WO2010078027A1 - Chlamydia antigens and uses thereof - Google Patents

Chlamydia antigens and uses thereof Download PDF

Info

Publication number
WO2010078027A1
WO2010078027A1 PCT/US2009/068457 US2009068457W WO2010078027A1 WO 2010078027 A1 WO2010078027 A1 WO 2010078027A1 US 2009068457 W US2009068457 W US 2009068457W WO 2010078027 A1 WO2010078027 A1 WO 2010078027A1
Authority
WO
WIPO (PCT)
Prior art keywords
antigen
polypeptide antigen
chlamydia
polypeptide
composition
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2009/068457
Other languages
English (en)
French (fr)
Inventor
Kenya Cohane
Michele Picard
Todd Gierahn
Jessica Flechtner
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genocea Biosciences Inc
Original Assignee
Genocea Biosciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genocea Biosciences Inc filed Critical Genocea Biosciences Inc
Priority to EP09836943A priority Critical patent/EP2379106A4/en
Priority to CA2781805A priority patent/CA2781805A1/en
Priority to US13/140,773 priority patent/US20110293664A1/en
Priority to JP2011542431A priority patent/JP2012512257A/ja
Priority to AU2009333159A priority patent/AU2009333159A1/en
Publication of WO2010078027A1 publication Critical patent/WO2010078027A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/295Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Chlamydiales (O)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies

Definitions

  • Chlamydia trachomatis is an enormous global public health problem, causing more cases of sexually transmitted disease than any other bacterial pathogen.
  • C. trachomatis is an obligate intracellular bacterium. Infection can cause various disease conditions such as urethritis, cervicitis, pharyngitis, proctitis, epididymitis, and prostatitis. Untreated chlamydial infection can cause pelvic inflammatory disease, which in turn can lead to ectopic pregnancy, infertility, and chronic pelvic pain.
  • the annual costs of treating pelvic inflammatory disease may be as high as US $10 billion.
  • the prevalence of C. trachomatis infection in the developing world is over 90%, with an estimated 500 million people at high risk for infection (World Health Organization, Sexually Transmitted Diseases, 2008).
  • the present invention encompasses the discovery of novel antigens from Chlamydia trachomatis that elicit antigen specific immune responses in mammals.
  • novel antigens, and/or nucleic acids encoding the antigens can be incorporated into immunogenic compositions and administered to elicit immune responses, e.g., to provide protection against chlamydia infections and disease caused by chlamydia organisms.
  • novel antigens, and/or responses to novel antigens can be detected to identify and/or characterize immune responses to chlamydia organisms.
  • the invention provides immunogenic compositions (e.g., vaccines) comprising an isolated chlamydia antigen selected from a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, and combinations thereof.
  • a chlamydia antigen comprises a full length chlamydia polypeptide.
  • a chlamydia antigen comprises a chlamydia polypeptide that lacks a signal sequence and/or transmembrane domain.
  • an immunogenic composition comprises a CT209 polypeptide antigen.
  • a CT209 polypeptide antigen comprises 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or 800 consecutive amino acids of a CT209 polypeptide sequence.
  • a CT209 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or 800 consecutive amino acids of the sequence shown in SEQ ID NO:1.
  • an immunogenic composition comprises a CT253 polypeptide antigen.
  • a CT253 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, or 200 consecutive amino acids of a CT253 polypeptide sequence. In some embodiments, a CT253 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, or 200 consecutive amino acids of the sequence shown in SEQ ID NO:3.
  • an immunogenic composition comprises a CT425 polypeptide antigen.
  • a CT425 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 consecutive amino acids of a CT425 polypeptide sequence.
  • a CT425 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 consecutive amino acids of the sequence shown in SEQ ID NO:5.
  • an immunogenic composition comprises a CT497 polypeptide antigen.
  • a CT497 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, or 450 consecutive amino acids of a CT497 polypeptide sequence.
  • a CT497 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, or 450 consecutive amino acids of the sequence shown in SEQ ID NO :7.
  • an immunogenic composition comprises a CT843 polypeptide antigen.
  • a CT843 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, or 85 consecutive amino acids of a CT843 polypeptide sequence.
  • a CT843 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, or 85 consecutive amino acids of the sequence shown in SEQ ID NO:9.
  • an immunogenic composition comprises two or more isolated chlamydia antigens.
  • the two or more isolated chlamydia antigens comprise two or more of a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, and a CT843 polypeptide antigen.
  • the two or more isolated chlamydia antigens comprise three or more of a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, and a CT843 polypeptide antigen.
  • the two or more isolated chlamydia antigens comprise four or more of a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, and a CT843 polypeptide antigen.
  • the two or more isolated chlamydia antigens comprise a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, and a CT843 polypeptide antigen.
  • an immunogenic composition comprises two or more isolated chlamydia antigens, wherein the two or more isolated chlamydia antigens comprise (a) a first chlamydia antigen selected from a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, and a CT843 polypeptide antigen; and (b) a second chlamydia antigen.
  • the second chlamydia antigen comprises one or more antigens selected from a CT062 polypeptide antigen, a CT 104 polypeptide antigen, a CT 144 polypeptide antigen, a CTl 11 polypeptide antigen, a CT242 polypeptide antigen, a CT491 polypeptide antigen, a CT601 polypeptide antigen, a CT687 polypeptide antigen, a CT732 polypeptide antigen, a CT781 polypeptide antigen, a CT788 polypeptide antigen, a CT808 polypeptide antigen, a CT823 polypeptide antigen, a CT812 polypeptide antigen, a CT681 polypeptide antigen, a CT858 polypeptide antigen, a CT713 polypeptide antigen, an OMP85 polypeptide antigen, a CT315 polypeptide antigen, a CT316 polypeptide antigen, a CT737 polypeptide antigen, and
  • a chlamydia antigen is fused to a heterologous polypeptide (e.g., an epitope tag).
  • a heterologous polypeptide e.g., an epitope tag
  • an immunogenic composition comprising a chlamydia antigen includes a pharmaceutically acceptable excipient.
  • an immunogenic composition comprising a chlamydia antigen includes an adjuvant.
  • an immunogenic composition includes a mineral-containing adjuvant.
  • the mineral-containing adjuvant includes aluminum hydroxide.
  • an immunogenic composition includes an adjuvant comprising an immunomodulatory oligonucleotide.
  • an immunogenic composition includes an adjuvant comprising an oil emulsion.
  • an immunogenic composition includes an adjuvant comprising a saponin.
  • an immunogenic composition includes an adjuvant comprising an immune stimulating complex (ISCOM).
  • an immunogenic composition includes virus-like particles (VLPs).
  • an immunogenic composition includes replicons.
  • an immunogenic composition elicits an immune response to Chlamydia trachomatis.
  • an immunogenic composition elicits a T cell mediated immune response to a chlamydia antigen (e.g., a CD4 T cell mediated immune response and/or a CD8 T cell mediated immune response).
  • a chlamydia antigen e.g., a CD4 T cell mediated immune response and/or a CD8 T cell mediated immune response.
  • an immunogenic composition elicits a ThI T cell response.
  • an immunogenic composition elicits an antibody response (e.g., an IgG response, and/or an IgA response).
  • the invention provides methods for eliciting an immune response against chlamydia in a mammal.
  • the methods include, for example, administering to the mammal an immunogenic composition comprising an isolated chlamydia antigen selected from a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, and combinations thereof, e.g., an immunogenic composition described herein.
  • a method elicits an immune response against Chlamydia trachomatis. In some embodiments, a method elicits a T cell response to a chlamydia antigen
  • an immunogenic composition elicits a ThI T cell response.
  • a method elicits IFN- ⁇ secretion by antigen specific T cells. In some embodiments, a method elicits an antibody response (e.g., an IgG response, and/or an IgA response).
  • an antibody response e.g., an IgG response, and/or an IgA response.
  • a method reduces the incidence of chlamydia infection in subjects administered the composition. In some embodiments, a method reduces the likelihood of lower tract infection by a chlamydia organism. In some embodiments, a method reduces the likelihood of upper tract infection by a chlamydia organism. In some embodiments, a method reduces the likelihood of chronic infection by a chlamydia organism.
  • a method reduces the likelihood of suffering from pelvic inflammatory disease due to a chlamydia infection.
  • an immunogenic composition is administered to the mammal at least two times (e.g., two, three, four, or five times).
  • an immunogenic composition administered after a first administration differs from the composition administered initially, e.g., the composition includes a different chlamydia antigen or a different subset of chlamydia antigens, or a different dose of antigen, or a different adjuvant, or a different dose of adjuvant.
  • a boost is administered by a different route than a previous administration.
  • the mammal is at risk for infection with Chlamydia trachomatis. In some embodiments, the mammal is infected with Chlamydia trachomatis. In some embodiments, the mammal is a female. In some embodiments, the mammal is a human.
  • an immunogenic composition administered in a method comprises an adjuvant.
  • an adjuvant is a mineral-containing adjuvant.
  • an immunogenic composition administered in a method comprises a pharmaceutically acceptable excipient.
  • an immunogenic composition comprises an adjuvant.
  • an immunogenic composition includes a mineral-containing adjuvant.
  • a mineral-containing adjuvant includes aluminum hydroxide.
  • an immunogenic composition includes an adjuvant comprising an immunomodulatory oligonucleotide.
  • an immunogenic composition includes an adjuvant comprising an oil emulsion.
  • an immunogenic composition includes an adjuvant comprising a saponin.
  • an immunogenic composition includes an adjuvant comprising an immune stimulating complex (ISCOM).
  • ISCOM immune stimulating complex
  • an immunogenic composition includes virus-like particles (VLPs). In some embodiments, an immunogenic composition includes replicons. [0024] In some embodiments of provided methods, an immunogenic composition comprises a CT209 polypeptide antigen. In some embodiments, a CT209 polypeptide antigen comprises 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or 800 consecutive amino acids of a CT209 polypeptide sequence.
  • a CT209 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or 800 consecutive amino acids of the sequence shown in SEQ ID NO:1.
  • an immunogenic composition comprises a CT253 polypeptide antigen.
  • a CT253 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, or 200 consecutive amino acids of a CT253 polypeptide sequence.
  • a CT253 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, or 200 consecutive amino acids of the sequence shown in SEQ ID NO:3.
  • an immunogenic composition comprises a CT425 polypeptide antigen.
  • a CT425 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 consecutive amino acids of a CT425 polypeptide sequence.
  • a CT425 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, or
  • an immunogenic composition comprises a CT497 polypeptide antigen.
  • a CT497 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, or 450 consecutive amino acids of a CT497 polypeptide sequence.
  • a CT497 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, or 450 consecutive amino acids of the sequence shown in SEQ ID NO:7.
  • an immunogenic composition comprises a CT843 polypeptide antigen.
  • a CT843 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, or 85 consecutive amino acids of a CT843 polypeptide sequence.
  • a CT843 polypeptide antigen comprises at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, or 85 consecutive amino acids of the sequence shown in SEQ ID NO:9.
  • an immunogenic composition comprises two or more isolated chlamydia antigens.
  • the two or more isolated chlamydia antigens comprise two or more of a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, and a CT843 polypeptide antigen.
  • the two or more isolated chlamydia antigens comprise three or more of a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, and a CT843 polypeptide antigen.
  • the two or more isolated chlamydia antigens comprise four or more of a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, and a CT843 polypeptide antigen.
  • the two or more isolated chlamydia antigens comprise a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, and a CT843 polypeptide antigen.
  • an immunogenic composition comprises two or more isolated chlamydia antigens, wherein the two or more isolated chlamydia antigens comprise (a) a first chlamydia antigen selected from a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, and a CT843 polypeptide antigen; and (b) a second chlamydia antigen.
  • the second chlamydia comprises one or more antigens selected from a CT062 polypeptide antigen, a CT 104 polypeptide antigen, a CT 144 polypeptide antigen, a CTl 11 polypeptide antigen, a CT242 polypeptide antigen, a CT491 polypeptide antigen, a CT601 polypeptide antigen, a CT687 polypeptide antigen, a CT732 polypeptide antigen, a CT781 polypeptide antigen, a CT788 polypeptide antigen, a CT808 polypeptide antigen, a CT823 polypeptide antigen, a CT812 polypeptide antigen, a CT681 polypeptide antigen, a CT858 polypeptide antigen, a CT713 polypeptide antigen, an OMP85 polypeptide antigen, a CT315 polypeptide antigen, a CT316 polypeptide antigen, a CT737 polypeptide antigen, and a CT
  • an immunogenic composition comprises a chlamydia antigen and an antigen from a different infectious agent.
  • an immunogenic composition comprises a chlamydia antigen selected from a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, and combinations thereof; and an antigen from a papillomavirus (e.g., a human papillomavirus).
  • a papillomavirus e.g., a human papillomavirus
  • an immunogenic composition comprises a chlamydia antigen selected from a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, and combinations thereof; and an antigen from a herpesvirus (e.g., herpes simplex virus-2).
  • a herpesvirus e.g., herpes simplex virus-2
  • an immunogenic composition comprises a chlamydia antigen selected from a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, and combinations thereof; and an antigen from N. gonorrheae.
  • the invention provides isolated nucleic acids comprising a nucleotide sequence encoding a chlamydia antigen selected from a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, and a CT843 polypeptide antigen.
  • a nucleic acid further comprises a nucleotide sequence encoding a heterologous peptide fused to the chlamydia antigen.
  • compositions including nucleic acids encoding a chlamydia antigen as described herein.
  • a composition includes an isolated nucleic acid comprising a nucleotide sequence encoding a chlamydia antigen selected from a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, and combinations thereof, and further comprises a pharmaceutically acceptable excipient.
  • a composition further comprises an adjuvant.
  • the invention provides methods for eliciting an immune response against chlamydia in a mammal by administering to the mammal a composition comprising a nucleic acid, wherein the nucleic acid comprises a nucleotide sequence encoding a chlamydia antigen selected from a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, and combinations thereof.
  • the invention provides methods for characterizing and/or detecting an immune response to a chlamydia antigen in a subject (e.g., a chlamydia antigen selected from a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, and combinations thereof).
  • a chlamydia antigen selected from a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, and combinations thereof.
  • an immune response in a na ⁇ ve subject is characterized.
  • an immune response in a subject infected, or suspected of having been infected, with chlamydia is characterized.
  • an immune response in a subject administered an immunogenic composition comprising a chlamydia antigen is characterized.
  • an antibody response is characterized.
  • a T cell response is characterized.
  • compositions and methods described herein can be used for the prophylaxis and/or treatment of any chlamydial disease, disorder, and/or condition, e.g., any of urethritis, cervicitis, pharyngitis, proctitis, epididymitis, prostatitis, pelvic inflammatory disease, and trachoma, due to a chlamydia infection.
  • an immunogenic composition described herein reduces risk of infection by, and/or treats, alleviates, ameliorates, relieves, delays onset of, inhibit progression of, reduces severity of, and/or reduce incidence of one or more symptoms or features of a chlamydial disease, disorder, and/or condition.
  • the prophylaxis and/or treatment of chlamydia infection comprises administering a therapeutically effective amount of an immunogenic composition comprising a novel chlamydial antigen described herein to a subject in need thereof, in such amounts and for such time as is necessary to achieve the desired result.
  • a "therapeutically effective amount" of an inventive immunogenic composition is that amount effective for treating, alleviating, ameliorating, relieving, delaying onset of, inhibiting progression of, reducing severity of, and/or reducing incidence of one or more symptoms or features of chlamydia infection.
  • inventive prophylactic and/or therapeutic protocols involve administering a therapeutically effective amount of one or more immunogenic compositions comprising a novel chlamydia antigen to a subject such that an immune response is stimulated in one or both of T cells and B cells.
  • the present invention provides novel immunogenic compositions comprising a therapeutically effective amount of one or more chlamydia antigens (e.g., one or more of a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, and combinations thereof) and one or more pharmaceutically acceptable excipients.
  • the present invention provides for pharmaceutical compositions comprising an immunogenic composition as described herein.
  • a method of administering a pharmaceutical composition comprising inventive compositions to a subject e.g. human, e.g., a child, adolescent, or young adult in need thereof is provided.
  • a therapeutically effective amount of an immunogenic composition is delivered to a patient and/or animal prior to, simultaneously with, and/or after diagnosis with a chlamydial disease, disorder, and/or condition.
  • a therapeutic amount of an inventive immunogenic composition is delivered to a patient and/or animal prior to, simultaneously with, and/or after onset of symptoms of a chlamydial disease, disorder, and/or condition.
  • immunogenic compositions of the present invention are administered by any of a variety of routes, including oral, intramuscular, subcutaneous, transdermal, interdermal, rectal, intravaginal, mucosal, nasal, buccal, enteral, sublingual; by intratracheal instillation, bronchial instillation, and/or inhalation; and/or as an oral spray, nasal spray, and/or aerosol.
  • routes including oral, intramuscular, subcutaneous, transdermal, interdermal, rectal, intravaginal, mucosal, nasal, buccal, enteral, sublingual; by intratracheal instillation, bronchial instillation, and/or inhalation; and/or as an oral spray, nasal spray, and/or aerosol.
  • immunogenic compositions of the present invention are administered by a variety of routes, including intravenous, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, intraperitoneal, topical (as by powders, ointments, creams, and/or drops), transdermal, or by intratracheal instillation.
  • an immunogenic composition may be administered in combination with one or more additional therapeutic agents which treat the symptoms of chlamydia infection (e.g., with an antibiotic such as an erythromycin or a tetracyclin).
  • the invention provides a variety of kits comprising one or more of the immunogenic compositions of the invention.
  • the invention provides a kit comprising an immunogenic composition comprising a chlamydia antigen, or a nucleic acid encoding the antigen, wherein the antigen is selected from a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, and combinations thereof; and instructions for use.
  • a kit may comprise multiple different chlamydia antigens.
  • a kit may comprise any of a number of additional components or reagents in any combination.
  • a kit may include, for example, (i) a chlamydia antigen selected from a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, and combinations thereof; (ii) an adjuvant; and (iii) instructions for administering a composition including the chlamydia antigen and the adjuvant to a subject in need thereof.
  • FIG. 1 is a graph showing results of a representative C. trachomatis ORFeome library screen.
  • Peritoneal CD8 T cells isolated and expanded from C57BL/6 mice that had been infected six days prior with 5 x 10 5 IFU of Chlamydia trachomatis were exposed to antigen presenting cells that had been pulsed with clones from the proteomic library and subsequently fixed.
  • the graph shows IFN ⁇ cytokine concentrations from supernatants harvested after 24 hours as determined by ELISA. Each data point represents a single clone in the library, and the line indicates the cutoff of the mean plus 2XSD. Control samples of mitogen-stimulated T cells (triangle) and T cells cultured with E. coli expressing irrelevant antigens (squares) are also indicated.
  • FIG. 2 is a graph showing the frequency of T cell responses to antigens from Chlamydia trachomatis in multiple animal strains. T cell responses to C. trachomatis antigens were evaluated in C57BL/6, Balb/c, CDl, and C3H mice. The graph represents the frequency with which each protein was identified across all strains. Each symbol represents a single clone in the library. These data are inclusive of nine screens of either CD4 or CD8 T cells.
  • Adjuvant refers to an agent that alters (e.g., enhances) an immune response to an antigen.
  • an adjuvant is used to enhance an immune response to a peptide antigen administered to a subject.
  • an adjuvant is used to enhance an immune response to an antigen encoded by a nucleic acid administered to a subject.
  • Antibody refers to any immunoglobulin, whether natural or wholly or partially synthetically produced. All derivatives thereof which maintain specific binding ability are also included in the term. The term also covers any protein having a binding domain which is homologous or largely homologous to an immunoglobulin binding domain. Such proteins may be derived from natural sources, or partly or wholly synthetically produced. An antibody may be monoclonal or polyclonal. An antibody may be a member of any immunoglobulin class, including any of the human classes: IgG, IgM, IgA, IgD, and IgE.
  • antibody fragment or “characteristic portion of an antibody” are used interchangeably and refer to any derivative of an antibody which is less than full-length.
  • an antibody fragment retains at least a significant portion of the full-length antibody's specific binding ability.
  • antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, scFv, Fv, dsFv diabody, and Fd fragments.
  • An antibody fragment may be produced by any means.
  • an antibody fragment may be enzymatically or chemically produced by fragmentation of an intact antibody and/or it may be recombinantly produced from a gene encoding the partial antibody sequence.
  • an antibody fragment may be wholly or partially synthetically produced.
  • An antibody fragment may optionally comprise a single chain antibody fragment.
  • an antibody fragment may comprise multiple chains which are linked together, for example, by disulfide linkages.
  • An antibody fragment may optionally comprise a multimolecular complex.
  • a functional antibody fragment will typically comprise at least about 50 amino acids and more typically will comprise at least about 200 amino acids.
  • Antigen refers to a molecule (e.g., a polypeptide) that elicits a specific immune response.
  • Antigen specific immunological responses also known as adaptive immune responses, are mediated by lymphocytes (e.g., T cells, B cells) that express antigen receptors (e.g., T cell receptors, B cell receptors).
  • an antigen is a T cell antigen, and elicits a cellular immune response.
  • an antigen is a B cell antigen, and elicits a humoral (i.e., antibody) response.
  • an antigen is both a T cell antigen and a B cell antigen.
  • antigen encompasses both a full length polypeptide as well as a portion of the polypeptide, that represent immunogenic fragments (i.e., fragments that elicit an antigen specific T cell response, B cell response, or both) of such complete polypeptides.
  • antigen is a peptide epitope found within a polypeptide sequence (e.g., a peptide epitope bound by a Major Histocompatibility Complex (MHC) molecule (e.g., MHC class I, or MHC class II).
  • MHC Major Histocompatibility Complex
  • peptides 5-15 amino acids in length, and longer polypeptides can be "antigens".
  • the present invention provides a CT209 polypeptide antigen.
  • a CT209 polypeptide antigen includes a full length CT209 polypeptide amino acid sequence (e.g., a full length CT209 polypeptide of SEQ ID NO:1).
  • a CT209 antigen polypeptide includes a portion of a CT209 polypeptide (e.g., a portion of the CT209 polypeptide of SEQ ID NO:1, e.g., which portion includes at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or 800 contiguous amino acids of a sequence at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to SEQ ID NO:1).
  • a CT209 antigen polypeptide includes a portion of a CT209 polypeptide (e.g., a portion of the CT209 polypeptide of SEQ ID NO:1, e.g., which portion includes at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or 800 contiguous amino acids of SEQ ID NO:1).
  • Chlamydia antigen refers to an antigen that elicits an antigen specific immune response against any organism of the Chlamydia genus, such as a Chlamydia trachomatis organism, a Chlamydia psittaci organism, or a Chlamydia pneumoniae organism, a Chlamydia suis organism, a Chlamydia muridarum organism, etc.
  • a chlamydia antigen elicits an antigen specific immune response against chlamydia organisms of multiple species (e.g., two or three of Chlamydia trachomatis, Chlamydia psittaci, and Chlamydia pneumoniae).
  • a C trachomatis CT209 polypeptide has a very high degree of identity to a CT843 polypeptide of C pneumoniae.
  • a C trachomatis CT209 polypeptide elicits an antigen specific immune response against both C trachomatis CT209 and C pneumoniae
  • CT843 polypeptides CT253 polypeptides of C. trachomatis and C pneumoniae also exhibit a high degree of identity and, in some embodiments, a CT253 polypeptide of one species can elicit antigen specific immune responses to both.
  • a chlamydia antigen elicits an antigen specific immune response against chlamydia organisms of multiple serovars (e.g., one or more of serovars A, B, Ba, C, D, E, F, G, H, I, J, K, Ll, L2, L3 of C. trachomatis).
  • Chlamydia antigens include full length polypeptides encoded by chlamydia genes, as well as immunogenic portions of the polypeptides.
  • Immunogenic composition refers to a composition that includes a molecule that induces an immune response in a subject.
  • an immunogenic composition includes a polypeptide or peptide antigen.
  • an immunogenic composition includes a nucleic acid encoding a polypeptide or peptide antigen.
  • An immunogenic composition can include molecules that induce an immune response against multiple antigens.
  • In vitro refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within an organism (e.g., animal, plant, and/or microbe).
  • in vivo refers to events that occur within an organism (e.g., animal, plant, and/or microbe).
  • Isolated means that the isolated entity has been separated from at least one component with which it was previously associated. When most other components have been removed, the isolated entity is "purified.” Isolation and/or purification and/or concentration may be performed using any techniques known in the art including, for example, chromatography, fractionation, precipitation, or other separation.
  • Nucleic acid As used herein, the term “nucleic acid,” in its broadest sense, refers to any compound and/or substance that is or can be incorporated into an oligonucleotide chain.
  • a nucleic acid is a compound and/or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage.
  • oligonucleotide and “polynucleotide” can be used interchangeably.
  • nucleic acid encompasses RNA as well as single and/or double-stranded DNA and/or cDNA.
  • nucleic acid “DNA,” “RNA,” and/or similar terms include nucleic acid analogs, i.e. analogs having other than a phosphodiester backbone.
  • nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and/or encode the same amino acid sequence.
  • Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, backbone modifications, etc.
  • a nucleic acid sequence is presented in the 5' to 3' direction unless otherwise indicated.
  • Polypeptide generally has its art- recognized meaning of a polymer of at least three amino acids. However, the term is also used to refer to specific classes of antigen polypeptides, such as, for example, CT209 polypeptides, CT253 polypeptides, CT425 polypeptides, CT497 polypeptides, and CT843 polypeptides. For each such class, the present specification provides several examples of known sequences of such polypeptides.
  • polypeptide as used herein to refer to "polypeptide antigen” is intended to be sufficiently general as to encompass not only polypeptides having a sequence recited herein, but also to encompass polypeptides having a variation of the sequence that elicits an antigen-specific response to the polypeptide.
  • a "CT209 polypeptide” includes the CT209 polypeptide shown in SEQ ID NO:1, as well as polypeptides that have variations of a SEQ ID NO:1 sequence and that maintain the ability to elicit an antigen- specific response to a polypeptide of SEQ ID NO: 1.
  • Other regions of similarity and/or identity can be determined by those of ordinary skill in the art by analysis of the sequences of various polypeptides presented herein.
  • BLAST is used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and proteins of the present disclosure.
  • Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information (available at the following internet address: ncbi.nlm.nih.gov).
  • HSPs high scoring sequence pairs
  • T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always>0) and N (penalty score for mismatching residues; always ⁇ 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score.
  • Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA, 90:5873- 5787, 1993).
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.
  • Subject refers to any organism to which a composition of this invention may be administered, e.g., for experimental, diagnostic, and/or therapeutic purposes. Typical subjects include mammals such as mice, rats, rabbits, non-human primates, and humans.
  • Suffering from An individual who is "suffering from” a disease, disorder, and/or condition has been diagnosed with or displays one or more symptoms of the disease, disorder, and/or condition.
  • a disease, disorder, and/or condition has not been diagnosed with and/or may not exhibit symptoms of the disease, disorder, and/or condition.
  • a disease, disorder, and/or condition is associated with a chlamydia infection (e.g., a C. trachomatis infection, a C. pneumoniae infection, or a C. psittaci infection).
  • a chlamydia infection e.g., a C. trachomatis infection, a C. pneumoniae infection, or a C. psittaci infection.
  • an individual who is susceptible to a chlamydia infection may be exposed to a chlamydia microbe (e.g., by ingestion, inhalation, physical contact, etc.).
  • an individual who is susceptible to a chlamydia infection may be exposed to an individual who is infected with the microbe.
  • an individual who is susceptible to a chlamydia infection is one who is in a location where the microbe is prevalent (e.g., one who is traveling to a location where the microbe is prevalent).
  • an individual who is susceptible to a chlamydia infection is susceptible due to young age (e.g., a child, adolescent, or young adult).
  • an individual who is susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition.
  • an individual who is susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.
  • therapeutically effective amount means an amount of a therapeutic, prophylactic, and/or diagnostic agent (e.g., inventive immunogenic composition) that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and/or condition, to treat, alleviate, ameliorate, relieve, alleviate symptoms of, prevent, delay onset of, inhibit progression of, reduce severity of, and/or reduce incidence of the disease, disorder, and/or condition.
  • therapeutic agent refers to any agent that, when administered to a subject, has a therapeutic, prophylactic, and/or diagnostic effect and/or elicits a desired biological and/or pharmacological effect.
  • Treating refers to partially or completely alleviating, ameliorating, relieving, delaying onset of, inhibiting progression of, reducing severity of, and/or reducing incidence of one or more symptoms or features of a particular disease, disorder, and/or condition.
  • treating a microbial infection may refer to inhibiting survival, growth, and/or spread of the microbe.
  • Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and/or condition and/or to a subject who exhibits only early signs of a disease, disorder, and/or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition.
  • treatment comprises delivery of an immunogenic composition (e.g., a vaccine) to a subject.
  • Vaccine refers to an entity comprising at least one immunogenic component (e.g., an immunogenic component which includes a peptide or protein, and/or an immunogenic component which includes a nucleic acid).
  • a vaccine includes at least two immunogenic components.
  • a vaccine is capable of stimulating an immune response of both T cells and B cells.
  • any assay available in the art may be used to determine whether T cells and/or B cells have been stimulated.
  • T cell stimulation may be assayed by monitoring antigen-induced production of cytokines, antigen-induced proliferation of T cells, and/or antigen-induced changes in protein expression.
  • B cell stimulation may be assayed by monitoring antibody titers, antibody affinities, antibody performance in neutralization assays, class-switch recombination, affinity maturation of antigen- specific antibodies, development of memory B cells, development of long-lived plasma cells that can produce large amounts of high-affinity antibodies for extended periods of time, germinal center reactions, and/or antibody performance in neutralization assays.
  • a vaccine further includes at least one adjuvant that can help stimulate an immune response in T cells and/or B cells.
  • Chlamydia trachomatis causes inflammation and damage to mucosal tissues, leading to pathologies such as urethritis, cervicitis, pharyngitis, proctitis, epididymitis, prostatitis, and trachoma.
  • Chlamydia bacteria which primarily infect epithelial cells, alternate between two developmental forms, the elementary body (EB) and reticulate body (RB).
  • EB forms of chlamydia are infectious and invade host cells. After forming an inclusion within host cells, EB forms differentiate into RB forms which replicate for a period of time and differentiate back to EB forms.
  • trachomatis species are categorized into serovars based on reactivity of patient sera to the major outer membrane protein (MOMP).
  • MOMP major outer membrane protein
  • Serovars A, B, Ba, and C are associated with infection of conjunctival epithelium.
  • Servovars D-K are associated with urogenital tract infections.
  • Serovars L1-L3 are associated with urogenital tract infection and a systemic condition, lymphogranuloma venereum.
  • Various arms of the adaptive immune system appear to play a role in responding to chlamydial infections.
  • CD4 T cell responses of the ThI subtype have been shown to be important for clearance of chlamydia infections in an animal model (Morrison et al., Infect. Immun.
  • CD8 T cells have lytic functions that are important for the control of intracellular pathogens. Chlamydia- specific CD8 T cells have been isolated from infected humans, indicating a role for these cells in responding to chlamydia infections (Gervassi et al., J. Immunol. 171 : 4278-4286, 2003).
  • the present invention provides chlamydia antigens, including CT209 polypeptide antigens, CT253 polypeptide antigens, CT425 polypeptide antigens, CT497 polypeptide antigens, CT843 polypeptide antigens, that are recognized by immune cells (e.g., T cells) of infected mammals.
  • immune cells e.g., T cells
  • these antigens were discovered as targets of cellular immunity in vivo. Accordingly, these antigens provide novel compositions for eliciting immune responses with the aim of eliciting beneficial immune responses, e.g., to protect against chlamydia infections and associated pathologies.
  • These antigens also provide novel targets for characterizing chlamydia infections and immune responses to chlamydia infections.
  • CT209 polypeptides are thought to function as cytoplasmic leucyl-tRNA synthetases in chlamydia organisms.
  • Exemplary amino acid and nucleotide sequences from a full length CT209 polypeptide of C. trachomatis are shown below in Table 1.
  • a CT209 polypeptide antigen includes at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or 800 consecutive amino acids of a CT209 polypeptide sequence, e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, or 800 consecutive amino acids of the sequence shown in SEQ ID NO:1.
  • a CT209 polypeptide antigen is a full length CT209 polypeptide (e.g., the antigen comprises the amino acid sequence of SEQ ID NO:1).
  • the antigen comprises the amino acid sequence of SEQ ID NO:1.
  • Exemplary amino acid and nucleotide sequences from a full length CT253 polypeptide of C. trachomatis are shown in Table 1.
  • a CT253 polypeptide antigen includes at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35,
  • a CT253 polypeptide antigen lacks a transmembrane domain and/or signal sequence (e.g., a CT253 polypeptide antigen lacks amino acids 1-24 of SEQ ID NO:3).
  • a CT253 polypeptide antigen is a full length CT253 polypeptide (e.g., the antigen comprises the amino acid sequence of SEQ ID NO:3)
  • a CT425 polypeptide antigen includes at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 consecutive amino acids of a CT425 polypeptide sequence, e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 consecutive amino acids of the sequence shown in SEQ ID NO:5.
  • a CT425 polypeptide antigen is a full length CT425 polypeptide (e.g., the antigen comprises the amino acid sequence of SEQ ID NO:5).
  • CT497 polypeptides are replicative DNA helicases. Exemplary amino acid and nucleotide sequences from a full length CT497 polypeptide of C. trachomatis are shown below in Table 1.
  • a CT497 polypeptide antigen includes at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, or 450 consecutive amino acids of a CT497 polypeptide sequence, e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, or 450 consecutive amino acids of the sequence shown in SEQ ID NO:7.
  • a CT497 polypeptide antigen lacks a transmembrane domain (e.g., a CT497 polypeptide antigen lacks amino acids 25-44 of SEQ ID NO:7).
  • a CT497 polypeptide antigen is a full length CT497 polypeptide (e.g., the antigen comprises the amino acid sequence of SEQ ID NO:7).
  • CT843 polypeptides are 30S ribosomal S 15 proteins. Exemplary amino acid and nucleotide sequences from a full length CT843 polypeptide of C. trachomatis are shown below in Table 1.
  • a CT843 polypeptide antigen includes at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, or 85 consecutive amino acids of a CT843 polypeptide sequence, e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 45, 50, 60, 65, 70, 75, 80, or 85 consecutive amino acids of the sequence shown in SEQ ID NO:9.
  • a CT843 polypeptide antigen is a full length CT843 polypeptide (e.g., the antigen comprises the amino acid sequence of SEQ ID NO:9).
  • CT209 ATGCGCTATGATCCCGGTCTCATAGAAGAAAAATGGCAAAAGTTTTGGGAGAACGAGCAA
  • GI 115604717 TATCCATCTGGGGCAGGATTGCACGTGGGGCATCTAATTGGCTATACAGCAACAGATATT
  • CT209 polypeptide antigens, CT253 polypeptide antigens, CT425 polypeptide antigens, CT497 polypeptide antigens, and CT843 polypeptide antigens can be provided in any combination with each other and/or with other chlamydia antigens.
  • a combination of chlamydia polypeptide antigens includes two of CT209, CT253, CT425, CT497, and CT843 polypeptide antigens.
  • a combination includes three of CT209, CT253, CT425, CT497, and CT843 polypeptide antigens.
  • a combination includes four of CT209, CT253, CT425, CT497, and CT843 polypeptide antigens. In some embodiments, a combination includes CT209, CT253, CT425, CT497, and CT843 polypeptide antigens.
  • CT209, CT253, CT425, CT497, and CT843 polypeptide antigens include one or more of CT062, CT104, CT144, CTl I l, CT242, CT491, CT601, CT687, CT732, CT781, CT788, CT808, and CT823 polypeptide antigens.
  • a combination of antigens includes one, two, three, four, or five of a CT209, CT253, CT425, CT497, or CT843 polypeptide antigen, and one, two, three, four, or five of a CT062, CT 104, CT 144, CTl 11, CT242, CT491, CT601, CT687, CT732, CT781, CT788, CT808, or CT823 polypeptide antigen.
  • Additional chlamydia polypeptide antigens that can be provided in combination with a novel antigen described herein include a polymorphic membrane protein D (PmpD or CT812; see GenBank NP_220332.1 GL15605546), a major outer membrane protein (MOMP or ompA or CT681; see GenBank NP 220200.1 GL15605414), CT858 or cpaf (GenBank NP 220380 GL15605594), CT713 or PorB (GenBank NP 220232.1 GL15605446), OMP85 (GenBank NP 219746.1 GL15604962), CT315 or RpoB (GenBank NP 219820.1 GL15605036), CT316, CT737, or CT674.
  • PmpD or CT812 see GenBank NP_220332.1 GL15605546
  • MOMP or ompA or CT681 see GenBank NP 220200.1 GL1560541
  • compositions that include a chlamydia antigen described herein and an antigen from a different infectious agent includes a chlamydia antigen and an antigen from a different infectious agent that causes a sexually transmitted disease.
  • compositions that include a chlamydia antigen e.g., a CT209 polypeptide antigen, a CT253 polypeptide antigen, a
  • compositions that include a chlamydia antigen (e.g., a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, or a combination thereof) and a herpesvirus antigen (e.g., a human herpes simplex virus-2 antigen) are provided.
  • a chlamydia antigen e.g., a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, or a combination thereof
  • a herpesvirus antigen e.g., a human herpes simplex virus-2 antigen
  • compositions that include a chlamydia antigen e.g., a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, or a combination thereof
  • a chlamydia antigen e.g., a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, or a combination thereof
  • a chlamydia antigen e.g., a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, or a combination thereof
  • a gonorrhea antigen e.
  • compositions that include a chlamydia antigen (e.g., a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, or a combination thereof) and an antigen from one or more of a papillomavirus, a herpesvirus (e.g., HSV-2), and N. gonorrheae, are provided.
  • a chlamydia antigen e.g., a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, or a combination thereof
  • an antigen from one or more of a papillomavirus e.g., a herpesvirus (e.g., HSV-2), and N.
  • a large variety of formulations of immunogenic compositions can be employed to induce immune responses.
  • a common route of administration in humans is by intramuscular injection
  • immunogenic compositions may also be applied orally, intranasally, subcutaneously, by inhalation, intravenously, or by other routes of administration.
  • chlamydia antigens are initially presented to naive lymphocytes in regional lymph nodes.
  • a chlamydia antigen composition includes purified components (e.g., purified antigens).
  • chlamydia antigens are fused to other molecules, such as proteins that can confer adjuvant activity, or moieties that facilitate isolation and purification (e.g., an epitope tag).
  • a chlamydia antigen composition includes an adjuvant.
  • the adjuvant includes mineral-containing adjuvant.
  • Mineral-containing ajduvants can be formulated as gels, in crystalline form, in amorphous form, as particles, etc.
  • Mineral-containing adjuvants include, for example, aluminum salts and/or calcium salts (e.g., aluminum hydroxide, aluminum phosphate, aluminum sulfate, calcium phosphate, etc.).
  • a chlamydia antigen composition includes aluminum hydroxide.
  • AlhydrogelTM is an example of an aluminum hydroxide gel adjuvant.
  • an adjuvant includes an immunomodulatory oligonucleotide.
  • an immunomodulatory oligonucleotide sequence includes CpG (unmethylated cytosine-guanosine) motifs.
  • Oligonucleotides having CpG motifs can include nucleotide analogs and/or non-naturally occuring internucleoside linkages (e.g., phosphorothioate linkages).
  • CpG motifs see Kandimalla, et al, Nuc. Acids Res. 31(9): 2393-2400, 2003; WO02/26757; WO99/62923; Krieg, Nat. Med.
  • an adjuvant comprises IC31TM (Intercell AG).
  • IC31TM is a synthetic adjuvant that includes an antimicrobial peptide, KLK, and an immunostimulatory oligonucleotide, ODNIa, and acts as a Toll-like Receptor 9 (TLR9) agonist.
  • an adjuvant includes a toxin.
  • a toxin is a bacterial ADP-ribosylating toxin, e.g., cholera toxin, E. coli heat labile toxin, or pertussis toxin.
  • the bacterial toxin is a detoxified form of an ADP- ribosylating toxin (see, e.g., Beignon, et al., Inf. Immun. 70(6):3012-3019, 2002; Pizza, et al., Vaccine 19:2534-2541, 2001; Pizza, et al., Int. J. Med. Microbiol. 290(4-5):455-461, 2000; Scharton-Kersten et al., Inf. Immun.68(9):5306-5313, 2000; Ryan et al., Inf. Immun. 67(12):6270-6280, 1999; Partidos et al., Immunol. Lett.
  • an adjuvant includes an endotoxin such as monophosphoryl lipid A or 3-De-O-acylated monophosphoryl lipid A (see U.S. Pat. No. 4,987,237 and GB 2122204B).
  • an adjuvant includes a muramyl dipeptide (e.g., N-acetyl- muramyl-L-threonyl-D-isoglutamine(thr-MDP), N-acetyl-normuramyl- 1 -alanyl-d- isoglutamine(nor-MDP), and N-acetylmuramyl- 1 -alanyl-d-isoglutaminyl- 1 -alanine-2-(l'-2'- dipalmitoyl-s- n-glycero-3 -hydroxyphosphoryloxy)-ethylamine MTP-PE) .
  • muramyl dipeptide e.g., N-acetyl- muramyl-L-threonyl-D-isoglutamine(thr-MDP)
  • an adjuvant includes an oil emulsion and/or emulsifier-based adjuvant.
  • an oil emulsion adjuvant includes a Freund's Adjuvant (e.g., Complete Freund's adjuvant (CFA), or incomplete Freund's adjuvant (IFA)).
  • an oil-emulsion adjuvant includes a squalene water emulsion, such as MF59 (Novartis; see, e.g., WO9014837), or a Synex adjuvant formulation (SAF)).
  • an oil emulsion includes a dispersing agent, e.g., a mono- or di-Ci 2 -C 24 -fatty acid ester of sorbitan or mannide, e.g., sorbitan mono-stearate, sorbitan mon-oleate, or mannide mono-oleate.
  • a dispersing agent e.g., a mono- or di-Ci 2 -C 24 -fatty acid ester of sorbitan or mannide, e.g., sorbitan mono-stearate, sorbitan mon-oleate, or mannide mono-oleate.
  • examples of oil emulsions that include squalene and dispersing agents includes ArlacelTM, MontanideTM ISA-720, and MontanideTM ISA-703. Other oil emulsions are described, e.g., in WO 95/17210 and EP 0399842.
  • an adjuvant includes a saponin.
  • Saponins are steroid and/or triterpenoid glycosides derived from plants such as Quillaja saponaria, Saponaria officianalis, Smilax ornata, and Gypsophilla paniculata.
  • Fractions of saponin-containing extracts that have been described and that can be used as adjuvants for chlamydia antigens include QuilTMA, QS21, QS7, QS17, QS18, QH-A, QH-B, QH-C, and QuilA (see, e.g., U.S. Pat. No. 5,057,540).
  • QS21 is used as an adjuvant.
  • an adjuvant includes an immune stimulating complex (ISCOM).
  • ISCOMs are particles that typically include a glycoside (e.g., a saponin) and a lipid.
  • an ISCOM includes a saponin and a cholesterol.
  • an ISCOM includes a saponin, a cholesterol, and a phospholipid (e.g., phosphatidylcholine and/or phosphatidylethanolamine).
  • an ISCOM includes a nonionic block copolymer.
  • ISCOMs can include additional adjuvants, e.g., additional adjuvant substances described herein (see, e.g., WO 05/002620).
  • an ISCOM includes a substance that targets is to a mucosal members (see, e.g., WO97/030728).
  • Other ISCOM compositions and preparation of the compositions suitable for combination with chlamydia antigens provided herein are described, e.g., in U.S. Pat. Pub. No. 20060121065, WO 00/07621, WO 04/004762, WO 02/26255, and WO 06/078213.
  • an adjuvant comprises an AbISCO ® adjuvant (e.g., Matrix-MTM, Isconova).
  • an adjuvant comprises AbISCO ® -100.
  • an adjuvant comprises AbISCO ® -300.
  • an adjuvant includes a nonionic block copolymer.
  • Nonionic block copolymers typicaly include two chains of hydrophobic polyoxyethylenes of various lengths combined with a block of hydrophobic polyoxypropylene.
  • a nonionic block copolymer is formulated in an oil-in- water emulsion (e.g., with oil and squalene).
  • an adjuvant includes virus like particles (VLPs).
  • VLPs are non replicating, non infectious particles that typically include one or more viral proteins, optionally formulated with an additional component such as a phospholipid.
  • a VLP includes proteins from one or more of the following: an influenza virus (e.g., a hemaglutinin (HA) or neuraminidase (NA) polyptide), Hepatitis B virus (e.g., a core or capsid polypeptide), Hepatitis E virus, measles virus, Sindbis virus, Rotavirus, Foot-and-
  • influenza virus e.g., a hemaglutinin (HA) or neuraminidase (NA) polyptide
  • Hepatitis B virus e.g., a core or capsid polypeptide
  • Hepatitis E virus measles virus, Sindbis virus, Rotavirus, Foot-and-
  • Mouth Disease virus Retrovirus, Norwalk virus, human papilloma virus, HIV, RNA-phages, Q ⁇ -phage (e.g., a coat protein), GA-phage, fr-phage, AP205 phage, a Ty (e.g., retrotransposon Ty protein pi).
  • Q ⁇ -phage e.g., a coat protein
  • GA-phage e.g., a coat protein
  • fr-phage e.g., fr-phage
  • AP205 phage e.g., retrotransposon Ty protein pi.
  • Ty e.g., retrotransposon Ty protein pi
  • an adjuvant includes replicons.
  • Replicons resemble VLPs in that they are noninfectious particles including viral proteins, and further include a nucleic acid encoding a polypeptide (e.g., an antigen).
  • a replicon includes proteins from an alphavirus.
  • Alphaviruses include, e.g., Eastern Equine Encephalitis Virus (EEE), Venezuelan Equine Encephalitis Virus (VEE), Everglades Virus, Mucambo Virus, Pixuna Virus, Western Equine Encephalitis Virus (WEE), Sindbis Virus, Semliki Forest Virus, Middleburg Virus, Chikungunya Virus, O'nyong-nyong Virus, Ross River Virus, Barmah Forest Virus, Getah Virus, Sagiyama Virus, Bebaru Virus, Mayaro Virus, Una Virus, Aura Virus, Whataroa Virus, Babanki Virus, Kyzylagach Virus, Highlands J Virus, Fort Morgan Virus, Ndumu Virus, and Buggy Creek Virus.
  • EEE Eastern Equine Encephalitis Virus
  • VEE Venezuelan Equine Encephalitis Virus
  • Everglades Virus Mucambo Virus
  • Pixuna Virus Pixuna Virus
  • an adjuvant includes a replicon that includes a nucleic acid encoding one or more chlamydia antigens described herein.
  • an adjuvant includes a replicon that encodes a cytokine (e.g., interleukin-12 (IL-12), IL-23, or granulocyte -macrophage colony-stimulating factor (GM-CSF)).
  • IL-12 interleukin-12
  • GM-CSF granulocyte -macrophage colony-stimulating factor
  • a VLP or replicon adjuvant includes one or more chlamydia antigens (i.e., VLP or replicon particles include a chlamydia antigen as part of the particles).
  • a VLP or replicon adjuvant is co- adminstered with a chlamydia antigen polypeptide.
  • an adjuvant includes liposomes, which are are artificially- constructed spherical lipid vesicles (see, e.g., U.S. Pat. Nos. 4,053,585; 6,090,406; and 5,916,588).
  • a lipid to be used in liposomes can be, but is not limited to, one or a plurality of the following: phosphatidylcholine, lipid A, cholesterol, dolichol, sphingosine, sphingomyelin, ceramide, glycosylceramide, cerebroside, sulfatide, phytosphingosine, phosphatidyl-ethanolamine, phosphatidylglycerol, phosphatidylinositol, phosphatidylserine, cardiolipin, phosphatidic acid, and lyso-phosphatides.
  • an adjuvant includes a liposome and a ligand for a Toll-like Receptor (TLR)(see, e.g., WO/2005/013891, WO/2005/079511, WO/2005/079506, and WO/2005/013891).
  • TLR Toll-like Receptor
  • an adjuvant includes JVRS-100. JVRS-100 comprises cationic liposomes combined with non-coding oligonucleotides or plasmids.
  • an adjuvant includes microparticles comprised of a polymer, e.g., a polymer of acrylic or methacrylic acid, polyphosphazenes, polycarbonates, polylactic acid, polyglycolic acid, copolymers of lactic acid or glycolic acid, polyhydroxybutyric acid, polyorthoesters, polyanhydrides, polysiloxanes, polycaprolactone, or a copolymer prepared from the monomers of these polymers.
  • a polymer e.g., a polymer of acrylic or methacrylic acid, polyphosphazenes, polycarbonates, polylactic acid, polyglycolic acid, copolymers of lactic acid or glycolic acid, polyhydroxybutyric acid, polyorthoesters, polyanhydrides, polysiloxanes, polycaprolactone, or a copolymer prepared from the monomers of these polymers.
  • an adjuvant includes microparticles comprised of a polymer selected from the group consisting of polyvinylpyrrolidone, polyvinylalcohol, polyhydroxyethylmethacrylate, polyacrylamide, polymethacrylamide, and polyethyleneglycol (see, e.g., U.S. Pat. No. 5,500,161).
  • an adjuvant includes biodegradable microspheres (e.g., microspheres comprised of poly(D,L-lactic acid), poly(D,L-glycolic acid), poly( ⁇ - caprolactone), polye ( ⁇ -hydroxy actid), polyhydroxybutyric acid, a polyorthoester, a polyanhydride, etc.).
  • biodegradable microspheres e.g., microspheres comprised of poly(D,L-lactic acid), poly(D,L-glycolic acid), poly( ⁇ - caprolactone), polye ( ⁇ -hydroxy actid), polyhydroxybutyric acid, a polyorthoester, a polyanhydride, etc.
  • an adjuvant includes a cytokine. In some embodiments, an adjuvant includes IL- 12. In some embodiments, an adjuvant includes IL-23. In some embodiments, an adjuvant includes GM-CSF.
  • a composition includes a vector suitable for expression in vitro (whether in a cell or in a cell-free system), e.g., for producing a polypeptide composition.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked and can include, for example, a plasmid, cosmid or viral vector.
  • the vector can be capable of autonomous replication or it can integrate into a host DNA.
  • Viral vectors include, e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses. Other types of viral vectors are known in the art.
  • a vector can include a nucleic acid encoding a chlamydia antigen in a form suitable for expression of the nucleic acid in a host cell.
  • a recombinant expression vector typically includes one or more regulatory sequences operatively linked to the nucleic acid sequence to be expressed. Regulatory sequences include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence, as well as tissue-specific regulatory and/or inducible sequences.
  • a sequence encoding a chlamydia antigen can include a sequence encoding a signal peptide (e.g., a heterologous signal peptide) such that the antigen is secreted from a host cell.
  • a signal peptide e.g., a heterologous signal peptide
  • the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and the like.
  • Recombinant expression vectors can be designed for expression and production of chlamydia antigens in prokaryotic or eukaryotic cells.
  • antigens can be expressed in E. coli, insect cells (e.g., using baculovirus expression vectors), yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA, 1990.
  • a recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
  • Expression of polypeptides in prokaryotes is often carried out in E.
  • Fusion vectors add a number of amino acids to a protein encoded therein, e.g., to the amino terminus or carboxy terminus of the recombinant protein, e.g., to increase expression of recombinant protein; to increase the solubility of the recombinant protein; and/or to aid in the purification of the recombinant antigen by acting as a ligand in affinity purification.
  • a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant antigen to enable separation of the recombinant antigen from the fusion moiety subsequent to purification of the fusion protein.
  • enzymes, and their cognate recognition sequences include Factor Xa, thrombin and enterokinase.
  • Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith, D.B. and Johnson, K.S.
  • Chlamydia antigen expression vectors include yeast expression vectors, vectors for expression in insect cells (e.g., a baculovirus expression vector) and vectors suitable for expression in mammalian cells.
  • An expression vector for use in mammalian cells can include viral regulatory elements.
  • commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40.
  • a vector can include an inducible promoter, e.g., a promoter regulated by a steroid hormone, by a polypeptide hormone (e.g., by means of a signal transduction pathway), or by a heterologous polypeptide (e.g., the tetracycline- inducible systems, "Tet-On" and "Tet-Off '; see, e.g., Clontech Inc., CA, Gossen and Bujard,
  • a host cell can be any prokaryotic or eukaryotic cell.
  • a chlamydia antigen can be expressed in bacterial cells (such as E. col ⁇ ), insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells (African green monkey kidney cells CV-I origin SV40 cells; Gluzman, Cell 23:175-182, 1981)).
  • bacterial cells such as E. col ⁇
  • insect cells such as E. col ⁇
  • yeast or mammalian cells such as Chinese hamster ovary cells (CHO) or COS cells (African green monkey kidney cells CV-I origin SV40 cells; Gluzman, Cell 23:175-182, 1981)
  • COS cells African green monkey kidney cells CV-I origin SV40 cells; Gluzman, Cell 23:175-182, 1981
  • Vector DNA can be introduced into host cells via conventional transformation or transfection techniques.
  • transformation and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co- precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation.
  • a host cell can be used to produce (i.e., express) a chlamydia antigen. Accordingly, the invention further provides methods for producing a chlamydia antigen using host cells.
  • the method includes culturing a host cell (into which a recombinant expression vector encoding a chlamydia antigen has been introduced) in a suitable medium such that a chlamydia antigen is produced.
  • the method further includes isolating a chlamydia antigen from the medium or the host cell.
  • Purified chlamydia antigens can be used for administration to mammals to induce an immune response, and/or to generate antibodies specific for the antigens.
  • the present invention also provides nucleic acid compositions that encode chlamydia antigens for administration to a subject in vivo, e.g., to elicit an immune response to the antigen.
  • a nucleic acid composition for administration in vivo includes a naked DNA plasmid encoding a chlamydia antigen.
  • Bacterial vectors, replicon vectors, live attenuated bacteria, and viral vectors for expression of heterologous genes also can be used.
  • Live attenuated viral vectors e.g., recombinant vaccinia (e.g., modified vaccinia Ankara (MVA), IDT Germany), recombinant adenovirus, avian poxvirus (e.g., canarypox (e.g., AL V ACTM, Aventis Pasteur) or fowlpox), poliovirus, and alphavirus virion vectors) have been successful in inducing cell-mediated immune response to antigens.
  • Avian poxviruses are defective in mammalian hosts, but can express inserted heterologous genes under early promoters.
  • Attenuated bacteria can also be used as a vehicle for DNA vaccine delivery.
  • suitable bacteria include S. enterica, S. tymphimurium, Listeria, and BCG.
  • S. enterica, S. tymphimurium, Listeria, and BCG suitable bacteria
  • the use of mutant bacteria with weak cell walls can aid the exit of DNA plasmids from the bacterium.
  • Nucleic acid compositions used for immunization can include an adjuvant (e.g., an adjuvant such as a polymer, a saponin, muramyl dipeptide, liposomes, immunomodulatory oligonucleotide, or another adjuvant described herein) to promote nucleic acid uptake.
  • adjuvants can be administered before, during, or after administration of the nucleic acid.
  • an adjuvant increases the uptake of nucleic acid into host cells and/or increases expression of the antigen from the nucleic acid within the cell, induce antigen presenting cells to infiltrate the region of tissue where the antigen is being expressed, or increase the antigen-specific response provided by lymphocytes.
  • This invention provides, inter alia, antibodies, or antigen-binding fragments thereof, to a novel chlamydia antigen described herein, e.g., a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, or a CT843 polypeptide antigen.
  • the antibodies can be of the various isotypes, including: IgG (e.g., IgGl, IgG2, IgG3, IgG4), IgM, IgAl, IgA2, IgD, or IgE.
  • an antibody is an IgG isotype, e.g., IgGl.
  • An antibody against a chlamydia antigen can be full- length (e.g., an IgGl or IgG4 antibody) or can include only an antigen-binding fragment (e.g., a Fab, F(ab)2, Fv or a single chain Fv fragment). These include monoclonal antibodies, recombinant antibodies, chimeric antibodies, human antibodies, and humanized antibodies, as well as antigen-binding fragments of the foregoing.
  • Monoclonal antibodies can be produced by a variety of techniques, including conventional monoclonal antibody methodology, e.g., the standard somatic cell hybridization technique of Kohler and Milstein, Nature 256: 495, 1975. Polyclonal antibodies can be produced by immunization of animal or human subjects. See generally, Harlow, E. and Lane, D. Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1988. Antibodies against chlamydia antigens described herein can be used, e.g., for diagnostic assays, or for therapeutic applications.
  • a subject's response to an immunogenic composition descrbed herein is evaluated, e.g., to determine efficacy of the composition, and/or to compare responses elicited by the composition to responses elicited by a different composition.
  • assays for T Cell Activation can be utilized in order to characterize an antigen or composition and/or to determine whether an immune response has been stimulated in a T cell or group of T cells.
  • assays are used to characterize a T cell response in a subject that has been administered an immunogenic composition to elicit an anti-chlamydia response (e.g., to evaluate whether a detectable T cell response has been elicited and/or to evaluate the potency of the response).
  • the novel chlamydia antigens described herein also provide diagnostic agents to evaluate exposure to chlamydia infections (e.g., in non-vaccinated subjects).
  • assays are used to characterize a T cell response in a subject to determine whether the subject has been infected with a chlamydia organism.
  • the subject can be a subject suspected of exposure to a chlamydia organism recently (i.e., an assay to detect a response can be performed with a sample taken from the subject about 3, 4, 5, 6, 7, 8, 9, 10, 14, 30, or more days after suspected exposure to a chlamydia organism).
  • the subject can be a subject suspected of exposure to a chlamydia organism weeks, months, or years prior to the assay.
  • stimulation of an immune response in T cells is determined by measuring antigen-induced production of cytokines by T cells.
  • stimulation of an immune response in T cells can be determined by measuring antigen- induced production of IFN ⁇ , IL-4, IL-2, IL-6, IL-10, IL- 17 and/or TNF ⁇ by T cells.
  • antigen-induced production of cytokines by T cells can be measured by intracellular cytokine staining followed by flow cytometry. Other suitable methods include surface capture staining followed by flow cytometry, or methods that determine cytokine concentration in supernatants of activated T cell cultures, such as ELISA or ELISPOT assays.
  • antigen-produced production of cytokines by T cells is measured by ELISPOT assay.
  • ELISPOT assays typically employ a technique very similar to the sandwich enzyme-linked immunosorbent assay (ELISA) technique.
  • An antibody e.g. monoclonal antibody, polyclonal antibody, etc.
  • An antibody is coated aseptically onto a PVDF (polyvinylidene fluoride) -backed microplate.
  • Antibodies are chosen for their specificity for the cytokine of interest. The plate is blocked (e.g., with a serum protein that is non-reactive with any of the antibodies in the assay).
  • Cells to be tested for cytokine production are plated out at varying densities, along with antigen or mitogen, and then placed in a humidified 37°C CO 2 incubator for a specified period of time.
  • Cytokine secreted by activated cells is captured locally by the coated antibody on the high surface area PVDF membrane.
  • a secondary antibody e.g. a biotinylated polyclonal antibody
  • This antibody is reactive with a distinct epitope of the target cytokine and thus is employed to detect the captured cytokine.
  • the detected cytokine is then visualized using an avidin-HRP, and a precipitating substrate (e.g., AEC, BCIP/NBT).
  • a precipitating substrate e.g., AEC, BCIP/NBT.
  • the colored end product typically represents an individual cytokine-producing cell. Spots can be counted manually (e.g., with a dissecting microscope) or using an automated reader to capture the microwell images and to analyze spot number and size. In some embodiments, each spot correlates to a single cytokine-producing cell.
  • an immune response in T cells is said to be stimulated if between about 1% and about 100% of antigen-specific T cells produce cytokines. In some embodiments, an immune response in T cells is said to be stimulated if at least about 1%, at least about 5%, at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 90%, at least about 95%, at least about 99%, or about 100% of antigen-specific T cells produce cytokines.
  • an immune response in T cells is said to be stimulated if immunized subjects comprise at least about 10-fold, at least about 50-fold, at least about 100- fold, at least about 500-fold, at least about 1000-fold, at least about 5000-fold, at least about 10,000-fold, at least about 50,000-fold, at least about 100,000-fold, or greater than at least about 100,000-fold more cytokine-producing cells than do na ⁇ ve controls.
  • stimulation of an immune response in T cells can be determined by measuring antigen-induced proliferation of T cells.
  • antigen-induced proliferation may be measured as uptake of H -thymidine in dividing T cells (sometimes referred to as "lymphocyte transformation test, or "LTT").
  • antigen-induced proliferation is said to have occurred if 3 H-thymidine uptake (given as number of counts from a ⁇ counter) is at least about 5 -fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, at least about 100-fold, at least about 500-fold, at least about 1000-fold, at least about 5000-fold, at least about 10,000-fold, or greater than at least about 10,000-fold higher than a na ⁇ ve control.
  • antigen-induced proliferation may be measured by flow cytometry.
  • antigen-induced proliferation may be measured by a carboxyfluorescein succinimidyl ester (CFSE) dilution assay.
  • CFSE is a non-toxic, fluorescent, membrane-permeating dye that binds the amino groups of cytoplasmic proteins with its succinimidyl-reactive group (e.g., T cell proteins). When cells divide, CFSE-labeled proteins are equally distributed between the daughter cells, thus halving cell fluorescence with each division.
  • antigen-specific T cells lose their fluorescence after culture in the presence of the respective antigen (CFSE low ) and are distinguishable from other cells in culture (CFSE hlgh ).
  • antigen-induced proliferation is said to have occurred if CFSE dilution (given as the percentage of CFSE low cells out of all CFSE + cells) is at least about 5%, at least about 10%, at least about 25%, at least about 50%, at least about 75%, at least about 90%, at least about 95%, or at least about 100%.
  • an immune response in T-cells is said to be stimulated if cellular markers of T cell activation are expressed at different levels (e.g., higher or lower levels) relative to unstimulated cells.
  • CDl Ia CD27, CD25, CD40L, CD44, CD45RO, and/or CD69 are more highly expressed in activated T cells than in unstimulated T cells.
  • L-selectin (CD62L), CD45RA, and/or CCR7 are less highly expressed in activated T cells than in unstimulated T cells.
  • an immune response in T cells is measured by assaying cytotoxicity by effector CD8 T cells against antigen-pulsed target cells.
  • a 51 chromium ( 51 Cr) release assay can be performed.
  • effector CD8 T cells bind infected cells presenting virus peptide on class I MHC and signal the infected cells to undergo apoptosis. If the cells are labeled with 51 Cr before the effector CD8 T cells are added, the amount of 51 Cr released into the supernatant is proportional to the number of targets killed.
  • an immune response in T cells is measured by detecting expression of one or more of Perforin, Granzyme B, or CD 107a (e.g., by ELISPOT or flow cytometry). See, e.g., Betts et al, J. Immunol. Meth. 281(l-2):65-78, 2003.
  • various assays can be utilized in order to determine whether an immune response has been stimulated in a B cell or group of B cells, e.g., to characterize an antibody response in a subject that has been administered an immunogenic composition against chlamydia, or to determine whether a subject has been exposed to a chlamydia organism.
  • stimulation of an immune response in B cells can be determined by measuring antibody titers.
  • antibody titer refers to the ability of antibodies to bind ntigens at particular dilutions.
  • a high antibody titer refers to the ability of antibodies to bind antigens even at high dilutions.
  • an immune response in B cells is said to be stimulated if antibody titers are measured to be positive at dilutions at least about 5 -fold greater, at least about 10-fold greater, at least about 20-fold greater, at least about 50-fold greater, at least about 100-fold greater, at least about 500-fold greater, at least about 1000 fold greater, or more than about 1000-fold greater than in non-immunized individuals or pre -immune serum.
  • stimulation of an immune response in B cells can be determined by measuring antibody affinity.
  • an immune response in B cells is said to be stimulated if an antibody that has an equilibrium dissociation constant (IQ) less than 10 "7 M, less than 10 "8 M, less than 10 "9 M, less than 10 "10 M, less than 10 "11 M, less than 10 "12 M, or less, has been elicited.
  • IQ equilibrium dissociation constant
  • a T cell-dependent immune response in B cells is said to be stimulated if class-switch recombination has occurred.
  • a switch from IgM to another isotype e.g., to an IgG isotype or to IgA or to a mixture of these isotypes
  • IgM is indicative of a T-cell dependent immune response in B cells.
  • an immune response in B cells is determined by measuring affinity maturation of antigen- specific antibodies. Affinity maturation occurs during the germinal center reaction whereby activated B cells repeatedly mutate a region of the immunoglobulin gene that encodes the antigen-binding region. B cells producing mutated antibodies which have a higher affinity for antigen are preferentially allowed to survive and proliferate. Thus, over time, the antibodies made by B cells in GCs acquire incrementally higher affinities.
  • the readout of this process is the presence of high antibody titer (e.g. high affinity IgG antibodies that bind and neutralize antigens even at high dilutions).
  • an immune response in B cells is said to be stimulated if memory B cells and/or long-lived plasma cells that can produce large amounts of high- affinity antibodies for extended periods of time have formed.
  • antibody titers are measured after different time intervals (e.g. 2 weeks, 1 month, 2 months, 6 months, 1 year, 2 years, 5 years, 10 years, 15 years, 20 years, 25 years, or longer) after vaccination in order to test for the presence of memory B cells and/or long-lived plasma cells that can produce large amounts of high-affinity antibodies for extended periods of time.
  • memory B cells and/or long-lived plasma cells that can produce large amounts of high-affinity antibodies for extended periods of time are said to be present by measuring humoral responses (e.g. if humoral responses are markedly more rapid and result in higher titers after a later booster vaccination than during the initial sensitization).
  • an immune response in B cells is said to be stimulated if a vigorous germinal center reaction occurs.
  • a vigorous germinal center reaction can be assessed visually by performing histology experiments.
  • vigorous germinal center reaction can be assayed by performing immunohistochemistry of antigen-containing lymphoid tissues (e.g., vaccine-draining lymph nodes, spleen, etc.).
  • immunohistochemistry is followed by flow cytometry.
  • stimulation of an immune response in B cells can be determined by identifying antibody isotypes (e.g., IgG, IgA, IgE, IgM).
  • IgG isotype antibodies
  • IgA isotype antibodies
  • B cells production of IgA isotype antibodies by B cells is a desirable immune response by B cells.
  • an immune response in B cells is determined by analyzing antibody function in neutralization assays.
  • the ability of a chlamydia organism to infect a susceptible cell in vitro in the absence of serum is compared to conditions when different dilutions of immune and non-immune serum are added to the culture medium in which the cells are grown.
  • an immune response in a B cell is said to be stimulated if infection by a chlamydia organism is neutralized at a dilution of about 1 :5, about 1 :10, about 1 :50, about 1 :100, about 1 :500, about 1 :1000, about 1 :5000, about 1 : 10,000, or less.
  • an immunogenic composition may be characterized (e.g., to assess efficacy in inducing a beneficial response in animal models) by infecting groups of immunized and non-immunized mice (e.g., 3 or more weeks after vaccination) with a dose of a chlamydia organism that typically produces a particular pathology (e.g., upper urogenital tract infection) or bacterial burden. The magnitude and duration of pathology or bacterial burden due to infection of both groups is monitored and compared.
  • B cell responses are characterized by transferring serum from immune mice as a "passive vaccine" to assess protection of non-immune mice from pathological effects or burden of infection.
  • infiltrating leukocyte populations are characterized (e.g., to assess the number and type cells in a region of infection, e.g., whether CD4 T cells, CD8 T cells, or other cell types are present).
  • Animal models for chlamydial urogenital infection have been described.
  • a chlamydia organism is applied as an intravaginal inoculum, and infection and pathology of one or more of lower and upper genital tracts of the infected animal is characterized. See, e.g., Barron et al. (J. Infect. Dis. 143(l):63-6, 1981), which describes an intra vaginal infection model in mice.
  • clearance of primary infection is a measure of protective immunity in this model.
  • detection of CD4 T cell responses of a ThI subtype correlate with protection (Morrison et al., Infect. Immun. 70:2741-2751, 2002).
  • an immunogenic composition is assessed in an animal model of chlamydia infection.
  • lower urogenital tract infection by chlamydia is assessed in the model (e.g., lower tract bacterial burden and/or inflammation due to infection is assessed).
  • upper tract infection by chlamydia is assessed in the model (e.g., one or more of upper tract bacterial burden, inflammation, infertility, collagen deposition, scarring due to infection, are assessed).
  • an ability to prevent ascension of a chlamydia infection from the lower tract to the upper genital tract is assessed.
  • rate of bacterial clearance from the lower tract is assessed.
  • rate of bacterial clearance from the upper tract is assessed.
  • an immunogenic composition is assessed in an animal model in multiple strains of the animal of interest (e.g., multiple mouse strains).
  • presence and size of hydrosalpinx is assessed.
  • desirable immunogenic compositions are characterized as having one or more of the above effects in vivo (e.g., in an animal model).
  • an immunogenic composition reduces lower urogenital tract infection by chlamydia bacteria.
  • an immunogenic composition reduces lower tract bacterial burden.
  • an immunogenic composition reduces lower tract inflammation due to infection.
  • an immunogenic composition reduces upper tract infection by chlamydia.
  • an immunogenic composition reduces one or more of upper tract bacterial burden, inflammation, infertility, collagen deposition, scarring due to a chlamydia infection.
  • an immunogenic composition reduces ascension of a chlamydia infection from the lower tract to the upper genital tract. In some embodiments, an immunogenic composition increases the rate of bacterial clearance from the lower tract and/or the upper tract. In some embodiments, an immunogenic composition reduces presence and/or size of hydrosalpinx or salpyngitis due to infection. In some embodiments, an immunogenic composition has one or more of the above effects in multiple animal strains (e.g., multiple mouse strains). [00129] One of ordinary skill in the art will recognize that the assays described above are only exemplary methods which could be utilized in order to determine whether T cell activation and/or B cell activation has occurred.
  • any assay known to one of skill in the art which can be used to determine whether T and/or B cell activation has occurred falls within the scope of this invention.
  • the assays described herein as well as additional assays that could be used to determine whether T and/or B cell activation has occurred are described in Current Protocols in Immunology (John Wiley & Sons, Hoboken, NY, 2007; incorporated herein by reference).
  • compositions and methods described herein can be used for the prophylaxis and/or treatment of any chlamydia infection, chlamydial disease, disorder, and/or condition.
  • prophylaxis refers to uses before onset of symptoms due to a chlamydia infection, chlamydial disease, disorder, and/or condition and/or before known exposure to a chlamydia organism.
  • immunogenic compositions in accordance with the present invention may be used to treat, alleviate, ameliorate, relieve, delay onset of, inhibit progression of, reduce risk of infection by, and reduce severity of, and/or reduce incidence of one or more symptoms or features of a chlamydial disease, disorder, and/or condition.
  • inventive an immunogenic composition may be used to treat, alleviate, ameliorate, relieve, delay onset of, inhibit progression of, reduce severity of, and/or reduce incidence of one or more symptoms or features of chlamydial infection (e.g., C. trachomatis infection, C. pneumoniae infection, C. psittaci infection).
  • chlamydial infection e.g., C. trachomatis infection, C. pneumoniae infection, C. psittaci infection.
  • a method for the prophylaxis and/or treatment of chlamydia infection comprises administering a therapeutically effective amount of an immunogenic composition described herein to a subject in need thereof, in such amounts and for such time as is necessary to achieve the desired result.
  • a "therapeutically effective amount" of an inventive immunogenic composition is that amount effective for reducing risk of infection by, or treating, alleviating, ameliorating, relieving, delaying onset of, inhibiting progression of, reducing severity of, and/or reducing incidence of one or more symptoms or features of chlamydia infection.
  • inventive prophylactic and/or therapeutic protocols involve administering a therapeutically effective amount of one or more inventive immunogenic compositions to a healthy subject (i.e., a subject who does not display any symptoms of chlamydia infection and/or who has not been diagnosed with chlamydia infection).
  • healthy individuals may be vaccinated using inventive immunogenic compositions prior to development of chlamydia infection and/or onset of symptoms of chlamydia infection; at risk individuals (e.g., patients exposed to individuals suffering from chlamydia infection, patients at high risk for sexually transmitted diseases, individuals at risk due to young age (e.g., children, adolescents, or young adults)) can be treated substantially contemporaneously with (e.g., within 48 hours, within 24 hours, or within 12 hours of) the onset of symptoms of and/or exposure to chlamydia infection.
  • individuals known to have chlamydia infection may receive treatment at any time.
  • inventive prophylactic and/or therapeutic protocols involve administering a therapeutically effective amount of one or more inventive immunogenic compositions to a subject such that an immune response is stimulated in both T cells and B cells.
  • immune responses e.g. T cell responses
  • a given indication e.g., humoral response, ThI T cell response, cytotoxic T cell, response, and/or a combination of these responses.
  • the present invention provides immunogenic compositions (e.g., vaccines) comprising a novel chlamydia antigen, e.g., one or more of a CT209 polypeptide antigen, a CT253 polypeptide antigen, a CT425 polypeptide antigen, a CT497 polypeptide antigen, a CT843 polypeptide antigen, and one or more pharmaceutically acceptable excipients.
  • a method of administering an inventive immunogenic composition to a subject in need thereof is provided.
  • inventive compositions are administered to humans.
  • the phrase "active ingredient" generally refers to an inventive immunogenic composition comprising at least one chlamydia antigen and optionally comprising one or more additional agents, such as an adjuvant.
  • immunogenic compositions are principally directed to compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of immunogenic compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with merely ordinary, if any, experimentation.
  • Subjects to which administration of the immunogenic compositions of the invention is contemplated include, but are not limited to, humans and/or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and/or dogs; and/or birds, including commercially relevant birds such as chickens, ducks, geese, and/or turkeys.
  • the formulations of the immunogenic compositions described herein may be prepared by any method known or hereafter developed in the art of vaccines.
  • such preparatory methods include the step of bringing the antigen(s) (or nucleic acids encoding the antigens, for nucleic acid based applications) into association with one or more excipients and/or one or more other accessory ingredients, and then, if necessary and/or desirable, shaping and/or packaging the product into a desired single- or multi-dose unit.
  • An immunogenic composition of the invention may be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses.
  • a "unit dose" is discrete amount of the immunogenic composition comprising a predetermined amount of the antigen(s).
  • Immunogenic formulations of the present invention may additionally comprise a pharmaceutically acceptable excipient, which, as used herein, includes any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired.
  • the pharmaceutically acceptable excipient is at least 95%, 96%, 97%, 98%, 99%, or 100% pure.
  • the excipient is approved for use in humans and for veterinary use.
  • the excipient is approved by United States Food and Drug Administration.
  • the excipient is pharmaceutical grade.
  • the excipient meets the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and/or the International Pharmacopoeia.
  • compositions used in the manufacture of immunogenic compositions include, but are not limited to, inert diluents, dispersing and/or granulating agents, surface active agents and/or emulsif ⁇ ers, disintegrating agents, binding agents, preservatives, buffering agents, lubricating agents, and/or oils. Such excipients may optionally be included in the inventive formulations.
  • Injectable formulations for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents.
  • a sterile injectable preparation may be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol.
  • acceptable vehicles and solvents that may be employed are water, Ringer's solution, U. S. P. and isotonic sodium chloride solution.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil can be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid are used in the preparation of injectables.
  • Injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
  • sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
  • an immunogenic composition is administered to a mucosal surface.
  • Compositions for rectal or vaginal administration can include suppositories which can be prepared by mixing immunogenic compositions of this invention with suitable excipients such as cocoa butter, polyethylene glycol or a suppository wax which are solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release antigen.
  • an immunogenic composition is administered orally.
  • Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules.
  • the antigen can be mixed with at least one inert, pharmaceutically acceptable excipient such as sodium citrate or dicalcium phosphate and/or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents
  • Suitable devices for use in delivering immunogenic compositions by an intradermal route described herein include short needle devices such as those described in U.S. Patents 4,886,499; 5,190,521; 5,328,483; 5,527,288; 4,270,537; 5,015,235; 5,141,496; and 5,417,662. Jet injection devices which deliver liquid immunogenic compositions to the dermis via a liquid jet injector and/or via a needle which pierces the stratum corneum and produces a jet which reaches the dermis are suitable. Jet injection devices are described, for example, in U.S. Patents 5,480,381; 5,599,302; 5,334,144; 5,993,412; 5,649,912; 5,569,189;
  • Ballistic powder/particle delivery devices which use compressed gas to accelerate an immunogenic composition in powder form through the outer layers of the skin to the dermis are suitable.
  • conventional syringes may be used in the classical mantoux method of intradermal administration.
  • a therapeutically effective amount of an inventive immunogenic composition is delivered to a patient and/or animal prior to, simultaneously with, and/or after exposure to a chlamydia organism or diagnosis with a chlamydial disease, disorder, and/or condition.
  • a therapeutic amount of an inventive composition is delivered to a patient and/or animal prior to, simultaneously with, and/or after onset of symptoms of a chlamydial disease, disorder, and/or condition.
  • the amount of an immunogenic composition is sufficient to reduce risk of infection by, or treat, alleviate, ameliorate, relieve, delay onset of, inhibit progression of, reduce severity of, and/or reduce incidence of one or more symptoms or features of the chlamydial disease, disorder, and/or condition.
  • Immunogenic compositions may be administered using any amount and any route of administration effective for treatment.
  • the exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the infection, the particular composition, its mode of administration, its mode of activity, and the like.
  • the specific effective dose level for any particular subject or organism will depend upon a variety of factors including the immunogenicity of the antigen composition employed; the specific composition employed; the nature of adjuvant used; the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and like factors well known in the medical arts.
  • Immunogenic compositions of the present invention may be administered by any route that elicits an immune response.
  • an immunogenic composition is administered subcutaneously.
  • an immunogenic composition is administered intramuscularly.
  • the immunogenic compositions of the present invention are administered by a variety of routes, including oral, intravenous, intraarterial, intramedullary, intrathecal, intraventricular, transdermal, interdermal, rectal, intravaginal, intraperitoneal, topical (as by powders, ointments, creams, and/or drops), transdermal, mucosal, nasal, buccal, enteral, sublingual; by intratracheal instillation, bronchial instillation, and/or inhalation; and/or as an oral spray, nasal spray, and/or aerosol.
  • an immunogenic composition of the invention may be administered in amounts that include a protein antigen in ranges of l ⁇ g-500 ⁇ g. In some embodiments, a dose of about 10 ⁇ g , 20 ⁇ g, 50 ⁇ g, or 100 ⁇ g is administered to a human. [00155] In some embodiments, an immunogenic composition is administered more than once (e.g., twice, three times, four times, five times). In some embodiments, a boost is given about 2 weeks, one month, three months, six months, one year, or longer after an initial immunization.
  • kits comprising one or more of the antigens described herein.
  • the invention provides a kit including a novel chlamydia antigen and instructions for use.
  • a kit may include multiple different chlamydia antigens.
  • a kit may include any of a number of additional components or reagents in any combination. All of the various combinations are not set forth explicitly but each combination is included in the scope of the invention.
  • a kit may include, for example, (i) an immunogenic composition including at least one of the following chlamydia antigens: CT209, CT253, CT425, CT497, or CT843 polypeptide antigens; and (ii) instructions for administering the composition to a subject in need thereof.
  • the kit further includes an adjuvant.
  • Kits that include nucleic acids encoding chlamydia antigens are also provided.
  • a kit may include, for example, (i) a composition including a nucleic acid encoding a chlamydia antigen; (ii) instructions for use of the nucleic acid compositin
  • kits may, for example, include protocols and/or describe conditions for production of immunogenic compositions and/or administration of immunogenic compositions, to a subject in need thereof, etc.
  • Kits generally include one or more vessels or containers so that some or all of the individual components and reagents may be separately housed.
  • Kits may also include a means for enclosing individual containers in relatively close confinement for commercial sale, e.g., a plastic box, in which instructions, packaging materials such as styrofoam, etc., may be enclosed.
  • An identifier e.g., a bar code, radio frequency identification (ID) tag, etc., may be present in or on the kit or in or one or more of the vessels or containers included in the kit.
  • An identifier can be used, e.g., to uniquely identify the kit for purposes of quality control, inventory control, tracking, movement between workstations, etc.
  • Chlamydia specific T cells were elicited by the intraperitoneal (i.p.) administration of 10 7 infectious units of Chlamydia trachomatis elemental bodies (EB) into inbred mice. Six days post injection, the mice were euthanized and the peritoneal elicited cells (PEC) harvested by lavaging the cavity with PBS containing penicillin/streptomycin. The PECs were pooled from each mouse and the T cell populations enriched by magnetic bead depletion using the Miltenyi Pan T sorting kit following the manufacturer's instructions. The resulting enriched T cell population was then sorted using antibody-conjugated magnetic beads specific for CD4 + T cells (Miltenyi).
  • the CD4 negative population was considered CD8 + .
  • Both T cell subsets were expanded non-specifically in vitro using either plate bound anti-CD3 and anti-CD28 antibodies (5 ⁇ g/mL each) or Dynabeads' Mouse CD3/CD28 T cell expander kit.
  • the T cells were maintained at 10 6 cells/mL in cPRMI-10% (RPMI, 10% FCS, HEPES, NEAA, Sodium Pyruvate, L-glutamine, penicillin/streptomycin and beta- mercaptoethanol) plus IL-2.
  • mice Six days prior to the library screen, na ⁇ ve syngeneic mice were injected i.p. with ImL of 3% brewer thiogly collate yeast to elicit macrophages. The day before the screen, the mice were euthanized and their PECs harvested and pooled as described above. The recovered PECs (predominantly macrophages) were resuspended in cRPMI-10%, and then plated at 10 5 cells per well in flat-bottom 96 well plates and placed into a 37 0 C, 5% CO 2 humidified incubator overnight.
  • the ORFeome library is a set of E. coli that express each open reading frame in the C. trachomatis serovar D/UW-3/Cx genome, which was prepared as described in WO 2007/098255, which is herein incorporated by reference.
  • the next day, the chlamydia ORFeome library was removed from the freezer, allowed to thaw at room temperature, and added to the macrophages at a 100:1 ratio of induced bacteria to macrophage, and returned to the 37 0 C, 5% CO 2 humidified incubator.
  • the cells were washed with PBS and then fixed with 1% paraformaldehyde (PFA). The cells were washed extensively, and residual PFA was quenched with 12OmM Lysine. After a final rinse with PBS, the expanded T cells were added to the pulsed, fixed macrophages at 10 5 cells per well. The plates containing the expanded T cells and pulsed macrophages were returned to the 37 0 C, 5% CO 2 humidified incubator. Twenty-four hours later, cell-free supernatants were harvested and evaluated for the presence of IFN ⁇ via ELISA.
  • PFA paraformaldehyde
  • the library screen was performed using cells from several inbred mouse strains including Balb/c, C57BL/6, C3H and one out bred strain, CDl . Based on the results of each ELISA, clones that stimulated T cells to produce an IFN ⁇ response greater than two standard deviations above the mean of all data were considered to be significant; sample data from CD8 T cells from C57BL/6 mice are shown in Figure 1.
  • the T cell response to each clone in the library is represented by a diamond, and the cutoff of the mean of all the data plus 2X SD is indicated by the line. For this screen ( Figure 1), approximately seventeen antigens out of the 894 possible proteins elicited responses above the cutoff.
  • CT425 hypothetical protein unknown CT497 replicative DNA helicase nucleus CT843 3OS ribosomal protein S15 cytoplasm
  • plasmid DNA from the library stocks was purified and sequenced. The resulting sequences are listed in Table 3, which shows the sequencing data for the genes that encoded T cell antigens identified in the library.
  • the primer used for sequencing was a consensus primer located within the plasmid, upstream of each clone.
  • Query represents the actual sequence data from the plasmid insert;
  • Sbjct is the sequence of the annotated gene found in GenBank. Alignments were performed using the nucleotide BLAST feature of the NCBI website on the internet at the following address: blast.ncbi.nlm.nih.gov/Blast.cgi.
  • Example2 Peripheral blood mononuclear cells from women with a clinical history of Chlamydia trachomatis infection respond to identified protein antigens
  • CD4 + and CD8 + T cells and CD14 + monocytes were separated using antibody coated magnetic beads and placed into culture - the monocytes were derived into dendritic cells (MDDC) with GM-CSF and IL-4 cytokines, and the T cells were non-specifically expanded using magnetic beads coated with anti-CD3 and anti-CD28 antibodies plus recombinant IL-2.
  • MDDC dendritic cells
  • the enriched and expanded CD4 + and CD8 + T cells were separately used to interrogate autologous MDDC that had been pulsed with an ORFeome library, to determine which antigens induced T cell responses naturally.
  • the ORFeome library was the same library described in Example 1 , except that it was moved to an E. coli strain that was inducible with arabinose rather than bacteriophage. After 18 hours of coculture, T cell responses were monitored by measuring interferon gamma (IFN ⁇ ) in the cell-free supernatants by ELISA. [00167] Over 110 samples from human subjects were screened against the library.
  • the invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process. Furthermore, it is to be understood that the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Veterinary Medicine (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/US2009/068457 2008-12-17 2009-12-17 Chlamydia antigens and uses thereof Ceased WO2010078027A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP09836943A EP2379106A4 (en) 2008-12-17 2009-12-17 ANTIGENS OF CHLAMYDIAS AND USES THEREOF
CA2781805A CA2781805A1 (en) 2008-12-17 2009-12-17 Chlamydia antigens and uses thereof
US13/140,773 US20110293664A1 (en) 2008-12-17 2009-12-17 Chlamydia antigens and uses thereof
JP2011542431A JP2012512257A (ja) 2008-12-17 2009-12-17 クラミジア抗原およびその使用
AU2009333159A AU2009333159A1 (en) 2008-12-17 2009-12-17 Chlamydia antigens and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US13826108P 2008-12-17 2008-12-17
US61/138,261 2008-12-17

Publications (1)

Publication Number Publication Date
WO2010078027A1 true WO2010078027A1 (en) 2010-07-08

Family

ID=42310157

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/068457 Ceased WO2010078027A1 (en) 2008-12-17 2009-12-17 Chlamydia antigens and uses thereof

Country Status (6)

Country Link
US (1) US20110293664A1 (https=)
EP (1) EP2379106A4 (https=)
JP (1) JP2012512257A (https=)
AU (1) AU2009333159A1 (https=)
CA (1) CA2781805A1 (https=)
WO (1) WO2010078027A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110014210A1 (en) * 2006-01-16 2011-01-20 Government of the US, as represented by the Secret ary, Department of Health and Human Services Chlamydia vaccine
WO2012054755A1 (en) * 2010-10-20 2012-04-26 Genocea Biosciences, Inc. Chlamydia antigens and uses thereof

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20020061848A1 (en) * 2000-07-20 2002-05-23 Ajay Bhatia Compounds and methods for treatment and diagnosis of chlamydial infection
EP3756684A1 (en) 2009-05-22 2020-12-30 Genocea Biosciences, Inc. Vaccines against herpes simplex virus type 2: compositions and methods for eliciting an immune response
JP2013525271A (ja) 2010-03-12 2013-06-20 チルドレンズ メディカル センター コーポレーション 免疫原およびそのスクリーニング方法
JP6055776B2 (ja) 2010-11-24 2016-12-27 ジェノセア バイオサイエンシーズ, インコーポレイテッド 単純ヘルペスウイルス2型に対するワクチン:免疫応答を誘発する組成物及び方法
AU2012340712B2 (en) * 2011-11-23 2017-09-14 Genocea Biosciences, Inc. Nucleic acid vaccines against Herpes Simplex Virus type 2: compositions and methods for eliciting an immune response
US11576958B2 (en) 2013-02-07 2023-02-14 Children's Medical Center Corporation Protein antigens that provide protection against pneumococcal colonization and/or disease
US10350288B2 (en) 2016-09-28 2019-07-16 Genocea Biosciences, Inc. Methods and compositions for treating herpes
CN112969474A (zh) 2018-09-12 2021-06-15 艾芬尼维克斯公司 多价肺炎球菌疫苗
MX2024002779A (es) 2021-09-09 2024-06-11 Affinivax Inc Vacunas neumocócicas multivalentes.

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000027994A2 (en) * 1998-11-12 2000-05-18 The Regents Of The University Of California Chlamydia pneumoniae genome sequence
US20050152926A1 (en) * 2002-02-13 2005-07-14 Chiron Srl Cytotoxic t-cell epitopes from chlamydia
WO2006050571A1 (en) * 2004-11-11 2006-05-18 Queensland University Of Technology Chlamydia antigens and uses thereof
US20060216308A1 (en) * 2001-12-12 2006-09-28 Novartis Vaccines And Diagnostics, Inc. Immunisation against Chlamydia trachomatis

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2218731A1 (en) * 1997-11-28 2010-08-18 Merck Serono Biodevelopment Chlamydia trachomatis genomic sequence and polypeptides, fragments thereof and uses thereof, in particular for the diagnosis, prevention and treatment of infection
US6822071B1 (en) * 1998-11-12 2004-11-23 The Regents Of The University Of California Polypeptides from Chlamydia pneumoniae and their use in the diagnosis, prevention and treatment of disease

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000027994A2 (en) * 1998-11-12 2000-05-18 The Regents Of The University Of California Chlamydia pneumoniae genome sequence
US20060216308A1 (en) * 2001-12-12 2006-09-28 Novartis Vaccines And Diagnostics, Inc. Immunisation against Chlamydia trachomatis
US20050152926A1 (en) * 2002-02-13 2005-07-14 Chiron Srl Cytotoxic t-cell epitopes from chlamydia
WO2006050571A1 (en) * 2004-11-11 2006-05-18 Queensland University Of Technology Chlamydia antigens and uses thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE GENPEPT NCBI; "Swiss-Prot_O84505, Replicative DNA Helicase", XP008143694, Database accession no. O84505 *
See also references of EP2379106A4 *
STEPHENS: "Genome sequence of an obligate intracellular pathogen of humans: Chlamydia 1 trachomatis.", SCIENCE, vol. 282, 1998, pages 754 - 759, XP002624763 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110014210A1 (en) * 2006-01-16 2011-01-20 Government of the US, as represented by the Secret ary, Department of Health and Human Services Chlamydia vaccine
US9259463B2 (en) * 2006-01-16 2016-02-16 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Chlamydia vaccine
US20170021007A1 (en) * 2006-01-16 2017-01-26 Government Of The Us, As Represented By The Secretary, Department Of Health And Human Services Chlamydia vaccine
US10420829B2 (en) * 2006-01-16 2019-09-24 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Chlamydia vaccine
WO2012054755A1 (en) * 2010-10-20 2012-04-26 Genocea Biosciences, Inc. Chlamydia antigens and uses thereof
JP2013545448A (ja) * 2010-10-20 2013-12-26 ジェノセア バイオサイエンシーズ, インコーポレイテッド クラミジア抗原及びその使用
JP2016106117A (ja) * 2010-10-20 2016-06-16 ジェノセア バイオサイエンシーズ, インコーポレイテッド クラミジア抗原及びその使用

Also Published As

Publication number Publication date
US20110293664A1 (en) 2011-12-01
AU2009333159A1 (en) 2011-08-04
EP2379106A4 (en) 2012-06-13
CA2781805A1 (en) 2010-07-08
EP2379106A1 (en) 2011-10-26
JP2012512257A (ja) 2012-05-31

Similar Documents

Publication Publication Date Title
US20110293664A1 (en) Chlamydia antigens and uses thereof
US12083173B2 (en) Protein antigens that provide protection against pneumococcal colonization and/or disease
CA2849391A1 (en) Chlamydia antigens and uses thereof
RU2352356C2 (ru) ИММУНОГЕННАЯ КОМПОЗИЦИЯ НА ОСНОВЕ АНТИГЕНА Chlamydia trachomatis (ВАРИАНТЫ) И ЕЕ ИСПОЛЬЗОВАНИЕ
JP2008544745A (ja) Chlamydiatrachomatisのための免疫原性組成物
JP2009515831A (ja) ペスト菌(Yersiniapestis)抗原を含む組成物
JP2007526318A (ja) Chlamydiapneumoniaeに対する免疫原性組成物
Shillova Per-oral Inoculation with Live or Killed Chlamydia muridarum Protects against a Chlamydia muridarum Per-vaginal Challenge
Poston T-cell Dependent and independent mechanisms of chlamydial eradication and control
CN1984678A (zh) 用于肺炎衣原体的免疫原性组合物
AU2012261545A1 (en) Immunogenic compositions for Chlamydia trachomatis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09836943

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2011542431

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2009333159

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2009836943

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2009333159

Country of ref document: AU

Date of ref document: 20091217

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 13140773

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2781805

Country of ref document: CA