr virus.
- eukaryotic expression vectors include pMSG, pAV009/A.sup.+, pMTO10/A.sup.+, pMAMneo-5, baculovirus pDSVE, pcDNA3.1, pIRES and any other vector allowing expression of proteins under the direction of e.g.
- HCMV immediate-early promoter SV40 early promoter, SV40 late promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
- Some expression systems have markers that provide gene amplification such as thymidine kinase, hygromycin B phosphotransferase, and dihydrofolate reductase.
- markers that provide gene amplification such as thymidine kinase, hygromycin B phosphotransferase, and dihydrofolate reductase.
- high yield expression systems not involving gene amplification are also suitable.
- the elements that may also be included in expression vectors include a replicon that functions in E. coli, a gene encoding drug resistance to permit selection of bacteria that harbor recombinant plasmids, and unique restriction sites in nonessential regions of the plasmid to allow insertion of eukaryotic sequences.
- the particular drug resistance gene chosen is not critical - any of the many drug resistance genes known in the art are suitable.
- the prokaryotic sequences are optionally chosen such that they do not interfere with the replication of the DNA in eukaryotic cells, if necessary.
- Standard transfection methods can be used to produce bacterial, mammalian, yeast or insect cell lines. Any of the well-known procedures for introducing foreign polynucleotide sequences into host cells may be used.
- liposome-based transfection kits such as LipofectamineTM (Invitrogen)
- lipid-based transfection kits such as Fugene (Roche Diagnostics)
- polyethylene glycol-based transfection calcium phosphate precipitation
- gene gun biolistic
- electroporation or viral infection
- any of the other well known methods for introducing cloned genomic DNA, cDNA, synthetic DNA or other foreign genetic material into a host cell may be used. It is only necessary that the particular genetic engineering procedure used be capable of successfully introducing at least one gene into the host cell capable of expressing the receptor.
- an expressed adenoviral protein can be optionally purified using standard techniques.
- the cells may be lysed either mechanically or by osmotic shock before being subject to precipitation and chromatography steps, the nature and sequence of which will depend on the particular recombinant material to be recovered.
- the recombinant protein may be secreted and recovered from the culture medium in which the recombinant cells had been cultured as is known in the art of protein expression.
- the vector of the invention is a plasmid vector, e.g. an expression vector.
- a plasmid vector according to the invention can also be used to generate a recombinant adenovirus.
- a further aspect of the present invention is a recombinant adenovirus, preferably a replication-incompetent adenovirus, comprising an isolated polynucleotide according to the invention and/or at least one isolated adenoviral capsid polypeptide according to the invention.
- the recombinant adenovirus of the invention comprises a hexon a fiber and a penton protein of the present invention, e.g. a combination as outlined in Table 2 above.
- the recombinant adenovirus is characterized in that it is capable of infecting a human cell - preferably capable of infecting a human cell after said adenovirus was incubated for one hour in a human blood serum derived from a human that has not previously been exposed to a chimpanzee adenovirus.
- said recombinant adenovirus is obtainable e.g.
- a recombinant adenovirus which is composed of the usual adenoviral proteins but which has a capsid that comprises at least one isolated adenoviral capsid polypeptide according to the invention or a functional derivative thereof.
- Methods for the construction of recombinant adenoviruses are well known in the art.
- one or several of the ElA, ElB, E2A, E2B, E3 and E4 gene products may be expressed in a complementing cell line that can be used for the propagation and rescue of recombinant adenoviruses that are replication-incompetent, because they lack e.g. one of the aforementioned gene products.
- a complementing cell line that can be used for the propagation and rescue of recombinant adenoviruses that are replication-incompetent, because they lack e.g. one of the aforementioned gene products.
- the use of such cell-lines is also described in the references outlined above.
- the adenovirus has a seroprevalence of less than 5% in human subjects and preferably no seroprevalence in human subjects, most preferably no seroprevalence in human subjects that have not previously been in contact with a chimpanzee adenovirus.
- the human subjects belong to an ethnic group selected from Europeans, indigenous people of Africa, Asians, indigenous people of America and indigenous people of Oceania. Methods for the identification of the ethnic origin of a human subject are comprised in the art (see e.g. WO/2003/102236).
- the adenovirus DNA is capable of entering a mammalian target cell, i.e. it is infectious.
- An infectious recombinant adenoviruses of the invention can be used as a vaccine and for gene therapy as also described below.
- the recombinant adenovirus comprises a molecule for delivery into a target cell.
- the target cell is a mammalian cell, e.g. a chimpanzee cell, a rodent cell or a human cell.
- the molecule for delivery into a target cell can be an expression cassette as defined herein.
- a recombinant adenovirus of the present invention that comprises an expression cassette, encoding e.g. a minigene or an antigene, can be generated by replacing a genomic region of the adenovirus selected from ElA, ElB, E2A, E2B, E3 and E4 with said expression cassette.
- the genomic regions ElA, ElB, E2A, E2B, E3 and E4 of the adenoviruses of the invention can easily be identified by an alignment with known and annotated adenoviral genomes such as from human Ad5 (see: Birgitt Tauber and Thomas Dobner, Oncogene (2001) 20, p. 7847 - 7854; and also: Andrew J. Davison, et al., "Genetic content and evolution of adenoviruses", Journal of General Virology (2003), 84, p. 2895-2908).
- Non-limiting examples of how to generate modified adenoviruses comprising a molecule for delivery into a target cell are also provided in examples 1 and 2 and figure 4 below.
- the molecule for delivery into a target cell is preferably a polynucleotide but may also be a polypeptide or a small chemical compound, preferably having a therapeutic or diagnostic activity.
- the molecule for delivery into a target cell is a polynucleotide that comprises an adenovirus 5' inverted terminal repeat sequence (ITR), a gene, e.g. SEQ ID NO: 1 and a 3' ITR.
- ITR adenovirus 5' inverted terminal repeat sequence
- the molecular size of the molecule has to be chosen such that the capsid can form around and package the molecule, when the recombinant adenovirus is produced, e.g. in a packaging cell line.
- the gene is a minigene which can have e.g. up to 7000 and maximally up to 8000 base pairs.
- the molecule for delivery into a target cell comprised in the recombinant adenovirus according to the invention is a polynucleotide encoding an antigenic protein or a fragment thereof.
- An antigenic protein or fragment thereof is capable of eliciting an immune response in a mammal and may be in a particularly preferred embodiment the gag protein of HIV as shown in the examples and being encoded by a polynucleotide according to SEQ ID NO: !.
- the recombinant adenovirus of the invention is an adenovirus that has been deposited at ECACC (European Collection of Cell Culture, Porton Down, Salisbury, SP4 OJG, UK) and has a deposit number selected from the group consisting of 08110601 (ChAd83), 08110602 (ChAd73), 08110603 (ChAd55), 08110604 (ChAdl47) and 08110605 (ChAdl46).
- the deposits of the aforementioned adenoviral strains (Latin name: Mastadenovirus, Adenoviridae) have been made on November 6, 2008 by Okairos AG, Elisabethenstr. 3, 4051 Basel, Switzerland.
- adenovirus derived from an adenovirus selected from the group consisting of 08110601 (ChAd83), 08110602 (ChAd73), 08110603 (ChAd55), 08110604 (ChAdl47) and 08110605 (ChAdI 46).
- the derived adenovirus is one of the aforementioned deposited adenoviruses that has been altered by introducing a deletion or modification in its genome, e.g. to obtain a replication incompetent adenovirus and/or an adenovirus that is capable of expressing a transgene in a host cell.
- one or more genes selected from the group consisting of ElA, ElB, E2A, E2B, E3 and E4 gene can be deleted, rendered non- functional, and/or can be replaced by an expression cassette as outlined above.
- a skilled person is well aware of how to introduce these genomic alterations in the deposited strains. In this respect, methods of generating modified adenoviruses comprising a molecule for delivery into a target cell, which is a preferred modification of the deposited strains, have been described above.
- composition that comprises an immunological adjuvant and at least one of the following (i) through (iv): (i) an isolated protein according to the invention; (ii) an isolated polynucleotide according to the invention; (iii) a vector according to the invention;
- a composition according to the invention that comprises an adjuvant can be used as a vaccine, e.g. for human subjects.
- the immunological adjuvant also referred to herein in short as “adjuvant” accelerates, prolongs and/or enhances the quality and/or strength of an immune response to an antigen/immunogen, in comparison to the administration of the antigen alone, thus, reducing the quantity of antigen/immunogen necessary in any given vaccine, and/or the frequency of injection necessary in order to generate an adequate immune response to the antigen/immunogen of interest.
- adjuvants examples include gel-like precipitates of aluminum hydroxide (alum); AlPO 4 ; alhydrogel; bacterial products from the outer membrane of Gram-negative bacteria, in particular monophosphoryl lipid A (MPLA), lipopolysaccharides (LPS), muramyl dipeptides and derivatives thereof; Freund's incomplete adjuvant; liposomes, in particular neutral liposomes, liposomes containing the composition and optionally cytokines; non-ionic block copolymers; ISCOMATRIX adjuvant (Drane et al., 2007); unmethylated DNA comprising CpG dinucleotides (CpG motif), in particular CpG ODN with a phosphorothioate (PTO) backbone (CpG PTO ODN) or phosphodiester (PO) backbone (CpG PO ODN); synthetic lipopeptide derivatives, in particular Pam 3 Cys; lipoarabinomannan
- Non-ionic block polymers containing polyoxyethylene (POE) and polyoxypropylene (POP), such as POE-POP-POE block copolymers may be used as an adjuvant (Newman et al., 1998). This type of adjuvant is particularly useful for compositions comprising nucleic acids as active ingredient.
- various pharmaceutically acceptable excipients may be used.
- Preferred pharmaceutically acceptable excipients are mentioned below when discussing the uses according to the invention.
- Activation of specific receptors can stimulate an immune response.
- receptors are known to the skilled artisan and comprise, for example, cytokine receptors, in particular type I cytokine receptors, type II cytokine receptors, TNF receptors; and vitamin D receptor acting as transcription factor; and the Toll-like receptors 1 (TLRl), TLR-2, TLR 3, TLR4, TLR5, TLR-6, TLR7, and TLR9.
- TLRl Toll-like receptors 1
- TLR9 Toll-like receptors 1
- the adjuvant of the composition of the present invention may be one or more Toll-like receptor agonists.
- the adjuvant is a Toll-like receptor 4 agonist.
- the adjuvant is a Toll-like receptor 9 agonist, preferably being encoded by the nucleotide tccatgacgttcctgacgtt (SEQ ID NO: 2).
- the invention provides a cell, preferably a non-simian cell, comprising at least one of the following:
- the cell may be selected of a bacterial cell such as an E. coli cell, a yeast cell such as
- Saccharomyces cerevisiae or Pichia pastoris a plant cell, an insect cell such as SF9 or Hi5 cells, or a mammalian cell.
- mammalian cells are Chinese hamster ovary (CHO) cells, human embryonic kidney (HEK 293) cells, HELA cells, human hepatoma cells (e.g.
- Huh7.5 Huh7.5
- Hep G2 human hepatoma cells Hep 3B human hepatoma cells and the like.
- the cell comprises an isolated polyucleotide according to (ii)
- this polynucleotide may be present in the cell either (i) freely dispersed as such, or (ii) integrated into the host cell genome or mitochondrial DNA.
- the cell is a host cell, preferably a 293 cell or a
- PER.C6TM cell that expresses at least one adenoviral gene selected from the group consisting of EIa, EIb, E2a, E2b, E4, Ll, L2, L3, L4 and L5.
- isolated polynucleotide according to the invention the isolated protein according to the invention, the vector according to the invention, the recombinant adenovirus according to the invention and/or the pharmaceutical composition according to the invention for the therapy or prophylaxis of a disease.
- Adenoviral vectors have demonstrated great potential as vaccine vectors. Preclinical and clinical studies have demonstrated the feasibility of vector design, robust antigen expression and protective immunity using this system.
- a preferred embodiment is the use according to the invention, wherein the therapy or prophylaxis is a vaccination, e.g. for human subjects. Detailed instructions of how adenoviruses are used and prepared for vaccination are provided as ample literature comprised in the art and known to the skilled person.
- a recombinant adenovirus of the invention can be administered in an immunologically and/or prophylactically effective dose which is preferably 1 x 10 8 to 1 x 10 11 viral particles (i.e., 1 x 10 8 , 5 x 10 8 , 1 x 10 9 , 5 x 10 9 , 1 x 10 10 , 2.5 x 10 10 or 5 x 10 10 particles).
- an immunologically and/or prophylactically effective dose which is preferably 1 x 10 8 to 1 x 10 11 viral particles (i.e., 1 x 10 8 , 5 x 10 8 , 1 x 10 9 , 5 x 10 9 , 1 x 10 10 , 2.5 x 10 10 or 5 x 10 10 particles).
- a vaccination which requires a boosting it is preferred to apply a vaccination which requires a boosting.
- the vaccine comprises an adjuvant.
- Preferred immunological adjutants have been mentioned herein and can be used in such vaccine.
- a recombinant adenovirus prepared using a polynucleotide or recombinant adenoviral protein or fragment thereof according to the invention can be used to transduce a host cell with a polynucleotide, e.g. DNA.
- a polynucleotide e.g. DNA.
- adenovirus can be prepared to express any custom protein or polypeptide in a host cell.
- the therapy recited in the use according to the invention is gene therapy.
- an isolated polynucleotide, an isolated protein, a vector, a recombinant adenovirus and/or a pharmaceutical composition according to the invention is used for gene therapy and is administered to a subject to be treated, it is preferred that it is administered in a sufficiently large dose such that the treatment results in one or more cells of the patient being transfected, i.e. transduced.
- an effective dose which is preferably 1 x 10 8 to 5 x 10 11 viral particles (i.e., 1 x 10 8 , 5 x 10 8 , 1 x 10 9 , 5 x 10 9 , 1 x 10 10 , 2.5 x 10 10 , 5 x 10 10 , 1 x 10 11 or, most preferably, 5 x 10 n particles) is administered.
- the preferably heterologous polynucleotide that is comprised in the recombinant adenovirus of the invention is capable of expressing a protein or polypeptide in a host cell of the subject, wherein the protein or polypeptide comprises a signal peptide which effects secretion of the protein or polypeptide from said host cell.
- a patient in need of a certain protein can be treated using an adenovirus of the present invention which comprises a cDNA that encodes a secretable form of that protein.
- the isolated polynucleotide, isolated protein, vector, adenovirus and/or pharmaceutical composition according to the invention is formulated to further comprise one or more pharmaceutically acceptable diluents; carriers; excipients, including fillers, binders, lubricants, glidants, disintegrants, and adsorbents; and/or preservatives.
- the pharmaceutical according to the invention can be administered by various well known routes, including oral, rectal, intragastrical and parenteral administration, e.g. intravenous, intramuscular, intranasal, intradermal, subcutaneous and similar administration routes. Parenteral-, intramuscular- and intravenous administration is preferred.
- the pharmaceutical according to the invention is formulated as syrup, an infusion or injection solution, a tablet, a capsule, a capslet, lozenge, a liposome, a suppository, a plaster, a band-aid, a retard capsule, a powder, or a slow release formulation.
- the diluent is water, a buffer, a buffered salt solution or a salt solution and the carrier preferably is selected from the group consisting of cocoa butter and vitebesole.
- Particular preferred pharmaceutical forms for the administration of the pharmaceutical according to the invention during the use of the present invention are forms suitable for injectable use and include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
- a solution or dispersion will include a solvent or dispersion medium, containing, for example, water-buffered aqueous solutions, e.g. biocompatible buffers, ethanol, polyol, such as glycerol, propylene glycol, polyethylene glycol, suitable mixtures thereof, surfactants or vegetable oils.
- Infusion or injection solutions can be accomplished by any number of art recognized techniques including but not limited to addition of preservatives like anti-bacterial or anti-fungal agents, e.g. parabene, chlorobutanol, phenol, sorbic acid or thimersal. Further, isotonic agents, such as sugars or salts, in particular sodium chloride may be incorporated in infusion or injection solutions.
- Preferred diluents of the present invention are water, physiological acceptable buffers, physiological acceptable buffer salt solutions or salt solutions.
- Preferred carriers are cocoa butter and vitebesole.
- Excipients which can be used with the various pharmaceutical forms of the pharmaceutical according to the invention can be chosen from the following non-limiting list: a) binders such as lactose, mannitol, crystalline sorbitol, dibasic phosphates, calcium phosphates, sugars, microcrystalline cellulose, carboxymethyl cellulose, hydroxyethyl cellulose, polyvinyl pyrrolidone and the like; b) lubricants such as magnesium stearate, talc, calcium stearate, zinc stearate, stearic acid, hydrogenated vegetable oil, leucine, glycerids and sodium stearyl fumarates, c) disintegrants such as starches, croscaramellose, sodium methyl cellulose, agar, bentonite, alginic acid, carboxymethyl cellulose, polyvinyl pyrrolidone and the like.
- binders such as lactose, mannitol, crystalline sorb
- Certain amounts of the pharmaceutical according to the invention are preferred for the therapy or prophylaxis of a disease. It is, however, understood that depending on the severity of the disease, the type of the disease, as well as on the respective patient to be treated, e.g. the general health status of the patient, etc., different doses of the pharmaceutical according to the invention are required to elicit a therapeutic or prophylactic effect. The determination of the appropriate dose lies within the discretion of the attending physician. If the pharmaceutical according to the invention is to be used prophylactically, it may be formulated as a vaccine. In this case the pharmaceutical according to the invention is preferably administered in above outlined preferred and particular preferred doses.
- the administration of the vaccine is repeated at least two, three, four, five, six, seven, eight nine or at least 10 times over the course of a defined period of time, until the vaccinated subject has generated sufficient antibodies against the pharmaceutical according to the invention so that the risk of developing the respective disease has lessened.
- the period of time in this case is usually variable depending on the antigenicity of the vaccine.
- the period of time is not more than four weeks, three months, six months or three years.
- at least one of the hyper variable domains of the hexon protein can be replaced by an immunogenic epitope of the respective disease agent that the vaccination is directed against.
- Vaccines typically contain one or more adjuvants as outlined above.
- a detailed summary of the use of adenoviruses for vaccination and methods pertaining thereto is provided in: Bangari DS and Mittal SK (2006) Vaccine, 24(7), p. 849-862; see also: Zhou D, et al., Expert Opin Biol Ther. 2006 Jan;6(l):63-72; and: Folgori A, et al., Nat Med. 2006 Feb; 12(2): 190-7.; see also: Draper SJ, et al., Nat Med. 2008 Aug;14(8):819- 21. Epub 2008 Jul 27.
- Fig. 1 Multiple sequence alignment between hexon proteins of various adenovirus isolates, using Clustal-W with default settings.
- ChAd55 refers to ChAd55 adenovirus.
- further hexon proteins of novel chimpanzee adenovirus isolates are shown
- Fig. 2 Multiple sequence alignment between fiber proteins of adenovirus ChAd55 and of further novel chimpanzee adenovirus isolates (designated as PanAdl, ChAd73, ChAd83,
- ChAd 146 and ChAd 147 using Clustal-W with default settings.
- Fig. 4 Diagram of construction of a replication-defective adenovirus vector by homologous recombination with wild type viral genome and the corresponding shuttle plasmid. See also example 2 .
- Fig. 5 Cell-mediated immune response in mice vaccinated with recombinant adenoviruses comprising an expression cassette for the expression of HIV gag protein (SEQ ID NO:1).
- the vaccination potency of recombinant human Ad5 and chimpanzee ChAd55 was compared (Fig. 5A) and of recombinant human Ad5 and bonobo PanAdl adenovirus was compared (Fig. 5B).
- the immune response was measured by Interferon- ⁇ ELIspot assay by incubating the cells with a CD8 HIV gag epitope mapped in Balb/C mice. The results are reported as spot forming cells per 10 6 splenocytes.
- Fig. 6 The seroprevalence of novel adenovirus vectors was evaluated on a panel of human sera of European origin.
- Neutralizing antibodies were only detected against Ad5 and CV-68 adenoviruses but not for any of the novel adenoviruses of the present invention.
- ChAd55, ChAd73, ChAd83, ChAd 146, ChAd 147 are a group of chimpanzee adenoviruses obtained from healthy animals housed in different European and US facilities. ChAd55, ChAd73, ChAd83, ChAdl46, ChAdl47 have the property of no detectable reactivity with human sera.
- PanAdl is a new adenovirus isolated from healthy bonobos (Pan Paniscus) housed in different European and US facilities. PanAdl has the property of no detectable reactivity with human sera.
- the common chimpanzee and bonobo adenovirus stocks were cloned by infecting 293 cells seeded in 96-well plates, after the first passage of amplification.
- the virus cloning was performed by limiting dilution of the cell lysate obtained at the first passage of the virus amplification. 5 isolated clones were picked up and serially propagated. After 3-4 serial passages of amplification, a large-scale preparation of adenovirus was performed on cells planted on 5 two-layer cell-factories (NUNC) (200 millions of cells/cell factory). Purified viral particles were obtained from cell lysate by two ultra-centrifugation steps on cesium chloride density gradients.
- NUNC two-layer cell-factories
- Genomic DNA was isolated from 3 X 10 12 pp of purified virus preparation by digestion with Proteinase K (0.5 mg/ml) in 1% SDS-TEN (2 hrs at 55°C). After a Phenol-Chloroform extraction and Ethanol precipitation, the genomic DNA was resuspended in water and submitted for genomic sequencing.
- HVR7 hypervariable region 7
- TGTCCTACCARCTCTTGCTTGA SEQ ID NO. 3
- GTGGAARGGCACGTAGCG SEQ ID NO. 4
- the HVR7 was amplified by PCR using purified viral DNA or crude 293 lysate as template and then sequenced. More detailed information about the isolate was obtained by sequencing the hypervariable regions 1 to 6.
- the DNA region containing HVR 1-6 was amplified by PCR using oligonucleotides HVRl -6fd, CAYGATGTGACCACCGACCG (SEQ ID NO.
- HVRl -6rev GTGTTYCTGTCYTGCAAGTC (SEQ ID NO. 6).
- subgroup E Chond55, ChAd73, ChAd83, ChAdI 46, ChAd 147)
- subgroup C PanAdl of human Ad virus classification (Horowitz, MS (1990), Adenoviridae and their replication. In Virology B.N. Fields and D.M. Knipe, eds (raven Press, New York) pp.1679- 1740).
- a phylogenetic tree was obtained by alignment of human and chimp adenovirus hexon amino acid sequences. The results are consistent with the initial classification based on nucleotide sequence alignment limited to hexon HVRl -6 and 7 by using Align X program (Informax, Inc) demonstrating a close phylogenetic relationship of ChAd55, ChAd73, ChAd83, ChAd 146, ChAd 147 isolates with human Ad4 (subgroup E) while bonobo adenovirus isolate PanAdl is related to human AdI, 2, 5, 6 (subgroup C).
- Example 2 Vector construction The PanAdl and ChAd55, ChAd73, ChAd83, ChAdl46, ChAdl47 virus genomes were cloned in a plasmid vector following the strategy detailed below. All manipulations of the vector genome were performed in E.coli following standard techniques. Vector systems were developed by deleting El and E3 regions from ChAd and PanAd backbones. The El region was substituted with expression cassettes based on human CMV IE promoter and BGHpA signal containing HCV non structural region (HCV NS) and HIV gag (SEQ ID NO: 1) genes for the evaluation of the immunological potency in animal models.
- HCV NS HCV non structural region
- SEQ ID NO: 1 HIV gag
- ChAd and PanAd vectors expressing the secreted alkaline phosphatase gene were constructed for the neutralization assay.
- the vectors were propagated in 293 cells and purified by CsCl gradients following standard protocols.
- the construction of PanAd 1 ⁇ E1 vectors proceeded through the steps provided below.
- PanAd 1 genome was used to construct a shuttle vector for cloning by homologous recombination the entire genome of PanAd 1. Briefly, the shuttle vector used to clone bonobo adenovirus 1 referred to herein as pBAdlRLD EGFP was constructed as follows: PanAd 1 left end (nt 1-450) was amplified by PCR with oligonucleotides
- PanAdl right end (nt 37362-37772) was then amplified by PCR with oligonucleotides 5'- TCCAGCGGCGCGCCAGACCCGAGTCTTACCAGGA-3' (SEQ ID NO: 9) and 5'- ATTCAGGATCCGAATTCGTTTAAACCATCATCAATAATATACCTTATTTTG-S ' (SEQ ID NO: 10), and cloned in pBAdl-L thus generating plasmid pBAdl-RL.
- a PanAdl DNA fragment (nt 3498-4039) containing pIX coding region was subsequently amplified by PCR with the oligonucleotides 5'- TATTCTGCGATCGCTGAGGTGGGTGAGTGGGCG -3' (SEQ ID NO: 11) and 5'- TTACTGGCGCGCCTGCCTCGAGTAAACGGCATTTGCAGGAGAAG-S' (SEQ ID NO: 12) then cloned into pBAdl-RL obtaining the plasmid pBAdlRLD EGFP shuttle.
- Shuttle plasmids containing the expression cassettes for secreted alkaline phosphatase (SEAP), HIV gag, HCV non structural region (NS) genes were also constructed by substituting the EGFP gene in pBAdlRLD EGFP shuttle.
- the HIV gag HCV NS region , SEAP and EGFP expression cassette based on human cytomegalovirus (HCMV) promoter and bovine growth hormone polyadenylation signal (Bgh polyA) were constructed as described in Emini et al., International Publication Number WO 03/031588.
- the viral DNA cassette was designed to contain restriction enzyme sites (Pmel) that are present only at the end of both ITRs to allow the release of viral DNA from plasmid DNA.
- PanAdl vector was constructed by homologous recombination in E. coli strain BJ5183.
- BJ5183 cells were co-transformed with PanAdl purified viral DNAs and pBAdlRLD-EGFP or pBAdlRLD-Gag.
- Homologous recombination between pIX genes, right ITR DNA sequences present at the ends of linearized pBAd IRLD-EGFP or pBAdlRLD-Gag and viral genomic DNAs allowed its insertion in the plasmid vector, by deleting at the same time the El region that was substituted by the expression cassette.
- a deletion of the entire E3 region spanning from nucleotide 28636 to nucleotide 32596 of PanAdl genomic sequence was introduced into PanAdl vector backbone by using a strategy involving several steps of cloning and homologous recombination in E. coli.
- the HIV gag and HCV NS region expression cassette based on human cytomegalovirus (HCMV) promoter and bovine growth hormone polyadenylation signal (Bgh poly A) was constructed as described in Emini et al., International Publication Number WO 03/031588 and inserted into PanAdl ⁇ El,E3/ EGFP vector by homologous recombination in E. coli strain BJ5183 exploiting the homologies between HCMV and Bgh polyA DNA sequences.
- ChAd55 shuttle was constructed by following the same strategy described above for PanAd vectors then used for the cloning of the ChAd55 viral genomes.
- the shuttle vector pARS ChAd55 containing the left end of viral genome from the ITR to the pDC gene with the El region deleted and substituted with the expression cassette was linearized with Ascl restriction enzyme and co-transformed into E. coli strain BJ5183 with ChAd55 purified viral DNA.
- Expression cassettes based on human cytomegalovirus (HCMV) promoter and bovine growth hormone poly-adenylation signal (Bgh polyA) were constructed to express secreted alkaline phosphatase (SEAP), EGFP, HIV gag , HCV NS genes. All expression cassettes were inserted into the single SnaBI site of pARS ChAd55 vector to be transferred by homologous recombination into the ⁇ E1 adenovirus pre-plasmids.
- HCMV human cytomegalovirus
- Bgh polyA bovine growth hormone poly-adenylation signal
- Example 3 Immunization experiments. The efficiency of ChAd55 and PanAdl vectors as potential recombinant vaccine was evaluated in mice with vectors expressing HIV gag transgene. The vector potency was compared with human Ad5 gag in immunization experiments performed in parallel. Groups of 10 animals were injected in the quadriceps with a dose of the vector of 10 vp/mouse for Ad5gag or ChAd55gag (Fig. 5A). In a separate experiment a group of 5 animals were injected with a dose of the vector of 10 8 vp/mouse for Ad5gag or PanAdl gag (Fig. 5B).
- the immune response elicited against HIV gag was measured by Interferon- ⁇ Elispot assay on splenocytes.
- the results of immunization experiments with ChAd55 and PanAdl in comparison with human Ad5 gag vector show that the novel adenoviruses of the invention are at least as effective in eliciting a specific immune response as the prior art recombinant adenovirus Ad5. Due to the close relatedness in sequence identity of the novel isolated adenoviruses of the invention it is expected that also the remaining adenoviruses ChAd73, ChAd83, ChAdl46 and ChAdl47 will show a similar immunization potency.
- Example 4 Neutralization Studies Neutralization assays were carried out in order to evaluate the prevalence in human sera of neutralizing antibodies against the common chimpanzee adenovirus 55 and the Bonobo adenovirus type 1, 2 and 3. The assay evaluated the effects of serum preincubation on the ability of ChAd55, PanAdl carrying the gene for secreted alkaline phosphatase (SEAP) to transduce human 293 cells.
- SEAP alkaline phosphatase
- the neutralization titer is defined as the dilution of serum giving a 50% reduction of the SEAP activity observed in the positive control with the virus in absence of serum. Each serum sample was tested at various dilutions (five 4-fold increments starting from 1/18 dilution through 1 :4608).
- ChAd73, ChAd83, ChAdl46 and ChAdl47 represent the ideal solution to the problem of the pre-existing anti-human Ad immunity that limits the administration of viral vectors based on common human Ad serotypes such as Ad5.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
La présente invention concerne de nouvelles souches d'adénovirus ayant une séroprévalence améliorée chez l'homme. Sous un aspect, la présente invention concerne des polypeptides isolés de protéines de capside adénovirale telles que les protéines hexon, penton et fibre et les fragments de celles-ci et des polynucléotides codant pour ceux-ci. L'invention concerne également un vecteur comportant le polynucléotide isolé selon l'invention, des adénovirus comportant les polynucléotides ou polypeptides isolés selon l'invention et une composition pharmaceutique comportant ledit vecteur, adénovirus, polypeptide et/ou polynucléotide. L'invention concerne également l'utilisation des polynucléotides isolés, des polypeptides isolés, du vecteur, des adénovirus et/ou de la composition pharmaceutique pour la thérapie ou la prophylaxie d'une maladie.
Priority Applications (39)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PCT/EP2009/000672 WO2010085984A1 (fr) | 2009-02-02 | 2009-02-02 | Séquences d'acide nucléique et d'acides aminés d'adénovirus simiens, vecteurs les contenant et leurs utilisations |
PL10702615T PL2391638T3 (pl) | 2009-02-02 | 2010-02-02 | Sekwencje nukleotydowe i aminokwasowe małpiego adenowirusa, zawierające je wektory i ich zastosowania |
CN201510427025.4A CN105112428B (zh) | 2009-02-02 | 2010-02-02 | 猿腺病毒核酸和氨基酸序列,包含其的载体及其用途 |
SI201031745T SI2391638T1 (sl) | 2009-02-02 | 2010-02-02 | Nukleinskokislinske in aminokislinske sekvence opičjega adenovirusa, vektorji, ki le-te vsebujejo, in njihova uporaba |
KR1020167024396A KR101763093B1 (ko) | 2009-02-02 | 2010-02-02 | 시미안 아데노바이러스 핵산- 및 아미노산-서열, 이를 포함하는 벡터 및 이의 용도 |
NZ603348A NZ603348A (en) | 2009-02-02 | 2010-02-02 | Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof |
CA3108979A CA3108979A1 (fr) | 2009-02-02 | 2010-02-02 | Sequences d'acide amine et d'acide nucleique d'adenovirus simien, vecteurs les contenant, et utilisations afferentes |
EP18173908.7A EP3385387B1 (fr) | 2009-02-02 | 2010-02-02 | Séquences d'acide aminé et d'acide nucléique d'adénovirus simien, vecteurs les contenant, et utilisations afférentes |
SG2011050275A SG172935A1 (en) | 2009-02-02 | 2010-02-02 | Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof |
HUE10702615A HUE039908T2 (hu) | 2009-02-02 | 2010-02-02 | Majom adenovírusból származó nukleinsav- és aminosav-szekvenciák, azt tartalmazó vektorok és alkalmazásuk |
CA2749325A CA2749325C (fr) | 2009-02-02 | 2010-02-02 | Sequences d'acide amine et d'acide nucleique d'adenovirus simien, vecteurs les contenant, et utilisations afferentes |
EP10702615.5A EP2391638B1 (fr) | 2009-02-02 | 2010-02-02 | Séquences d'acide aminé et d'acide nucléique d'adénovirus simien, vecteurs les contenant, et utilisations afférentes |
DK10702615.5T DK2391638T3 (en) | 2009-02-02 | 2010-02-02 | Abeadenovirus nucleic acid and amino acid sequences, vectors containing them, and uses thereof. |
RU2011136282/10A RU2604815C2 (ru) | 2009-02-02 | 2010-02-02 | Нуклеинокислотные и аминокислотные последовательности аденовируса обезьян, векторы, содержащие указанные последовательности, и их применение |
BRPI1008018A BRPI1008018A2 (pt) | 2009-02-02 | 2010-02-02 | ácidos nucleicos de adenovírus símio e sequências de aminoácidos, vetores contendo os mesmos e uso dos mesmos |
ES10702615T ES2687294T3 (es) | 2009-02-02 | 2010-02-02 | Secuencias de aminoácidos y de ácidos nucleicos de adenovirus de simio, vectores que las contienen, y sus usos |
AU2010209938A AU2010209938A1 (en) | 2009-02-02 | 2010-02-02 | Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof |
PT10702615T PT2391638T (pt) | 2009-02-02 | 2010-02-02 | Sequências de aminoácidos e ácidos nucleicos de adenovírus símio, vetores contendo as mesmas, e as suas utilizações |
JP2011546719A JP5882741B2 (ja) | 2009-02-02 | 2010-02-02 | サルアデノウイルスの核酸配列及びアミノ酸配列、それを含有するベクター、並びにその使用 |
KR1020117017573A KR101761425B1 (ko) | 2009-02-02 | 2010-02-02 | 시미안 아데노바이러스 핵산- 및 아미노산-서열, 이를 포함하는 벡터 및 이의 용도 |
CN201080006197XA CN102300872A (zh) | 2009-02-02 | 2010-02-02 | 猿腺病毒核酸和氨基酸序列,包含其的载体及其用途 |
SG2014007959A SG2014007959A (en) | 2009-02-02 | 2010-02-02 | Simian adenovirus nucleic acid- and amino acid- sequences, vectors containing same, and uses thereof |
LTEP10702615.5T LT2391638T (lt) | 2009-02-02 | 2010-02-02 | Beždžionių adenoviruso nukleorūgšties ir aminorūgščių sekos, vektoriai, turintys sekas ir jų panaudojimas |
SG10201900819SA SG10201900819SA (en) | 2009-02-02 | 2010-02-02 | Simian adenovirus nucleic acid- and amino acid- sequences, vectors containing same, and uses thereof |
MX2011007980A MX2011007980A (es) | 2009-02-02 | 2010-02-02 | Secuencias de acido nucleico y aminoacido de adenovirus de simio, vectores que contienen los mismos y usos de las mismas. |
PCT/EP2010/000616 WO2010086189A2 (fr) | 2009-02-02 | 2010-02-02 | Séquences d'acide aminé et d'acide nucléique d'adénovirus simien, vecteurs les contenant, et utilisations afférentes |
ES18173908T ES2898235T3 (es) | 2009-02-02 | 2010-02-02 | Secuencias de aminoácidos y de ácidos nucleicos de adenovirus de simio, vectores que las contienen, y sus usos |
NZ59435510A NZ594355A (en) | 2009-02-02 | 2010-02-02 | Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof |
US13/147,193 US9718863B2 (en) | 2009-02-02 | 2010-02-06 | Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof |
IL214097A IL214097B (en) | 2009-02-02 | 2011-07-14 | Nucleic Acid and Amino Acid Sequences of Simian Adenovirus Vectors Containing Them and Their Uses |
IL241494A IL241494A0 (en) | 2009-02-02 | 2015-09-10 | Nucleic acid and amino acid sequences of simian adenovirus, vectors containing them and their uses |
AU2015238866A AU2015238866B2 (en) | 2009-02-02 | 2015-10-08 | Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof |
JP2016019877A JP6262779B2 (ja) | 2009-02-02 | 2016-02-04 | サルアデノウイルスの核酸配列及びアミノ酸配列、それを含有するベクター、並びにその使用 |
US15/623,723 US10544192B2 (en) | 2009-02-02 | 2017-06-15 | Chimpanzee clade E adenovirus nucleic acid-and amino acid-sequences, vectors containing same, and uses thereof |
AU2017204292A AU2017204292B2 (en) | 2009-02-02 | 2017-06-23 | Simian adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof |
JP2017238046A JP2018078894A (ja) | 2009-02-02 | 2017-12-12 | サルアデノウイルスの核酸配列及びアミノ酸配列、それを含有するベクター、並びにその使用 |
HRP20181377TT HRP20181377T1 (hr) | 2009-02-02 | 2018-08-28 | Nukleinskokiselinski i aminokiselinski sljedovi majmunskog adenovirusa, vektori koji ih sadrže, te njihova upotreba |
CY181100894T CY1120652T1 (el) | 2009-02-02 | 2018-08-28 | Αλληλουχιες νουκλεϊνικου οξεος και αμινοξεος αδενοϊου πιθηκοειδους, φορεις που περιεχουν αυτες και χρησεις αυτων |
US16/710,131 US11214599B2 (en) | 2009-02-02 | 2019-12-11 | Recombinant simian adenoviral vectors encoding a heterologous fiber protein and uses thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PCT/EP2009/000672 WO2010085984A1 (fr) | 2009-02-02 | 2009-02-02 | Séquences d'acide nucléique et d'acides aminés d'adénovirus simiens, vecteurs les contenant et leurs utilisations |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2010085984A1 true WO2010085984A1 (fr) | 2010-08-05 |
Family
ID=41165487
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2009/000672 WO2010085984A1 (fr) | 2009-02-02 | 2009-02-02 | Séquences d'acide nucléique et d'acides aminés d'adénovirus simiens, vecteurs les contenant et leurs utilisations |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN105112428B (fr) |
NZ (1) | NZ603348A (fr) |
WO (1) | WO2010085984A1 (fr) |
Cited By (49)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2012071318A3 (fr) * | 2010-11-23 | 2012-09-27 | The Trustees Of The University Of Pennsylvania | Adénovirus simiens de la sous-famille e a1321, a1325, a1295, a1309, a1316 et a1322 et utilisations de ceux-ci |
WO2013074501A1 (fr) | 2011-11-14 | 2013-05-23 | Crucell Holland B.V. | Immunisation primovaccination-rappel hétérologue à l'aide de vaccins à base du virus de la rougeole |
WO2013135615A1 (fr) | 2012-03-12 | 2013-09-19 | Crucell Holland B.V. | Lots d'adénovirus recombinants ayant des extrémités terminales modifiées |
WO2013173702A2 (fr) | 2012-05-18 | 2013-11-21 | The Trustees Of The University Of Pennsylvania | Adénovirus simiens de la sous-famille e a1302, a1320, a1331 et a1337 et leurs utilisations |
US8932607B2 (en) | 2012-03-12 | 2015-01-13 | Crucell Holland B.V. | Batches of recombinant adenovirus with altered terminal ends |
WO2015092710A1 (fr) | 2013-12-19 | 2015-06-25 | Glaxosmithkline Biologicals, S.A. | Administration simultanée controlatérale de vaccins |
WO2016049287A1 (fr) | 2014-09-26 | 2016-03-31 | Beth Israel Deaconess Medical Center, Inc. | Méthodes et compositions d'induction d'une immunité protectrice contre l'infection par le virus de l'immunodéficience humaine |
WO2016166088A1 (fr) | 2015-04-14 | 2016-10-20 | Janssen Vaccines & Prevention B.V. | Adénovirus recombiné exprimant deux transgènes avec un promoteur bidirectionnel |
WO2016198599A1 (fr) * | 2015-06-12 | 2016-12-15 | Glaxosmithkline Biologicals S.A. | Polypeptides et polynucléotides d'adénovirus |
US9597363B2 (en) | 2008-03-04 | 2017-03-21 | The Trustees Of The University Of Pennsylvania | Simian adenoviruses SAdV-36, -42.1, -42.2, and -44 and uses thereof |
WO2017220499A1 (fr) | 2016-06-20 | 2017-12-28 | Janssen Vaccines & Prevention B.V. | Promoteur bidirectionnel puissant et équilibré |
WO2018011768A1 (fr) | 2016-07-15 | 2018-01-18 | Janssen Vaccines And Prevention B.V. | Méthodes et compositions permettant l'induction d'une immunité protectrice contre l'infection par le virus de marburg |
WO2018011198A1 (fr) | 2016-07-15 | 2018-01-18 | Janssen Vaccines & Prevention B.V. | Méthodes d'induction d'une immunité protectrice contre l'infection par le virus de l'immunodéficience humaine. |
WO2018104919A1 (fr) | 2016-12-09 | 2018-06-14 | Glaxosmithkline Biologicals Sa | Constructions d'adénovirus de chimpanzé avec des antigènes de lyssavirus |
BE1024824B1 (fr) * | 2015-06-12 | 2018-07-13 | Glaxosmithkline Biologicals Sa | Polynucleotides et polypeptides d'adenovirus |
WO2018138667A1 (fr) | 2017-01-25 | 2018-08-02 | Glaxosmithkline Biologicals Sa | Nouvelle formulation |
WO2018146205A1 (fr) | 2017-02-09 | 2018-08-16 | Janssen Vaccines & Prevention B.V. | Promoteur puissant et court pour l'expression de gènes hétérologues |
WO2018185732A1 (fr) | 2017-04-06 | 2018-10-11 | Janssen Vaccines & Prevention B.V. | Régime de primo-vaccination/rappel par mva-bn et ad26.zebov ou ad26.filo |
WO2018229711A1 (fr) | 2017-06-15 | 2018-12-20 | Janssen Vaccines & Prevention B.V. | Vecteurs à poxvirus codant pour des antigènes du vih, et leurs procédés d'utilisation |
WO2019016756A1 (fr) | 2017-07-21 | 2019-01-24 | Glaxosmithkline Biologicals Sa | Constructions d'antigène du virus chikungunya |
WO2019023566A1 (fr) | 2017-07-28 | 2019-01-31 | Janssen Vaccines & Prevention B.V. | Méthodes et compositions pour assurer l'immunisation contre l'arnrep hétérologue |
WO2019099970A1 (fr) | 2017-11-20 | 2019-05-23 | Janssen Pharmaceuticals Inc. | Procédé d'administration sûre de vecteurs adénoviraux codant pour un antigène du virus zika |
WO2019123250A1 (fr) | 2017-12-19 | 2019-06-27 | Janssen Sciences Ireland Unlimited Company | Méthodes et compositions permettant d'induire une réponse immunitaire contre le virus de l'hépatite b (vhb) |
EP3584252A1 (fr) | 2015-12-15 | 2019-12-25 | Janssen Vaccines & Prevention B.V. | Antigènes, vecteurs, compositions du virus de l'immunodéficience humaine et leurs procédés d'utilisation |
WO2020016394A1 (fr) | 2018-07-20 | 2020-01-23 | Janssen Vaccines & Prevention B.V. | Vecteur adénoviral recombinant exprimant un antigène zika à productivité améliorée |
WO2020030572A1 (fr) | 2018-08-07 | 2020-02-13 | Glaxosmithkline Biologicals Sa | Processus et vaccins |
US10561721B2 (en) | 2014-09-03 | 2020-02-18 | Bavarian Nordic A/S | Methods and compositions for inducing protective immunity against filovirus infection |
US10561722B2 (en) | 2014-09-03 | 2020-02-18 | Bavarian Nordic A/S | Methods and compositions for enhancing immune responses |
CN111356466A (zh) * | 2017-10-31 | 2020-06-30 | 扬森疫苗与预防公司 | 腺病毒及其用途 |
WO2021228842A1 (fr) | 2020-05-11 | 2021-11-18 | Janssen Pharmaceuticals, Inc. | Protéines de fusion de protéine de spicule de coronavirus stabilisées |
EA039001B1 (ru) * | 2015-08-19 | 2021-11-19 | Глаксосмитклайн Байолоджикалс С.А. | Аденовирусные полинуклеотиды и полипептиды |
WO2022002894A1 (fr) | 2020-06-29 | 2022-01-06 | Janssen Vaccines & Prevention B.V. | Association de vaccin contre une infection par le virus respiratoire syncytial |
WO2022008438A1 (fr) | 2020-07-06 | 2022-01-13 | Janssen Pharmaceuticals, Inc. | Protéines de spicule de coronavirus stabilisées à titre de protéines de fusion |
WO2022008613A1 (fr) | 2020-07-08 | 2022-01-13 | Janssen Sciences Ireland Unlimited Company | Vaccins à base de réplicon d'arn contre le vhb |
US11384122B2 (en) | 2020-01-31 | 2022-07-12 | Janssen Pharmaceuticals, Inc. | Compositions and methods for preventing and treating coronavirus infection—SARS-CoV-2 vaccines |
WO2022175479A1 (fr) | 2021-02-19 | 2022-08-25 | Janssen Vaccines & Prevention B.V. | Associations de vaccins contre les infections par les souches a et b du virus respiratoire syncytial |
WO2022175477A1 (fr) | 2021-02-19 | 2022-08-25 | Janssen Vaccines & Prevention B.V. | Antigènes fb de vrs de pré-fusion stabilisés |
WO2022207839A2 (fr) | 2021-04-01 | 2022-10-06 | Janssen Vaccines & Prevention B.V. | Protéines piv3 f de pré-fusion stabilisées |
US11473105B2 (en) | 2016-05-12 | 2022-10-18 | Janssen Vaccines & Prevention B.V. | Potent and balanced bidirectional promoter |
WO2023020939A1 (fr) | 2021-08-17 | 2023-02-23 | Janssen Pharmaceuticals, Inc. | Vaccins contre le sars-cov-2 |
WO2023026182A1 (fr) | 2021-08-24 | 2023-03-02 | Janssen Pharmaceuticals, Inc. | Vaccins anti-sars-cov-2 |
WO2023047349A1 (fr) | 2021-09-24 | 2023-03-30 | Janssen Pharmaceuticals, Inc. | Protéines de fusion protéines de spicule de coronavirus stabilisées |
WO2023047348A1 (fr) | 2021-09-24 | 2023-03-30 | Janssen Pharmaceuticals, Inc. | Protéines de fusion de protéine de spicule de coronavirus stabilisées |
WO2023110618A1 (fr) | 2021-12-16 | 2023-06-22 | Janssen Vaccines & Prevention B.V. | Protéines de fusion hmpv pré-hybrides stabilisées |
WO2023111725A1 (fr) | 2021-12-14 | 2023-06-22 | Janssen Pharmaceuticals, Inc. | Vaccins anti-sars-cov-2 |
WO2023198815A1 (fr) | 2022-04-14 | 2023-10-19 | Janssen Vaccines & Prevention B.V. | Administration séquentielle d'adénovirus |
WO2024061757A1 (fr) | 2022-09-23 | 2024-03-28 | Janssen Vaccines & Prevention B.V. | Protéines f du piv1 humain en pré-fusion |
WO2024061759A1 (fr) | 2022-09-23 | 2024-03-28 | Janssen Vaccines & Prevention B.V. | Protéines s de coronavirus stabilisées |
WO2024074584A1 (fr) | 2022-10-06 | 2024-04-11 | Janssen Vaccines & Prevention B.V. | Protéines f du piv3 sous forme pré-fusion stabilisées |
Families Citing this family (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3504230A1 (fr) * | 2016-08-23 | 2019-07-03 | GlaxoSmithKline Biologicals SA | Peptides de fusion avec des antigènes liés à des fragments courts de chaîne invariante (cd74) |
CN111108192B (zh) * | 2017-07-05 | 2023-12-15 | Nouscom股份公司 | 非人类人猿腺病毒核酸序列和氨基酸序列、含有其的载体及其用途 |
SG11202003399TA (en) * | 2017-10-31 | 2020-05-28 | Janssen Vaccines & Prevention Bv | Adenovirus and uses thereof |
MA50502A (fr) * | 2017-10-31 | 2020-09-09 | Janssen Vaccines & Prevention Bv | Adénovirus et utilisations associées |
KR20210081325A (ko) * | 2018-10-19 | 2021-07-01 | 노우스콤 아게 | 경골어류 불변 사슬 암 백신 |
CN113897388B (zh) * | 2020-07-06 | 2024-05-31 | 嘉兴安宇生物科技有限公司 | 一种新型黑猩猩腺病毒载体及其构建方法和应用 |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003046124A2 (fr) * | 2001-11-21 | 2003-06-05 | The Trustees Of The University Of Pennsylvania | Sequences d'acides nucleiques et d'acides amines d'adenovirus simiens, vecteurs les contenant et procedes d'utilisation associes |
WO2005071093A2 (fr) * | 2004-01-23 | 2005-08-04 | Istituto Di Ricerche Di Biologia Molecolare P Angeletti Spa | Porteurs de vaccin adenoviral de chimpanze |
WO2009073104A2 (fr) * | 2007-11-28 | 2009-06-11 | The Trustees Of The University Of Pennsylvania | Adénovirus simiens sadv-39, -25.2, -26, -30, -37, et -38 de la sous-famille e et utilisations de ceux-ci |
Family Cites Families (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7138103B2 (en) * | 1998-06-22 | 2006-11-21 | Immunomedics, Inc. | Use of bi-specific antibodies for pre-targeting diagnosis and therapy |
EP1409012B1 (fr) * | 2001-06-22 | 2009-02-11 | The Wistar Institute Of Anatomy And Biology | Procedes visant a induire une reaction immunitaire cytotoxique et compositions d'adenovirus simien recombine utiles a cet effet |
US7291498B2 (en) * | 2003-06-20 | 2007-11-06 | The Trustees Of The University Of Pennsylvania | Methods of generating chimeric adenoviruses and uses for such chimeric adenoviruses |
ATE492643T1 (de) * | 2004-10-13 | 2011-01-15 | Crucell Holland Bv | Verbesserte adenovirusvektoren und deren verwendung |
BRPI0609362A2 (pt) * | 2005-04-11 | 2010-03-30 | Us Gov Health & Human Serv | vetor de adenovìrus recombinante, adenovìrus recombinante, composição imunogênica e método para a produção da referida composição imunogênica |
JP2008541730A (ja) * | 2005-05-23 | 2008-11-27 | ヴァクシン インコーポレイテッド | 高力価かつ複製コンピテントアデノウイルス不含である組換えアデノウイルスベクターの迅速な作成法 |
-
2009
- 2009-02-02 WO PCT/EP2009/000672 patent/WO2010085984A1/fr active Application Filing
-
2010
- 2010-02-02 CN CN201510427025.4A patent/CN105112428B/zh active Active
- 2010-02-02 NZ NZ603348A patent/NZ603348A/en not_active IP Right Cessation
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2003046124A2 (fr) * | 2001-11-21 | 2003-06-05 | The Trustees Of The University Of Pennsylvania | Sequences d'acides nucleiques et d'acides amines d'adenovirus simiens, vecteurs les contenant et procedes d'utilisation associes |
WO2005071093A2 (fr) * | 2004-01-23 | 2005-08-04 | Istituto Di Ricerche Di Biologia Molecolare P Angeletti Spa | Porteurs de vaccin adenoviral de chimpanze |
WO2009073104A2 (fr) * | 2007-11-28 | 2009-06-11 | The Trustees Of The University Of Pennsylvania | Adénovirus simiens sadv-39, -25.2, -26, -30, -37, et -38 de la sous-famille e et utilisations de ceux-ci |
Non-Patent Citations (6)
Title |
---|
FARINA S F ET AL: "Replication-defective vector based on a Chimpanzee adenovirus", JOURNAL OF VIROLOGY, THE AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 75, no. 23, 1 December 2001 (2001-12-01), pages 11603 - 11613, XP002957497, ISSN: 0022-538X * |
MCCOY KIMBERLY ET AL: "Effect of preexisting immunity to adenovirus human serotype 5 antigens on the immune responses of nonhuman primates to vaccine regimens based on human- or chimpanzee-derived adenovirus vectors.", JOURNAL OF VIROLOGY JUN 2007, vol. 81, no. 12, June 2007 (2007-06-01), pages 6594 - 6604, XP002551699, ISSN: 0022-538X * |
PERUZZI D ET AL: "A novel Chimpanzee serotype-based adenoviral vector as delivery tool for cancer vaccines", VACCINE, BUTTERWORTH SCIENTIFIC. GUILDFORD, GB, vol. 27, no. 9, 20 January 2009 (2009-01-20), pages 1293 - 1300, XP026194421, ISSN: 0264-410X, [retrieved on 20090120] * |
ROY ET AL: "Partial protection against H5N1 influenza in mice with a single dose of a chimpanzee adenovirus vector expressing nucleoprotein", VACCINE, BUTTERWORTH SCIENTIFIC. GUILDFORD, GB, vol. 25, no. 39-40, 15 September 2007 (2007-09-15), pages 6845 - 6851, XP022250370, ISSN: 0264-410X * |
ROY S ET AL: "Complete nucleotide sequences and genome organization of four chimpanzee adenoviruses", VIROLOGY, ACADEMIC PRESS,ORLANDO, US, vol. 324, no. 2, 1 July 2004 (2004-07-01), pages 361 - 372, XP004519188, ISSN: 0042-6822 * |
TATSIS N ET AL: "Chimpanzee-origin adenovirus vectors as vaccine carriers", GENE THERAPY, MACMILLAN PRESS LTD., BASINGSTOKE, GB, vol. 13, no. 5, 1 March 2006 (2006-03-01), pages 421 - 429, XP002527576, ISSN: 0969-7128 * |
Cited By (80)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US9597363B2 (en) | 2008-03-04 | 2017-03-21 | The Trustees Of The University Of Pennsylvania | Simian adenoviruses SAdV-36, -42.1, -42.2, and -44 and uses thereof |
WO2012071318A3 (fr) * | 2010-11-23 | 2012-09-27 | The Trustees Of The University Of Pennsylvania | Adénovirus simiens de la sous-famille e a1321, a1325, a1295, a1309, a1316 et a1322 et utilisations de ceux-ci |
US8834863B2 (en) | 2010-11-23 | 2014-09-16 | The Trustees Of The University Of Pennsylvania | Subfamily E simian adenoviruses A1321, A1325, A1295, A1309, A1316 and A1322 and uses thereof |
US10149873B2 (en) | 2010-11-23 | 2018-12-11 | The Trustees Of The University Of Pennsylvania | Subfamily E simian adenoviruses A1321, A1325, A1295, A1309, A1316 and A1322 and uses thereof |
AU2011332025B2 (en) * | 2010-11-23 | 2015-06-25 | The Trustees Of The University Of Pennsylvania | Subfamily E simian adenoviruses A1321, A1325, A1295, A1309 and A1322 and uses thereof |
US9382551B2 (en) | 2010-11-23 | 2016-07-05 | The Trustees Of The University Of Pennsylvania | Subfamily E simian adenoviruses A1321, A1325, A1295, A1309, A1316 and A1322 and uses thereof |
WO2013074501A1 (fr) | 2011-11-14 | 2013-05-23 | Crucell Holland B.V. | Immunisation primovaccination-rappel hétérologue à l'aide de vaccins à base du virus de la rougeole |
WO2013135615A1 (fr) | 2012-03-12 | 2013-09-19 | Crucell Holland B.V. | Lots d'adénovirus recombinants ayant des extrémités terminales modifiées |
US8932607B2 (en) | 2012-03-12 | 2015-01-13 | Crucell Holland B.V. | Batches of recombinant adenovirus with altered terminal ends |
WO2013173702A2 (fr) | 2012-05-18 | 2013-11-21 | The Trustees Of The University Of Pennsylvania | Adénovirus simiens de la sous-famille e a1302, a1320, a1331 et a1337 et leurs utilisations |
EP2850194A4 (fr) * | 2012-05-18 | 2016-06-08 | Univ Pennsylvania | Adénovirus simiens de la sous-famille e a1302, a1320, a1331 et a1337 et leurs utilisations |
US9217159B2 (en) | 2012-05-18 | 2015-12-22 | The Trustees Of The University Of Pennsylvania | Subfamily E simian adenoviruses A1302, A1320, A1331 and A1337 and uses thereof |
AU2013262626B2 (en) * | 2012-05-18 | 2018-11-29 | The Trustees Of The University Of Pennsylvania | Subfamily E simian adenoviruses A1302, A1320, A1331 and A1337 and uses thereof |
US10113182B2 (en) | 2012-05-18 | 2018-10-30 | The Trustees Of The University Of Pennsylvania | Subfamily E simian adenoviruses A1302, A1320, A1331 and A1337 and uses thereof |
WO2015092710A1 (fr) | 2013-12-19 | 2015-06-25 | Glaxosmithkline Biologicals, S.A. | Administration simultanée controlatérale de vaccins |
EP3656395A1 (fr) | 2014-09-03 | 2020-05-27 | Bavarian Nordic A/S | Procédés et compositions permettant d'induire une immunité protectrice contre l'infection par filovirus |
US10561722B2 (en) | 2014-09-03 | 2020-02-18 | Bavarian Nordic A/S | Methods and compositions for enhancing immune responses |
US11918639B2 (en) | 2014-09-03 | 2024-03-05 | Bavarian Nordic A/S | Methods and compositions for inducing protective immunity against filovirus infection |
US10561721B2 (en) | 2014-09-03 | 2020-02-18 | Bavarian Nordic A/S | Methods and compositions for inducing protective immunity against filovirus infection |
US11173201B2 (en) | 2014-09-03 | 2021-11-16 | Bavarian Nordic A/S | Methods and compositions for inducing protective immunity against filovirus infection |
EP3868398A1 (fr) | 2014-09-26 | 2021-08-25 | Beth Israel Deaconess Medical Center, Inc. | Méthodes et compositions d'induction d'une immunité protectrice contre l'infection par le virus de l'immunodéficience humaine |
WO2016049287A1 (fr) | 2014-09-26 | 2016-03-31 | Beth Israel Deaconess Medical Center, Inc. | Méthodes et compositions d'induction d'une immunité protectrice contre l'infection par le virus de l'immunodéficience humaine |
US10570417B2 (en) | 2015-04-14 | 2020-02-25 | Janssen Vaccines & Prevention B.V. | Recombinant adenovirus expressing two transgenes with a bidirectional promoter |
WO2016166088A1 (fr) | 2015-04-14 | 2016-10-20 | Janssen Vaccines & Prevention B.V. | Adénovirus recombiné exprimant deux transgènes avec un promoteur bidirectionnel |
BE1024824B1 (fr) * | 2015-06-12 | 2018-07-13 | Glaxosmithkline Biologicals Sa | Polynucleotides et polypeptides d'adenovirus |
WO2016198621A1 (fr) * | 2015-06-12 | 2016-12-15 | Glaxosmithkline Biologicals Sa | Polypeptides et polynucléotides d'adénovirus |
WO2016198599A1 (fr) * | 2015-06-12 | 2016-12-15 | Glaxosmithkline Biologicals S.A. | Polypeptides et polynucléotides d'adénovirus |
EA038402B9 (ru) * | 2015-06-12 | 2021-09-22 | Глаксосмитклайн Байолоджикалс Са | Аденовирусные полинуклеотиды и полипептиды |
EA038402B1 (ru) * | 2015-06-12 | 2021-08-23 | Глаксосмитклайн Байолоджикалс Са | Аденовирусные полинуклеотиды и полипептиды |
US11254711B2 (en) | 2015-06-12 | 2022-02-22 | Glaxosmithkline Biologicals Sa | Adenovirus polynucleotides and polypeptides |
BE1024420B1 (fr) * | 2015-06-12 | 2018-02-19 | Glaxosmithkline Biologicals Sa | Polynucleotides et polypeptides d'adenovirus |
US11254710B2 (en) | 2015-06-12 | 2022-02-22 | Glaxosmithkline Biologicals Sa | Adenovirus polynucleotides and polypeptides |
EA039001B1 (ru) * | 2015-08-19 | 2021-11-19 | Глаксосмитклайн Байолоджикалс С.А. | Аденовирусные полинуклеотиды и полипептиды |
EP3964569A1 (fr) | 2015-12-15 | 2022-03-09 | Janssen Vaccines & Prevention B.V. | Antigènes, vecteurs, compositions du virus de l'immunodéficience humaine et leurs procédés d'utilisation |
EP3584252A1 (fr) | 2015-12-15 | 2019-12-25 | Janssen Vaccines & Prevention B.V. | Antigènes, vecteurs, compositions du virus de l'immunodéficience humaine et leurs procédés d'utilisation |
US11473105B2 (en) | 2016-05-12 | 2022-10-18 | Janssen Vaccines & Prevention B.V. | Potent and balanced bidirectional promoter |
US11781155B2 (en) | 2016-06-20 | 2023-10-10 | Janssen Vaccines & Prevention B.V. | Potent and balanced bidirectional promoter |
WO2017220499A1 (fr) | 2016-06-20 | 2017-12-28 | Janssen Vaccines & Prevention B.V. | Promoteur bidirectionnel puissant et équilibré |
US11001858B2 (en) | 2016-06-20 | 2021-05-11 | Janssen Vaccines & Prevention B.V. | Potent and balanced bidirectional promoter |
WO2018011768A1 (fr) | 2016-07-15 | 2018-01-18 | Janssen Vaccines And Prevention B.V. | Méthodes et compositions permettant l'induction d'une immunité protectrice contre l'infection par le virus de marburg |
WO2018011198A1 (fr) | 2016-07-15 | 2018-01-18 | Janssen Vaccines & Prevention B.V. | Méthodes d'induction d'une immunité protectrice contre l'infection par le virus de l'immunodéficience humaine. |
US10925956B2 (en) | 2016-07-15 | 2021-02-23 | Janssen Vaccines & Prevention B.V. | Methods and compositions for inducing protective immunity against a marburg virus infection |
US10925955B2 (en) | 2016-07-15 | 2021-02-23 | Janssen Vaccines & Prevention B.V. | Methods and compositions for inducing protective immunity against a Marburg virus infection |
WO2018104919A1 (fr) | 2016-12-09 | 2018-06-14 | Glaxosmithkline Biologicals Sa | Constructions d'adénovirus de chimpanzé avec des antigènes de lyssavirus |
WO2018138667A1 (fr) | 2017-01-25 | 2018-08-02 | Glaxosmithkline Biologicals Sa | Nouvelle formulation |
US11034978B2 (en) | 2017-02-09 | 2021-06-15 | Janssen Vaccines & Prevention B.V. | Potent and short promoter for expression of heterologous genes |
WO2018146205A1 (fr) | 2017-02-09 | 2018-08-16 | Janssen Vaccines & Prevention B.V. | Promoteur puissant et court pour l'expression de gènes hétérologues |
WO2018185732A1 (fr) | 2017-04-06 | 2018-10-11 | Janssen Vaccines & Prevention B.V. | Régime de primo-vaccination/rappel par mva-bn et ad26.zebov ou ad26.filo |
US11173204B2 (en) | 2017-04-06 | 2021-11-16 | Janssen Vaccines & Prevention B.V. | MVA-BN and Ad26.ZEBOV or Ad26.filo prime-boost regimen |
WO2018229711A1 (fr) | 2017-06-15 | 2018-12-20 | Janssen Vaccines & Prevention B.V. | Vecteurs à poxvirus codant pour des antigènes du vih, et leurs procédés d'utilisation |
WO2019016756A1 (fr) | 2017-07-21 | 2019-01-24 | Glaxosmithkline Biologicals Sa | Constructions d'antigène du virus chikungunya |
WO2019023566A1 (fr) | 2017-07-28 | 2019-01-31 | Janssen Vaccines & Prevention B.V. | Méthodes et compositions pour assurer l'immunisation contre l'arnrep hétérologue |
US11235051B2 (en) | 2017-07-28 | 2022-02-01 | Janssen Vaccines & Prevention B.V. | Methods and compositions for heterologous repRNA immunizations |
US11964007B2 (en) | 2017-07-28 | 2024-04-23 | Janssen Vaccines & Prevention B.V. | Methods and compositions for heterologous repRNA immunizations |
CN111356466A (zh) * | 2017-10-31 | 2020-06-30 | 扬森疫苗与预防公司 | 腺病毒及其用途 |
US10864263B2 (en) | 2017-11-20 | 2020-12-15 | Janssen Pharmaceuticals, Inc. | Method of providing safe administration of adenoviral vectors encoding a zika virus antigen |
WO2019099970A1 (fr) | 2017-11-20 | 2019-05-23 | Janssen Pharmaceuticals Inc. | Procédé d'administration sûre de vecteurs adénoviraux codant pour un antigène du virus zika |
WO2019123250A1 (fr) | 2017-12-19 | 2019-06-27 | Janssen Sciences Ireland Unlimited Company | Méthodes et compositions permettant d'induire une réponse immunitaire contre le virus de l'hépatite b (vhb) |
US11713469B2 (en) | 2018-07-20 | 2023-08-01 | Janssen Vaccines & Prevention B.V. | Recombinant adenoviral vector expressing Zika antigen with improved productivity |
WO2020016394A1 (fr) | 2018-07-20 | 2020-01-23 | Janssen Vaccines & Prevention B.V. | Vecteur adénoviral recombinant exprimant un antigène zika à productivité améliorée |
WO2020030572A1 (fr) | 2018-08-07 | 2020-02-13 | Glaxosmithkline Biologicals Sa | Processus et vaccins |
US11384122B2 (en) | 2020-01-31 | 2022-07-12 | Janssen Pharmaceuticals, Inc. | Compositions and methods for preventing and treating coronavirus infection—SARS-CoV-2 vaccines |
US11498944B2 (en) | 2020-01-31 | 2022-11-15 | Janssen Pharmaceuticals, Inc. | Compositions and methods for preventing and treating coronavirus infection—SARS-CoV-2 vaccines |
WO2021228842A1 (fr) | 2020-05-11 | 2021-11-18 | Janssen Pharmaceuticals, Inc. | Protéines de fusion de protéine de spicule de coronavirus stabilisées |
WO2022002894A1 (fr) | 2020-06-29 | 2022-01-06 | Janssen Vaccines & Prevention B.V. | Association de vaccin contre une infection par le virus respiratoire syncytial |
WO2022008438A1 (fr) | 2020-07-06 | 2022-01-13 | Janssen Pharmaceuticals, Inc. | Protéines de spicule de coronavirus stabilisées à titre de protéines de fusion |
WO2022008613A1 (fr) | 2020-07-08 | 2022-01-13 | Janssen Sciences Ireland Unlimited Company | Vaccins à base de réplicon d'arn contre le vhb |
WO2022175479A1 (fr) | 2021-02-19 | 2022-08-25 | Janssen Vaccines & Prevention B.V. | Associations de vaccins contre les infections par les souches a et b du virus respiratoire syncytial |
WO2022175477A1 (fr) | 2021-02-19 | 2022-08-25 | Janssen Vaccines & Prevention B.V. | Antigènes fb de vrs de pré-fusion stabilisés |
WO2022207839A2 (fr) | 2021-04-01 | 2022-10-06 | Janssen Vaccines & Prevention B.V. | Protéines piv3 f de pré-fusion stabilisées |
WO2023020939A1 (fr) | 2021-08-17 | 2023-02-23 | Janssen Pharmaceuticals, Inc. | Vaccins contre le sars-cov-2 |
WO2023026182A1 (fr) | 2021-08-24 | 2023-03-02 | Janssen Pharmaceuticals, Inc. | Vaccins anti-sars-cov-2 |
WO2023047349A1 (fr) | 2021-09-24 | 2023-03-30 | Janssen Pharmaceuticals, Inc. | Protéines de fusion protéines de spicule de coronavirus stabilisées |
WO2023047348A1 (fr) | 2021-09-24 | 2023-03-30 | Janssen Pharmaceuticals, Inc. | Protéines de fusion de protéine de spicule de coronavirus stabilisées |
WO2023111725A1 (fr) | 2021-12-14 | 2023-06-22 | Janssen Pharmaceuticals, Inc. | Vaccins anti-sars-cov-2 |
WO2023110618A1 (fr) | 2021-12-16 | 2023-06-22 | Janssen Vaccines & Prevention B.V. | Protéines de fusion hmpv pré-hybrides stabilisées |
WO2023198815A1 (fr) | 2022-04-14 | 2023-10-19 | Janssen Vaccines & Prevention B.V. | Administration séquentielle d'adénovirus |
WO2024061757A1 (fr) | 2022-09-23 | 2024-03-28 | Janssen Vaccines & Prevention B.V. | Protéines f du piv1 humain en pré-fusion |
WO2024061759A1 (fr) | 2022-09-23 | 2024-03-28 | Janssen Vaccines & Prevention B.V. | Protéines s de coronavirus stabilisées |
WO2024074584A1 (fr) | 2022-10-06 | 2024-04-11 | Janssen Vaccines & Prevention B.V. | Protéines f du piv3 sous forme pré-fusion stabilisées |
Also Published As
Publication number | Publication date |
---|---|
CN105112428B (zh) | 2021-04-20 |
CN105112428A (zh) | 2015-12-02 |
NZ603348A (en) | 2014-05-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US11214599B2 (en) | Recombinant simian adenoviral vectors encoding a heterologous fiber protein and uses thereof | |
WO2010085984A1 (fr) | Séquences d'acide nucléique et d'acides aminés d'adénovirus simiens, vecteurs les contenant et leurs utilisations | |
US11098324B2 (en) | Non human great apes adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof | |
US20240002879A1 (en) | Gorilla adenovirus nucleic acid- and amino acid-sequences, vectors containing same, and uses thereof | |
JP2018078894A (ja) | サルアデノウイルスの核酸配列及びアミノ酸配列、それを含有するベクター、並びにその使用 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09776357 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 09776357 Country of ref document: EP Kind code of ref document: A1 |