WO2010060046A2 - Génotypage par transfert d'énergie colorant-sonde par résonance de fluorescence - Google Patents

Génotypage par transfert d'énergie colorant-sonde par résonance de fluorescence Download PDF

Info

Publication number
WO2010060046A2
WO2010060046A2 PCT/US2009/065550 US2009065550W WO2010060046A2 WO 2010060046 A2 WO2010060046 A2 WO 2010060046A2 US 2009065550 W US2009065550 W US 2009065550W WO 2010060046 A2 WO2010060046 A2 WO 2010060046A2
Authority
WO
WIPO (PCT)
Prior art keywords
probe
sequence
nucleic acid
target
acid sequence
Prior art date
Application number
PCT/US2009/065550
Other languages
English (en)
Other versions
WO2010060046A3 (fr
Inventor
Micah Halpern
Phillip M. Ellis
Original Assignee
Midwest Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Midwest Research Institute filed Critical Midwest Research Institute
Publication of WO2010060046A2 publication Critical patent/WO2010060046A2/fr
Publication of WO2010060046A3 publication Critical patent/WO2010060046A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/6818—Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism

Definitions

  • SNPs single nucleotide polymorphisms
  • INDELs insertion/deletions
  • microsatellite variations A SNP is a genetic marker resulting from a variation in sequence at a particular position within a DNA sequence. SNPs can result from a base transition (purine to purine or pyrimidine to pyrimidine) or transversion (purine to pyrimidine or pyrimidine to purine).
  • INDELs typically arise when one or more nucleotides is added or subtracted from a sequence (e.g., CCT to CT).
  • Microsatellites also termed short tandem repeats (STR) in the forensics field, are an example of a specific type of INDEL often attributed to polymerase slippage and consist of repeating units of 1-6 base pairs (e.g., CAGCAG).
  • Such variation is extensive throughout all genomes.
  • the human genome consists of approximately 3 billion base pairs and inherited genetic differences contribute to human phenotypic diversity.
  • the most common type of human genetic variation is the SNP.
  • SNP single nucleotide changes are the result of normal cellular operations (a malfunction during the replication of DNA causes the wrong base to be inserted into a nucleic acid chain) or random interactions with the environment (the action of mutagens can cause chemical modification of a nucleic base (changing it into a different base).
  • Cancers arise from the accumulation of inherited polymorphisms and/or sporadic somatic polymorphisms in the DNA that affects cell cycle and growth signaling genes.
  • Emerging applications for which SNP, INDEL, and/or microsatellite testing is fast becoming critical include the fields of in vitro diagnostics, clinical diagnostics, molecular biology research, forensic science, identity testing, pharmacogenetics, veterinary diagnostics, agricultural-genetics testing, environmental testing, food testing, industrial process monitoring, insurance testing and others. There are many other potential applications for the detection and/or quantitation of individual/strain identification.
  • a wide variety of technologies have been developed to screen for these changes and fall under the major categories of hybridization-based, enzyme-based, post-amplification detection and different forms of DNA sequencing. In hybridization-screening, developments aimed at discovering and identifying DNA changes can be classified under two major sub-categories of generic DNA intercalator techniques and strand specific hybridization.
  • the first subcategory within hybridization includes generic methods that utilize DNA intercalating dyes that exhibit increased fluorescence when bound to double stranded DNA. These fluorescent moieties include SYBR, SYTO and a host of other well characterized dyes. End point melting curve analysis using these dyes is able to discriminate artifacts (i.e., primer dimer) from specific amplicons but maintain a somewhat low level resolution between amplicons with a similar sequence. In other words, application of dye- based hybridization methods are primarily used for PCR optimization and, only more recently, have been developed for higher resolution screening using more proprietary dyes (e.g., LC Green) and advances in data analysis.
  • DNA intercalating dyes that exhibit increased fluorescence when bound to double stranded DNA. These fluorescent moieties include SYBR, SYTO and a host of other well characterized dyes. End point melting curve analysis using these dyes is able to discriminate artifacts (i.e., primer dimer) from specific amplicons but maintain
  • the second subcategory within hybridization-based screening technology includes strand specific methods that utilize additional nucleic acid reaction components (beyond generic dyes) to monitor the progress of amplification reactions.
  • the most typical added reaction component is some form of oligonucleotide probe designed in or around the sequence of interest. These methods often use fluorescence energy transfer (FET) as the basis of detection.
  • FET fluorescence energy transfer
  • One or more nucleic acid probes are labeled with fluorescent molecules, one of which is able to act as an energy donor and the other of which is an energy acceptor molecule.
  • the donor molecule is excited with a specific wavelength of light that falls within its excitation spectrum which causes it to emit light within its fluorescence emission wavelength.
  • the acceptor molecule is then excited at the emitting wavelength of the first molecule by accepting energy from the donor molecule by a variety of distance-dependent energy transfer mechanisms.
  • FET Fluorescence Resonance Energy Transfer
  • hi FRET the acceptor molecule accepts the emission energy of the donor molecule when they are in close proximity (e.g., on the same, or on a neighboring molecule) with the distance of separation termed the Forster distance.
  • FRET detection The basis of FRET detection is to monitor the changes at the acceptor emission wavelength caused by separation of the two moieties.
  • FRET probes There are two commonly used types of FRET probes: those using hydrolysis of nucleic acid probes to separate donor from acceptor, and those using hybridization to alter the spatial relationship of donor and acceptor molecules.
  • Hydrolysis probes are commercially available as Taqman probes generally shown in Fig. 1. These consist of DNA oligonucleotides that are labeled with donor and acceptor molecules. The probes are designed to bind to a specific region on one strand of a PCR product. Following annealing of the PCR primer to this strand, Taq enzyme extends the DNA with 5' to 3' polymerase activity. Taq enzyme also exhibits 5' to 3' exonuclease activity. TaqMan probes are typically protected at the 3' end to prevent extension. If the TaqMan probe is hybridized to the product strand, the Taq polymerase enzyme will subsequently hydrolyze the probe thereby liberating the donor from the acceptor as the basis of detection. The signal in this instance is cumulative wherein the concentration of free donor and acceptor molecules increasing with each cycle of the amplification reaction. This approach is typically used for quantitation and more recently has been adapted for SNP detection on an assay specific basis.
  • hybridization probes are available in a number of forms and are not consumed during detection as shown in Fig. 2.
  • Molecular beacons are an example of oligonucleotides that have complementary 5' and 3 1 sequences such that they form hairpin loops. Terminal fluorescent labels must be in close proximity for FRET to occur when the hairpin structure is formed. Following hybridization of a molecular beacon to a complementary sequence, the fluorescent labels are separated so FRET does not occur thereby forming the basis of detection.
  • Another approach to using hybridization probes utilizes a pair of labeled oligonucleotides commonly known as dual hybridization probes. These hybridize in close proximity on a PCR product strand bringing donor and acceptor molecules together so that FRET can occur. Variations on this approach can include using a labeled amplification primer with a single adjacent probe.
  • hybridization probes have shown good success with obtaining high levels of resolution for SNP genotyping but suffer from other shortcomings.
  • both methods require the presence of a reasonably long stretch of a known sequence so that the probe/probe pair can bind specifically in close proximity to each other. This can be a problem in some applications wherein the length of known sequences that can be used to design an effective probe may be relatively short.
  • pairs of probes involves more complex experimental design whereby the genotype is a function of the melting off of both probes and requires careful design parameters often limited by sequence identity.
  • a method for detecting and screening at least one SNP, at least one INDEL and/or at least one microsatellite includes asymmetrically amplifying a target nucleic acid in the presence of a DNA intercalating dye, adding a probe containing an acceptor fluorophore to the sample, hybridizing the probe to the target sequence, and analyzing the sample using a melt- curve analysis to identify at least one SNP, at least one INDEL, and/or at least one microsatellite therein.
  • the methods of the present invention will be primarily described in reference to detection and screening of SNPs. However, it will be appreciated by those skilled in the art that the methods hereof may also be used in connection with INDELs and microsatellites or the like without departing from the scope of the present invention or requiring undue experimentation.
  • nucleic acid molecules may be double- stranded molecules and that reference to a particular site on one strand refers, as well, to the corresponding site on a complementary strand.
  • reference to an adenine, a thymine (uridine), a cytosine, or a guanine at a particular site on one strand of a nucleic acid molecule also defines the thymine (uridine), adenine, guanine, or cytosine (respectively) at the corresponding site on a complementary strand of the nucleic acid molecule.
  • Probes and primers may be designed to hybridize to either strand and SNP genotyping methods disclosed herein may generally target either strand.
  • the term “complementary” means having the ability to hybridize to a genomic region, a gene, cDNA, or an RNA transcript thereof as the result of base-specific hydrogen bonding between complementary strands to form Watson-Crick or Hoogstein base pairs.
  • hybridize refers to the formation of a base-paired interaction between single-stranded nucleic acid molecules.
  • the hybridization conditions are such that two nucleotide sequences with an exact match for base pairing, or only a small percentage (1-40%) of base mismatch between the two sequences, form a base paired double-stranded nucleic acid molecule that is stable enough to allow detection.
  • nucleotide sequences form at least 60% base pairing of the nucleotides of the shorter of the two single- stranded nucleic acid molecules, or at least 95% base pairing, or at least 98% base pairing, or at least 99% base pairing, or form 100% base pairing of the nucleotides of the shorter of the two single-stranded nucleic acid molecules.
  • Primers may be oligonucleotides that are designed to hybridize with a portion of the target nucleic acid sequence or amplification products in a sequence-specific manner, and serve as primers for primer extension, amplification and/or sequencing reactions.
  • the criteria for designing sequence-specific primers are well known to persons of skill in the art.
  • the sequence-specific portions of the primers are of sufficient length to permit specific annealing to complementary sequences in ligation products and amplification products, as appropriate.
  • Figure 1 is a schematic representation of a TaqMan hydrolysis probe
  • Fig. 2 is a schematic representation of hybridization probes
  • Fig. 3 is a schematic representation of one embodiment of the method of the present invention
  • Fig. 4 is a schematic representation of one embodiment of the method of the present invention.
  • Fig. 5 is a graphical representation of one example of FRET excitation and emission
  • Fig. 6a is a schematic representation of a single locus probe hybridization scenario in accordance with one embodiment of the method of the present invention
  • Fig. 6b is a schematic representation of a complex locus probe hybridization scenario in accordance with one embodiment of the method of the present invention.
  • Fig. 7 is a graphical representation of resulting melt peaks from the probe hybridzation scenarios of Figs. 6a and 6b;
  • Fig. 8 is a graphical representation of data generated from synthetic resolution testing of a 30 bp probe wherein error bars at +/- 0.4 degrees accounts for potential differences between replicates due to thermal block temperature control;
  • Fig. 9 is a graphical representation of data generated from synthetic resolution testing using a 21bp fluorophore labeled probe (top panel) and an unlabeled probe (bottom panel);
  • Fig. 10 is a graphical representation of data generated from synthetic resolution testing using a 15 bp fluorophore labeled probe
  • Fig. 11 is a graphical representation of data generated from synthetic resolution testing of species multi-SNP templates wherein error bars at +/- 1.0 degrees accounts for potential differences between replicates due to thermal block temperature control;
  • Fig. 12 is a graphical representation of data generated from synthetic resolution testing of a probe labeled by tDt wherein error bars at +/- 0.4 degrees accounts for potential differences between replicates due to thermal block temperature control;
  • Fig. 13 is a graphical representation of data generated from probe treatments of a 30 bp fluorophore labeled probe with inosines including an unmodified (blue), inosine at probe position 30 (pink) and inosines at probe positions 28, 29 and 30 (green);
  • Fig. 14 is a graphical representation of data generated from cytochrome B speciation using one embodiment of the method of the present invention.
  • Fig. 15 is a graphical representation of data generated from MHCdrBeta penguin paternity testing using one embodiment of the method of the present invention.
  • Fig. 16 is a graphical representation of dpFRET sensitivity using quantitated human genomic standard in accordance with one embodiment of the method of the present invention.
  • Fig. 17 is a graphical representation of dpFRET microsatellite testing of JCCL samples for TPOX locus in accordance with one embodiment of the method of the present invention
  • Fig. 18 is a graphical representation of dpFRET microsatellite testing (D3 complex locus) in accordance with one embodiment of the method of the present invention
  • Fig. 19 is a graphical representation of dpFRET microsatellite testing (lack of allelic dropout) in accordance with one embodiment of the method of the present invention.
  • Fig. 20 is a graphical representation of dpFRET microsatellite testing (mixed samples) in accordance with one embodiment of the method of the present invention
  • Fig. 21 is a graphical representation of dpFRET microsatellite testing (chimeric bone marrow transplant sample) in accordance with one embodiment of the method of the present invention
  • Fig. 22 is a schematic representation of relative sequencing in accordance with one embodiment of the method of the present invention.
  • Fig. 23 is a represenation of a gel-electrophoresis showing dpFRET 80 cycle CytB amplification wherein specific product (350 bp) and non-specific product are shown;
  • Fig. 24 is a graphical representation of a 9 repeat probe mismatch peak differentiation in accordance with one embodiment of the method of the present invention
  • Fig. 25 is a graphical representation of a 11 repeat probe mismatch peak differentiation wherein yellow hatched lines delineate approximate melt temperatures for different alleles using a single repeat probe
  • Fig. 26 is a chi-square curve fitting a 9 repeat probe in accordance with one embodiment of the method of the present invention
  • Fig. 27 is a chi-square curve fitting an 11 repeat probe in accordance with one embodiment of the method of the present invention
  • Fig. 28 is a graphical representation of a slope ratio analysis in accordance with one embodiment of the method of the present invention.
  • Fig. 29 is a graphical representation of the loss of heterozygosity in cancer in accordance with one embodiment of the method of the present invention.
  • SNP single nucleotide polymorphism
  • INDEL insertion/deletion loci
  • FRET fluorescence resonance energy-transfer
  • the present method may be used on any source of DNA or cDNA prepared from RNA derived from a source including, but not limited to, fungal, plant, yeast, bacterial, viral, human, animal, any living organism or combinations thereof (collectively hereinafter "DNA source").
  • DNA source a source including, but not limited to, fungal, plant, yeast, bacterial, viral, human, animal, any living organism or combinations thereof.
  • the methods of the present invention may be used on both dead and live cultured organisms. It will be appreciated by one skilled in the art that the methods of the present invention may be used to analyze any source of DNA by adjusting variables described hereinbelow including primers and probes. Moreover, it is contemplated that the present invention may be applied to virtually any nucleic acid. The methods hereof are particularly useful for detecting and screening single or multiple nucleotide substitutions in a target.
  • a clean sample of DNA is extracted from the desired DNA source.
  • Extraction techniques are well known to those skilled in the art and any such technique may be used to extract the desired DNA from a DNA source for analysis.
  • an aliquot of DNA preferably in a range of about 0.001 nanograms to about 10000 nanograms, more preferably from about 0.1 to 1000 nanograms, and most preferably from about 1 to 100 nanograms is extracted from a DNA source.
  • the chromosomal sequences and, in particular, the target nucleic acid sequence must first be amplified.
  • PCR polymerase chain reaction
  • the second step is hybridization or annealing, in which the primers bind to their complementary bases on the single-stranded nucleic acid sequence.
  • the third step is nucleic acid synthesis by a polymerase. Starting from the primer, the polymerase can read a template nucleic acid strand and match it with complementary nucleotides present in the reaction mixture. The results is two new helixes in place of the first, each composed of one of the original strands plus its newly assembled complementary strand. After denaturation, this process may be repeated over and over again, leading to an exponential increase of the target nucleic acid sequence.
  • asymmetric PCR is used to amplify one strand of DNA from an original DNA sample more than the other strand.
  • from about 10 femtograms to 10 micrograms of original DNA sample may be used.
  • PCR is carried out as usual but with a great excess of the first primer complementary for the strand desired to be amplified (i.e., containing the target nucleic acid sequence). This occurs by adding a disproportionately higher amount of the first amplification primer than the second amplification primer.
  • the primer concentration ratio may be from about 1 :5.
  • any suitable primer concentration ratio may be utilized without departing from the scope of the present invention.
  • the presence of the excess first primer results in the DNA strand containing the target nucleic acid sequence continuing to amplify after its other (non-target) complementary DNA strand has run out of the second primer and no longer replicates.
  • the strand that is generated is determined by which of the first or second amplification primer is added in higher amounts. In this manner, many copies of a single-stranded target nucleotide sequence may be generated.
  • the first phase employs two primers involved in a standard PCR amplification to increase the concentration of a double stranded copy of the region of interest.
  • the second phase employs a single primer (that can be the same or different from the primers employed in the first phase) complementary to the strand termed the hybridization template strand.
  • Different combinations of these two phases of amplification are possible.
  • One embodiment is represented by combining the two phases in a single reaction tube as typically described for asymmetric PCR. This approach is useful when there is an abundance of sample and only requires testing with a single hybridization probe as in the case of screening for a single known polymorphism.
  • phase I double stranded amplification (either in singleplex or multiplex fashion), aliquoting of phase I products into single or multiple phase II single stranded amplification reactions.
  • This approach is useful for limited amounts of sample or genotyping across large sequence distances. This reduces the amount of sample and reagents required to produce the initial double stranded template. Methods of optimizing amplification reactions are well known to those skilled in the art.
  • PCR may be optimized by altering times and temperatures for annealing, polymerization, and denaturing, as well as changing the buffers, salts, and other reagents in the reaction composition. Optimization can also be affected by the design of the amplification primers used. For example, the length of the primers, as well as the G-C: A-T ratio can alter the efficiency of primer annealing, thus altering the amplification reaction. It will be appreciated that other methods now known or hereafter discovered for isolating and amplifying a DNA strand may be used instead of asymmetric PCR to produce the hybridization template strand .
  • a fluorophore labeled oligonucleotide probe is hybridized to the template in the presence of a DNA intercalating dye.
  • the exact fraction of the nucleotides that must be complementary in order to obtain stable hybridization varies with a number of hybridization condition factors, including, without limitation, nucleotide sequence (e.g., G and C content of the shorter of the two single stranded nucleic acid molecules), the location of the mismatches along the two molecules, salt concentrations of the hybridization buffers, temperature, and pH.
  • T m melting temperature of a double-stranded nucleic acid molecule
  • the probe can either be commercially synthesized or chemically/enzymatically created in the lab using a number of known labeling techniques including terminal transferase and other labeling strategies.
  • Phase I double stranded
  • Phase II single stranded amplification
  • probe hybridization is accomplished in the same closed tube reaction.
  • the second scenario consists of Phase I and Phase II amplification in a single reaction followed by hybridization with a single or small number of probes. This approach is similar to the first scenario but alleviates the added step of blocking the 3' end of the probe and permits fluorophore labeling of the 5' end.
  • the third scenario consists of phase I amplification in a singleplex or multiplex fashion to amplify a single or multiple targets. This reaction is then aliquoted across a single or multiple phase II amplification reaction that is either supplemented with 3' blocked probes or supplemented post-reaction with probes and a PCR inhibitor. Following probe hybridization, the next step involves detecting the sample's DNA hybridization status using fluorescence resonance energy transfer (FRET). FRET is particularly useful because it enables specification of a target sequence and has the potential for multiplexing.
  • FRET fluorescence resonance energy transfer
  • the basic goal of this procedure is to produce signals indicative of the presence of a single SNP in the double-stranded DNA as shown in Fig. 3 or multiple SNPs as shown in Fig. 4 wherein these signals change or disappear when the DNA becomes single-stranded following denaturation.
  • FRET FRET
  • a donor fluorophore molecule absorbs excitation energy and delivers this via dipole-dipole interaction to a nearby acceptor fluorophore molecule.
  • the acceptor fluorophore then reemits the energy at a higher wavelength. This process only occurs when the donor and acceptor molecules are sufficiently close to one another.
  • Several different strategies for determining the optimal physical arrangement of the donor and acceptor moieties are known in the art, any of which may be used in the present invention.
  • the acceptor molecule reemits the fluorescent signal of the donor molecule following excitation.
  • the two molecules are held apart from one another, only the fluorescence of the donor molecule can be detected with no fluorescence detected from the acceptor fluorophore.
  • any suitable donor fluorophore such as SYBR Green I (Excitation 490, Emission 520), and any suitable acceptor fluorophore, such as Texas Red (Excitation 590, Emission 620), may be used in the present invention.
  • the donor fluorophore may be excited at a wavelength of 490 nm, emits at a wavelength of 520 nm which is then transferred via FRET to the acceptor fluorophore on the labeled probe and reemitted at 620 nm.
  • Fig. 5 shows excitation and emission wavelengths for SYBR Green I, and Texas Red, the region of FRET between the two molecules, and the dual emiussion signal generated by both dyes.
  • the next step of the methods of the present invention involves the detection of single or multiple SNPs within the target nucleotide with follow-on differentiation by melt-curve variation between different sequences.
  • the peak (or multiple peaks as is the case for a heterozygote) at the lower melt temperature is the result from the FRET probe and the peak at a higher temperature is the result from the melting of the amplicon itself.
  • the amplicon melt peak is generated by fluorescence of intercalated SYBR Green I at the tail end of the SYBR Green I emission spectrum. This secondary melt peak provides a positive signal for amplification of specific product and can be used to distinguish non-specific signal occasionally generated by the probe for >45 cycle amplification reactions.
  • one embodiment of the method of the present invention provides that both strands of the hybridized combined DNA probe/template hybrid discussed hereinabove are denatured at a high temperature.
  • the temperature is then lowered to a point where of the template strand and fluorescent labeled probe reassemble and the donor intercalating dye is deposited between the template and the probe.
  • the reaction is exposed to a specific wavelength of light and as a result of intercalation, the dye fluoresces at a particular wavelength. This energy is transferred by FRET to the fluorophore on the hybridized probe, absorbed and reemitted at a different wavelength than the intercalating dye. Readings are taken as the temperature is slowly increased in order to detect single or multiple base pair changes within the target nucleotide.
  • melt point temperatures are dependent on the template sequence. A perfect match between the probe sequence and template sequence produces a distinctive melt temperature. Single and multiple (1-40%) SNPs in the sequence of the template result in a reduced melt temperature in comparison to a perfect match. This means that, using a single probe sequence, one or multiple changes within a portion of template sequence can be detected as shown in Figs. 3 and 4. Subsequent melt temperatures depend on what and how many changes occur within a sequence.
  • melt temperature of the probe/template hybrid can be artificially manipulated using a number of approaches including additives (DMSO, etc.) and, more importantly, using nucleotide analogues incorporated into the probe.
  • additives DMSO, etc.
  • nucleotide analogues incorporated into the probe.
  • An example is provided in Fig. 6 wherein inosine bases are incorporated into the probe at different positions to alter the melt behavior of probe against different template sequences. This would allow manipulation of probe sequence composition in a way that could produce a unique melt signature for any and all changes within the template sequence.
  • a significant strength of the inventive dpFRET methods of the present invention is that the same technology used for SNP detection and screening can be applied to the typing of microsatellites or repetitive sequences and insertion/deletion loci.
  • a template is generated for a region of interest by asymmetric PCR followed by hybridization with an allele specific probe.
  • the allele specific probe contains a defined number of repeats.
  • This approach produces two potential melt peaks for the probe consisting of either a match (High T m ) or a mismatch (Low T m ) with the number of repeats contained within the target. Similar to the SNP methods discussed hereinabove, a second melt peak at a higher temperature signifies production of specific amplicon.
  • Potential probe hybridization scenarios are shown in Fig. 6a for a simple locus and Fig. 6b for a complex locus.
  • An example of the resulting melt peaks are shown in Fig. 7.
  • Sequences corresponding to positions 14925-14974 of the Cambridge human mitochondrial genome (JO 1415) and mutated templates were synthesized, purified by standard desalting, and concentrations were standardized by a commercial source (Integrated DNA Technologies).
  • the mutated templates included representatives for substantially every possible single point mutation within the 30 bp central core region composed of positions 14935-14964.
  • the variable animal species template library contained sequences corresponding to the same position of the Cambridge human mitochondrial genome from a number of animal species as listed in Table 1 and was generated by the same commercial source. Non- variable 10 bp sequences flanking the variable regions were also included in each template to avoid potential problems associated with incomplete synthesis such as N-I templates. All sequences for both the human and species variation libraries are listed in appendix A.
  • Both template libraries were evaluated by standard melt curve analysis with human reference probe sequences (30 bp: ACGTCTCGAGTGATGTGGGCGATTGATGAA, 21 bp: TCGAGTGATGTGGGCGATTGA, 15 bp: GTGGGCGATTGATGA) and labeled at the 3' terminus with a Texas Red-X NHS Ester.
  • the fluorescent probe was commercially synthesized, HPLC purified and quantity standardized by a commercial source (Integrated DNA Technologies).
  • Hybridization reactions contained IX SYBR Green I Master Mix (Bio-Rad), 50 uM template and a 5 uM labeled probe and were subjected to the following thermal protocol on an IQ5 real-time thermal cycler (Bio-Rad): 95 0 C for 1 minute, 25 0 C for 1 minute and incremental increase of 0.2 0 C to a final temperature of 95 0 C.
  • a standard excitation filter of 490 nm (30 nm bandwidth) was coupled with a 620 nm (20 nm bandwidth) emission filter placed in the appropriate corresponding position of the emission filter wheel.
  • TdT Terminal deoxynucleotidyl transferase
  • TdT New England Biolabs
  • ChromaTide Texas Red-12-dUTP Invitrogen
  • the same oligonucleotide sequence used for synthetic probe testing (ACGTCTCGAGTGATGTGGGCGATTGATGAA) was synthesized (Integrated DNA Technologies) followed by standard desalt purification. The following were combined for TdT labeling: 200 uM synthetic oligonucleotide, IX NEB buffer 4, CoC12 (5 mM), Texas Red-12-dUTP (1 mM) and 60 units of terminal transferase.
  • the reaction was incubated overnight at 37 0 C and terminated by incubation at 70 0 C for 10 minutes.
  • the reaction was subjected to DyeEX chromatographic separation of unincorporated fluorophore nucleotides (Qiagen). Probes were hybridized to the human variation template library and melted as previously described.
  • Cytochrome B Species Identification Published sequences (NCBI) encompassing Cytochrome B for multiple animal species were aligned using MegAlign (Lasergene) and regions of conservation were used to manually design primers according to standard practice. Optimal primer sequences used for dpFRET testing were CYTB 0088F Mix: 5'-TCCGCATGATGAAAyTTyGGnTC-3' and CYTB 0438R Mix: 5'-GTGGCCCCTCAGAAdGAyATyTG-3'.
  • Genomic material for multiple animal species was provided by Brookf ⁇ eld Zoo (Brookfield, IL) and human and ferret genomic material was provided by the National Center for Forensic Science (Orlando, FL).
  • Asymmetric PCR reactions were supplemented with IX SYBR Green Mastermix (BioRad), 500 nM forward primer and 15 nM reverse primer. Cycling parameters consisted of the following protocol: Initial denaturation at 95 0 C for 3 minutes followed by 40 cycles of 95 0 C for 10 sec, 59 0 C for 40 sec which formed the double stranded amplification portion of the protocol. This was immediately followed by 40 cycles of 95 0 C for 10 sec, 56 0 C for 40 sec forming the single stranded amplification portion of the protocol. Post amplification, 5 uM of probe complementary to human Cytochrome B sequence was added to each reaction and melted as previously described using a 0.5 degree incremental increase in temperature.
  • MHCdrB Individual Identification
  • NCBI Genetics for Mhc DRB for multiple animal species were aligned using MegAlign (Lasergene) and regions of conservation were used to manually design primers according to standard practice.
  • Optimal primer sequences for dpFRET testing were UNIV_MHCdr_3F Mix: S'-ACGGsACsGAGCGGGTG-S' and UNIV_MHCdr_3R: 5'- CACCCCGTAGTTGTC-3'.
  • Asymmetric PCR reactions containing IX SYBR Green Mastermix (BioRad), 100 nM forward primer and 500 nM reverse primer were amplified using the following thermal protocol: Initial denaturation at 95 0 C for 3 minutes followed by 40 cycles of 95 0 C for 10 sec, 63 0 C for 40 sec. This was immediately followed by 40 cycles of 95 0 C for 10 sec, 59 0 C for 40 sec. Following amplification, the reaction was supplemented with 5 uM of commercially synthesized Texas Red fluorescently labeled probe: UNIVdr 0245
  • TPOX F (5'-GCACAGAACAGGCACTTAGG-S')
  • TPOX R (5'-CGCTCAAACGTGAGGTTG-S ')
  • D3S1358 F ATGAAATCAACAGAGGCTTGC
  • D3S1358 R ACTGCAGTCCAATCTGGGT
  • the thermal protocol used for PCR amplification consisted of the following: Initial denaturation at 95 0 C for 3 minutes followed by 40 cycles of 95 0 C for 10 sec, 59 0 C for 30 sec and 72 0 C for 30 sec followed by 40 cycles of 95 0 C for 10 sec, 57 0 C for 30 sec and 72 0 C for 30sec. Following amplification, each reaction was supplemented with 5 uM of commercially synthesized allele specific Texas Red labeled probe and melted as previously described using a 0.5 degree incremental increase in temperature on an IQ5 real-time PCR platform (Bio-Rad).
  • Probes consisted of the following basic structure wherein number of core repeats (N) corresponded with each allele tested: TPOX [GAACCCTCACTG (AATG)N TTTGGGCAAATAAACGCTGACAAG] D3S1358 [TGCATGTATCTA (TCTG)N (TCTA) N TGAGACAGGGTCTTGC] Example 6. Sensitivity and Allelic Dropout
  • samples provided by the Dartmouth School of Medicine were tested for application to "Real World” samples.
  • Samples were originally obtained for a previous study on chimerism in bone marrow transplant patients. Multiple cell fractions (donor, recipient, monocytes, granulocytes, peripheral blood and bone marrow) were sampled following treatment to monitor the success or rejection of the transplanted tissue. If transplant recipient genotype is detected in any of the cell fractions this dictates the need for additional testing and alters treatment.
  • Genotypes generated by standard protocols used in forensic analysis (Beckman Coulter CEQ 8000 and ID kit) were supplied by Dartmouth School of Medicine for comparison to dpFRET STR genotyping. Samples were analyzed using dpFRET as previously described for the TPOX locus and results compared to current accepted protocols.
  • the 30 bp 3' fluorophore labeled probe resulted in discrimination of any change at any position except for mutations in the template complementary to probe nucleotides 30, 29, and 1.
  • the unlabeled probe was unable to discriminate mutations at multiple positions both distal and internal within the template (probe nucleotides 26, 22, 13 and 1). It is also important to note that the melt point graph is similar between labeled and unlabeled probes with the labeled probe displaying more significant variation from the reference for most points.
  • 21 and 15 bp fluorophore labeled probes were also tested and showed similar results with finer resolution at the ends of the template using the dpFRET approach.
  • the fluorophore labeled 21 bp probe (Fig. 9 top panel) was indistinguishable from the reference for template mutations complementary to probe positions 21 and 1 and showed no effect due to template mutation in flanking sequence.
  • Similar melting protocols using an unlabeled probe (Fig. 9 bottom panel) resulted in melt temperatures indistinguishable from the reference for mutations at multiple positions (probe nucleotides 17, 8, 4, 3, 2 and 1).
  • Synthetic SNP Testing Species Variation. All synthetic animal species templates showed reduced melt temperatures compared to the human reference sequence when hybridized with a human probe sequence (Fig. 11). A few templates are listed with the number of SNPs in parenthesis to illustrate the range of sequence divergence. In general, increased number of SNPs within the template tended to reduce the melt temperature as would be expected. Four species templates (Skate, Aardvark, Dogfish and Dugong) did not produce melt curves when tested with a human probe sequence. All these templates had > 10 SNPs. It should also be noted that closely related Orangutan sequence showed a differential melt temperature and contained only a single SNP. Unlabeled probes were not tested against the animal species library. tDt Probe labeling.
  • Results for 3' fluorophore tDt labeling of a 30 bp oligonucleotide probe showed no significant differences from a commercially synthesized probe (Fig. 12). Melt temperatures for both the commercially synthesized probe and tDt labeled probe were within +/- 0.4 0 C for each template within the human variation library. Labeling efficiency of the enzyme was extremely low and did not provide significant amounts of reagent for sample testing.
  • the probe treatment with inosine at positions 30, 29 and 28 showed a significant difference from the unmodified probe at positions complementary to the inosine residues, at positions adjacent (positions 27, 26, 25 and 24) and at positions distal (positions 7 and 5) to the modified residues.
  • SNP Assay Sensitivity.
  • the limit of detection using dpFRET for SNP analysis was 5 picograms (approximately 1 genome equivalent) for both homozygote and heterozygote samples (Fig. 16). Fluorescent signal showed no decrease for less concentrated samples and no allelic dropout was observed for the heterozygote.
  • Both 500 femtograms (approximately 0.1 genome equivalents) and the no template control showed non-specific probe interaction as evidenced by a broad probe melt peak with neither sample resulting in a peak indicative of specific target amplification.
  • TPOX Microsatellite Locus Testing— Simple Locus (TPOX). dpFRET analysis of the TPOX locus for samples provided by the Johnson County criminalistics Laboratory showed identical results to genotype data previously generated by the crime lab using standard capillary electrophoresis detection (Fig. 17). dpFRET melt curves for each allelic probe are shown.
  • Microsatellite Locus Testing Complex Locus (D3S1358). Similar to STR simple locus testing, dpFRET analysis of the D3S 1358 STR complex locus resulted in similar although not identical results. When analyzed by size, complex STR loci can result in the same size profile for alleles that do not contain the same sequence. This is due an equivalent change (an addition to one core repeat with a deletion in the second core repeat) that cannot be differentiated based on size. Discrepancies for some samples were seen when analyzed by dpFRET due to the sequence based analysis of the approach that was able to detect this type of difference between alleles.
  • Microsatellite sensitivity and lack of allelic dropout. Preliminary results to determine the limit of detection using dpFRET for STR analysis was 50 picograms (approximately equivalent to 10 genomic copies) for both homozygote and heterozygote samples (Fig. 19). It is important to note that fluorescent signal showed no decrease for less concentrated samples and no allelic dropout was observed for the heterozygote.. Microsatellite — mixed samples. Artificial mix. Artificial mixtures of homozygote and heterozygote samples tested with an 8 repeat allelic probe resulted in fluorescent match and mismatch signal intensity changes approximately equivalent to the concentration of allele within the sample (Fig. 20).
  • the first mix composed of a homozygote and heterozygote contained approximately 3X the amount of target allele (8 repeats) compared to non-target allele (10 repeats) and resulted in a significantly higher match peak signal intensity. It should be noted that the match and mismatch peak fluorescent intensities are not directly correlated with sample allelic content (match - 170 RFU, mismatch ⁇ 80 RFU).
  • the second mix contained an equal proportion of target and non-target allele and resulted in approximately equivalent fluorescent intensities for the match (- 110 RFU) and mismatch ( ⁇ 90 RFU) peaks.
  • the third mix (right panel) was composed of 3 X non-target allele and resulted in markedly higher mismatch peak signal intensity. Similar to the first treatment, peak height intensity did not correlate with sample allelic content (match ⁇ 90 RFU, mismatch - 130 RFU).
  • T m oligonucleotide melting temperature
  • the T m of duplex DNA is defined as the temperature where one-half of the nucleotides are paired and one-half are unpaired.
  • T m can be predicted using a variety of formulas with the most accurate being the thermodynamic nearest neighbor model.
  • the nearest neighbor model is based on the assumption that probe hybridization energy can be calculated from enthalpy and entropy of all nearest neighbor pairs, including a contribution from each dangling end. Dangling ends account for the effects seen when a shorter probe is bound to a target with flanking sequence.
  • the first phase of the development of dpFRET for SNP genotyping involved determination of the effect of probe size on resolution.
  • Initial testing used a synthetic library of templates that encompassed any potential change at every position complementary to the probe sequence.
  • the most obvious result for all probe sizes tested (30, 21 or 15 bp) showed that this approach is capable of producing a differential melt relative to a perfect match with the probe sequence.
  • a mutation at two different locations within the sequence can potentially produce the same melt temperature, but that temperature is always lower than a perfect match between the probe and reference sequence.
  • Changes at the ends (5' and 3') of the template were indistinguishable from the reference sequence for larger (30 and 21 bp) probes most likely due to inadequate end effects.
  • a reduction in the size of the probe (15 bp) produced a differential melt temperature for all changes.
  • probe size should be limited to 15-30 bp depending on the particular application desired.
  • dpFRET showed higher resolution for internal template changes than SYBR Green I (intercalating dye) alone. This result lends credibility to the hypothesized end-effects theory.
  • Internal mismatches are averaged out across the template as it melts when utilizing an intercalating dye. Any single mismatch is averaged with all matching nucleotides across a template producing a lower signal to noise ratio.
  • the effect is more significant because FRET can only occur across a limited distance. So, signal differences contributed from the mismatch remains constant, but the noise produced by dye intercalated at a distance is minimized. This same approach can be used for other applications with limited SNPs including a range of synthetic template sequences.
  • the probe and template were not able to hybridize in a manner sufficient to intercalate dye and donate signal to the fluorophore probe for genotyping. Hence, even with 30% divergence between the probe and template, a signal was generated. Similar to probe size testing on the template variation library, all probe/template complexes showed a reduced melt temperature compared to the reference human sequence but were unable to classify all templates as unique. This is most likely due to the fact that multiple mutations at variable positions can have the same destabilizing effect on the DNA duplex and would not therefore produce a unique melt temperature.
  • Deoxylnosine (dl) is a naturally occurring base that, while not truly universal, is less destabilizing than mismatches involving the four standard bases. Hydrogen bond interactions between dl and dA, dG, dC and dT are weak and unequal with the result that some base-pairing bias does exist with dI:dC > dI:dA > dI:dG > dlrdT. It is believed that this base pairing bias would differentially affect melting behavior of the whole complex. In other words, a mutation from C to T at one position would bind inosine in a weaker manner and affect the melting of the nearest neighbors. Incorporation of inosines at the end was most likely to show this effect.
  • Results demonstrated that single and multiple insertions of inosine within the probe sequence were able to alter the melting behavior of corresponding template mutations and nearest neighbor mutations. This effect has been modeled and can alter the melting behavior of a probe in different ways based on number and location of inosine bases within the probe, probe sequence and template nearest neighbor sequence. By locating inosine bases in a sequence dependent fashion, a unique temperature for any change within a template may be provided.
  • Terminal transferase is a template independent polymerase that catalyzes the addition of deoxynucleotides to the 3' hydroxyl terminus of DNA molecules.
  • TdT can be used to incorporate a fluorophore labeled nucleotide at the 3' end of an oligonucleotide probe.
  • the FRET system that was tested used Texas Red as the acceptor fluorophore that was incorporated by tDt as a dUTP.
  • tDt labeling has been shown to be extremely inefficient at incorporation of this particular fluorophore. This is most likely due to interference with the active site of the enzyme. Additional end labeling strategies (ULYSIS) were tested and proved unsuccessful.
  • Future directions for probe generation would include testing of alternative fluorophores with tDt.
  • the relative sequencing methods of the present invention enable one probe set to be designed against a reference sequence. Each probe would encompass approximately 30 base pairs of sequence and would stretch across the sequence of interest. For example, if one were interested in looking for SNPs in 270 base pairs of human mitochondrial Dloop (control region) sequence, 9 probes would be designed that covered the region of interest. Multiple samples could then be tested with each probe to produce a melt temperature either matching or lower than the reference sequence. Any probes that produced a lower T m would signify the presence of a SNP relative to the reference sequence at that probe position.
  • the probe can form a probe/probe dimer that produces a signal at a significantly reduced melt temperature without producing an amplicon peak. Optimization of probe concentration can alleviate this effect for most probes, but is not really necessary due to the absence of an amplicon peak. Due to strong SYBR signal, the amplicon can produce a signal and is used as a qualification of positive amplification. Without the presence of an amplicon peak, the probe/probe dimer signal can be classified as noise. Finally, it is important to note that the amplicon melt peaks included a small shoulder peak. It was discovered through follow-on development and testing that this shoulder was due to a minor population of unlabeled probe that results from incomplete synthesis that allows the unlabeled probe to participate in the amplification.
  • dpFRET was explored as an alternative using previously designed human probes.
  • the probes were not only able to hybridize to penguin sequences, but were able to resolve differences between individuals. Examination of the sequence showed that although differential SNPs from the human design existed that were conserved among all penguins tested, differences between individuals could still be resolved. For regions of the amplicon that were more highly divergent from human, probes were designed against a Humboldt reference sequence which showed better resolution of heterozygote alleles.
  • the methods of the present invention provide the ability to resolve multiple alleles (heterozygotes) within a single individual and a further demonstration of the flexibility of the approach and flexibility of assay design.
  • dpFRET is not only flexible enough to applied across a range of species for paternity and population studies, but requires significantly less resources than the current approaches.
  • dpFRET it is important to resolve the sensitivity of the inventive methods. Human testing with previously quantified genomic material showed an initial detection limit of a single copy. This result is not surprising due to the fact that dpFRET uses 50-80 cycles of amplification depending on the approach. This level of sensitivity has already been shown for approaches using Taqman detection and is primarily due to the fact that non-specific product produced with high numbers of amplification cycles is not detected due to signal generation produced by probe hybridization.
  • dpFRET is capable of capitalizing on the same strategy. Only non-specific product with less than 30% divergence will produce a signal with dpFRET.
  • An example of product generated for CytB in different species is shown in Fig. 23.
  • multiple non-specific products are also amplified that show no signal upon detection and genotyping with dpFRET.
  • results from SNP testing using dpFRET shows that the inventive methods are robust for detection of few copies within a sample. It is also successful at genotyping both haploid and diploid loci with no impact on detection of multiple alleles. Design strategies are highly flexible and are capable of detecting single or multiple SNPs using a single assay. Potentials for development include increased discrimination between mutations and reduced reagent costs through alternative approaches.
  • Microsatellites or STRs are accepted as the marker of choice for forensics and ecology and are more recently being valued in clinical studies for the ability to monitor progression of cancer and aid in monitoring transplant success. Information is typically generated by amplification followed by sizing of the alleles by capillary electrophoresis. Not only is this approach subject to a number of artifacts, but also requires specialized equipment and a high degree of training to generate genotypes. A simpler approach to interrogate these highly informative markers would provide a significant step in more routine application of this approach. Microsatellite sequences can vary in content but typically have a similar structure.
  • flanking sequences are used to amplify a repetitive region composed of a core repetitive section.
  • This core repeat can be composed of either a single sequence (simple repeat) or multiple sequences (complex repeat) with additional SNPs potentially present within.
  • dpFRET for SNP genotyping
  • a design approach was developed that would permit identification of a specific allele within a sample wherein the microsatellite locus was designated with three regions composed of a 'reporter flank', 'core repeat region' and 'anchor flank'.
  • the anchor flank could be designed with a higher Tm than the fluorophore labeled reporter flank. This would favor hybridization of the anchor region first, followed by hybridiztaiton of the core repeat region of the probe and assuming an exact match, this would be followed by the reporter flank. Upon melting of a perfect match, a signal would be generated indicative of the presence of the number of repeats contained within the probe. If the probe were to encounter a mismatch with the template sequence, the result would be decreased hybridization with the reporter region of the probe resulting in decreased signal intensity and more importantly a lower melting temperature. This would primarily be due to the reduction in bonding energy of the probe due to imperfect hybridization and would result in generation of differential melting temperatures between a probe/template match or mismatch.
  • TPOX is located on chromosome 2 within intron 10 of human thyroid peroxidase gene. TPOX is one of the loci typically employed for individual identification as part of the collection of loci known as CODIS. Validated primer sequences from the Promega PowerPlex kit were used to remove any ambiguity generated by in-house designs. Following brief optimization for 80 cycle amplifications, probes were designed for common alleles (8-12 repeats). Samples provided by the Johnson County Crime Lab that were previously typed by CE were tested and showed agreement between CE and dpFRET genotypes. The same approach was then tested on a complex locus. D3 S 1358 is located on chromosome 3, is not known to be located within a coding region and is also one of the core loci within CODIS.
  • dpFRET can be used with existing primer designs and simply acts as a new method of allele detection to replace size-based CE genotyping.
  • D3S1358 showed discordant results with CE generated genotypes.
  • a complex locus with more than one core repeat has the potential to generate the same size product with different alleles.
  • D3 17 and 17' are different alleles but cannot be differentiated by CE.
  • Testing with dpFRET was able to differentiate these genotypes due to differential probe hybridization (individual 11). To further prove this hypothesis, amplification products could be cloned and sequenced to verify the presence of two alleles. Similar results were seen for 15 and 15' alleles.
  • Allelic dropout is also an important consideration for analysis of trace level samples. This is primarily due to preferential amplification of one allele. For additional reasons, it is important to quantify starting material prior to CE based testing. The dpFRET approach to genotyping was tested for this effect and no significant allelic drop out was observed. In addition, varying amounts of starting material were tested and all samples showed equivalent results. This is primarily due to the difference in the approach to amplification. CE based typing typically utilizes 30-40 cycles. dpFRET uses 50-80 cycles of amplification. This provides the opportunity to amplify any target alleles that might be present and produces an equivalent signal. This is of particular importance in both forensic and clinical applications.
  • dpFRET was tested for application to mixed samples and showed melt peak heights approximately equivalent to starting allele concentrations. This is evidenced by the fact that homozygotes routinely result in higher (typically double intensity) signal than heterozygotes for the match peak and lab generated mixes display peak heights equivalent to the concentration of alleles within the sample. dpFRET was also successful at reproducing donor and recipient percentages within a sample as compared to CE. Some variation was seen through testing most likely due to the amplification approach. The current protocol uses 40 cycles of double-stranded amplification followed by 40 cycles of single stranded amplification in a separate reaction.
  • a single dsAMP is split across multiple ssAMPs followed by addition of allele specific probes to individual reactions. This minimizes the amount of sample required (sample is only added to the dsAMP) but also provides multiple opportunities for sampling error to introduce variability in peak height. Less variability is seen with closed tube asymmetric 80 cycle amplification protocols but requires multiple aliquots of sample for testing of each probe. This necessitated exploring other approaches for minimizing the need for testing with every allelic probe.
  • Fig. 28 is a graphical depiction of this approach. This same method can be applied for any probe as all the allelic probes can be measured at the same temperature (74 0 C). By careful probe design, multiple markers can be analyzed under a single quantitative analysis scheme. This reduces the amount of data points required and significantly increases the speed of analysis.
  • dpFRET provides the first opportunity to examine both SNP and microsatellite markers using the same equipment, chemistry and basic technical approach. This simplifies the needs of a forensic laboratory by reducing the required infrastructure. dpFRET analysis is also more rapid and less labor intensive than current approaches (i.e., CE). Also inherent in the approach is the ability to amplify the smallest possible microsatellite markers ("ultra miniSTRs") because there is no requirement for differential marker size for CE separation. This has strong implications for genotyping of trace level degraded samples that could significantly advance studies in forensic science.
  • dpFRET has the potential to advance both discovery and screening capabilities in clinical diagnostics and molecular pathology. Benefits are numerous for areas including cancer (Fig. 29), transplants, blood typing, pharmacogenetics and a host of other clinical fields.
  • Lab-on-a-card microfluidic based systems have the ability to reproduce every step used in a laboratory setting with automated sample processing and analysis.
  • microfluidic cards can extract, amplify and detect DNA sequences in an enclosed system which allows both portability of the system and minimal requirements for trained personnel.
  • dpFRET has been successfully tested in just such a system designed by Micronics, Inc. (Seattle, WA).
  • Implications for forensics and clinical diagnostics include on-site analysis of samples and point-of-care diagnosis of molecular based markers.
  • a number of high throughput PCR platforms have been developed in recent years. These include approaches from thermal cyclers capable of 384 reactions per run to unique platforms capable of >3000 reactions per run.
  • dpFRET has potential for high- throughput for screening as well as discovery using 'relative dpFRET sequencing'.
  • Applications include genotyping changes in microbial and viral genomes, increased sample throughput for forensic laboratories and a host of other fields.
  • Rhino TAA CTG CCT TCT CAT CTG TCG CCC ATA TCT CTC GAG ACG TGA ATT ACG GC
  • TftDeer TAA CAG CAT TTT CCT CTG TA A CCC ACA TTT GCC GAG ACG TC A ACT ATG GG
  • CytB_16G CAACCGCCTTTTCATCAATCGCCCAGATCACTCGAGACGTAAA ⁇ ATGGC
  • CytB_17T CAACCGCCTTTTCATCAATCGCCCACTTCACTCGAGACGTAAATTATGGC
  • CytB_17C CAACC ⁇ CCTTTTCATCAATCGCCCACCTCACTCGAGACGTAAATTATGGC
  • CytB_ ⁇ 18A CAACCGCCTTTTCATCAATCGCCCACAACACTCGAGACGTAAATTATGGC
  • CytB_18C CAACCGCCTTTTCATCAATCGCCCACACCACTCGAGACGTAAATTATGGC
  • CytB_19A CAACCGCCTTTTCATCAATCGCCCACATAACTCGAGACGTAAATTATGGC
  • CytB_20C CAACCGCCTTTTCATCAATCGCCCACATCCCTCGAGACGTAAATTATGGC
  • CytB_20G CAACCGCCTTTTCATCAATCGCCCACATCGCTCGAGACGTAAATTATGGC
  • CytB_21T CAACCGCCTTTTCATCAATCGCCCACATCATTCGAGACGTAAATTATGGC
  • CytB_21A CAACCGCCTTTTCATCAATCGCCCACATCAATCGAGACGTAAATTATGGC
  • CytB_22A CAACCGCCTTTTCATCAATCGCCCACATCACACGAGACGTAAATTATGGC
  • CytB_22C CAACCGCCTTTTCATCAATCGCCCACATCACCCGAGACGTAAATTATGGC
  • CytB_23A CAACCGCCTTTTCATCAATCGCCCACATCACTAGAGACGTAAATTATGGC
  • CytB_24A CAACCGCCTTTTCATCAATCGCCCACATCACTCAAGACGTAAATTATGGC
  • CytB_24C CAACCGCCTTTTCATCAATCGCCCACATCACTCCAGACGTAAATTATGGC
  • CytB_25C CAACCGCCTTTTCATCAATCGCCCACATCACTCGCGACGTAAATTATGGC
  • Cyta_2SG CAACCGCCTTTTCATCAATCGCCCACATCACTCGGGACGTAAATTATGGC
  • CytB_26T CAACCGCCTTTTCATCAATCGCCCACATCACTCGATACGTAAATTATGGC
  • CytB_26A CAACCGCCTTTTCATCAATCGCCCACATCACTCGAAACGTAAATTATGGC
  • CytB_26C CAACCGCCTTTTCATCAATCGCCCACATCACTCGACACGTAAATTATGGC
  • CytB_27C CAACCGCCTTTTCATCAATCGCCCACATCACTCGAGCCGTAAATTATGGC
  • CytB_28A CAACCGCCTTTTCATCAATCGCCCACATCACTCGAGAAGTAAATTATGGC
  • CytB_29T CAACCGCCTTTTCATCAATCGCCCACATCACTCGAGACTTAAATTATGGC
  • CytB_29A CAACCGCCTTTTCATCAATCGCCCACATCACTCGAGACATAAATTATGGC
  • CytB_29C CAACCGCCTTTTCATCAATCGCCCACATCACTCGAGACCTAAATTATGGC
  • CytB_30A CAAGCGCCTT ⁇ TCATCAATCGCCCACATCACTCGAGACGAAAATTATGGC
  • CytB_30C CAACCGCCTTTTCATCAATCGCCCACATCACTCGAGACGCAAATTATGGC
  • CytB_30G CAACCGCCTTTTCATCAATCGCCCACATCACTCGAGACGGAAATTATGGC
  • CytB 27T28T29T30A CAACCGCCTTTTCATCAATCGCCCACATCACTCGAGTTTAAAATTATGGC
  • CytB_lA2A3A4T CAACCGCCTTAAATTCAATCGCCCACATCACTCGAGACGTAAATTATGGC
  • CytB_22A23A24A25T CAACCGCCTTTTCATCAATCGCCCACATCACAAATGACGTAAATTATGGC

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne un procédé amélioré permettant de détecter, identifier et cribler pour des polymorphismes polynucléotidiques simples, des locus d'insertion/délétion, et des microsatellites. Le procédé consiste à ajouter un colorant intercalant donneur à un échantillon contenant une séquence d'acide nucléique cible amplifiée, ajouter une sonde contenant un fluorophore accepteur à l'échantillon, hybrider la sonde avec la séquence cible, exciter le colorant donneur avec une longueur d'onde spécifique, surveiller la fluorescence émanant de l’échantillon due au transfert d'énergie par résonance de fluorescence (FRET) du colorant au fluorophore de la sonde et associée à l'hybridation de la sonde avec la séquence cible et/ou à la dissociation de la sonde de la séquence cible, et analyser la courbe de fusion de l'échantillon afin d'identifier au moins un polymorphisme nucléotidique simple (ou multiple) connu ou inconnu, des locus d'insertion/délétion, ou un microsatellite à l’intérieur de ceux-ci.
PCT/US2009/065550 2008-11-24 2009-11-23 Génotypage par transfert d'énergie colorant-sonde par résonance de fluorescence WO2010060046A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US12/276,849 2008-11-24
US12/276,849 US20100129796A1 (en) 2008-11-24 2008-11-24 Dye probe fluorescence resonance energy transfer genotyping

Publications (2)

Publication Number Publication Date
WO2010060046A2 true WO2010060046A2 (fr) 2010-05-27
WO2010060046A3 WO2010060046A3 (fr) 2010-10-14

Family

ID=42196633

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/065550 WO2010060046A2 (fr) 2008-11-24 2009-11-23 Génotypage par transfert d'énergie colorant-sonde par résonance de fluorescence

Country Status (2)

Country Link
US (1) US20100129796A1 (fr)
WO (1) WO2010060046A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012003950A1 (fr) * 2010-07-09 2012-01-12 Universität Duisburg-Essen Détection de mutations, en particulier de délétions ou d'insertions
WO2021058470A1 (fr) * 2019-09-23 2021-04-01 Universiteit Gent Sonde et procédé de génotypage str

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5720564B2 (ja) * 2009-03-31 2015-05-20 凸版印刷株式会社 遺伝子型の識別方法
NO337188B1 (no) * 2013-04-08 2016-02-08 Niva COMPAS-PCR fremgangsmåte og fremgangsmåter for påvisning, identifisering eller overvåking av laksearter, kit, samt anvendelse av metoden og kit
TWI617667B (zh) * 2017-03-03 2018-03-11 長庚大學 核酸分子檢測方法及檢測套組
CN108715888A (zh) * 2018-06-07 2018-10-30 王卫东 一种基于fret的pcr均相检测系统及其应用
CN109337962A (zh) * 2018-08-24 2019-02-15 暨南大学 基于荧光定量pcr检测鲟鱼的引物和探针及其试剂盒与方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050142595A1 (en) * 2003-11-07 2005-06-30 U.S. Genomics, Inc. Intercalator FRET donors or acceptors

Family Cites Families (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5066584A (en) * 1988-09-23 1991-11-19 Cetus Corporation Methods for generating single stranded dna by the polymerase chain reaction
US5688647A (en) * 1995-12-08 1997-11-18 Griffith University Detection of dinucleotide repeat polymorphism in exon 18 of LDL receptor gene for determining predisposition to obesity
US5627054A (en) * 1996-04-05 1997-05-06 The United States Of America As Represented By The Secretary Of The Army Competitor primer asymmetric polymerase chain reaction
GB9725197D0 (en) * 1997-11-29 1998-01-28 Secr Defence Detection system
GB9812768D0 (en) * 1998-06-13 1998-08-12 Zeneca Ltd Methods
GB9821989D0 (en) * 1998-10-08 1998-12-02 Hybaid Ltd Detection of nucleic acid polymorphism
US6174681B1 (en) * 1999-03-05 2001-01-16 Mayo Foundation For Medical Education And Research Method and probe set for detecting cancer
US20010055764A1 (en) * 1999-05-07 2001-12-27 Empedocles Stephen A. Microarray methods utilizing semiconductor nanocrystals
CA2383939C (fr) * 2000-06-27 2009-12-01 National Institute Of Advanced Industrial Science And Technology Nouvelles sondes d'acides nucleiques et procedes d'essai d'acide nucleique par utilisation des memes
US6558929B2 (en) * 2000-09-15 2003-05-06 Fraunhofer-Gesellschaft Zur Forderung Der Angewandten Forshung E.V. PCR reaction mixture for fluorescence-based gene expression and gene mutation analyses
US20030212256A1 (en) * 2000-10-17 2003-11-13 Edinger Shlomit R. Proteins and nucleic acids encoding same
US6436689B1 (en) * 2000-11-22 2002-08-20 Pe Corporation (Ny) Isolated nucleic acid molecules encoding human protease proteins, and uses thereof
GB0112868D0 (en) * 2001-05-25 2001-07-18 Secr Defence Detection system
FI114399B (fi) * 2001-06-06 2004-10-15 Biohit Oyj Menetelmä ekstensiotuotteiden määrittämiseksi
WO2003043402A2 (fr) * 2001-10-19 2003-05-30 Proligo Llc Sondes d'acide nucleique et procedes de detection et/ou de quantification d'analytes d'acide nucleique
US20060014144A1 (en) * 2001-12-18 2006-01-19 Christensen Ulf B Pseudonucleotide comprising an intercalator
US20030219755A1 (en) * 2002-05-24 2003-11-27 Nanibhushan Dattagupta Compositions and methods for performing hybridization assays using target enhanced signal amplification (TESA)
US20070059690A1 (en) * 2002-05-31 2007-03-15 Amirul Islam "Met/fret based method of target nucleic acid detection whereby the donor/acceptor moieties are on complementary strands"
JP2004024035A (ja) * 2002-06-21 2004-01-29 Tosoh Corp 核酸の検出方法
US20030235823A1 (en) * 2002-06-24 2003-12-25 The University Of Alabama Nucleotide sequences that code for torsin genes, torsin proteins, and methods of using the same to treat protein-aggregation
EP1394271B1 (fr) * 2002-09-02 2007-11-14 Toyo Boseki Kabushiki Kaisha Méthode pour identifier un polymorphisme de nucléotide utilisant le transfer d'énergie de résonance
US20070184453A1 (en) * 2002-10-02 2007-08-09 Roche Molecular Systems, Inc Fret process
EP1594984A2 (fr) * 2003-02-18 2005-11-16 Applera Corporation Compositions et procedes pour l'analyse multiplex de polynucleotides
US7300755B1 (en) * 2003-05-12 2007-11-27 Fred Hutchinson Cancer Research Center Methods for haplotyping genomic DNA
CA2584569C (fr) * 2004-10-18 2014-09-30 Brandeis University Amorces, sondes et procedes d'amplification d'acides nucleiques
US20060183136A1 (en) * 2004-11-05 2006-08-17 Genevieve Pont-Kingdon Method for haplotyping and genotyping by melting curve analysis of hybridization probes
US20090221095A1 (en) * 2005-10-13 2009-09-03 Northwestern University Colorimetric Screening of DNA Binding/Intercalating Agents with Gold Nanoparticle Probes
WO2007129628A1 (fr) * 2006-05-02 2007-11-15 Wako Pure Chemical Industries, Ltd. Amorce et sonde destinées à la détection de mycobacterium intracellulare, et procédé permettant de détecter mycobacterium intracellulare au moyen de l'amorce et de la sonde
CA2672034C (fr) * 2006-12-13 2014-02-18 Luminex Corporation Systemes et procedes d'analyse multiplex de pcr en temps reel

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050142595A1 (en) * 2003-11-07 2005-06-30 U.S. Genomics, Inc. Intercalator FRET donors or acceptors

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HOWELL, W. M. ET AL.: 'iFRET: An improved fluorescence system for DNA-meltin g analysis' GENOME RESEARCH vol. 12, no. 9, September 2002, pages 1401 - 1407 *
HOWELL, W. M.: 'Detection of DNA hybridization using induced fluorescence res onance energy transfer' METHODS IN MOLECULAR BIOLOGY vol. 335, 2006, page 33 *
TALAVERA, E. M. ET AL.: 'Fluorescence energy transfer between fluorescein la bel and DNA intercalators to detect nucleic acid hybridization in homogeneou s media' APPLIED SPECTROSCOPY vol. 57, no. 2, February 2003, pages 208 - 215 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012003950A1 (fr) * 2010-07-09 2012-01-12 Universität Duisburg-Essen Détection de mutations, en particulier de délétions ou d'insertions
WO2021058470A1 (fr) * 2019-09-23 2021-04-01 Universiteit Gent Sonde et procédé de génotypage str

Also Published As

Publication number Publication date
US20100129796A1 (en) 2010-05-27
WO2010060046A3 (fr) 2010-10-14

Similar Documents

Publication Publication Date Title
US11926866B2 (en) Method for detecting on-target and predicted off-target genome editing events
US11530446B2 (en) Methods and compositions for DNA profiling
US8936912B2 (en) Method for multiplexed nucleic acid patch polymerase chain reaction
EP2534263B1 (fr) Procédés et compositions pour la détection universelle d'acides nucléiques
WO2003020983A1 (fr) Pcr allele specifique pour genotypage
US8236498B2 (en) Method of detecting nucleotide sequence with an intramolecular probe
JP2012523821A (ja) 対立遺伝子変種を検出するための方法、組成物、およびキット
WO2010060046A2 (fr) Génotypage par transfert d'énergie colorant-sonde par résonance de fluorescence
Di Francia et al. Decision criteria for rational selection of homogeneous genotyping platforms for pharmacogenomics testing in clinical diagnostics
CN104450869B (zh) 一种双脱氧核苷修饰的引物方法、反应体系及其在突变检测中的应用
JP3949378B2 (ja) ポリヌクレオチド配列の変異を決定するための方法
US11111514B2 (en) Method for multiplexed nucleic acid patch polymerase chain reaction
EP3847181A1 (fr) Amorces de queue universelles à motifs de liaison multiples pour la détection multiplexée de polymorphismes mononucléotidiques
US20210395799A1 (en) Methods for variant detection
JP2005328758A (ja) 核酸増幅方法及びこれを利用した一塩基多型の解析
US20060141475A1 (en) Polynucleotide sequence detection assays and analysis
US9909170B2 (en) Method for multiplexed nucleic acid patch polymerase chain reaction
Kawai et al. Sensitive detection of EGFR mutations using a competitive probe to suppress background in the SMart Amplification Process
Deharvengt et al. Nucleic acid analysis in the clinical laboratory
Halpern et al. A single nucleotide polymorphism melt curve assay employing an intercalating dye probe fluorescence resonance energy transfer for forensic analysis
Halpern Development And Forensic Application Of Dye Probe Fluorescence Resonance Energy Transfer For Improved Detection Of Changes In Dn
WO2009098998A1 (fr) Méthode de détection d'acides nucléiques et kit de détection d'acides nucléiques
SCHIENMAN Techniques of DNA Fingerprinting
Novroski et al. The STR DECoDE Panel: Increased Diversity and Enhanced DNA Mixture Deconvolution
Li et al. Mutation Discovery Using High‐Throughput Mutation Screening Technology

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09828354

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09828354

Country of ref document: EP

Kind code of ref document: A2