WO2010033639A2 - Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses - Google Patents
Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses Download PDFInfo
- Publication number
- WO2010033639A2 WO2010033639A2 PCT/US2009/057215 US2009057215W WO2010033639A2 WO 2010033639 A2 WO2010033639 A2 WO 2010033639A2 US 2009057215 W US2009057215 W US 2009057215W WO 2010033639 A2 WO2010033639 A2 WO 2010033639A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- fetal
- maternal
- dna
- fetal nucleic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6804—Nucleic acid analysis using immunogens
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- biomarkers are useful for noninvasive detection of fetal genetic traits.
- Certain fetal genetic traits include but are not limited to presence or absence of fetal nucleic acid.
- Non-invasive prenatal testing is becoming a field of rapidly growing interest. Early detection of pregnancy- related conditions, including complications during pregnancy and genetic defects of the fetus is of crucial importance, as it allows early medical intervention necessary for the safety of both the mother and the fetus. Prenatal diagnosis has been conducted using cells isolated from the fetus through procedures such as chorionic villus sampling (CVS) or amniocentesis. However, these conventional methods are invasive and present an appreciable risk to both the mother and the fetus. The National Health Service currently cites a miscarriage rate of between 1 and 2 per cent following the invasive amniocentesis and chorionic villus sampling (CVS) tests.
- CVS chorionic villus sampling
- Circulating cell free fetal nucleic acid has several advantages making it more applicable for non-invasive prenatal testing. For example, cell free nucleic acid is present at higher levels than fetal cells and at concentrations sufficient for genetic analysis. Also, cffNA is cleared from the maternal bloodstream within hours after delivery, preventing contamination from previous pregnancies.
- Examples of prenatal tests performed by detecting fetal DNA in maternal plasma or serum include fetal rhesus D (RhD) genotyping (Lo et al., N. Engl. J. Med. 339:1734-1738, 1998), fetal sex determination (Costa et al., N. Engl. J. Med. 346:1502, 2002), and diagnosis of several fetal disorders (Amicucci et al., Clin. Chem. 46:301-302, 2000; Saito et al., Lancet 356:1170, 2000; and Chiu et al., Lancet 360:998-1000, 2002).
- RhD fetal rhesus D
- the technology provides inter alia human epigenetic biomarkers that are useful for the noninvasive detection of fetal genetic traits, including, but not limited to, the presence or absence of fetal nucleic acid, the absolute or relative amount of fetal nucleic acid, fetal sex, and fetal chromosomal abnormalities such as aneuploidy.
- the human epigenetic biomarkers of the technology represent genomic DNA that display differential CpG methylation patterns between the fetus and mother.
- the compositions and processes of the technology allow for the detection and quantification of fetal nucleic acid in a maternal sample based on the methylation status of the nucleic acid in said sample.
- the amount of fetal nucleic acid from a maternal sample can be determined relative to the total amount of nucleic acid present, thereby providing the percentage of fetal nucleic acid in the sample. Further, the amount of fetal nucleic acid can be determined in a sequence-specific (or locus-specific) manner and with sufficient sensitivity to allow for accurate chromosomal dosage analysis (for example, to detect the presence or absence of a fetal aneuploidy).
- a method for enriching fetal nucleic acids from a maternal biological sample, based on differential methylation between fetal and maternal nucleic acid comprising the steps of: (a) binding a target nucleic acid, from a sample, and a control nucleic acid, from the sample, to a methylation-specific binding protein; and (b) eluting the bound nucleic acid based on methylation status, wherein differentially methylated nucleic acids elute at least partly into separate fractions.
- the nucleic acid sequence includes one or more of the polynucleotide sequences of SEQ ID NOs: 1-89. SEQ ID NOs: 1-89 are provided in Table 4.
- the technology includes the sequences of SEQ ID NOs: 1-89, and variations thereto.
- a control nucleic acid is not included in step (a).
- a method for enriching fetal nucleic acid from a maternal sample comprises the following steps: (a) obtaining a biological sample from a woman; (b) separating fetal and maternal nucleic acid based on the methylation status of a CpG-containing genomic sequence in the sample, wherein the genomic sequence from the fetus and the genomic sequence from the woman are differentially methylated, thereby distinguishing the genomic sequence from the woman and the genomic sequence from the fetus in the sample.
- the genomic sequence is at least 15 nucleotides in length, comprising at least one cytosine, further wherein the region has (1) a genomic locus selected from Table 1; and (2) a DNA sequence of no more than 10 kb upstream and/or downstream from the locus.
- obtaining a biological sample from a woman does not limit the scope of the technology. This obtaining can refer to actually collecting a sample from a woman (e.g., a blood draw) or to receiving a sample from elsewhere (e.g., from a clinic or hospital) and performing steps of a method.
- a method for enriching fetal nucleic acid from a maternal sample comprises the following steps: (a) obtaining a biological sample from the woman; (b) digesting or removing maternal nucleic acid based on the methylation status of a CpG-containing genomic sequence in the sample, wherein the genomic sequence from the fetus and the genomic sequence from the woman are differentially methylated, thereby enriching for the genomic sequence from the fetus in the sample.
- Maternal nucleic acid may be digested using one or more methylation sensitive restriction enzymes that selectively digest or cleave maternal nucleic acid based on its methylation status.
- the genomic sequence is at least 15 nucleotides in length, comprising at least one cytosine, further wherein the region consists of (1) a genomic locus selected from Table 1; and (2) a DNA sequence of no more than 10 kb upstream and/or downstream from the locus.
- a method for preparing nucleic acid having a nucleotide sequence of a fetal nucleic acid comprises the following steps: (a) providing a sample from a pregnant female; (b) separating fetal nucleic acid from maternal nucleic acid from the sample of the pregnant female according to a different methylation state between the fetal nucleic acid and the maternal nucleic acid counterpart, wherein the nucleotide sequence of the fetal nucleic acid comprises one or more CpG sites from one or more of the polynucleotide sequences of SEQ ID NOs: 1-89 within a polynucleotide sequence from a gene or locus that contains one of the polynucleotide sequences of SEQ ID NOs: 1-89; and (c) preparing nucleic acid comprising a nucleotide sequence of the fetal nucleic acid by an amplification process in which fetal nucleic acid separated in part (b) is utilized as
- a method for preparing nucleic acid having a nucleotide sequence of a fetal nucleic acid comprises the following steps: (a) providing a sample from a pregnant female; (b) digesting or removing maternal nucleic acid from the sample of the pregnant female according to a different methylation state between the fetal nucleic acid and the maternal nucleic acid counterpart, wherein the nucleotide sequence of the fetal nucleic acid comprises one or more CpG sites from one or more of the polynucleotide sequences of SEQ ID NOs: 1-89 within a polynucleotide sequence from a gene that contains one of the polynucleotide sequences of SEQ ID NOs: 1-89; and (c) preparing nucleic acid comprising a nucleotide sequence of the fetal nucleic acid.
- the preparing process of step (c) may be a hybridization process, a capture process, or an amplification process in which fetal nucleic acid separated in part (b) is utilized as a template.
- the maternal nucleic acid may be digested using one or more methylation sensitive restriction enzymes that selectively digest or cleave maternal nucleic acid based on its methylation status.
- the polynucleotide sequences of SEQ ID NOs: 1-89 may be within a polynucleotide sequence from a CpG island that contains one of the polynucleotide sequences of SEQ ID NOs: 1-89.
- polynucleotide sequences of SEQ ID NOs: 1- 89 are further characterized in Tables 1-3 herein, including the identification of CpG islands that overlap with the polynucleotide sequences provided in SEQ ID NOs: 1-89.
- the nucleic acid prepared by part (c) is in solution.
- the method further comprises quantifying the fetal nucleic acid from the amplification process of step (c).
- a method for enriching fetal nucleic acid from a sample from a pregnant female with respect to maternal nucleic acid comprises the following steps: (a) providing a sample from a pregnant female; and (b) separating or capturing fetal nucleic acid from maternal nucleic acid from the sample of the pregnant female according to a different methylation state between the fetal nucleic acid and the maternal nucleic acid, wherein the nucleotide sequence of the fetal nucleic acid comprises one or more CpG sites from one or more of the polynucleotide sequences of SEQ ID NOs: 1- 89 within a polynucleotide sequence from a gene that contains one of the polynucleotide sequences of SEQ ID NOs: 1-89.
- the polynucleotide sequences of SEQ ID NOs: 1-89 may be within a polynucleotide sequence from a CpG island that contains one of the polynucleotide sequences of SEQ ID NOs: 1-89.
- the polynucleotide sequences of SEQ ID NOs: 1-89 are characterized in Table 1 herein.
- the nucleic acid separated by part (b) is in solution.
- the method further comprises amplifying and/or quantifying the fetal nucleic acid from the separation process of step (b).
- a composition comprising an isolated nucleic acid from a fetus of a pregnant female, wherein the nucleotide sequence of the nucleic acid comprises one or more of the polynucleotide sequences of SEQ ID NOs: 1-89.
- the nucleotide sequence consists essentially of a nucleotide sequence of a gene, or portion thereof.
- the nucleotide sequence consists essentially of a nucleotide sequence of a CpG island, or portion thereof.
- the polynucleotide sequences of SEQ ID NOs: 1-89 are further characterized in Table 1.
- the nucleic acid is in solution.
- the nucleic acid from the fetus is enriched relative to maternal nucleic acid.
- the composition further comprises an agent that binds to methylated nucleotides.
- the agent may be a methyl-CpG binding protein (MBD) or fragment thereof.
- a composition comprising an isolated nucleic acid from a fetus of a pregnant female, wherein the nucleotide sequence of the nucleic acid comprises one or more CpG sites from one or more of the polynucleotide sequences of SEQ ID NOs: 1-89 within a polynucleotide sequence from a gene, or portion thereof, that contains one of the polynucleotide sequences of SEQ ID NOs: 1-89.
- the nucleotide sequence of the nucleic acid comprises one or more CpG sites from one or more of the polynucleotide sequences of SEQ ID NOs: 1-89 within a polynucleotide sequence from a CpG island, or portion thereof, that contains one of the polynucleotide sequences of SEQ ID NOs: 1-89.
- the polynucleotide sequences of SEQ ID NOs: 1-89 are further characterized in Table 1.
- the nucleic acid is in solution.
- the nucleic acid from the fetus is enriched relative to maternal nucleic acid. Hyper- and hypomethylated nucleic acid sequences of the technology are identified in Table 1.
- the composition further comprises an agent that binds to methylated nucleotides.
- the agent may be a methyl-CpG binding protein (MBD) or fragment thereof.
- MBD methyl-CpG binding protein
- a nucleotide sequence of the technology includes three or more of the CpG sites.
- the nucleotide sequence includes five or more of the CpG sites.
- the nucleotide sequence is from a gene region that comprises a PRC2 domain (see Table 3).
- the nucleotide sequence is from a gene region involved with development.
- S0X14 - which is an epigenetic marker of the present technology (See Table 1) - is a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate.
- the genomic sequence from the woman is methylated and the genomic sequence from the fetus is unmethylated. In other embodiments, the genomic sequence from the woman is unmethylated and the genomic sequence from the fetus is methylated. In another embodiment, the genomic sequence from the fetus is hypermethylated relative to the genomic sequence from the mother. Fetal genomic sequences found to be hypermethylated relative to maternal genomic sequence are provided in SEQ ID NOs: 1-59. Alternatively, the genomic sequence from the fetus is hypomethylated relative to the genomic sequence from the mother. Fetal genomic sequences found to be hypomethylated relative to maternal genomic sequence are provided in SEQ ID NOs: 60-85. Methylation sensitive restriction enzymes of the technology may be sensitive to hypo- or hyper- methylated nucleic acid.
- the fetal nucleic acid is extracellular nucleic acid. Generally the extracellular fetal nucleic acid is about 500, 400, 300, 250, 200 or 150 (or any number there between) nucleotide bases or less. In another embodiment, the digested maternal nucleic acid is less than about 90, 100, 110, 120, 130, 140 or 150 base pairs. In a related embodiment, the fetal nucleic acid is selectively amplified, captured or separated from or relative to the digested maternal nucleic acid based on size.
- PCR primers may be designed to amplify nucleic acid greater than about 75, 80, 85, 90, 95, 100, 105, 110, 115 or 120 (or any number there between) base pairs thereby amplifying fetal nucleic acid and not digested maternal nucleic acid.
- the nucleic acid is subjected to fragmentation prior to certain methodss of the technology. Examples of methods of fragmenting nucleic acid, include but are not limited to sonication and restriction enzyme digestion.
- the fetal nucleic acid is derived from the placenta. In other embodiments the fetal nucleic acid is apoptotic.
- the present technology provides a method in which the sample is a member selected from the following: maternal whole blood, maternal plasma or serum, amniotic fluid, a chorionic villus sample, biopsy material from a pre-implantation embryo, fetal nucleated cells or fetal cellular remnants isolated from maternal blood, maternal urine, maternal saliva, washings of the female reproductive tract and a sample obtained by celocentesis or lung lavage.
- the biological sample is maternal blood.
- the biological sample is a chorionic villus sample.
- the maternal sample is enriched for fetal nucleic acid prior to certain methodss of the present technology. Examples of fetal enrichment methods are provided in PCT Publication Nos. WO/2007140417A2, WO2009/032781A2 and US Publication No. 20050164241.
- nucleated and anucleated cell populations are removed from the sample prior to practicing certain methodss of the technology (e.g., substantially all nucleated and anucleated cell populations are removed).
- the sample is collected, stored or transported in a manner known to the person of ordinary skill in the art to minimize degradation or the quality of fetal nucleic acid present in the sample.
- the sample can be from any animal, including but not limited, human, non-human, mammal, reptile, cattle, cat, dog, goat, swine, pig, monkey, ape, gorilla, bull, cow, bear, horse, sheep, poultry, mouse, rat, fish, dolphin, whale, and shark, or any animal or organism that may have a detectable pregnancy-associated disorder or chromosomal abnormality.
- the sample is treated with a reagent that differentially modifies methylated and unmethylated DNA.
- the reagent may comprise bisulfite; or the reagent may comprise one or more enzymes that preferentially cleave methylated DNA; or the reagent may comprise one or more enzymes that preferentially cleave unmethylated DNA.
- methylation sensitive restriction enzymes include, but are not limited to, Hhal and Hpall.
- the fetal nucleic acid is separated from the maternal nucleic acid by an agent that specifically binds to methylated nucleotides in the fetal nucleic acid. In another embodiment, the fetal nucleic acid is separated or removed from the maternal nucleic acid by an agent that specifically binds to methylated nucleotides in the maternal nucleic acid counterpart. In an embodiment, the agent that binds to methylated nucleotides is a methyl-CpG binding protein (MBD) or fragment thereof.
- MBD methyl-CpG binding protein
- a method for determining the amount or copy number of fetal DNA in a maternal sample that comprises differentially methylated maternal and fetal DNA.
- the method is performed by a) distinguishing between the maternal and fetal DNA based on differential methylation status; and b) quantifying the fetal DNA of step a).
- the method comprises a) digesting the maternal DNA in a maternal sample using one or more methylation sensitive restriction enzymes thereby enriching the fetal DNA; and b) determining the amount of fetal DNA from step a).
- the amount of fetal DNA can be used inter alia to confirm the presence or absence of fetal nucleic acid, determine fetal sex, diagnose fetal disease or be used in conjunction with other fetal diagnostic methods to improve sensitivity or specificity.
- the method for determining the amount of fetal DNA does not require the use of a polymorphic sequence. For example, an allelic ratio is not used to quantify the fetal DNA in step b).
- the method for determining the amount of fetal DNA does not require the treatment of DNA with bisulfite to convert cytosine residues to uracil. Bisulfite is known to degrade DNA, thereby, further reducing the already limited fetal nucleic acid present in maternal samples.
- determining the amount of fetal DNA in step b) is done by introducing one or more competitors at known concentrations. In another embodiment, determining the amount of fetal DNA in step b) is done by RT-PCR, primer extension, sequencing or counting. In a related embodiment, the amount of nucleic acid is determined using BEAMing technology as described in US Patent Publication No. US20070065823. In another embodiment, the restriction efficiency is determined and the efficiency rate is used to further determine the amount of fetal DNA. Exemplary differentially methylated nucleic acids are provided in SEQ ID NOs: 1-89.
- a method for determining the concentration of fetal DNA in a maternal sample comprising a) determining the total amount of DNA present in the maternal sample; b) selectively digesting the maternal DNA in a maternal sample using one or more methylation sensitive restriction enzymes thereby enriching the fetal DNA; c) determining the amount of fetal DNA from step b); and d) comparing the amount of fetal DNA from step c) to the total amount of DNA from step a), thereby determining the concentration of fetal DNA in the maternal sample.
- the concentration of fetal DNA can be used inter alia in conjunction with other fetal diagnostic methods to improve sensitivity or specificity.
- the method for determining the amount of fetal DNA does not require the use of a polymorphic sequence.
- an allelic ratio is not used to quantify the fetal DNA in step b).
- the method for determining the amount of fetal DNA does not require the treatment of DNA with bisulfite to convert cytosine residues to uracil.
- determining the amount of fetal DNA in step b) is done by introducing one or more competitors at known concentrations.
- determining the amount of fetal DNA in step b) is done by RT-PCR, sequencing or counting.
- the restriction efficiency is determined and used to further determine the amount of total DNA and fetal DNA. Exemplary differentially methylated nucleic acids are provided in SEQ ID NOs: 1-89.
- a method for determining the presence or absence of a fetal aneuploidy using fetal DNA from a maternal sample wherein the maternal sample comprises differentially methylated maternal and fetal DNA, comprising a) selectively digesting the maternal DNA in a maternal sample using one or more methylation sensitive restriction enzymes thereby enriching the fetal DNA; b) determining the amount of fetal DNA from a target chromosome; c) determining the amount of fetal DNA from a reference chromosome; and d) comparing the amount of fetal DNA from step b) to step c), wherein a biologically or statistically significant difference between the amount of target and reference fetal DNA is indicative of the presence of a fetal aneuploidy.
- the method for determining the amount of fetal DNA does not require the use of a polymorphic sequence. For example, an allelic ratio is not used to quantify the fetal DNA in step b).
- the method for determining the amount of fetal DNA does not require the treatment of DNA with bisulfite to convert cytosine residues to uracil.
- determining the amount of fetal DNA in steps b) and c) is done by introducing one or more competitors at known concentrations.
- determining the amount of fetal DNA in steps b) and c) is done by RT-PCR, sequencing or counting.
- the amount of fetal DNA from a target chromosome determined in step b) is compared to a standard control, for example, the amount of fetal DNA from a target chromosome from euploid pregnancies.
- the restriction efficiency is determined and used to further determine the amount of fetal DNA from a target chromosome and from a reference chromosome.
- Exemplary differentially methylated nucleic acids are provided in SEQ ID NOs: 1-89.
- a method for detecting the presence or absence of a chromosomal abnormality by analyzing the amount or copy number of target nucleic acid and control nucleic acid from a sample of differentially methylated nucleic acids comprising the steps of: (a) enriching a target nucleic acid, from a sample, and a control nucleic acid, from the sample, based on its methylation state; (b) performing a copy number analysis of the enriched target nucleic acid in at least one of the fractions; (c) performing a copy number analysis of the enriched control nucleic acid in at least one of the fractions; (d) comparing the copy number from step (b) with the copy number from step (c); and (e) determining if a chromosomal abnormality exists based on the comparison in step (d), wherein the target nucleic acid and control nucleic acid have the same or substantially the same methylation status.
- a method for detecting the presence or absence of a chromosomal abnormality by analyzing the amount or copy number of target nucleic acid and control nucleic acid from a sample of differentially methylated nucleic acids comprising the steps of: (a) binding a target nucleic acid, from a sample, and a control nucleic acid, from the sample, to a binding agent; (b) eluting the bound nucleic acid based on methylation status, wherein differentially methylated nucleic acids elute at least partly into separate fractions; (c) performing a copy number analysis of the eluted target nucleic acid in at least one of the fractions; (d) performing a copy number analysis of the eluted control nucleic acid in at least one of the fractions; (e) comparing the copy number from step (c) with the copy number from step (d); and (f) determining if a chromosomal abnormality exists based on the comparison in step (e),
- a method for detecting the presence or absence of a chromosomal abnormality by analyzing the allelic ratio of target nucleic acid and control nucleic acid from a sample of differentially methylated nucleic acids comprising the steps of: (a) binding a target nucleic acid, from a sample, and a control nucleic acid, from the sample, to a binding agent; (b) eluting the bound nucleic acid based on methylation status, wherein differentially methylated nucleic acids elute at least partly into separate fractions; (c) performing an allelic ratio analysis of the eluted target nucleic acid in at least one of the fractions; (d) performing an allelic ratio analysis of the eluted control nucleic acid in at least one of the fractions; (e) comparing the allelic ratio from step c with the allelic ratio from step d; and (f) determining if a chromosomal abnormality exists based on the comparison in step (e
- the amount of maternal nucleic acid is determined using the methylation-based methods of the technology.
- fetal nucleic acid can be separated (for example, digested using a methylation-sensitive enzyme) from the maternal nucleic acid in a sample, and the maternal nucleic acid can be quantified using the methods of the technology.
- the amount of maternal nucleic acid is determined, that amount can subtracted from the total amount of nucleic acid in a sample to determine the amount of fetal nucleic acid.
- the amount of fetal nucleic acid can be used to detect fetal traits, including fetal aneuploidy, as described herein.
- the methods may also be useful for detecting a pregnancy-associated disorder.
- the sample comprises fetal nucleic acid, or fetal nucleic acid and maternal nucleic acid.
- the fetal nucleic acid and the maternal nucleic acid may have a different methylation status. Nucleic acid species with a different methylation status can be differentiated by any method known in the art.
- the fetal nucleic acid is enriched by the selective digestion of maternal nucleic acid by a methylation sensitive restriction enzyme.
- the fetal nucleic acid is enriched by the selective digestion of maternal nucleic acid using two or more methylation sensitive restriction enzymes in the same assay.
- the target nucleic acid and control nucleic acid are both from the fetus.
- the average size of the fetal nucleic acid is about 100 bases to about 500 bases in length.
- the chromosomal abnormality is an aneuploidy, such as trisomy 21.
- the target nucleic acid is at least a portion of a chromosome which may be abnormal and the control nucleic acid is at least a portion of a chromosome which is very rarely abnormal.
- the target nucleic acid is from chromosome 21
- the control nucleic acid is from a chromosome other than chromosome 21 - preferably another autosome.
- the binding agent is a methylation-specific binding protein such as MBD-Fc.
- the enriched or eluted nucleic acid is amplified and/or quantified by any method known in the art.
- the fetal DNA is quantified using a method that does not require the use of a polymorphic sequence. For example, an allelic ratio is not used to quantify the fetal DNA.
- the method for quantifying the amount of fetal DNA does not require the treatment of DNA with bisulfite to convert cytosine residues to uracil.
- the methods of the technology include the additional step of determining the amount of one or more Y-chromosome-specific sequences in a sample.
- the amount of fetal nucleic acid in a sample as determined by using the methylation-based methods of the technology is compared to the amount of Y-chromosome nucleic acid present.
- Methods for differentiating nucleic acid based on methylation status include, but are not limited to, methylation sensitive capture, for example using, MBD2-Fc fragment; bisulfite conversion methods, for example, MSP (methylation-sensitive PCR), COBRA, methylation-sensitive single nucleotide primer extension (Ms-SNuPE) or Sequenom MassCLEAVETM technology; and the use of methylation sensitive restriction enzymes.
- MSP methylation-sensitive PCR
- COBRA methylation-sensitive single nucleotide primer extension
- Sequenom MassCLEAVETM technology Sequenom MassCLEAVETM technology
- any method for differentiating nucleic acid based on methylation status can be used with the compositions and methods of the technology.
- methods of the technology may further comprise an amplification step.
- the amplification step can be performed by PCR, such as methylation-specific PCR.
- the amplification reaction is performed on single molecules, for example, by digital PCR, which is further described in US Patent Nos 6,143,496 and 6,440,706, both of which are hereby incorporated by reference.
- the method does not require amplification.
- the amount of enriched fetal DNA may be determined by counting the fetal DNA (or sequence tags attached thereto) with a flow cytometer or by sequencing means that do not require amplification.
- the amount of fetal DNA is determined by an amplification reaction that generates amplicons larger than the digested maternal nucleic acid, thereby further enriching the fetal nucleic acid.
- any one of the following sequencing technologies may be used: a primer extension method (e.g., iPLEX ® ; Sequenom, Inc.), direct DNA sequencing, restriction fragment length polymorphism (RFLP analysis), allele specific oligonucleotide (ASO) analysis, methylation- specific PCR (MSPCR), pyrosequencing analysis, acycloprime analysis, Reverse dot blot, GeneChip microarrays, Dynamic allele-specific hybridization (DASH), Peptide nucleic acid (PNA) and locked nucleic acids (LNA) probes, TaqMan, Molecular Beacons, Intercalating dye, FRET primers, fluorescence tagged dNTP/ddNTPs, AlphaScreen, SNPstream, genetic bit analysis (GBA), Multiplex minisequencing, SNaPshot, GOOD assay, Microarray miniseq, arrayed primer extension (APEX), Microarray primer extension, Tag arrays,
- a primer extension method
- InvaderTM assay hybridization using at least one probe, hybridization using at least one fluorescently labeled probe, electrophoresis, cloning and sequencing, for example as performed on the 454 platform (Roche) (Margulies, M. et al. 2005 Nature 437, 376-380), lllumina Genome Analyzer (or Solexa platform) or SOLiD System (Applied Biosystems) or the Helicos True Single Molecule DNA sequencing technology (Harris T D et al. 2008 Science, 320, 106-109), the single molecule, real-time (SMRT.TM.) technology of Pacific Biosciences, or nanopore-based sequencing (Soni GV and Meller A. 2007 Clin Chem 53: 1996-2001) and combinations thereof.
- Nanopore-based methods may include sequencing nucleic acid using a nanopore, or counting nucleic acid molecules using a nanopore, for example, based on size wherein sequence information is not determined.
- the absolute copy number of one or more nucleic acids can be determined, for example, using mass spectrometry, a system that uses a competitive PCR approach for absolute copy number measurements. See for example, Ding C, Cantor CR (2003) A high-throughput gene expression analysis technique using competitive PCR and matrix-assisted laser desorption ionization time-of-flight MS. Proc Natl Acad Sci U S A 100:3059-3064, and US Patent Application No. 10/655762, which published as US Patent Publication No. 20040081993, both of which are hereby incorporated by reference.
- the amount of the genomic sequence is compared with a standard control, wherein an increase or decrease from the standard control indicates the presence or progression of a pregnancy- associated disorder.
- the amount of fetal nucleic acid may be compared to the total amount of DNA present in the sample.
- the amount of fetal nucleic acid from target chromosome may be compared to the amount of fetal nucleic acid from a reference chromosome.
- the reference chromosome is another autosome that has a low rate of aneuploidy.
- the ratio of target fetal nucleic acid to reference fetal nucleic acid may be compared to the same ratio from a normal, euploid pregnancy.
- a control ratio may be determined from a DNA sample obtained from a female carrying a healthy fetus who does not have a chromosomal abnormality.
- one uses a panel of control samples.
- certain chromosome anomalies are known, one can also have standards that are indicative of a specific disease or condition.
- a panel of control DNAs that have been isolated from mothers who are known to carry a fetus with, for example, chromosome 13, 18, or 21 trisomy, and a mother who is pregnant with a fetus who does not have a chromosomal abnormality.
- the present technology provides a method in which the alleles from the target nucleic acid and control nucleic acid are differentiated by sequence variation.
- the sequence variation may be a single nucleotide polymorphism (SNP) or an insertion/deletion polymorphism.
- the fetal nucleic acid should comprise at least one high frequency heterozygous polymorphism (e.g., about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25% or more frequency rate), which allows the determination of the allelic-ratio of the nucleic acid in order to assess the presence or absence of the chromosomal abnormality.
- a list of exemplary SNPs is provided in Table 2, however, this does not represent a complete list of polymorphic alleles that can be used as part of the technology.
- any SNP meeting the following criteria may also be considered: (a) the SNP has a heterozygosity frequency greater than about 2% (preferably across a range of different populations), (b) the SNP is a heterozygous locus; and (c)(i) the SNP is within nucleic acid sequence described herein, or (c)(iii) the SNP is within about 5 to about 2000 base pairs of a SNP described herein (e.g., within about 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1250, 1500, 1750 or 2000 base pairs of a SNP described herein).
- sequence variation is a short tandem repeat (STR) polymorphism.
- sequence variation falls in a restriction site, whereby one allele is susceptible to digestion by a restriction enzyme and the one or more other alleles are not.
- sequence variation is a methylation site.
- performing an allelic ratio analysis comprises determining the ratio of alleles of the target nucleic acid and control nucleic acid from the fetus of a pregnant woman by obtaining an nucleic acid-containing biological sample from the pregnant woman, wherein the biological sample contains fetal nucleic acid, partially or wholly separating the fetal nucleic acid from the maternal nucleic acid based on differential methylation, discriminating the alleles from the target nucleic acid and the control nucleic acid, followed by determination of the ratio of the alleles, and detecting the presence or absence of a chromosomal disorder in the fetus based on the ratio of alleles, wherein a ratio above or below a normal, euploid ratio is indicative of a chromosomal disorder.
- the target nucleic acid is from a suspected aneuploid chromosome (e.g., chromosome 21) and the control nucleic acid is from a euploid chromosome from a suspected aneup
- the present technology is combined with other fetal markers to detect the presence or absence of multiple chromosomal abnormalities, wherein the chromosomal abnormalities are selected from the following: trisomy 21, trisomy 18 and trisomy 13, or combinations thereof.
- the chromosomal disorder involves the X chromosome or the Y chromosome.
- the compositions or processes may be multiplexed in a single reaction.
- the amount of fetal nucleic acid may be determined at multiple loci across the genome.
- the amount of fetal nucleic acid may be determined at multiple loci on one or more target chromosomes (e.g., chromosomes 13, 18 or 21) and on one or more reference chromosomes. If an allelic ratio is being used, one or more alleles from Table 2 can be detected and discriminated simultaneously. When determining allelic ratios, multiplexing embodiments are particularly important when the genotype at a polymorphic locus is not known.
- the assay may not be informative.
- greater than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 100, 200, 300 or 500, and any intermediate levels polynucleotide sequences of the technology are enriched, separated and/or examined according the methods of the technology.
- less than 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 polynucleotide sequences may need to be analyzed to accurately detect the presence or absence of a chromosomal abnormality.
- compositions or processes of the technology may be used to assay samples that have been divided into 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 100 or more replicates, or into single molecule equivalents.
- Methods for analyzing fetal nucleic acids from a maternal sample in replicates, including single molecule analyses, are provided in US Application No, 11/364,294, which published as US Patent Publication No. US 2007-0207466 Al, which is hereby incorporated by reference.
- the present technology provides a method wherein a comparison step shows an increased risk of a fetus having a chromosomal disorder if the ratio of the alleles or absolute copy number of the target nucleic acid is higher or lower by 1 standard deviation from the standard control sequence. In some embodiments, the comparison step shows an increased risk of a fetus having a chromosomal disorder if the ratio of the alleles or absolute copy number of the target nucleic acid is higher or lower by 2 standard deviation from the standard control sequence.
- the comparison step shows an increased risk of a fetus having a chromosomal disorder if the ratio of the alleles or absolute copy number of the target nucleic acid is higher or lower by 3 standard deviation from the standard control sequence. In some embodiments, the comparison step shows an increased risk of a fetus having a chromosomal disorder if the ratio of the alleles or absolute copy number of the target nucleic acid is higher or lower than a statistically significant standard deviation from the control.
- the standard control is a maternal reference, and in another embodiment the standard control is a fetal reference chromosome (e.g., non-trisomic autosome).
- the methods of the technology may be combined with other methods for diagnosing a chromosomal abnormality.
- a noninvasive diagnostic method may require confirmation of the presence or absence of fetal nucleic acid, such as a sex test for a female fetus or to confirm an RhD negative female fetus in an RhD negative mother.
- the compositions and methods of the technology may be used to determine the percentage of fetal nucleic acid in a maternal sample in order to enable another diagnostic method that requires the percentage of fetal nucleic acid be known. For example, does a sample meet certain threshold concentration requirements?
- the amount or concentration of fetal nucleic acid may be required to make a diagnose with a given sensitivity and specificity.
- the compositions and methods of the technology for detecting a chromosomal abnormality can be combined with other known methods thereby improving the overall sensitivity and specificity of the detection method.
- an increased risk for a chromosomal abnormality is based on the outcome or result(s) produced from the compositions or methods provided herein.
- An example of an outcome is a deviation from the euploid absolute copy number or allelic ratio, which indicates the presence of chromosomal aneuploidy. This increase or decrease in the absolute copy number or ratio from the standard control indicates an increased risk of having a fetus with a chromosomal abnormality (e.g., trisomy 21).
- Information pertaining to a method described herein, such as an outcome, result, or risk of trisomy or aneuploidy, for example, may be transfixed, renditioned, recorded and/or displayed in any suitable medium.
- an outcome may be transfixed in a medium to save, store, share, communicate or otherwise analyze the outcome.
- a medium can be tangible (e.g., paper) or intangible (e.g., electronic medium), and examples of media include, but are not limited to, computer media, databases, charts, patient charts, records, patient records, graphs and tables, and any other medium of expression.
- the information sometimes is stored and/or renditioned in computer readable form and sometimes is stored and organized in a database.
- the information may be transferred from one location to another using a physical medium (e.g., paper) or a computer readable medium (e.g., optical and/or magnetic storage or transmission medium, floppy disk, hard disk, random access memory, computer processing unit, facsimile signal, satellite signal, transmission over an internet or transmission over the world-wide web).
- a physical medium e.g., paper
- a computer readable medium e.g., optical and/or magnetic storage or transmission medium, floppy disk, hard disk, random access memory, computer processing unit, facsimile signal, satellite signal, transmission over an internet or transmission over the world-wide web.
- a CpG island may be used as the CpG-containing genomic sequence in some cases, whereas in other cases the CpG-containing genomic sequence may not be a CpG island.
- the present technology provides a kit for performing the methods of the technology.
- One component of the kit is a methylation-sensitive binding agent.
- FIGURE 1 Shows the design of the recombinant MBD-Fc protein used to separate differentially methylated DNA.
- FIGURE 2 Shows the methyl-CpG-binding, antibody-like protein has a high affinity and high avidity to its "antigen", which is preferably DNA that is methylated at CpG di-nucleotides.
- FIGURE 3 Shows the methyl binding domain of MBD-FC binds DNA molecules regardless of their methylation status. The strength of this protein/DNA interaction is defined by the level of DNA methylation. After binding genomic DNA, eluate solutions of increasing salt concentrations can be used to fractionate non-methylated and methylated DNA allowing for a controlled separation.
- FIGURE 4 Shows the experiment used to identify differentially methylated DNA from a fetus and mother using the recombinant MBD-Fc protein and a microarray.
- FIGURE 5 Shows typical results generated by Sequenom ® EpiTYPERTM method, which was used to validate the results generated from the experiment illustrated in Figure 4.
- FIGURE 6 Shows the correlation between the log ratios derived from microarray analysis (x axis) and methylation differences obtained by EpiTYPER analysis (y axis). Each data point represents the average for one region across all measured samples.
- the microarray analysis is comparative in nature because the highly methylated fraction of the maternal DNA is hybridized together with the highly methylated fraction of placenta DNA. Positive values indicate higher methylation of the placenta samples. In mass spectrometry each samples is measured individually. We first calculated difference in methylation by subtracting the maternal methylation values from the placenta methylation value. To compare the results with the microarray data we calculated the average of the differences for all maternal / placenta DNA pairs.
- FIGURE 8 Shown is the correlation between the number of gDNA molecules that were expected and the number of molecules measured by competitive PCR in combination with mass spectrometry analysis.
- DNA derived from whole blood (black plus signs) and commercially available fully methylated DNA(red crosses) in a 90 to 10 ratio.
- MBD-FC fusion protein to separate the non- methylated and the methylated fraction of DNA. Each fraction was subject to competitive PCR analysis with mass spectrometry readout.
- the method has been described earlier for the analysis of copy number variations and is commercially available for gene expression analysis. The approach allows absolute quantification of DNA molecules with the help of a synthetic oligonucleotides of know concentration.
- FIGURE 9A-9C Shown are bar graph plots of the methylation differences obtained from the microarray analysis (dark bars) and the mass spectrometry analysis (light grey bars) with respect to their genomic location.
- the x axis for each plot shows the chromosomal position of the region.
- the y axis depicts the log ration (in case of the microarrays) and the methylation differences (in case of the mass spectrometry results).
- each hybridization probe in the area is shown as a single black (or dark grey) bar.
- Bars showing values greater than zero indicate higher DNA methylation in the placenta samples compared to the maternal DNA. For some genes the differences are small (i.e. RBl or DSCR6) but still statistically significant. Those regions would be less suitable for a fetal DNA enrichment strategy.
- FIGURE 10 Shows one embodiment of the Fetal Quantifier Method. Maternal nucleic acid is selectively digested and the remaining fetal nucleic acid is quantified using a competitor of known concentration. In this schema, the analyte is separated and quantified by a mass spectromter.
- FIGURE 11 Shows one embodiment of the Methylation-Based Fetal Diagnostic Method.
- Maternal nucleic acid is selectively digested and the remaining fetal nucleic acid is quantified for three different chromosomes (13, 18 and 21).
- Parts 2 and 3 of the Figure illustrate the size distribution of the nucleic acid in the sample before and after digestion.
- the amplification reactions can be size-specific (e.g., greater than 100 base pair amplicons) such that they favor the longer, non-digested fetal nucleic acid over the digested maternal nucleic acid, thereby further enriching the fetal nucleic acid.
- the spectra at the bottom of the Figure show an increased amount of chromosome 21 fetal nucleic acid indicative of trisomy 21.
- FIGURE 12 Shows the total number of amplifiable genomic copies from four different DNA samples isolated from the blood of non-pregnant women. Each sample was diluted to contain approximately 2500, 1250, 625 or 313 copies per reaction. Each measurement was obtained by taking the mean DNA/competitor ratio obtained from two total copy number assays (ALB and RNAseP in Table X). As Figure 12 shows, the total copy number is accurate and stable across the different samples, thus validating the usefulness of the competitor-based approach.
- FIGURES 13A and B A model system was created that contained a constant number of maternal non- methylated DNA with varying amounts of male placental methylated DNA spiked-in.
- the samples were spiked with male placental amounts ranging from approximately 0 to 25% relative to the maternal non- methylated DNA.
- the fraction of placental DNA was calculated using the ratios obtained from the methylation assays ( Figure 13A) and the Y-chromosome marker ( Figure 13B) as compared to the total copy number assay.
- the methylation and Y-chromosome markers are provided in Table X.
- FIGURES 14 A and B Show the results of the total copy number assay from plasma samples.
- Figure 14A the copy number for each sample is shown. Two samples (no 25 and 26) have a significantly higher total copy number than all the other samples. A mean of approximately 1300 amplifiable copies/ml plasma was obtained (range 766-2055).
- Figure 14B shows a box-and-whisker plot of the given values, summarizing the results.
- FIGURES 15A and B The amount (or copy numbers) of fetal nucleic acid from 33 different plasma samples taken from pregnant women with male fetuses are plotted. The copy numbers obtained were calculated using the methylation markers and the Y-chromosome-specific markers using the assays provided in Table X. As can be seen in Figure 15B, the box-and-whisker plot of the given values indicated minimal difference between the two different measurements, thus validating the accuracy and stability of the method.
- FIGURE 16 Shows a paired correlation between the results obtained using the methylation markers versus the Y-chromosome marker from Figure 15A.
- FIGURE 17 Shows the digestion efficiency of the restriction enzymes using the ratio of digestion for the control versus the competitor and comparing this value to the mean total copy number assays. Apart from sample 26 all reactions indicate the efficiency to be above about 99%.
- FIGURE 18 Provides a specific method for calculating fetal DNA fraction (or concentration) in a sample using the Y-chromosome-specific markers for male pregnancies and the mean of the methylated fraction for all pregnancies (regardless of fetal sex).
- FIGURE 19 Provides a specific method for calculating fetal DNA fraction (or concentration) in a sample without the Y-chromosome-specific markers. Instead, only the Assays for Methylation Quantification were used to determine the concentration of fetal DNA.
- FIGURE 20 Shows a power calculation t-test for a simulated trisomy 21 diagnosis using the methods of the technology. The Figure shows the relationship between the coefficient of variation (CV) on the x-axis and the power to discriminate the assay populations using a simple t-test (y-axis). The data indicates that in 99% of all cases, one can discriminate the two population (euploid vs. aneuploid) on a significance level of 0.001 provided a CV of 5% or less.
- CV coefficient of variation
- pregnancy-associated disorder refers to any condition or disease that may affect a pregnant woman, the fetus, or both the woman and the fetus. Such a condition or disease may manifest its symptoms during a limited time period, e.g., during pregnancy or delivery, or may last the entire life span of the fetus following its birth.
- a pregnancy-associated disorder include ectopic pregnancy, preeclampsia, preterm labor, RhD incompatibility, fetal chromosomal abnormalities such as trisomy 21, and genetically inherited fetal disorders such as cystic fibrosis, beta- thalassemia or other monogenic disorders.
- the ability to enrich fetal nucleic from a maternal sample may prove particularly useful for the noninvasive prenatal diagnosis of autosomal recessive diseases such as the case when a mother and father share an identical disease causing mutation, an occurrence previously perceived as a challenge for maternal plasma-based non-trisomy prenatal diagnosis.
- chromosomal abnormality or "aneuploidy” as used herein refers to a deviation between the structure of the subject chromosome and a normal homologous chromosome.
- normal refers to the predominate karyotype or banding pattern found in healthy individuals of a particular species, for example, a euploid genome (in humans, 46XX or 46XY).
- a chromosomal abnormality can be numerical or structural, and includes but is not limited to aneuploidy, polyploidy, inversion, a trisomy, a monosomy, duplication, deletion, deletion of a part of a chromosome, addition, addition of a part of chromosome, insertion, a fragment of a chromosome, a region of a chromosome, chromosomal rearrangement, and translocation.
- Chromosomal abnormality may also refer to a state of chromosomal abnormality where a portion of one or more chromosomes is not an exact multiple of the usual haploid number due to, for example, chromosome translocation.
- Chromosomal translocation e.g.
- a chromosomal abnormality can be correlated with presence of a pathological condition or with a predisposition to develop a pathological condition.
- a chromosomal abnormality may be detected by quantitative analysis of nucleic acid.
- nucleic acid and “nucleic acid molecule” may be used interchangeably throughout the disclosure.
- the terms refer to nucleic acids of any composition from, such as DNA (e.g., complementary DNA (cDNA), genomic DNA (gDNA) and the like), RNA (e.g., message RNA (mRNA), short inhibitory RNA (siRNA), ribosomal RNA (rRNA), tRNA, microRNA, RNA highly expressed by the fetus or placenta, and the like), and/or DNA or RNA analogs (e.g., containing base analogs, sugar analogs and/or a non-native backbone and the like), RNA/DNA hybrids and polyamide nucleic acids (PNAs), all of which can be in single- or double-stranded form, and unless otherwise limited, can encompass known analogs of natural nucleotides that can function in a similar manner as naturally occurring nucleotides.
- DNA e.g., complementary DNA (cDNA), genomic DNA (g
- nucleic acids provided in SEQ ID Nos: 1-89 can be in any form useful for conducting processes herein (e.g., linear, circular, supercoiled, single-stranded, double-stranded and the like) or may include variations (e.g., insertions, deletions or substitutions) that do not alter their utility as part of the present technology.
- a nucleic acid may be, or may be from, a plasmid, phage, autonomously replicating sequence (ARS), centromere, artificial chromosome, chromosome, or other nucleic acid able to replicate or be replicated in vitro or in a host cell, a cell, a cell nucleus or cytoplasm of a cell in certain embodiments.
- ARS autonomously replicating sequence
- a template nucleic acid in some embodiments can be from a single chromosome (e.g., a nucleic acid sample may be from one chromosome of a sample obtained from a diploid organism).
- the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.
- a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, single nucleotide polymorphisms (SNPs), and complementary sequences as well as the sequence explicitly indicated.
- degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem.
- nucleic acid is used interchangeably with locus, gene, cDNA, and mRNA encoded by a gene.
- the term also may include, as equivalents, derivatives, variants and analogs of RNA or DNA synthesized from nucleotide analogs, single- stranded ("sense” or “antisense”, “plus” strand or “minus” strand, "forward” reading frame or “reverse” reading frame) and double-stranded polynucleotides.
- Deoxyribonucleotides include deoxyadenosine, deoxycytidine, deoxyguanosine and deoxythymidine.
- RNA the base cytosine is replaced with uracil.
- a template nucleic acid may be prepared using a nucleic acid obtained from a subject as a template.
- a "nucleic acid comprising one or more CpG sites” or a "CpG-containing genomic sequence” as used herein refers to a segment of DNA sequence at a defined location in the genome of an individual such as a human fetus or a pregnant woman.
- a "CpG-containing genomic sequence” is at least 15 nucleotides in length and contains at least one cytosine.
- it can be at least 30, 50, 80, 100, 150, 200, 250, or 300 nucleotides in length and contains at least 2, 5, 10, 15, 20, 25, or 30 cytosines.
- CpG-containing genomic sequence at a given location, e.g., within a region centering around a given genetic locus (see Table 1), nucleotide sequence variations may exist from individual to individual and from allele to allele even for the same individual.
- a region centering around a defined genetic locus e.g., a CpG island
- Each of the upstream or downstream sequence (counting from the 5' or 3' boundary of the genetic locus, respectively) can be as long as 10 kb, in other cases may be as long as 5 kb, 2 kb, 1 kb, 500 bp, 200 bp, or 100 bp.
- a "CpG-containing genomic sequence” may encompass a nucleotide sequence transcribed or not transcribed for protein production, and the nucleotide sequence can be an inter-gene sequence, intra-gene sequence, protein-coding sequence, a non protein-coding sequence (such as a transcription promoter), or a combination thereof.
- a "methylated nucleotide” or a “methylated nucleotide base” refers to the presence of a methyl moiety on a nucleotide base, where the methyl moiety is not present in a recognized typical nucleotide base.
- cytosine does not contain a methyl moiety on its pyrimidine ring, but 5- methylcytosine contains a methyl moiety at position 5 of its pyrimidine ring. Therefore, cytosine is not a methylated nucleotide and 5-methylcytosine is a methylated nucleotide.
- thymine contains a methyl moiety at position 5 of its pyrimidine ring, however, for purposes herein, thymine is not considered a methylated nucleotide when present in DNA since thymine is a typical nucleotide base of DNA.
- Typical nucleoside bases for DNA are thymine, adenine, cytosine and guanine.
- Typical bases for RNA are uracil, adenine, cytosine and guanine.
- a "methylation site" is the location in the target gene nucleic acid region where methylation has, or has the possibility of occurring. For example a location containing CpG is a methylation site wherein the cytosine may or may not be methylated.
- a "CpG site” or “methylation site” is a nucleotide within a nucleic acid that is susceptible to methylation either by natural occurring events in vivo or by an event instituted to chemically methylate the nucleotide in vitro.
- a "methylated nucleic acid molecule” refers to a nucleic acid molecule that contains one or more methylated nucleotides that is/are methylated.
- CpG island as used herein describes a segment of DNA sequence that comprises a functionally or structurally deviated CpG density.
- Yamada et al. (Genome Research 14:247-266, 2004) have described a set of standards for determining a CpG island: it must be at least 400 nucleotides in length, has a greater than 50% GC content, and an OCF/ECF ratio greater than 0.6.
- Others (Takai et al., Proc. Natl. Acad. Sci. U.S.A. 99:3740-3745, 2002) have defined a CpG island less stringently as a sequence at least 200 nucleotides in length, having a greater than 50% GC content, and an OCF/ECF ratio greater than 0.6.
- epigenetic state refers to any structural feature at a molecular level of a nucleic acid (e.g., DNA or RNA) other than the primary nucleotide sequence.
- a nucleic acid e.g., DNA or RNA
- the epigenetic state of a genomic DNA may include its secondary or tertiary structure determined or influenced by, e.g., its methylation pattern or its association with cellular proteins.
- methylation profile refers to the characteristics of a DNA segment at a particular genomic locus relevant to methylation. Such characteristics include, but are not limited to, whether any of the cytosine (C) residues within this DNA sequence are methylated, location of methylated C residue(s), percentage of methylated C at any particular stretch of residues, and allelic differences in methylation due to, e.g., difference in the origin of the alleles.
- methylation profile or “methylation status” also refers to the relative or absolute concentration of methylated C or unmethylated C at any particular stretch of residues in a biological sample.
- cytosine (C) residue(s) within a DNA sequence are methylated it may be referred to as "hypermethylated”; whereas if the cytosine (C) residue(s) within a DNA sequence are not methylated it may be referred to as "hypomethylated”.
- the cytosine (C) residue(s) within a DNA sequence e.g., fetal nucleic acid
- the cytosine (C) residue(s) within a DNA sequence are methylated as compared to another sequence from a different region or from a different individual (e.g., relative to maternal nucleic acid), that sequence is considered hypermethylated compared to the other sequence.
- cytosine (C) residue(s) within a DNA sequence are not methylated as compared to another sequence from a different region or from a different individual (e.g., the mother), that sequence is considered hypomethylated compared to the other sequence.
- These sequences are said to be “differentially methylated”, and more specifically, when the methylation status differs between mother and fetus, the sequences are considered “differentially methylated maternal and fetal nucleic acid”.
- agent that binds to methylated nucleotides refers to a substance that is capable of binding to methylated nucleic acid. The agent may be naturally-occurring or synthetic, and may be modified or unmodified.
- the agent allows for the separation of different nucleic acid species according to their respective methylation states.
- An example of an agent that binds to methylated nucleotides is described in PCT Patent Application No. PCT/EP2005/012707, which published as WO06056480A2 and is hereby incorporated by reference.
- the described agent is a bifunctional polypeptide comprising the DNA-binding domain of a protein belonging to the family of Methyl-CpG binding proteins (MBDs) and an Fc portion of an antibody (see Figure 1).
- MBDs Methyl-CpG binding proteins
- the recombinant methyl-CpG- binding, antibody-like protein can preferably bind CpG methylated DNA in an antibody-like manner.
- the methyl-CpG-binding, antibody-like protein has a high affinity and high avidity to its "antigen", which is preferably DNA that is methylated at CpG dinucleotides.
- the agent may also be a multivalent MBD (see Figure 2).
- polymorphism refers to a sequence variation within different alleles of the same genomic sequence. A sequence that contains a polymorphism is considered “polymorphic sequence”. Detection of one or more polymorphisms allows differentiation of different alleles of a single genomic sequence or between two or more individuals. As used herein, the term "polymorphic marker" or
- polymorphic sequence refers to segments of genomic DNA that exhibit heritable variation in a DNA sequence between individuals.
- markers include, but are not limited to, single nucleotide polymorphisms (SNPs), restriction fragment length polymorphisms (RFLPs), short tandem repeats, such as di-, tri- or tetra-nucleotide repeats (STRs), and the like.
- SNPs single nucleotide polymorphisms
- RFLPs restriction fragment length polymorphisms
- STRs tetra-nucleotide repeats
- single nucleotide polymorphism refers to the polynucleotide sequence variation present at a single nucleotide residue within different alleles of the same genomic sequence. This variation may occur within the coding region or non-coding region (i.e., in the promoter or intronic region) of a genomic sequence, if the genomic sequence is transcribed during protein production. Detection of one or more SNP allows differentiation of different alleles of a single genomic sequence or between two or more individuals.
- allele is one of several alternate forms of a gene or non-coding regions of DNA that occupy the same position on a chromosome.
- the term allele can be used to describe DNA from any organism including but not limited to bacteria, viruses, fungi, protozoa, molds, yeasts, plants, humans, non- humans, animals, and archeabacteria.
- ratio of the alleles or “allelic ratio” as used herein refer to the ratio of the population of one allele and the population of the other allele in a sample. In some trisomic cases, it is possible that a fetus may be tri-allelic for a particular locus. In such cases, the term “ratio of the alleles” refers to the ratio of the population of any one allele against one of the other alleles, or any one allele against the other two alleles.
- non-polymorphism-based quantitative method refers to a method for determining the amount of an analyte (e.g., total nucleic acid, Y-chromosome nucleic acid, or fetal nucleic acid) that does not require the use of a polymorphic marker or sequence. Although a polymorphism may be present in the sequence, said polymorphism is not required to quantify the sequence.
- analyte e.g., total nucleic acid, Y-chromosome nucleic acid, or fetal nucleic acid
- non- polymorphism-based quantitative methods include, but are not limited to, RT-PCR, digital PCR, array-based methods, sequencing methods, nanopore-based methods, nucleic acid-bound bead-based counting methods and competitor-based methods wherein one or more competitors are introduced at a known concentration(s) to determine the amount of one or more analytes.
- some of the above exemplary methods may need to be actively modified or designed such that one or more polymorphisms are not interrogated.
- absolute amount refers to the amount or quantity of an analyte (e.g., total nucleic acid or fetal nucleic acid).
- the present technology provides compositions and processes for determining the absolute amount of fetal nucleic acid in a mixed maternal sample. Absolute amount or copy number represents the number of molecules available for detection, and may be expressed as the genomic equivalents per unit.
- concentration refers to the amount or proportion of a substance in a mixture or solution (e.g., the amount of fetal nucleic acid in a maternal sample that comprises a mixture of maternal and fetal nucleic acid).
- the concentration may be expressed as a percentage, which is used to express how large/small one quantity is, relative to another quantity as a fraction of 100.
- Platforms for determining the quantity or amount of an analyte include, but are not limited to, mass spectrometery, digital PCR, sequencing by synthesis platforms (e.g., pyrosequencing), fluorescence spectroscopy and flow cytometry.
- sample refers to a specimen containing nucleic acid.
- samples include, but are not limited to, tissue, bodily fluid (for example, blood, serum, plasma, saliva, urine, tears, peritoneal fluid, ascitic fluid, vaginal secretion, breast fluid, breast milk, lymph fluid, cerebrospinal fluid or mucosa secretion), umbilical cord blood, chorionic villi, amniotic fluid, an embryo, a two-celled embryo, a four-celled embryo, an eight-celled embryo, a 16-celled embryo, a 32-celled embryo, a 64-celled embryo, a 128-celled embryo, a 256-celled embryo, a 512-celled embryo, a 1024-celled embryo, embryonic tissues, lymph fluid, cerebrospinal fluid, mucosa secretion, or other body exudate, fecal matter, an individual cell or extract of the such sources that contain the nucleic
- Fetal DNA can be obtained from sources including but not limited to maternal blood, maternal serum, maternal plasma, fetal cells, umbilical cord blood, chorionic villi, amniotic fluid, urine, saliva, lung lavage, cells or tissues.
- blood refers to a blood sample or preparation from a pregnant woman or a woman being tested for possible pregnancy.
- the term encompasses whole blood or any fractions of blood, such as serum and plasma as conventionally defined.
- bisulfite as used herein encompasses any suitable types of bisulfites, such as sodium bisulfite, that are capable of chemically converting a cytosine (C) to a uracil (U) without chemically modifying a methylated cytosine and therefore can be used to differentially modify a DNA sequence based on the methylation status of the DNA.
- a reagent that "differentially modifies" methylated or non-methylated DNA encompasses any reagent that modifies methylated and/or unmethylated DNA in a process through which distinguishable products result from methylated and non-methylated DNA, thereby allowing the identification of the DNA methylation status.
- processes may include, but are not limited to, chemical reactions (such as a C.fwdarw.U conversion by bisulfite) and enzymatic treatment (such as cleavage by a methylation-dependent endonuclease).
- an enzyme that preferentially cleaves or digests methylated DNA is one capable of cleaving or digesting a DNA molecule at a much higher efficiency when the DNA is methylated, whereas an enzyme that preferentially cleaves or digests unmethylated DNA exhibits a significantly higher efficiency when the DNA is not methylated.
- non-bisulfite-based method and “non-bisulfite-based quantitative method” as used herein refer to any method for quantifying methylated or non-methylated nucleic acid that does not require the use of bisulfite.
- the terms also refer to methods for preparing a nucleic acid to be quantified that do not require bisulfite treatment. Examples of non-bisulfite-based methods include, but are not limited to, methods for digesting nucleic acid using one or more methylation sensitive enzymes and methods for separating nucleic acid using agents that bind nucleic acid based on methylation status.
- methyl-sensitive enzymes and "methylation sensitive restriction enzymes” are DNA restriction endonucleases that are dependent on the methylation state of their DNA recognition site for activity. For example, there are methyl-sensitive enzymes that cleave or digest at their DNA recognition sequence only if it is not methylated. Thus, an unmethylated DNA sample will be cut into smaller fragments than a methylated DNA sample. Similarly, a hypermethylated DNA sample will not be cleaved. In contrast, there are methyl-sensitive enzymes that cleave at their DNA recognition sequence only if it is methylated. As used herein, the terms “cleave”, “cut” and “digest” are used interchangeably.
- target nucleic acid refers to a nucleic acid examined using the methods disclosed herein to determine if the nucleic acid is part of a pregnancy-related disorder or chromosomal abnormality.
- a target nucleic acid from chromosome 21 could be examined using the methods of the technology to detect Down's Syndrome.
- control nucleic acid refers to a nucleic acid used as a reference nucleic acid according to the methods disclosed herein to determine if the nucleic acid is part of a chromosomal abnormality.
- a control nucleic acid from a chromosome other than chromosome 21 (herein referred to as a "reference chromosome”) could be as a reference sequence to detect Down's Syndrome.
- the control sequence has a known or predetermined quantity.
- sequence-specific or locus-specific method refers to a method that interrogates (for example, quantifies) nucleic acid at a specific location (or locus) in the genome based on the sequence composition. Sequence-specific or locus-specific methods allow for the quantification of specific regions or chromosomes.
- gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) involved in the transcription/translation of the gene product and the regulation of the transcription/translation, as well as intervening sequences (introns) between individual coding segments (exons).
- polypeptide polypeptide
- peptide protein
- protein protein
- amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers.
- the terms encompass amino acid chains of any length, including full-length proteins (i.e., antigens), wherein the amino acid residues are linked by covalent peptide bonds.
- amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
- Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, . gamma. -carboxyglutamate, and O-phosphoserine.
- Amino acids may be referred to herein by either the commonly known three letter symbols or by the one- letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
- Primers refer to oligonucleotides that can be used in an amplification method, such as a polymerase chain reaction (PCR), to amplify a nucleotide sequence based on the polynucleotide sequence corresponding to a particular genomic sequence, e.g., one located within the CpG island CGI137, PDE9A, or CGI009 on chromosome 21, in various methylation status. At least one of the PCR primers for amplification of a polynucleotide sequence is sequence-specific for the sequence.
- PCR polymerase chain reaction
- template refers to any nucleic acid molecule that can be used for amplification in the technology. RNA or DNA that is not naturally double stranded can be made into double stranded DNA so as to be used as template DNA. Any double stranded DNA or preparation containing multiple, different double stranded DNA molecules can be used as template DNA to amplify a locus or loci of interest contained in the template DNA.
- amplification reaction refers to a process for copying nucleic acid one or more times.
- the method of amplification includes but is not limited to polymerase chain reaction, self-sustained sequence reaction, ligase chain reaction, rapid amplification of cDNA ends, polymerase chain reaction and ligase chain reaction, Q-beta phage amplification, strand displacement amplification, or splice overlap extension polymerase chain reaction.
- a single molecule of nucleic acid is amplified, for example, by digital PCR.
- sensitivity refers to the number of true positives divided by the number of true positives plus the number of false negatives, where sensitivity (sens) may be within the range of 0 ⁇ sens ⁇ 1.
- method embodiments herein have the number of false negatives equaling zero or close to equaling zero, so that no subject is wrongly identified as not having at least one chromosome abnormality or other genetic disorder when they indeed have at least one chromosome abnormality or other genetic disorder.
- an assessment often is made of the ability of a prediction algorithm to classify negatives correctly, a complementary measurement to sensitivity.
- sensitivity refers to the number of true negatives divided by the number of true negatives plus the number of false positives, where sensitivity (spec) may be within the range of 0 ⁇ spec ⁇ 1.
- methods embodiments herein have the number of false positives equaling zero or close to equaling zero, so that no subject wrongly identified as having at least one chromosome abnormality other genetic disorder when they do not have the chromosome abnormality other genetic disorder being assessed.
- variable refers to a factor, quantity, or function of an algorithm that has a value or set of values.
- a variable may be the design of a set of amplified nucleic acid species, the number of sets of amplified nucleic acid species, percent fetal genetic contribution tested, percent maternal genetic contribution tested, type of chromosome abnormality assayed, type of genetic disorder assayed, type of sex-linked abnormalities assayed, the age of the mother and the like.
- independent refers to not being influenced or not being controlled by another.
- dependent refers to being influenced or controlled by another. For example, a particular chromosome and a trisomy event occurring for that particular chromosome that results in a viable being are variables that are dependent upon each other.
- One of skill in the art may use any type of method or prediction algorithm to give significance to the data of the present technology within an acceptable sensitivity and/or specificity.
- prediction algorithms such as Chi-squared test, z-test, t-test, ANOVA (analysis of variance), regression analysis, neural nets, fuzzy logic, Hidden Markov Models, multiple model state estimation, and the like may be used.
- One or more methods or prediction algorithms may be determined to give significance to the data having different independent and/or dependent variables of the present technology. And one or more methods or prediction algorithms may be determined not to give significance to the data having different independent and/or dependent variables of the present technology.
- several algorithms may be chosen to be tested. These algorithms can be trained with raw data. For each new raw data sample, the trained algorithms will assign a classification to that sample (i.e. trisomy or normal). Based on the classifications of the new raw data samples, the trained algorithms' performance may be assessed based on sensitivity and specificity. Finally, an algorithm with the highest sensitivity and/or specificity or combination thereof may be identified.
- fetal nucleic acid in maternal plasma was first reported in 1997 and offers the possibility for non-invasive prenatal diagnosis simply through the analysis of a maternal blood sample (Lo et al., Lancet 350:485-487, 1997). To date, numerous potential clinical applications have been developed. In particular, quantitative abnormalities of fetal nucleic acid, for example DNA, concentrations in maternal plasma have been found to be associated with a number of pregnancy-associated disorders, including preeclampsia, preterm labor, antepartum hemorrhage, invasive placentation, fetal Down syndrome, and other fetal chromosomal aneuploidies. Hence, fetal nucleic acid analysis in maternal plasma represents a powerful mechanism for the monitoring of fetomaternal well-being.
- Methylation is an epigenetic phenomenon, which refers to processes that alter a phenotype without involving changes in the DNA sequence.
- the present inventors provides novel genomic polynucleotides that are differentially methylated between the fetal DNA from the fetus (e.g., from the placenta) and the maternal DNA from the mother, for example from peripheral blood cells. This discovery thus provides a new approach for distinguishing fetal and maternal genomic DNA and new methods for accurately quantifying fetal nucleic which may be used for non-invasive prenatal diagnosis.
- nucleic acids sizes are given in either kilobases (kb) or base pairs (bp). These are estimates derived from agarose or acrylamide gel electrophoresis, from sequenced nucleic acids, or from published DNA sequences.
- kb kilobases
- bp base pairs
- proteins sizes are given in kilodaltons (kDa) or amino acid residue numbers. Protein sizes are estimated from gel electrophoresis, from sequenced proteins, from derived amino acid sequences, or from published protein sequences.
- Oligonucleotides that are not commercially available can be chemically synthesized, e.g., according to the solid phase phosphoramidite triester method first described by Beaucage & Caruthers, Tetrahedron Lett. 22: 1859-1862 (1981), using an automated synthesizer, as described in Van Devanter et. al., Nucleic Acids Res. 12: 6159-6168 (1984). Purification of oligonucleotides is performed using any art-recognized strategy, e.g., native acrylamide gel electrophoresis or anion-exchange high performance liquid chromatography (HPLC) as described in Pearson & Reanier, J. Chrom. 255: 137-149 (1983).
- HPLC high performance liquid chromatography
- the present technology relates to separating, enriching and analyzing fetal DNA found in maternal blood as a non-invasive means to detect the presence and/or to monitor the progress of a pregnancy-associated condition or disorder.
- the first steps of practicing the technology are to obtain a blood sample from a pregnant woman and extract DNA from the sample.
- a blood sample is obtained from a pregnant woman at a gestational age suitable for testing using a method of the present technology.
- the suitable gestational age may vary depending on the disorder tested, as discussed below.
- Collection of blood from a woman is performed in accordance with the standard protocol hospitals or clinics generally follow.
- An appropriate amount of peripheral blood e.g., typically between 5- 50 ml, is collected and may be stored according to standard procedure prior to further preparation.
- Blood samples may be collected, stored or transported in a manner known to the person of ordinary skill in the art to minimize degradation or the quality of nucleic acid present in the sample.
- the analysis of fetal DNA found in maternal blood may be performed using, e.g., the whole blood, serum, or plasma.
- the methods for preparing serum or plasma from maternal blood are well known among those of skill in the art.
- a pregnant woman's blood can be placed in a tube containing EDTA or a specialized commercial product such as Vacutainer SST (Becton Dickinson, Franklin Lakes, NJ.) to prevent blood clotting, and plasma can then be obtained from whole blood through centrifugation.
- serum may be obtained with or without centrifugation-following blood clotting. If centrifugation is used then it is typically, though not exclusively, conducted at an appropriate speed, e.g., 1,500-3,000 times g.
- Plasma or serum may be subjected to additional centrifugation steps before being transferred to a fresh tube for DNA extraction.
- DNA may also be recovered from the cellular fraction, enriched in the buffy coat portion, which can be obtained following centrifugation of a whole blood sample from the woman and removal of the plasma.
- the sample may first be enriched or relatively enriched for fetal nucleic acid by one or more methods.
- the discrimination of fetal and maternal DNA can be performed using the compositions and processes of the present technology alone or in combination with other discriminating factors. Examples of these factors include, but are not limited to, single nucleotide differences between chromosome X and Y, chromosome Y-specific sequences, polymorphisms located elsewhere in the genome, size differences between fetal and maternal DNA and differences in methylation pattern between maternal and fetal tissues.
- the methods provided herein offer an alternative approach for the enrichment of fetal DNA based on the methylation-specific separation of differentially methylated DNA. It has recently been discovered that many genes involved in developmental regulation are controlled through epigenetics in embryonic stem cells. Consequently, multiple genes can be expected to show differential DNA methylation between nucleic acid of fetal origin and maternal origin Once these regions are identified, a technique to capture methylated DNA can be used to specifically enrich fetal DNA. For identification of differentially methylated regions, a novel approach was used to capture methylated DNA.
- MBD-FC methyl binding domain of MBD2
- MBD-FC Fc fragment of an antibody
- Methylation specific antibodies bind DNA stochastically, which means that only a binary answer can be obtained.
- the methyl binding domain of MBD-FC on the other hand binds DNA molecules regardless of their methylation status. The strength of this protein - DNA interaction is defined by the level of DNA methylation. After binding genomic DNA, eluate solutions of increasing salt concentrations can be used to fractionate non-methylated and methylated DNA allowing for a more controlled separation (Gebhard C, Schwarzfischer L, Pham TH, Andreesen R, Mackensen A, Rehli M (2006) Rapid and sensitive detection of CpG-methylation using methyl-binding (MB)-PCR.
- Methyl-CpG immunoprecipitation cannot only enrich, but also fractionate genomic DNA according to methylation level, which is particularly helpful when the unmethylated DNA fraction should be investigated as well Methylation Sensitive Restriction Enzyme Digestion
- the technology also provides compositions and processes for determining the amount of fetal nucleic acid from a maternal sample.
- the technology allows for the enrichment of fetal nucleic acid regions in a maternal sample by selectively digesting nucleic acid from said maternal sample with an enzyme that selectively and completely or substantially digests the maternal nucleic acid to enrich the sample for at least one fetal nucleic acid region.
- the digestion efficiency is greater than about 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%
- the amount of fetal nucleic acid can be determined by quantitative methods that do not require polymorphic sequences or bisulfite treatment, thereby, offering a solution that works equally well for female fetuses and across different ethnicities and preserves the low copy number fetal nucleic acid present in the sample.
- methyl-sensitive enzymes that preferentially or substantially cleave or digest at their DNA recognition sequence if it is non-methylated.
- an unmethylated DNA sample will be cut into smaller fragments than a methylated DNA sample Similarly, a hypermethylated DNA sample will not be cleaved.
- methyl-sensitive enzymes that cleave at their DNA recognition sequence only if it is methylated.
- Methyl-sensitive enzymes that digest unmethylated DNA suitable for use in methods of the technology include, but are not limited to, Hpall, Hhal, Maell, BstUI and Acil.
- An enzyme that can be used is Hpall that cuts only the unmethylated sequence CCGG.
- Another enzyme that can be used is Hhal that cuts only the unmethylated sequence GCGC Both enzymes are available from New England BioLabs ® , Inc. Combinations of two or more methyl-sensitive enzymes that digest only unmethylated DNA can also be used.
- Suitable enzymes that digest only methylated DNA include, but are not limited to, Dpnl, which cuts at a recognition sequence GATC, and McrBC, which belongs to the family of AAA.sup. ⁇ proteins and cuts DNA containing modified cytosines and cuts at recognition site 5' . . . Pu.sup.mC(N.sub.40-3000) Pu.sup.mC . . . 3' (New England BioLabs, Inc., Beverly, Mass.).
- methylation analysis procedures are known in the art, and can be used in conjunction with the present technology. These assays allow for determination of the methylation state of one or a plurality of CpG islands within a DNA sequence. In addition, the methods maybe used to quantify methylated nucleic acid. Such assays involve, among other techniques, DNA sequencing of bisulfite-treated DNA, PCR (for sequence-specific amplification), Southern blot analysis, and use of methylation-sensitive restriction enzymes.
- Genomic sequencing is a technique that has been simplified for analysis of DNA methylation patterns and 5-methylcytosine distribution by using bisulfite treatment (Frommer et al., Proc. Natl. Acad. Sci. USA 89:1827-1831, 1992). Additionally, restriction enzyme digestion of PCR products amplified from bisulfite- converted DNA may be used, e.g., the method described by Sadri & Hornsby (Nucl. Acids Res. 24:5058- 5059, 1996), or COBRA (Combined Bisulfite Restriction Analysis) (Xiong & Laird, Nucleic Acids Res. 25:2532- 2534, 1997).
- COBRA analysis is a quantitative methylation assay useful for determining DNA methylation levels at specific gene loci in small amounts of genomic DNA (Xiong & Laird, Nucleic Acids Res. 25:2532-2534, 1997). Briefly, restriction enzyme digestion is used to reveal methylation-dependent sequence differences in PCR products of sodium bisulfite-treated DNA. Methylation-dependent sequence differences are first introduced into the genomic DNA by standard bisulfite treatment according to the procedure described by Frommer et al. (Proc. Natl. Acad. Sci. USA 89:1827-1831, 1992).
- PCR amplification of the bisulfite converted DNA is then performed using primers specific for the interested CpG islands, followed by restriction endonuclease digestion, gel electrophoresis, and detection using specific, labeled hybridization probes.
- Methylation levels in the original DNA sample are represented by the relative amounts of digested and undigested PCR product in a linearly quantitative fashion across a wide spectrum of DNA methylation levels.
- this technique can be reliably applied to DNA obtained from microdissected paraffin- embedded tissue samples.
- Typical reagents for COBRA analysis may include, but are not limited to: PCR primers for specific gene (or methylation-altered DNA sequence or CpG island); restriction enzyme and appropriate buffer; gene-hybridization oligo; control hybridization oligo; kinase labeling kit for oligo probe; and radioactive nucleotides.
- bisulfite conversion reagents may include: DNA denaturation buffer; sulfonation buffer; DNA recovery reagents or kits (e.g., precipitation, ultrafiltration, affinity column); desulfonation buffer; and DNA recovery components.
- the MethyLightTM assay is a high-throughput quantitative methylation assay that utilizes fluorescence-based real-time PCR (Ta q M an. RTM.) technology that requires no further manipulations after the PCR step (Eads et al.. Cancer Res. 59:2302-2306, 1999). Briefly, the MethyLight.TM. process begins with a mixed sample of genomic DNA that is converted, in a sodium bisulfite reaction, to a mixed pool of methylation-dependent sequence differences according to standard procedures (the bisulfite process converts unmethylated cytosine residues to uracil).
- Fluorescence-based PCR is then performed either in an "unbiased” (with primers that do not overlap known CpG methylation sites) PCR reaction, or in a “biased” (with PCR primers that overlap known CpG dinucleotides) reaction. Sequence discrimination can occur either at the level of the amplification process or at the level of the fluorescence detection process, or both.
- the MethyLight assay may be used as a quantitative test for methylation patterns in the genomic DNA sample, wherein sequence discrimination occurs at the level of probe hybridization.
- the PCR reaction provides for unbiased amplification in the presence of a fluorescent probe that overlaps a particular putative methylation site.
- An unbiased control for the amount of input DNA is provided by a reaction in which neither the primers, nor the probe overlie any CpG dinucleotides.
- a qualitative test for genomic methylation is achieved by probing of the biased PCR pool with either control oligonucleotides that do not "cover” known methylation sites (a fluorescence-based version of the "MSP" technique), or with oligonucleotides covering potential methylation sites.
- the MethyLight process can by used with a "TaqMan” probe in the amplification process.
- double-stranded genomic DNA is treated with sodium bisulfite and subjected to one of two sets of PCR reactions using TaqMan. RTM. probes; e.g., with either biased primers and TaqMan. RTM. probe, or unbiased primers and TaqMan. RTM. probe.
- the TaqMan. RTM. probe is dual-labeled with fluorescent "reporter” and "quencher” molecules, and is designed to be specific for a relatively high GC content region so that it melts out at about lO.degree. C. higher temperature in the PCR cycle than the forward or reverse primers. This allows the TaqMan. RTM.
- Taq polymerase enzymatically synthesizes a new strand during PCR, it will eventually reach the annealed TaqMan. RTM. probe.
- the Taq polymerase 5' to 3' endonuclease activity will then displace the TaqMan. RTM. probe by digesting it to release the fluorescent reporter molecule for quantitative detection of its now unquenched signal using a real-time fluorescent detection system.
- Typical reagents e.g., as might be found in a typical MethyLight.TM. -based kit) for MethyLight.TM.
- PCR primers for specific gene or methylation-altered DNA sequence or CpG island
- TaqMan. RTM probes
- optimized PCR buffers and deoxynucleotides and Taq polymerase.
- the Ms-SNuPE technique is a quantitative method for assessing methylation differences at specific CpG sites based on bisulfite treatment of DNA, followed by single-nucleotide primer extension (Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531, 1997).
- genomic DNA is reacted with sodium bisulfite to convert unmethylated cytosine to uracil while leaving 5-methylcytosine unchanged.
- Amplification of the desired target sequence is then performed using PCR primers specific for bisulfite-converted DNA, and the resulting product is isolated and used as a template for methylation analysis at the CpG site(s) of interest.
- Typical reagents for Ms-SNuPE analysis may include, but are not limited to: PCR primers for specific gene (or methylation-altered DNA sequence or CpG island); optimized PCR buffers and deoxynucleotides; gel extraction kit; positive control primers; Ms-SNuPE primers for specific gene; reaction buffer (for the Ms-SNuPE reaction); and radioactive nucleotides.
- bisulfite conversion reagents may include: DNA denaturation buffer; sulfonation buffer; DNA recovery regents or kit (e.g., precipitation, ultrafiltration, affinity column); desulfonation buffer; and DNA recovery components.
- MSP methylation-specific PCR
- DNA is modified by sodium bisulfite converting unmethylated, but not methylated cytosines to uracil, and subsequently amplified with primers specific for methylated versus umnethylated DNA.
- MSP requires only small quantities of DNA, is sensitive to 0.1% methylated alleles of a given CpG island locus, and can be performed on DNA extracted from paraffin-embedded samples.
- Typical reagents e.g., as might be found in a typical MSP-based kit
- MSP analysis may include, but are not limited to: methylated and unmethylated PCR primers for specific gene (or methylation-altered DNA sequence or CpG island), optimized PCR buffers and deoxynucleotides, and specific probes.
- the MCA technique is a method that can be used to screen for altered methylation patterns in genomic DNA, and to isolate specific sequences associated with these changes (Toyota et al., Cancer Res. 59:2307- 12, 1999). Briefly, restriction enzymes with different sensitivities to cytosine methylation in their recognition sites are used to digest genomic DNAs from primary tumors, cell lines, and normal tissues prior to arbitrarily primed PCR amplification. Fragments that show differential methylation are cloned and sequenced after resolving the PCR products on high-resolution polyacrylamide gels. The cloned fragments are then used as probes for Southern analysis to confirm differential methylation of these regions.
- Typical reagents for MCA analysis may include, but are not limited to: PCR primers for arbitrary priming Genomic DNA; PCR buffers and nucleotides, restriction enzymes and appropriate buffers; gene-hybridization oligos or probes; control hybridization oligos or probes.
- Another method for analyzing methylation sites is a primer extension assay, including an optimized PCR amplification reaction that produces amplified targets for subsequent primer extension genotyping analysis using mass spectrometry.
- the assay can also be done in multiplex This method (particularly as it relates to genotyping single nucleotide polymorphisms) is described in detail in PCT publication WO05012578A1 and US publication US20050079521A1.
- the assay can be adopted to detect bisulfite introduced methylation dependent C to T sequence changes
- multiplexed primer extension reactions e g., multiplexed homogeneous primer mass extension (hME) assays
- DNA methylation analysis includes restriction landmark genomic scanning (RLGS, Costello et al , 2000), methylation-sensitive-representational difference analysis (MS-RDA), methylation specific AP-PCR (MS AP-PCR) and methyl-CpG binding domain column/segregation of partly melted molecules (MBD/SPM).
- RGS restriction landmark genomic scanning
- MS-RDA methylation-sensitive-representational difference analysis
- MS AP-PCR methylation specific AP-PCR
- MBD/SPM methyl-CpG binding domain column/segregation of partly melted molecules
- the nucleic acid may be subjected to sequence-based analysis Furthermore, once it is determined that one particular genomic sequence of fetal origin is hypermethylated or hypomethylated compared to the maternal counterpart, the amount of this fetal genomic sequence can be determined. Subsequently, this amount can be compared to a standard control value and serve as an indication for the potential of certain pregnancy-associated disorder.
- nucleic acid amplification is the enzymatic synthesis of nucleic acid amplicons (copies) which contain a sequence that is complementary to a nucleic acid sequence being amplified. Nucleic acid amplification is especially beneficial when the amount of target sequence present in a sample is very low.
- the sensitivity of an assay can be vastly improved, since fewer target sequences are needed at the beginning of the assay to better ensure detection of nucleic acid in the sample belonging to the organism or virus of interest.
- PCR polymerase chain reaction
- PCR is most usually carried out as an automated process with a thermostable enzyme. In this process, the temperature of the reaction mixture is cycled through a denaturing region, a primer annealing region, and an extension reaction region automatically. Machines specifically adapted for this purpose are commercially available.
- PCR amplification of a polynucleotide sequence is typically used in practicing the present technology
- amplification of a genomic sequence found in a maternal blood sample may be accomplished by any known method, such as ligase chain reaction (LCR), transcription-mediated amplification, and self-sustained sequence replication or nucleic acid sequence- based amplification (NASBA), each of which provides sufficient amplification.
- LCR ligase chain reaction
- NASBA nucleic acid sequence- based amplification
- More recently developed branched-DNA technology may also be used to qualitatively demonstrate the presence of a particular genomic sequence of the technology, which represents a particular methylation pattern, or to quantitatively determine the amount of this particular genomic sequence in the maternal blood.
- branched-DNA signal amplification for direct quantitation of nucleic acid sequences in clinical samples, see Nolte, Adv. Clin. Chem. 33:201-235, 1998.
- compositions and processes of the technology are also particularly useful when practiced with digital PCR.
- Digital PCR was first developed by Kalinina and colleagues (Kalinina et al., "Nanoliter scale PCR with TaqMan detection.” Nucleic Acids Research. 25; 1999-2004, (1997)) and further developed by Vogelstein and Kinzler (Digital PCR. Proc Natl Acad Sci U S A. 96; 9236-41, (1999)).
- the application of digital PCR for use with fetal diagnostics was first described by Cantor et al. (PCT Patent Publication No. WO05023091A2) and subsequently described by Quake et al. (US Patent Publication No.
- a primer extension reaction operates, for example, by discriminating the SNP alleles by the incorporation of deoxynucleotides and/or dideoxynucleotides to a primer extension primer which hybridizes to a region adjacent to the SNP site.
- the primer is extended with a polymerase.
- the primer extended SNP can be detected physically by mass spectrometry or by a tagging moiety such as biotin.
- the SNP alleles can be discriminated and quantified.
- Reverse transcribed and amplified nucleic acids may be modified nucleic acids.
- Modified nucleic acids can include nucleotide analogs, and in certain embodiments include a detectable label and/or a capture agent.
- detectable labels include without limitation fluorophores, radioisotopes, colormetric agents, light emitting agents, chemiluminescent agents, light scattering agents, enzymes and the like.
- capture agents include without limitation an agent from a binding pair selected from antibody/antigen, antibody/antibody, antibody/antibody fragment, antibody/antibody receptor, antibody/protein A or protein G, hapten/anti-hapten, biotin/avidin, biotin/streptavidin, folic acid/folate binding protein, vitamin B12/intrinsic factor, chemical reactive group/complementary chemical reactive group (e.g., sulfhydryl/maleimide, sulfhydryl/haloacetyl derivative, amine/isotriocyanate, amine/succinimidyl ester, and amine/sulfonyl halides) pairs, and the like.
- Modified nucleic acids having a capture agent can be immobilized to a solid support in certain embodiments
- Mass spectrometry is a particularly effective method for the detection of a polynucleotide of the technology, for example a PCR amplicon, a primer extension product or a detector probe that is cleaved from a target nucleic acid.
- the presence of the polynucleotide sequence is verified by comparing the mass of the detected signal with the expected mass of the polynucleotide of interest.
- the relative signal strength, e.g., mass peak on a spectra, for a particular polynucleotide sequence indicates the relative population of a specific allele, thus enabling calculation of the allele ratio directly from the data.
- Sequencing technologies are improving in terms of throughput and cost. Sequencing technologies, such as that achievable on the 454 platform (Roche) (Margulies, M. et al. 2005 Nature 437, 376-380), lllumina Genome Analyzer (or Solexa platform) or SOLiD System (Applied Biosystems) or the Helicos True Single Molecule DNA sequencing technology (Harris T D et al. 2008 Science, 320, 106-109), the single molecule, real-time (SMRT.TM.) technology of Pacific Biosciences, and nanopore sequencing (Soni GV and Meller A. 2007 Clin Chem 53: 1996-2001), allow the sequencing of many nucleic acid molecules isolated from a specimen at high orders of multiplexing in a parallel fashion (Dear Brief Funct Genomic Proteomic 2003; 1: 397-416).
- Each of these platforms allow sequencing of clonally expanded or non-amplified single molecules of nucleic acid fragments.
- Certain platforms involve, for example, (i) sequencing by ligation of dye-modified probes (including cyclic ligation and cleavage), (ii) pyrosequencing, and (iii) single-molecule sequencing.
- Nucleotide sequence species, amplification nucleic acid species and detectable products generated there from can be considered a "study nucleic acid" for purposes of analyzing a nucleotide sequence by such sequence analysis platforms.
- Sequencing by ligation is a nucleic acid sequencing method that relies on the sensitivity of DNA ligase to base-pairing mismatch.
- DNA ligase joins together ends of DNA that are correctly base paired. Combining the ability of DNA ligase to join together only correctly base paired DNA ends, with mixed pools of fluorescently labeled oligonucleotides or primers, enables sequence determination by fluorescence detection.
- Longer sequence reads may be obtained by including primers containing cleavable linkages that can be cleaved after label identification. Cleavage at the linker removes the label and regenerates the 5' phosphate on the end of the ligated primer, preparing the primer for another round of ligation.
- primers may be labeled with more than one fluorescent label (e.g., 1 fluorescent label, 2, 3, or 4 fluorescent labels).
- Clonal bead populations can be prepared in emulsion microreactors containing study nucleic acid ("template"), amplification reaction components, beads and primers. After amplification, templates are denatured and bead enrichment is performed to separate beads with extended templates from undesired beads (e.g., beads with no extended templates). The template on the selected beads undergoes a 3' modification to allow covalent bonding to the slide, and modified beads can be deposited onto a glass slide. Deposition chambers offer the ability to segment a slide into one, four or eight chambers during the bead loading process.
- primers hybridize to the adapter sequence.
- a set of four color dye-labeled probes competes for ligation to the sequencing primer. Specificity of probe ligation is achieved by interrogating every 4th and 5th base during the ligation series. Five to seven rounds of ligation, detection and cleavage record the color at every 5th position with the number of rounds determined by the type of library used. Following each round of ligation, a new complimentary primer offset by one base in the 5' direction is laid down for another series of ligations. Primer reset and ligation rounds (5-7 ligation cycles per round) are repeated sequentially five times to generate 25-35 base pairs of sequence for a single tag. With mate-paired sequencing, this process is repeated for a second tag.
- Such a system can be used to exponentially amplify amplification products generated by a process described herein, e.g., by ligating a heterologous nucleic acid to the first amplification product generated by a process described herein and performing emulsion amplification using the same or a different solid support originally used to generate the first amplification product.
- Such a system also may be used to analyze amplification products directly generated by a process described herein by bypassing an exponential amplification process and directly sorting the solid supports described herein on the glass slide.
- Pyrosequencing is a nucleic acid sequencing method based on sequencing by synthesis, which relies on detection of a pyrophosphate released on nucleotide incorporation.
- sequencing by synthesis involves synthesizing, one nucleotide at a time, a DNA strand complimentary to the strand whose sequence is being sought.
- Study nucleic acids may be immobilized to a solid support, hybridized with a sequencing primer, incubated with DNA polymerase, ATP sulfurylase, luciferase, apyrase, adenosine 5' phosphsulfate and luciferin. Nucleotide solutions are sequentially added and removed.
- nucleotide Correct incorporation of a nucleotide releases a pyrophosphate, which interacts with ATP sulfurylase and produces ATP in the presence of adenosine 5' phosphsulfate, fueling the luciferin reaction, which produces a chemiluminescent signal allowing sequence determination.
- An example of a system that can be used by a person of ordinary skill based on pyrosequencing generally involves the following steps: ligating an adaptor nucleic acid to a study nucleic acid and hybridizing the study nucleic acid to a bead; amplifying a nucleotide sequence in the study nucleic acid in an emulsion; sorting beads using a picoliter multiwell solid support; and sequencing amplified nucleotide sequences by pyrosequencing methodology (e.g., Nakano et al., "Single-molecule PCR using water-in-oil emulsion;" Journal of Biotechnology 102: 117-124 (2003)).
- Such a system can be used to exponentially amplify amplification products generated by a process described herein, e.g., by ligating a heterologous nucleic acid to the first amplification product generated by a process described herein.
- Certain single-molecule sequencing embodiments are based on the principal of sequencing by synthesis, and utilize single-pair Fluorescence Resonance Energy Transfer (single pair FRET) as a mechanism by which photons are emitted as a result of successful nucleotide incorporation.
- the emitted photons often are detected using intensified or high sensitivity cooled charge-couple-devices in conjunction with total internal reflection microscopy (TIRM). Photons are only emitted when the introduced reaction solution contains the correct nucleotide for incorporation into the growing nucleic acid chain that is synthesized as a result of the sequencing process.
- TIRM total internal reflection microscopy
- FRET FRET based single-molecule sequencing
- energy is transferred between two fluorescent dyes, sometimes polymethine cyanine dyes Cy3 and Cy5, through long-range dipole interactions.
- the donor is excited at its specific excitation wavelength and the excited state energy is transferred, non-radiatively to the acceptor dye, which in turn becomes excited.
- the acceptor dye eventually returns to the ground state by radiative emission of a photon.
- the two dyes used in the energy transfer process represent the "single pair", in single pair FRET. Cy3 often is used as the donor fluorophore and often is incorporated as the first labeled nucleotide.
- Cy5 often is used as the acceptor fluorophore and is used as the nucleotide label for successive nucleotide additions after incorporation of a first Cy3 labeled nucleotide.
- the fluorophores generally are within 10 nanometers of each for energy transfer to occur successfully.
- An example of a system that can be used based on single-molecule sequencing generally involves hybridizing a primer to a study nucleic acid to generate a complex; associating the complex with a solid phase; iteratively extending the primer by a nucleotide tagged with a fluorescent molecule; and capturing an image of fluorescence resonance energy transfer signals after each iteration (e.g., U.S. Patent No. 7,169,314; Braslavsky et al., PNAS 100(7): 3960-3964 (2003)).
- Such a system can be used to directly sequence amplification products generated by processes described herein.
- the released linear amplification product can be hybridized to a primer that contains sequences complementary to immobilized capture sequences present on a solid support, a bead or glass slide for example.
- Hybridization of the primer-released linear amplification product complexes with the immobilized capture sequences immobilizes released linear amplification products to solid supports for single pair FRET based sequencing by synthesis.
- the primer often is fluorescent, so that an initial reference image of the surface of the slide with immobilized nucleic acids can be generated. The initial reference image is useful for determining locations at which true nucleotide incorporation is occurring. Fluorescence signals detected in array locations not initially identified in the "primer only" reference image are discarded as non-specific fluorescence.
- the bound nucleic acids often are sequenced in parallel by the iterative steps of, a) polymerase extension in the presence of one fluorescently labeled nucleotide, b) detection of fluorescence using appropriate microscopy, TIRM for example, c) removal of fluorescent nucleotide, and d) return to step a with a different fluorescently labeled nucleotide.
- nucleotide sequencing may be by solid phase single nucleotide sequencing methods and processes.
- Solid phase single nucleotide sequencing methods involve contacting sample nucleic acid and solid support under conditions in which a single molecule of sample nucleic acid hybridizes to a single molecule of a solid support. Such conditions can include providing the solid support molecules and a single molecule of sample nucleic acid in a "microreactor.” Such conditions also can include providing a mixture in which the sample nucleic acid molecule can hybridize to solid phase nucleic acid on the solid support.
- Single nucleotide sequencing methods useful in the embodiments described herein are described in United States Provisional Patent Application Serial Number 61/021,871 filed January 17, 2008.
- nanopore sequencing detection methods include (a) contacting a nucleic acid for sequencing ("base nucleic acid,” e.g., linked probe molecule) with sequence-specific detectors, under conditions in which the detectors specifically hybridize to substantially complementary subsequences of the base nucleic acid; (b) detecting signals from the detectors and (c) determining the sequence of the base nucleic acid according to the signals detected.
- the detectors hybridized to the base nucleic acid are disassociated from the base nucleic acid (e.g., sequentially dissociated) when the detectors interfere with a nanopore structure as the base nucleic acid passes through a pore, and the detectors disassociated from the base sequence are detected.
- a detector disassociated from a base nucleic acid emits a detectable signal, and the detector hybridized to the base nucleic acid emits a different detectable signal or no detectable signal.
- nucleotides in a nucleic acid e.g., linked probe molecule
- nucleotide representatives specific nucleotide sequences corresponding to specific nucleotides
- nucleotide representatives may be arranged in a binary or higher order arrangement (e.g., Soni and Meller, Clinical Chemistry 53(11): 1996-2001 (2007)).
- a nucleic acid is not expanded, does not give rise to an expanded nucleic acid, and directly serves a base nucleic acid (e.g., a linked probe molecule serves as a non-expanded base nucleic acid), and detectors are directly contacted with the base nucleic acid.
- a first detector may hybridize to a first subsequence and a second detector may hybridize to a second subsequence, where the first detector and second detector each have detectable labels that can be distinguished from one another, and where the signals from the first detector and second detector can be distinguished from one another when the detectors are disassociated from the base nucleic acid.
- detectors include a region that hybridizes to the base nucleic acid (e.g., two regions), which can be about 3 to about 100 nucleotides in length (e.g., about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95 nucleotides in length).
- a detector also may include one or more regions of nucleotides that do not hybridize to the base nucleic acid.
- a detector is a molecular beacon.
- a detector often comprises one or more detectable labels independently selected from those described herein.
- Each detectable label can be detected by any convenient detection process capable of detecting a signal generated by each label (e.g., magnetic, electric, chemical, optical and the like).
- a CD camera can be used to detect signals from one or more distinguishable quantum dots linked to a detector.
- reads may be used to construct a larger nucleotide sequence, which can be facilitated by identifying overlapping sequences in different reads and by using identification sequences in the reads.
- sequence analysis methods and software for constructing larger sequences from reads are known to the person of ordinary skill (e.g., Venter et al., Science 291: 1304-1351 (2001)).
- Specific reads, partial nucleotide sequence constructs, and full nucleotide sequence constructs may be compared between nucleotide sequences within a sample nucleic acid (i.e., internal comparison) or may be compared with a reference sequence (i.e., reference comparison) in certain sequence analysis embodiments.
- nucleic acid species in a plurality of nucleic acids e.g., nucleotide sequence species, amplified nucleic acid species and detectable products generated from the foregoing.
- Multiplexing refers to the simultaneous detection of more than one nucleic acid species.
- General methods for performing multiplexed reactions in conjunction with mass spectrometry are known (see, e.g., U.S. Pat. Nos. 6,043,031, 5,547,835 and International PCT application No. WO 97/37041).
- Multiplexing provides an advantage that a plurality of nucleic acid species (e.g., some having different sequence variations) can be identified in as few as a single mass spectrum, as compared to having to perform a separate mass spectrometry analysis for each individual target nucleic acid species.
- Methods provided herein lend themselves to high-throughput, highly-automated processes for analyzing sequence variations with high speed and accuracy, in some embodiments. In some embodiments, methods herein may be multiplexed at high levels in a single reaction.
- the number of nucleic acid species multiplexed include, without limitation, about 1 to about 500 (e.g., about 1-3, 3-5, 5-7, 7-9, 9-11, 11-13, 13-15, 15-17, 17-19, 19-21, 21-23, 23-25, 25-27, 27- 29, 29-31, 31-33, 33-35, 35-37, 37-39, 39-41, 41-43, 43-45, 45-47, 47-49, 49-51, 51-53, 53-55, 55-57, 57-59, 59-61, 61-63, 63-65, 65-67, 67-69, 69-71, 71-73, 73-75, 75-77, 77-79, 79-81, 81-83, 83-85, 85-87, 87-89, 89- 91, 91-93, 93-95, 95-97, 97-101, 101-103, 103-105, 105-107, 107-109,
- Design methods for achieving resolved mass spectra with multiplexed assays can include primer and oligonucleotide design methods and reaction design methods. See, for example, the multiplex schemes provided in Tables X and Y.
- primer and oligonucleotide design in multiplexed assays the same general guidelines for primer design applies for uniplexed reactions, such as avoiding false priming and primer dimers, only more primers are involved for multiplex reactions.
- analyte peaks in the mass spectra for one assay are sufficiently resolved from a product of any assay with which that assay is multiplexed, including pausing peaks and any other by-product peaks.
- multiplex analysis may be adapted to mass spectrometric detection of chromosome abnormalities, for example.
- multiplex analysis may be adapted to various single nucleotide or nanopore based sequencing methods described herein. Commercially produced micro- reaction chambers or devices or arrays or chips may be used to facilitate multiplex analysis, and are commercially available.
- Some methods rely on measuring the ratio of maternal to paternally inherited alleles to detect fetal chromosomal aneuploidies from maternal plasma.
- a diploid set yields a 1:1 ratio while trisomies can be detected as a 2:1 ratio. Detection of this difference is impaired by statistical sampling due to the low abundance of fetal DNA, presence of excess maternal DNA in the plasma sample and variability of the measurement technique. The latter is addressed by using methods with high measurement precision, like digital PCR or mass spectrometry.
- Enriching the fetal fraction of cell free DNA in a sample is currently achieved by either depleting maternal DNA through size exclusion or focusing on fetal-specific nucleic acids, like fetal-expressed RNA.
- fetal DNA Another differentiating feature of fetal DNA is its DNA methylation pattern.
- novel compositions and methods for accurately quantifying fetal nucleic acid based on differential methylation between a fetus and mother rely on sensitive absolute copy number analysis to quantify the fetal nucleic acid portion of a maternal sample, thereby allowing for the prenatal detection of fetal traits.
- the methods of the technology have identified approximately 3000 CpG rich regions in the genome that are differentially methylated between maternal and fetal DNA. The selected regions showed highly conserved differential methylation across all measured samples.
- the set of regions is enriched for genes important in developmental regulation, indicating that epigenetic regulation of these areas is a biologically relevant and consistent process (see Table 3).
- Enrichment of fetal DNA can now be achieved by using our MBD-FC protein to capture cell free DNA (e.g., substantially all cell free DNA) and then elute the highly methylated DNA fraction with high salt concentrations. Using the low salt eluate fractions, the MBD-FC is equally capable of enriching non-methylated fetal DNA.
- the present technology provides 63 confirmed genomic regions on chromosomes 13, 18 and 21 with low maternal and high fetal methylation levels. After capturing these regions, SNPs can be used to determine the aforementioned allele ratios. When high frequency SNPs are used around 10 markers have to be measured to achieve a high confidence of finding at least one SNP where the parents have opposite homozygote genotypes and the child has a heterozygote genotype.
- a method for chromosomal abnormality detection that utilizes absolute copy number quantification.
- a diploid chromosome set will show the same number of copies for differentially methylated regions across all chromosomes, but, for example, a trisomy 21 sample would show 1.5 times more copies for differentially methylated regions on chromosome 21.
- Normalization of the genomic DNA amounts for a diploid chromosome set can be achieved by using unaltered autosomes as reference (also provided herein - see Table 1). Comparable to other approaches, a single marker is less likely to be sufficient for detection of this difference, because the overall copy numbers are low.
- the methods of the present technology offer a redundancy of detectable markers that enables highly reliable discrimination of diploid versus aneuploid chromosome sets.
- detection of a chromosome abnormality refers to identification of an imbalance of chromosomes by processing data arising from detecting sets of amplified nucleic acid species, nucleotide sequence species, or a detectable product generated from the foregoing (collectively “detectable product”). Any suitable detection device and method can be used to distinguish one or more sets of detectable products, as addressed herein.
- An outcome pertaining to the presence or absence of a chromosome abnormality can be expressed in any suitable form, including, without limitation, probability (e.g., odds ratio, p-value), likelihood, percentage, value over a threshold, or risk factor, associated with the presence of a chromosome abnormality for a subject or sample.
- An outcome may be provided with one or more of sensitivity, specificity, standard deviation, coefficient of variation (CV) and/or confidence level, or combinations of the foregoing, in certain embodiments.
- Detection of a chromosome abnormality based on one or more sets of detectable products may be identified based on one or more calculated variables, including, but not limited to, sensitivity, specificity, standard deviation, coefficient of variation (CV), a threshold, confidence level, score, probability and/or a combination thereof.
- sensitivity specificity
- CV coefficient of variation
- a threshold a threshold
- confidence level confidence level
- score probability and/or a combination thereof.
- the number of sets selected for a diagnostic method, and/or (ii) the particular nucleotide sequence species of each set selected for a diagnostic method is determined in part or in full according to one or more of such calculated variables.
- one or more of sensitivity, specificity and/or confidence level are expressed as a percentage.
- the percentage, independently for each variable, is greater than about 90% (e.g., about 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99%, or greater than 99% (e.g., about 99.5%, or greater, about 99.9% or greater, about 99.95% or greater, about 99.99% or greater)).
- Coefficient of variation (CV) in some embodiments is expressed as a percentage, and sometimes the percentage is about 10% or less (e.g., about 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1%, or less than 1% (e.g., about 0.5% or less, about 0.1% or less, about 0.05% or less, about 0.01% or less)).
- a probability (e.g., that a particular outcome determined by an algorithm is not due to chance) in certain embodiments is expressed as a p-value, and sometimes the p- value is about 0.05 or less (e.g., about 0.05, 0.04, 0.03, 0.02 or 0.01, or less than 0.01 (e.g., about 0.001 or less, about 0.0001 or less, about 0.00001 or less, about 0.000001 or less)).
- scoring or a score may refer to calculating the probability that a particular chromosome abnormality is actually present or absent in a subject/sample.
- the value of a score may be used to determine for example the variation, difference, or ratio of amplified nucleic detectable product that may correspond to the actual chromosome abnormality. For example, calculating a positive score from detectable products can lead to an identification of a chromosome abnormality, which is particularly relevant to analysis of single samples.
- simulated (or simulation) data can aid data processing for example by training an algorithm or testing an algorithm.
- Simulated data may for instance involve hypothetical various samples of different concentrations of fetal and maternal nucleic acid in serum, plasma and the like.
- Simulated data may be based on what might be expected from a real population or may be skewed to test an algorithm and/or to assign a correct classification based on a simulated data set.
- Simulated data also is referred to herein as "virtual" data.
- Fetal/maternal contributions within a sample can be simulated as a table or array of numbers (for example, as a list of peaks corresponding to the mass signals of cleavage products of a reference biomolecule or amplified nucleic acid sequence), as a mass spectrum, as a pattern of bands on a gel, or as a representation of any technique that measures mass distribution. Simulations can be performed in most instances by a computer program.
- One possible step in using a simulated data set is to evaluate the confidence of the identified results, i.e. how well the selected positives/negatives match the sample and whether there are additional variations.
- a common approach is to calculate the probability value (p-value) which estimates the probability of a random sample having better score than the selected one. As p-value calculations can be prohibitive in certain circumstances, an empirical model may be assessed, in which it is assumed that at least one sample matches a reference sample (with or without resolved variations). Alternatively other distributions such as Poisson distribution can be used to describe the probability distribution.
- an algorithm can assign a confidence value to the true positives, true negatives, false positives and false negatives calculated.
- the assignment of a likelihood of the occurrence of a chromosome abnormality can also be based on a certain probability model.
- in silico refers to research and experiments performed using a computer. In silico methods include, but are not limited to, molecular modeling studies, karyotyping, genetic calculations, biomolecular docking experiments, and virtual representations of molecular structures and/or processes, such as molecular interactions.
- a "data processing routine” refers to a process, that can be embodied in software, that determines the biological significance of acquired data (i.e., the ultimate results of an assay). For example, a data processing routine can determine the amount of each nucleotide sequence species based upon the data collected. A data processing routine also may control an instrument and/or a data collection routine based upon results determined. A data processing routine and a data collection routine often are integrated and provide feedback to operate data acquisition by the instrument, and hence provide assay- based judging methods provided herein.
- software refers to computer readable program instructions that, when executed by a computer, perform computer operations.
- software is provided on a program product containing program instructions recorded on a computer readable medium, including, but not limited to, magnetic media including floppy disks, hard disks, and magnetic tape; and optical media including CD-ROM discs, DVD discs, magneto-optical discs, and other such media on which the program instructions can be recorded.
- a computer readable medium including, but not limited to, magnetic media including floppy disks, hard disks, and magnetic tape; and optical media including CD-ROM discs, DVD discs, magneto-optical discs, and other such media on which the program instructions can be recorded.
- true positive refers to a subject correctly diagnosed as having a chromosome abnormality.
- false positive refers to a subject wrongly identified as having a chromosome abnormality.
- true negative refers to a su bject correctly identified as not having a chromosome abnormality.
- false negative refers to a subject wrongly identified as not having a chromosome abnormality.
- Two measures of performance for any given method can be calculated based on the ratios of these occurrences: (i) a sensitivity value, the fraction of predicted positives that are correctly identified as being positives (e.g., the fraction of nucleotide sequence sets correctly identified by level comparison detection/determination as indicative of chromosome abnormality, relative to all nucleotide sequence sets identified as such, correctly or incorrectly), thereby reflecting the accuracy of the results in detecting the chromosome abnormality; and (ii) a specificity value, the fraction of predicted negatives correctly identified as being negative (the fraction of nucleotide sequence sets correctly identified by level comparison detection/determination as indicative of chromosomal normality, relative to all nucleotide sequence sets identified as such, correctly or incorrectly), thereby reflecting accuracy of the results in detecting the chromosome abnormality.
- a sensitivity value the fraction of predicted positives that are correctly identified as being positives (e.g., the fraction of nucleotide sequence sets correctly identified by level comparison detection/determin
- Example 1 the Applicants used a new fusion protein that captures methylated DNA in combination with CpG Island array to identify genomic regions that are differentially methylated between fetal placenta tissue and maternal blood.
- a stringent statistical approach was used to only select regions which show little variation between the samples, and hence suggest an underlying biological mechanism.
- Eighty-five differentially methylated genomic regions predominantly located on chromosomes 13, 18 and 21 were validated.
- a quantitative mass spectrometry based approach was used that interrogated 261 PCR amplicons covering these 85 regions. The results are in very good concordance (95% confirmation), proving the feasibility of the approach.
- the Applicants provide an innovative approach for aneuploidy testing, which relies on the measurement of absolute copy numbers rather than allele ratios.
- genomic DNA from maternal buffy coat and corresponding placental tissue was first extracted.
- M BD-FC was used to capture the methylated fraction of each DNA sample. See Figures 1-3.
- the two tissue fractions were labeled with different fluorescent dyes and hybridized to an Agilent ® CpG Island microarray. See Figure 4. This was done to identify differentially methylated regions that could be utilized for prenatal diagnoses. Therefore, two criteria were employed to select genomic regions as potential enrichment markers: the observed methylation difference had to be present in all tested sample pairs, and the region had to be more than 200 bp in length.
- Genomic DNA (gDNA) from maternal buffy coat and placental tissue was prepared using the QIAamp DNA Mini KitTM and QIAamp DNA Blood Mini KitTM, respectively, from Qiagen ® (Hilden, Germany).
- gDNA was quantified using the NanoDrop ND 1000TM spectrophotometer (Thermo Fisher ® , Waltham, MA,USA).
- Ultrasonication of 2.5 ⁇ g DNA in 500 ⁇ l TE buffer to a mean fragment size of 300-500 bp was carried out with the Branson Digital Sonifier 450TM (Danbury, CT, USA) using the following settings: amplitude 20%, sonication time 110 seconds, pulse on/pulse off time 1.4/0.6 seconds. Fragment range was monitored using gel electrophoresis.
- Sonicated DNA (2 ⁇ g) was added to the washed MBD-Fc beads in 2 ml Buffer A and rotated for 3 hours at 4°C. Beads were centrifuged to recover unbound DNA fragments (300 mM fraction) and subsequently washed twice with 600 ⁇ l of buffers containing increasing NaCI concentrations (400, 500, 550, 600, and 1000 mM). The flow through of each wash step was collected in separate tubes and desalted using a MinElute PCR Purification KitTM (Qiagen ® ). In parallel, 200 ng sonicated input DNA was processed as a control using the MinElute PCR Purification KitTM (Qiagen ® ).
- the 600 mM and IM NaCI fractions (enriched methylated DNA) for each sample were combined and labeled with either Alexa Fluor 555-aha- dCTP (maternal) or Alexa Fluor 647-aha-dCTP (placental) using the BioPrime Total Genomic Labeling SystemTM (Invitrogen ® , Carlsbad, CA, USA).
- the labeling reaction was carried out according to the manufacturer's manual.
- the differently labeled genomic DNA fragments of matched maternal/placental pairs were combined to a final volume of 80 ⁇ l, supplemented with 50 ⁇ g Cot-1 DNA (Invitrogen ® ), 52 ⁇ l of Agilent 1OX blocking reagent (Agilent Technologies ® , Santa Clara, CA, USA), 78 ⁇ l of deionized formamide, and 260 ⁇ l Agilent 2X hybridization buffer.
- the samples were heated to 95°C for 3 min, mixed, and subsequently incubated at 37°C for 30 min. Hybridization on Agilent CpG Island Microarray KitTM was then carried out at 67°C for 40 hours using an Agilent SureHybTM chamber and an Agilent hybridization oven.
- Genomic DNA sodium bisulfite conversion was performed using EZ-96 DNA Methylation KitTM (ZymoResearch, Orange County, CA). The manufacturer's protocol was followed using lug of genomic DNA and the alternative conversion protocol (a two temperature DNA denaturation).
- Sequenom's MassARRAY ® System was used to perform quantitative methylation analysis. This system utilizes matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry in combination with RNA base specific cleavage (Sequenom ® MassCLEAVETM). A detectable pattern is then analyzed for methylation status. PCR primers were designed using Sequenom ® EpiDESIGNERTM
- Mass spectra were acquired using a MassARRAYTM Compact MALDI-TOF (Sequenom ® , San Diego) and methylation ratios were generated by the EpiTYPERTM software vl.O (Sequenom ® , San Diego).
- Groups that contained less than 4 probes were excluded from the analysis. For groups including four or five probes, all probes were used in a paired t-test. For Groups with six or more probes, a sliding window test consisting of five probes at a time was used, whereby the window was moved by one probe increments. Each test sample was compared to the control sample and the p-values were recorded. Genomic regions were selected as being differentially methylated if eight out of ten samples showed a p value ⁇ 0.01, or if six out of ten samples showed a p value ⁇ 0.001.
- genomic regions were classified as being not differentially methylated when the group showed less than eight samples with a p value ⁇ 0.01 and less than six samples with a p value ⁇ 0.001. Samples that didn't fall in either category were excluded from the analysis. For a subset of genomic regions that have been identified as differentially methylated, the results were confirmed using quantitative methylation analysis.
- the Go analysis was performed using the online GOstat tool (http://gostat.wehi.edu.au/cgibin/-goStat.pl). P values were calculated using Fisher's exact test.
- a standard sample was used, in which the methylated DNA fraction of monocytes was hybridized against itself. This standard provided a reference for the variability of fluorescent measurements in a genomic region. Differentially methylated regions were then identified by comparing the log ratios of each of the ten placental/maternal samples against this standard. Because the goal of this study was to identify markers that allow the reliable separation of maternal and fetal DNA, the target selection was limited to genes that showed a stable, consistent methylation difference over a contiguous stretch of genomic DNA. This focused the analysis on genomic regions where multiple probes indicated differential methylation. The selection was also limited to target regions where all samples showed differential methylation, excluding those with strong inter-individual differences. Two of the samples showed generally lower log ratios in the microarray analysis. Because a paired test was used for target selection, this did not negatively impact the results.
- a GO analysis of the set of differentially methylated genes reveals that this set is significantly enriched for functions important during development.
- Example 2 describes a non-invasive approach for detecting the amount of fetal nucleic acid present in a maternal sample (herein referred to as the "Fetal Quantifier Method"), which may be used to detect or confirm fetal traits (e.g., fetal sex of RhD compatibility), or diagnose chromosomal abnormalities such as Trisomy 21 (both of which are herein referred to as the "Methylation-Based Fetal Diagnostic Method”).
- Figure 10 shows one embodiment of the Fetal Quantifier Method
- Figure 11 shows one embodiment of the Methylation-Based Fetal Diagnostic Method. Both processes use fetal DNA obtained from a maternal sample.
- the sample comprises maternal and fetal nucleic acid that is differentially methylated.
- the sample may be maternal plasma or serum.
- Fetal DNA comprises approximately 2-30% of the total DNA in maternal plasma.
- the actual amount of fetal contribution to the total nucleic acid present in a sample varies from pregnancy to pregnancy and can change based on a number of factors, including, but not limited to, gestational age, the mother's health and the fetus' health.
- the technical challenge posed by analysis of fetal DNA in maternal plasma lies in the need to be able to discriminate the fetal DNA from the co-existing background maternal DNA.
- the methods of the present technology exploit such differences, for example, the differential methylation that is observed between fetal and maternal DNA, as a means to enrich for the relatively small percentage of fetal DNA present in a sample from the mother.
- the non-invasive nature of the approach provides a major advantage over conventional methods of prenatal diagnosis such as, amniocentesis, chronic villus sampling and cordocentesis, which are associated with a small but finite risk of fetal loss.
- the method is not dependent on fetal cells being in any particular cell phase, the method provides a rapid detection means to determine the presence and also the nature of the chromosomal abnormality. Further, the approach is sex-independent (i.e., does not require the presence of a Y-chromosome) and polymorphic- independent (i.e., an allelic ratio is not determined). Thus, the compositions and methods of the technology represent improved universal, noninvasive approaches for accurately determining the amount of fetal nucleic acid present in a maternal sample.
- the present technology takes advantage of the presence of circulating, cell free fetal nucleic acid (ccfDNA) in maternal plasma or serum.
- ccfDNA circulating, cell free fetal nucleic acid
- the methods of the technology should only consume a small portion of the limited available fetal DNA. For example, less than 50%, 40%, 30%, 25%, 20%, 15%, 10%, 5% or less of the sample.
- the approach should preferably be developed in a multiplex assay format in which one or more (preferably all) of the following assays are included: • Assays for the detection of total amount of genomic equivalents present in the sample, i.e., assays recognizing both maternal and fetal DNA species;
- a target-specific, competitor oligonucleotide that is identical, or substantially identical, to the target sequence apart from a distinguishable feature of the competitor, such as a difference in one or more nucleotides relative to the target sequence.
- This oligonucleotide when added into the PCR reaction will be co-amplified with the target and a ratio obtained between these two PCR amplicons will indicate the number of target specific DNA sequences (e.g., fetal DNA from a specific locus) present in the maternal sample.
- the amplicon lengths should preferably be of similar length in order not to skew the amplification towards the shorter fragments. However, as long as the amplification efficiency is about equal, different lengths may be used.
- Differentially methylated targets can be selected from Table 1 or from any other targets known to be differentially methylated between mother and fetus. These targets can be hypomethylated in
- the results obtained from the different assays can be used to quantify one or more of the following: o Total number of amplifiable genomes present in the sample (total amount of genomic equivalents); o The fetal fraction of the amplifiable genomes (fetal concentration or percentage); or o Differences in copy number between fetal ly-derived DNA sequences (for example, between fetal chromosome 21 and a reference chromosome such as chromosome 3). Examples of assays used in the test
- Genomic Amplification- PCR was performed in a total volume of 50 ul by adding PCR reagents (Buffer, dNTPs, primers and polymerase). Exemplary PCR and extend primers are provided below. In addition, synthetic competitor oligonucleotide was added at known concentrations. 4) Replicates (optional) - Following PCR the 50 ul reaction was split into 5 ul parallel reactions
- Post PCR steps include SAP, primer extension (MassEXTEND ® technology), resin treatment, dispensing of spectrochip and MassARRAY. 5) Quantification of the Amplifiable Genomes - Sequenom MassARRAY ® technology was used to determine the amount of amplification product for each assay Following PCR, a single base extension assay was used to interrogate the amplified regions (including the competitor oligonucleotides introduced in step 3). Specific extend primers designed to hybridize directly adjacent to the site of interest were introduced.
- iPLEX ® MassEXTEND ® primers DNA oligonucleotides
- iPLEX ® MassEXTEND ® primers DNA oligonucleotides
- the iPLEX primers were hybridized to the complementary DNA templates and extended with a DNA polymerase Special termination mixtures that contain different combinations of deoxy- and dideoxynucleotide triphosphates along with enzyme and buffer, directed limited extension of the iPLEX primers Primer extension occurs until a complementary dideoxynucleotide is incorporated
- the primer extension products can be simultaneously separated and detected using Matrix Assisted Laser Desorption/lonization, Time-Of-Fl ⁇ ght (MALDI-TOF) mass spectrometry on the MassARRAY ® Analyzer Compact Following this separation and detection, SEQUENOM's proprietary software automatically analyzes the data.
- MALDI-TOF Time-Of-Fl ⁇ ght
- Targets were selected in housekeeping genes not located on the chromosomes 13, 18, 21, X or Y.
- the targets should be in a single copy gene and not contain any recognition sites for the methylation sensitive restriction enzymes
- ApoE Forward Primer 5'-ACGTTGGATG-TTGACAGTTTCTCCTTCCCC (Primer contains a 5' 10 bp MassTag separated by a dash)
- ApoE Reverse Primer 5'-ACGTTGGATG-GAATGTGACCAGCAACGCAG (Primer contains a 5' 10 bp MassTag separated by a dash)
- Targets specific for the Y-chromosome were selected, with no similar or paralog sequences elsewhere in the genome.
- the targets should preferably be in a single copy gene and not contain any recognition sites for the methylation sensitive restriction enzyme(s).
- Underlined sequences are PCR primer sites, and italic nucleotide(s) is the site for the single-base extend primer and bold letter (C) is the nucleotide extended on human DNA.
- SRY synthetic competitor oligonucleotide 5'- GAGTTTTGGATAGTAAAATAAGTTTCGAACTCTGGCACCTTTCAATTTTGTCGCACTTTCCTTGTTTTTGACAATGC AATCATATGCTTC
- Targets were selected in regions known to be differentially methylated between maternal and fetal DNA. Sequences were selected to contain several restriction sites for methylation sensitive enzymes. For this study the Hhal (GCGC) and Hpall (CCGG) enzymes were used.
- PCR primer sites Underlined sequences are PCR primer sites, italic is the site for the single base extend primer and bold letter (C) is the nucleotide extended on human DNA, lower case letter are recognition sites for the methylation sensitive restriction enzymes.
- TBX3 Reverse Primer 5'- ACGTTGGATG-TTAATCACCCAGCGCATGGC (Primer contains a 5' 10 bp MassTag separated by a dash)
- TBX3 Extension Primer 5'- CCCCTCCCGGTGGGTGATAAA [C/T] Primer extends C on human DNA targets and T on synthetic DNA targets. 5' Lower case “a” is a non-complementary nucleotide
- Targets were selected in regions known not to be methylated in any tissue to be investigated. Sequences were selected to contain no more than one site for each restriction enzyme to be used.
- Hhal Reverse Primer 5'- ACGTTGGATG-TCCTGGGTTTTGGGGTGGGAA (Primer contains a 5' 10 bp MassTag separated by a dash)
- Hhal Extension Primer 5'- TTCCAG CTGTG GTTCTCTCTC
- T Assay for Total Amount
- M Assay for Methylation quantification
- Y Y-Chromosome Specific Assay
- D Digestion control
- a model system was developed to simulate DNA samples isolated from plasma. These samples contained a constant number of maternal non-methylated DNA and were spiked with different amounts of male placental methylated DNA. The samples were spiked with amounts ranging from approximately 0 to 25% relative to the maternal non-methylated DNA. The results are shown in Figures 13A and B. The fraction of placental DNA was calculated using the ratios obtained from the methylation assays ( Figure 13A), the SRY markers ( Figure 13B) and the total copy number assays. The primer sequences for the methylation assays (TBX), Y-chromosome assays (SRY) and total copy number (APOE) are provided above. The model system demonstrated that the methylation- based method performed equal to the Y-chromosome method (SRY markers), thus validating the methylation-based method as a sex-independent fetal quantifier.
- Figure 14A The results from the total copy number quantification can be seen in Figures 14A and B.
- Figure 14A the copy number for each sample is shown. Two samples (nos. 25 and 26) have a significantly higher total copy number than all the other samples. In general, a mean of approximately 1300 amplifiable copies/ml plasma was obtained (range 766-2055).
- Figure 14B shows a box-and-whisker plot of the given values, summarizing the results.
- Figures 15A and B the numbers of fetal copies for each sample are plotted. As all samples were from male pregnancies. The copy numbers obtained can be calculated using either the methylation or the Y-chromosome- specific markers. As can be seen in Figure 15B, the box-and-whisker plot of the given values indicated minimal difference between the two different measurements.
- Mass spectra analysis was done using Typer 4 (a Sequenom software product). The peak height (signal over noise) for each individual DNA analyte and competitor assay was determined and exported for further analysis.
- the total number of molecules present for each amplicon was calculated by dividing the DNA specific peak by the competitor specific peak to give a ratio. (The "DNA” Peak in Figures 18 and 19 can be thought of as the analyte peak for a given assay). Since the number of competitor molecules added into the reaction is known, the total number of DNA molecules can be determined by multiplying the ratio by the number of added competitor molecules.
- the fetal DNA fraction (or concentration) in each sample was calculated using the Y-chromosome-specific markers for male pregnancies and the mean of the methylated fraction for all pregnancies.
- the ratio was obtained by dividing the analyte (DNA) peak by the competitor peak and multiplying this ratio by the number of competitor molecules added into the reaction. This value was divided by a similar ratio obtained from the total number of amplifiable genome equivalents determination (using the Assay(s) for Total Amount). See Figure 18. Since the total amount of nucleic acid present in a sample is a sum of maternal and fetal nucleic acid, the fetal contribution can be considered to be a fraction of the larger, background maternal contribution.
- a first simple power calculation was performed that assumes a measurement system that uses 20 markers from chromosome 21, and 20 markers from one or more other autosomes. Starting with 100 copies of fetal DNA, a measurement standard deviation of 25 copies and the probability for a type I error to be lower than 0.001, it was found that the methods of the technology will be able to differentiate a diploid from a triploid chromosome set in 99.5% of all cases.
- the practical implementation of such an approach could for example be achieved using mass spectrometry, a system that uses a competitive PCR approach for absolute copy number measurements.
- the method can run 20 assays in a single reaction and has been shown to have a standard deviation in repeated measurements of around 3 to 5%.
- FIG. 8 shows the effectiveness of MBD-FC protein (a methyl-binding agent) for capturing and thereby separating methylated DNA in the presence of an excess of unmethylated DNA (see Figure 8).
- a second statistical power analysis was performed to assess the predictive power of an embodiment of the Methylation-Based Fetal Diagnostic Method described herein.
- the simulation was designed to demonstrate the likelihood of differentiating a group of trisomic chromosome 21 specific markers from a group of reference markers (for example, autosomes excluding chromosome 21). Many parameters influence the ability to discriminate the two populations of markers reliably. For the present simulation, values were chosen for each parameter that have been shown to be the most likely to occur based on experimentation. The following parameters and respective values were used:
- Average methylation percentage in a target region for fetal DNA 80%
- NCBI Build 36.1 March 2006 human reference sequence
- a or “an” can refer to one of or a plurality of the elements it modifies (e.g., "a reagent” can mean one or more reagents) unless it is contextually clear either one of the elements or more than one of the elements is described.
- the term “about” as used herein refers to a value within 10% of the underlying parameter (i.e., plus or minus 10%), and use of the term “about” at the beginning of a string of values modifies each of the values (i.e., "about 1, 2 and 3” refers to about 1, about 2 and about 3).
- a weight of "about 100 grams” can include weights between 90 grams and 110 grams.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Enzymes And Modification Thereof (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP20187954.1A EP3770255A1 (en) | 2008-09-16 | 2009-09-16 | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
| JP2011527069A JP5727375B2 (ja) | 2008-09-16 | 2009-09-16 | 非侵襲性の出生前診断のために有用な、母体サンプル由来の胎児核酸のメチル化に基づく濃縮のためのプロセスおよび組成物 |
| HK11112460.3A HK1158256B (en) | 2008-09-16 | 2009-09-16 | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses |
| CN2009801458565A CN102216456A (zh) | 2008-09-16 | 2009-09-16 | 基于甲基化富集母体样品中胎儿核酸的非侵入性产前诊断用方法和组合物 |
| EP09815148.3A EP2329021B1 (en) | 2008-09-16 | 2009-09-16 | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses |
| DK09815148.3T DK2329021T3 (en) | 2008-09-16 | 2009-09-16 | Methods and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample suitable for non-invasive prenatal diagnoses |
| AU2009293232A AU2009293232B2 (en) | 2008-09-16 | 2009-09-16 | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses |
| ES09815148.3T ES2599967T3 (es) | 2008-09-16 | 2009-09-16 | Procedimientos y composiciones para el enriquecimiento basado en metilación de ácido nucleico fetal de una muestra materna útiles para diagnósticos prenatales no invasivos |
| EP16173137.7A EP3103871B1 (en) | 2008-09-16 | 2009-09-16 | Processes for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for fetal nucleic acid quantification |
| CA2737200A CA2737200C (en) | 2008-09-16 | 2009-09-16 | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US19226408P | 2008-09-16 | 2008-09-16 | |
| US61/192,264 | 2008-09-16 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2010033639A2 true WO2010033639A2 (en) | 2010-03-25 |
| WO2010033639A9 WO2010033639A9 (en) | 2011-02-17 |
Family
ID=42040120
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2009/057215 Ceased WO2010033639A2 (en) | 2008-09-16 | 2009-09-16 | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses |
Country Status (8)
| Country | Link |
|---|---|
| EP (3) | EP3770255A1 (enExample) |
| JP (7) | JP5727375B2 (enExample) |
| CN (1) | CN102216456A (enExample) |
| AU (1) | AU2009293232B2 (enExample) |
| CA (4) | CA2737200C (enExample) |
| DK (1) | DK2329021T3 (enExample) |
| ES (1) | ES2599967T3 (enExample) |
| WO (1) | WO2010033639A2 (enExample) |
Cited By (96)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2505666A1 (en) * | 2011-04-02 | 2012-10-03 | New England Biolabs, Inc. | Methods and compositions for enriching either target polynucleotides or non-target polynucleotides from a mixture of target and non-target polynucleotides |
| WO2012149339A2 (en) | 2011-04-29 | 2012-11-01 | Sequenom, Inc. | Quantification of a minority nucleic acid species |
| WO2013052913A2 (en) | 2011-10-06 | 2013-04-11 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2013052907A2 (en) | 2011-10-06 | 2013-04-11 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2013055817A1 (en) | 2011-10-11 | 2013-04-18 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2013177086A1 (en) | 2012-05-21 | 2013-11-28 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2013192562A1 (en) | 2012-06-22 | 2013-12-27 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2014011928A1 (en) | 2012-07-13 | 2014-01-16 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
| US8688388B2 (en) | 2011-10-11 | 2014-04-01 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2014055790A2 (en) | 2012-10-04 | 2014-04-10 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2014055774A1 (en) | 2012-10-04 | 2014-04-10 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2014116598A2 (en) | 2013-01-25 | 2014-07-31 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2014164838A1 (en) | 2013-03-12 | 2014-10-09 | Sequenom, Inc. | Quantification of cell-specific nucleic acid markers having a particular methylation state |
| WO2014165596A1 (en) | 2013-04-03 | 2014-10-09 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2014168711A1 (en) | 2013-03-13 | 2014-10-16 | Sequenom, Inc. | Primers for dna methylation analysis |
| US8962247B2 (en) | 2008-09-16 | 2015-02-24 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses |
| WO2015051163A2 (en) | 2013-10-04 | 2015-04-09 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2015054080A1 (en) | 2013-10-07 | 2015-04-16 | Sequenom, Inc. | Methods and processes for non-invasive assessment of chromosome alterations |
| EP2942401A1 (en) | 2014-05-09 | 2015-11-11 | Lifecodexx AG | Detection of DNA that originates from a specific cell-type |
| EP2942400A1 (en) | 2014-05-09 | 2015-11-11 | Lifecodexx AG | Multiplex detection of DNA that originates from a specific cell-type |
| WO2015169947A1 (en) * | 2014-05-09 | 2015-11-12 | Lifecodexx Ag | Detection of dna that originates from a specific cell-type and related methods |
| WO2015183872A1 (en) | 2014-05-30 | 2015-12-03 | Sequenom, Inc. | Chromosome representation determinations |
| US9305756B2 (en) | 2013-03-13 | 2016-04-05 | Agena Bioscience, Inc. | Preparation enhancements and methods of use for MALDI mass spectrometry |
| US9310378B2 (en) | 2008-01-15 | 2016-04-12 | Agena Bioscience, Inc. | Compositions and processes for improved mass spectrometry analysis |
| WO2016057901A1 (en) | 2014-10-10 | 2016-04-14 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP3018213A1 (en) | 2014-11-04 | 2016-05-11 | Genesupport SA | Method for determining the presence of a biological condition by determining total and relative amounts of two different nucleic acids |
| US9605313B2 (en) | 2012-03-02 | 2017-03-28 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2017205826A1 (en) | 2016-05-27 | 2017-11-30 | Sequenom, Inc. | Methods for detecting genetic variations |
| WO2018022906A1 (en) | 2016-07-27 | 2018-02-01 | Sequenom, Inc. | Methods for non-invasive assessment of genomic instability |
| WO2018022890A1 (en) | 2016-07-27 | 2018-02-01 | Sequenom, Inc. | Genetic copy number alteration classifications |
| US9920361B2 (en) | 2012-05-21 | 2018-03-20 | Sequenom, Inc. | Methods and compositions for analyzing nucleic acid |
| US9926593B2 (en) | 2009-12-22 | 2018-03-27 | Sequenom, Inc. | Processes and kits for identifying aneuploidy |
| US9984198B2 (en) | 2011-10-06 | 2018-05-29 | Sequenom, Inc. | Reducing sequence read count error in assessment of complex genetic variations |
| WO2018136881A1 (en) | 2017-01-20 | 2018-07-26 | Sequenom, Inc. | Sequencing adapter manufacture and use |
| WO2018136888A1 (en) | 2017-01-20 | 2018-07-26 | Sequenom, Inc. | Methods for non-invasive assessment of genetic alterations |
| WO2018136882A1 (en) | 2017-01-20 | 2018-07-26 | Sequenom, Inc. | Methods for non-invasive assessment of copy number alterations |
| WO2018140521A1 (en) | 2017-01-24 | 2018-08-02 | Sequenom, Inc. | Methods and processes for assessment of genetic variations |
| WO2018170511A1 (en) | 2017-03-17 | 2018-09-20 | Sequenom, Inc. | Methods and processes for assessment of genetic mosaicism |
| EP3292221A4 (en) * | 2015-05-06 | 2019-01-02 | Seracare Life Sciences Inc. | Liposomal preparations for non-invasive-prenatal or cancer screening |
| US10196681B2 (en) | 2011-10-06 | 2019-02-05 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US10323268B2 (en) | 2011-10-06 | 2019-06-18 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2019140201A1 (en) | 2018-01-12 | 2019-07-18 | Claret Bioscience, Llc | Methods and compositions for analyzing nucleic acid |
| EP3540076A1 (en) | 2013-06-21 | 2019-09-18 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US10424394B2 (en) | 2011-10-06 | 2019-09-24 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US10504613B2 (en) | 2012-12-20 | 2019-12-10 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP3578670A1 (en) | 2013-05-24 | 2019-12-11 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2020092807A1 (en) * | 2018-10-31 | 2020-05-07 | Guardant Health, Inc. | Methods, compositions and systems for calibrating epigenetic partitioning assays |
| US10738358B2 (en) | 2008-09-16 | 2020-08-11 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
| WO2020206143A1 (en) | 2019-04-05 | 2020-10-08 | Claret Bioscience, Llc | Methods and compositions for analyzing nucleic acid |
| WO2020264051A1 (en) * | 2019-06-24 | 2020-12-30 | ChromaCode, Inc. | Methods for differentially quantifying nucleic acids |
| EP3760739A1 (en) | 2014-07-30 | 2021-01-06 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2021072037A1 (en) | 2019-10-09 | 2021-04-15 | Claret Bioscience, Llc | Methods and compositions for analyzing nucleic acid |
| WO2021087491A1 (en) | 2019-10-31 | 2021-05-06 | Sequenom, Inc. | Application of mosaicism ratio in multifetal gestations and personalized risk assessment |
| US11004537B2 (en) | 2011-06-24 | 2021-05-11 | Sequenom, Inc. | Methods and processes for non invasive assessment of a genetic variation |
| US20210198733A1 (en) | 2018-07-03 | 2021-07-01 | Natera, Inc. | Methods for detection of donor-derived cell-free dna |
| US11111543B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US11111545B2 (en) | 2010-05-18 | 2021-09-07 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11111544B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| WO2021262805A1 (en) | 2020-06-24 | 2021-12-30 | Claret Bioscience, Llc | Methods and compositions for analyzing nucleic acid |
| US11286530B2 (en) | 2010-05-18 | 2022-03-29 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11299780B2 (en) | 2016-07-15 | 2022-04-12 | The Regents Of The University Of California | Methods of producing nucleic acid libraries |
| WO2022076574A1 (en) | 2020-10-08 | 2022-04-14 | Claret Bioscience, Llc | Methods and compositions for analyzing nucleic acid |
| US11306359B2 (en) | 2005-11-26 | 2022-04-19 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
| US11306357B2 (en) | 2010-05-18 | 2022-04-19 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11319596B2 (en) | 2014-04-21 | 2022-05-03 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US11322224B2 (en) | 2010-05-18 | 2022-05-03 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11326208B2 (en) | 2010-05-18 | 2022-05-10 | Natera, Inc. | Methods for nested PCR amplification of cell-free DNA |
| US11332793B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11332785B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11339429B2 (en) | 2010-05-18 | 2022-05-24 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11365447B2 (en) | 2014-03-13 | 2022-06-21 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US11390916B2 (en) | 2014-04-21 | 2022-07-19 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11408031B2 (en) | 2010-05-18 | 2022-08-09 | Natera, Inc. | Methods for non-invasive prenatal paternity testing |
| EP3973081A4 (en) * | 2019-05-23 | 2022-09-07 | American Molecular Laboratories, Inc. | METHODS FOR DETECTING RARE DNA SEQUENCES IN FECAL SAMPLES |
| US11479812B2 (en) | 2015-05-11 | 2022-10-25 | Natera, Inc. | Methods and compositions for determining ploidy |
| US11485996B2 (en) | 2016-10-04 | 2022-11-01 | Natera, Inc. | Methods for characterizing copy number variation using proximity-litigation sequencing |
| US11519028B2 (en) | 2016-12-07 | 2022-12-06 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
| US11629345B2 (en) | 2018-06-06 | 2023-04-18 | The Regents Of The University Of California | Methods of producing nucleic acid libraries and compositions and kits for practicing same |
| US11697849B2 (en) | 2012-01-20 | 2023-07-11 | Sequenom, Inc. | Methods for non-invasive assessment of fetal genetic variations that factor experimental conditions |
| US11753684B2 (en) | 2015-11-10 | 2023-09-12 | Eurofins Lifecodexx Gmbh | Detection of fetal chromosomal aneuploidies using DNA regions that are differentially methylated between the fetus and the pregnant female |
| US11939634B2 (en) | 2010-05-18 | 2024-03-26 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US12020778B2 (en) | 2010-05-18 | 2024-06-25 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US12024738B2 (en) | 2018-04-14 | 2024-07-02 | Natera, Inc. | Methods for cancer detection and monitoring |
| US12084720B2 (en) | 2017-12-14 | 2024-09-10 | Natera, Inc. | Assessing graft suitability for transplantation |
| WO2024186778A1 (en) | 2023-03-03 | 2024-09-12 | Laboratory Corporation Of America Holdings | Methods and systems for positive cfdna screening on genetic variations using mosaicism ratio |
| US12100478B2 (en) | 2012-08-17 | 2024-09-24 | Natera, Inc. | Method for non-invasive prenatal testing using parental mosaicism data |
| US12146195B2 (en) | 2016-04-15 | 2024-11-19 | Natera, Inc. | Methods for lung cancer detection |
| WO2024238593A1 (en) | 2023-05-15 | 2024-11-21 | Laboratory Corporation Of America Holdings | Machine-learning approaches to pan-cancer screening in whole genome sequencing |
| US12152275B2 (en) | 2010-05-18 | 2024-11-26 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US12221653B2 (en) | 2010-05-18 | 2025-02-11 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US12260934B2 (en) | 2014-06-05 | 2025-03-25 | Natera, Inc. | Systems and methods for detection of aneuploidy |
| US12305235B2 (en) | 2019-06-06 | 2025-05-20 | Natera, Inc. | Methods for detecting immune cell DNA and monitoring immune system |
| US12460264B2 (en) | 2016-11-02 | 2025-11-04 | Natera, Inc. | Method of detecting tumour recurrence |
| US12492429B2 (en) | 2014-04-21 | 2025-12-09 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US12545960B2 (en) | 2010-05-18 | 2026-02-10 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US12553083B2 (en) | 2010-05-18 | 2026-02-17 | Natera, Inc. | Methods for enriching and sequencing nucleic acids for non-invasive cancer testing |
Families Citing this family (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9428746B2 (en) | 2007-10-31 | 2016-08-30 | Akonni Biosystems, Inc. | Method and kit for purifying nucleic acids |
| CA2737200C (en) * | 2008-09-16 | 2020-03-31 | Sequenom Center For Molecular Medicine | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
| CN108103057B (zh) * | 2012-08-28 | 2021-09-03 | 阿科尼生物系统公司 | 用于纯化核酸的方法和试剂盒 |
| CN112037860B (zh) * | 2013-06-13 | 2024-02-23 | 豪夫迈·罗氏有限公司 | 用于非入侵性性染色体非整倍性确定的统计分析 |
| JP6643815B2 (ja) * | 2015-05-15 | 2020-02-12 | 森永乳業株式会社 | 腸内状態の判定方法、および腸内状態の判定装置 |
| WO2017082034A1 (ja) * | 2015-11-10 | 2017-05-18 | 富士フイルム株式会社 | 細胞間または細胞群間の同一人かどうか、他人かどうか、親子かどうか、または血縁関係かどうかの判定方法 |
| CN110734907A (zh) * | 2019-09-17 | 2020-01-31 | 上海凌恩生物科技有限公司 | 一种叶绿体dna的富集方法 |
| EP4158059A1 (en) * | 2020-05-28 | 2023-04-05 | Illumina, Inc. | Comparing copies of polynucleotides with different features |
| WO2021263111A1 (en) * | 2020-06-25 | 2021-12-30 | 10X Genomics, Inc. | Spatial analysis of dna methylation |
| CN111755072B (zh) * | 2020-08-04 | 2021-02-02 | 深圳吉因加医学检验实验室 | 一种同时检测甲基化水平、基因组变异和插入片段的方法及装置 |
| CA3202240A1 (en) * | 2020-11-19 | 2022-05-27 | Nucleix Ltd. | Detecting methylation changes in dna samples using restriction enzymes and high throughput sequencing |
| EP4277528B1 (en) | 2021-01-12 | 2024-11-20 | Ricoh Company, Ltd. | Diagnostic support apparatus, diagnostic support method, and diagnostic support program |
| CN116246704B (zh) * | 2023-05-10 | 2023-08-15 | 广州精科生物技术有限公司 | 用于胎儿无创产前检测的系统 |
| WO2025113619A1 (en) * | 2023-11-29 | 2025-06-05 | Centre For Novostics | Enrichment of clinically-relevant nucleic acids |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5786146A (en) | 1996-06-03 | 1998-07-28 | The Johns Hopkins University School Of Medicine | Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids |
| WO2005012578A1 (en) | 2003-07-31 | 2005-02-10 | Sequenom, Inc. | Methods for high level multiplexed polymerase chain reactions and homogeneous mass extension reactions for genotyping of polymorphisms |
Family Cites Families (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US2187108A (en) | 1938-05-27 | 1940-01-16 | Du Pont | Process of purifying lead nitrate solutions |
| CA2153387A1 (en) | 1993-01-07 | 1994-07-21 | Hubert Koester | Dna sequencing by mass spectrometry |
| US5605798A (en) | 1993-01-07 | 1997-02-25 | Sequenom, Inc. | DNA diagnostic based on mass spectrometry |
| WO1997037041A2 (en) | 1996-03-18 | 1997-10-09 | Sequenom, Inc. | Dna sequencing by mass spectrometry |
| GB9704444D0 (en) | 1997-03-04 | 1997-04-23 | Isis Innovation | Non-invasive prenatal diagnosis |
| US6143496A (en) | 1997-04-17 | 2000-11-07 | Cytonix Corporation | Method of sampling, amplifying and quantifying segment of nucleic acid, polymerase chain reaction assembly having nanoliter-sized sample chambers, and method of filling assembly |
| NO986133D0 (no) | 1998-12-23 | 1998-12-23 | Preben Lexow | FremgangsmÕte for DNA-sekvensering |
| NZ533466A (en) | 1999-06-28 | 2005-10-28 | California Inst Of Techn | Microfabricated elastomeric valve and pump systems |
| US6440706B1 (en) | 1999-08-02 | 2002-08-27 | Johns Hopkins University | Digital amplification |
| US6927028B2 (en) | 2001-08-31 | 2005-08-09 | Chinese University Of Hong Kong | Non-invasive methods for detecting non-host DNA in a host using epigenetic differences between the host and non-host DNA |
| JP2005514956A (ja) * | 2002-01-18 | 2005-05-26 | ジェンザイム・コーポレーション | 胎児dnaの検出および対立遺伝子の定量化のための方法 |
| CN1703521B (zh) | 2002-09-06 | 2011-11-16 | 波士顿大学信托人 | 基因表达的定量 |
| WO2004078999A1 (en) * | 2003-03-05 | 2004-09-16 | Genetic Technologies Limited | Identification of fetal dna and fetal cell markers in maternal plasma or serum |
| CA2531105C (en) | 2003-07-05 | 2015-03-17 | The Johns Hopkins University | Method and compositions for detection and enumeration of genetic variations |
| EP1664077B1 (en) | 2003-09-05 | 2016-04-13 | Trustees of Boston University | Method for non-invasive prenatal diagnosis |
| EP1689884A4 (en) * | 2003-10-08 | 2007-04-04 | Univ Boston | PROCESS FOR THE PRENATAL DIAGNOSIS OF CHROMOSOMAL ABNORMALITIES |
| DE60328193D1 (de) | 2003-10-16 | 2009-08-13 | Sequenom Inc | Nicht invasiver Nachweis fötaler genetischer Merkmale |
| WO2006056480A2 (en) | 2004-11-29 | 2006-06-01 | Klinikum Der Universität Regensburg | Means and methods for detecting methylated dna |
| US7645576B2 (en) | 2005-03-18 | 2010-01-12 | The Chinese University Of Hong Kong | Method for the detection of chromosomal aneuploidies |
| HUE030215T2 (en) | 2006-02-02 | 2017-04-28 | Univ Leland Stanford Junior | Non-invasive fetal genetic screening by digital analysis |
| US7754428B2 (en) * | 2006-05-03 | 2010-07-13 | The Chinese University Of Hong Kong | Fetal methylation markers |
| US7901884B2 (en) * | 2006-05-03 | 2011-03-08 | The Chinese University Of Hong Kong | Markers for prenatal diagnosis and monitoring |
| EP3260556B1 (en) | 2006-05-31 | 2019-07-31 | Sequenom, Inc. | Methods for the extraction of nucleic acid from a sample |
| US20080026390A1 (en) * | 2006-06-14 | 2008-01-31 | Roland Stoughton | Diagnosis of Fetal Abnormalities by Comparative Genomic Hybridization Analysis |
| WO2008157264A2 (en) | 2007-06-15 | 2008-12-24 | Sequenom, Inc. | Combined methods for the detection of chromosomal aneuploidy |
| US9404150B2 (en) | 2007-08-29 | 2016-08-02 | Sequenom, Inc. | Methods and compositions for universal size-specific PCR |
| US8476013B2 (en) * | 2008-09-16 | 2013-07-02 | Sequenom, Inc. | Processes and compositions for methylation-based acid enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
| CA2737200C (en) * | 2008-09-16 | 2020-03-31 | Sequenom Center For Molecular Medicine | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
| JP6447765B1 (ja) * | 2017-11-21 | 2019-01-09 | 株式会社リコー | 検査デバイス及びデバイス |
-
2009
- 2009-09-16 CA CA2737200A patent/CA2737200C/en active Active
- 2009-09-16 JP JP2011527069A patent/JP5727375B2/ja not_active Expired - Fee Related
- 2009-09-16 EP EP20187954.1A patent/EP3770255A1/en not_active Withdrawn
- 2009-09-16 CN CN2009801458565A patent/CN102216456A/zh active Pending
- 2009-09-16 AU AU2009293232A patent/AU2009293232B2/en not_active Ceased
- 2009-09-16 WO PCT/US2009/057215 patent/WO2010033639A2/en not_active Ceased
- 2009-09-16 CA CA3209502A patent/CA3209502A1/en active Pending
- 2009-09-16 CA CA3209378A patent/CA3209378A1/en active Pending
- 2009-09-16 EP EP09815148.3A patent/EP2329021B1/en active Active
- 2009-09-16 ES ES09815148.3T patent/ES2599967T3/es active Active
- 2009-09-16 DK DK09815148.3T patent/DK2329021T3/en active
- 2009-09-16 EP EP16173137.7A patent/EP3103871B1/en active Active
- 2009-09-16 CA CA3073079A patent/CA3073079C/en active Active
-
2014
- 2014-09-05 JP JP2014180865A patent/JP5923571B2/ja not_active Expired - Fee Related
-
2015
- 2015-04-02 JP JP2015076001A patent/JP2015126748A/ja not_active Withdrawn
-
2018
- 2018-02-02 JP JP2018017349A patent/JP2018064595A/ja not_active Withdrawn
- 2018-02-02 JP JP2018017348A patent/JP6634105B2/ja not_active Expired - Fee Related
-
2020
- 2020-10-16 JP JP2020174625A patent/JP2021003138A/ja not_active Withdrawn
-
2023
- 2023-06-30 JP JP2023108402A patent/JP2023115354A/ja active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5786146A (en) | 1996-06-03 | 1998-07-28 | The Johns Hopkins University School Of Medicine | Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids |
| WO2005012578A1 (en) | 2003-07-31 | 2005-02-10 | Sequenom, Inc. | Methods for high level multiplexed polymerase chain reactions and homogeneous mass extension reactions for genotyping of polymorphisms |
| US20050079521A1 (en) | 2003-07-31 | 2005-04-14 | Martin Beaulieu | Methods for high level multiplexed polymerase chain reactions and homogeneous mass extension reactions |
Non-Patent Citations (29)
| Title |
|---|
| "Current Protocols in Molecular Biology", 1994 |
| BATZER ET AL., NUCLEIC ACID RES., vol. 19, 1991, pages 5081 |
| BEAUCAGE; CARUTHERS, TETRAHEDRON LETT., vol. 22, 1981, pages 1859 - 1862 |
| COLELLA ET AL., BIOTECHNIQUES, vol. 35, no. 1, July 2003 (2003-07-01), pages 146 - 50 |
| DUPONT JM; TOST J; JAMMES H; GUT IG., ANAL BIOCHEM, vol. 333, no. 1, October 2004 (2004-10-01), pages 119 - 27 |
| EADS ET AL., CANCER RES., 1999, pages 2302 - 2306 |
| EHRICH M ET AL.: "Cytosine methylation profiling of cancer cell lines", PROC NATL ACAD SCI U S A, vol. 105, 2008, pages 4844 - 48 |
| EHRICH M ET AL.: "Quantitative high-throughput analysis of DNA methylation patterns by base specific cleavage and mass spectrometry", PROC NATL ACAD SCI USA, vol. 102, 2005, pages 15785 - 15790, XP055083781, DOI: doi:10.1073/pnas.0507816102 |
| EHRICH M; NELSON MR; STANSSENS P; ZABEAU M; LILOGLOU T; XINARIANOS G; CANTOR CR; FIELD JK; VAN DEN BOOM D: "Quantitative high-throughput analysis of DNA methylation patterns by base specific cleavage and mass spectrometry", PROC NATL ACAD SCI U S A, vol. 102, 2005, pages 15785 - 15790, XP055083781, DOI: doi:10.1073/pnas.0507816102 |
| FROMMER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 1827 - 1831 |
| GONZALGO; JONES, NUCLEIC ACIDS RES., vol. 25, 1997, pages 2529 - 2531 |
| HERMAN ET AL., PROC. NAT. ACAD. SCI. USA, vol. 93, 1996, pages 9821 - 9826 |
| KRIEGLER: "Gene Transfer and Expression: A Laboratory Manual", 1990 |
| LAIRD, P.W., NATURE REVIEWS CANCER, vol. 3, 2003, pages 253 - 266 |
| LEE TI ET AL.: "Control of developmental regulators by Polycomb in human embryonic stem cells", CELL, vol. 125, 2006, pages 301 - 313, XP055221189, DOI: doi:10.1016/j.cell.2006.02.043 |
| LO ET AL., LANCET, vol. 350, 1997, pages 485 - 487 |
| OHTSUKA ET AL., J. BIOL. CHEM., vol. 260, 1985, pages 2605 - 2608 |
| PEARSON; REANIER, J. CHROM., vol. 255, 1983, pages 137 - 149 |
| ROSSOLINI ET AL., MOL. CELL. PROBES, vol. 8, 1994, pages 91 - 98 |
| SADRI; HORNSBY, NUCL. ACIDS RES., vol. 24, 1996, pages 5058 - 5059 |
| SAMBROOK ET AL.: "Molecular Biology: A laboratory Approach", 1989, COLD SPRING HARBOR |
| SAMBROOK; RUSSELL: "Molecular Cloning, A Laboratory Manual", 2001 |
| TAKAI ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 99, 2002, pages 3740 - 3745 |
| TOOKE N; PETTERSSON M., IVDT, November 2004 (2004-11-01), pages 41 |
| TOYOTA ET AL., CANCER RES., vol. 59, 1999, pages 2307 - 12 |
| UHLMANN, K. ET AL., ELECTROPHORESIS, vol. 23, 2002, pages 4072 - 4079 |
| VAN DEVANTER, NUCLEIC ACIDS RES., vol. 12, 1984, pages 6159 - 6168 |
| XIONG; LAIRD, NUCLEIC ACIDS RES., vol. 25, 1997, pages 2532 - 2534 |
| YAMADA ET AL., GENOME RESEARCH, vol. 14, 2004, pages 247 - 266 |
Cited By (203)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11111544B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US11111543B2 (en) | 2005-07-29 | 2021-09-07 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US12571047B2 (en) | 2005-07-29 | 2026-03-10 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US12509728B2 (en) | 2005-07-29 | 2025-12-30 | Natera, Inc. | System and method for cleaning noisy genetic data and determining chromosome copy number |
| US11306359B2 (en) | 2005-11-26 | 2022-04-19 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
| US12571043B2 (en) | 2005-11-26 | 2026-03-10 | Natera, Inc. | System and method for cleaning noisy genetic data from target individuals using genetic data from genetically related individuals |
| US9873912B2 (en) | 2008-01-15 | 2018-01-23 | Agena Bioscience, Inc. | Compositions and processes for improved mass spectrometry analysis |
| US9310378B2 (en) | 2008-01-15 | 2016-04-12 | Agena Bioscience, Inc. | Compositions and processes for improved mass spectrometry analysis |
| US12077819B2 (en) | 2008-01-15 | 2024-09-03 | Agena Bioscience, Inc. | Compositions and processes for improved mass spectrometry analysis |
| US10329612B2 (en) | 2008-01-15 | 2019-06-25 | Agena Bioscience, Inc. | Compositions and processes for improved mass spectrometry analysis |
| US10612086B2 (en) | 2008-09-16 | 2020-04-07 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
| US8962247B2 (en) | 2008-09-16 | 2015-02-24 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses |
| US10738358B2 (en) | 2008-09-16 | 2020-08-11 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
| US9926593B2 (en) | 2009-12-22 | 2018-03-27 | Sequenom, Inc. | Processes and kits for identifying aneuploidy |
| US11180799B2 (en) | 2009-12-22 | 2021-11-23 | Sequenom, Inc. | Processes and kits for identifying aneuploidy |
| US12509730B2 (en) | 2010-05-18 | 2025-12-30 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US12494267B2 (en) | 2010-05-18 | 2025-12-09 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11332793B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11326208B2 (en) | 2010-05-18 | 2022-05-10 | Natera, Inc. | Methods for nested PCR amplification of cell-free DNA |
| US12553083B2 (en) | 2010-05-18 | 2026-02-17 | Natera, Inc. | Methods for enriching and sequencing nucleic acids for non-invasive cancer testing |
| US12553086B2 (en) | 2010-05-18 | 2026-02-17 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US12545960B2 (en) | 2010-05-18 | 2026-02-10 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11322224B2 (en) | 2010-05-18 | 2022-05-03 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11332785B2 (en) | 2010-05-18 | 2022-05-17 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11339429B2 (en) | 2010-05-18 | 2022-05-24 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11312996B2 (en) | 2010-05-18 | 2022-04-26 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11306357B2 (en) | 2010-05-18 | 2022-04-19 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11939634B2 (en) | 2010-05-18 | 2024-03-26 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11408031B2 (en) | 2010-05-18 | 2022-08-09 | Natera, Inc. | Methods for non-invasive prenatal paternity testing |
| US11286530B2 (en) | 2010-05-18 | 2022-03-29 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US12020778B2 (en) | 2010-05-18 | 2024-06-25 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11482300B2 (en) | 2010-05-18 | 2022-10-25 | Natera, Inc. | Methods for preparing a DNA fraction from a biological sample for analyzing genotypes of cell-free DNA |
| US12410476B2 (en) | 2010-05-18 | 2025-09-09 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US12110552B2 (en) | 2010-05-18 | 2024-10-08 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US12152275B2 (en) | 2010-05-18 | 2024-11-26 | Natera, Inc. | Methods for non-invasive prenatal ploidy calling |
| US11111545B2 (en) | 2010-05-18 | 2021-09-07 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11519035B2 (en) | 2010-05-18 | 2022-12-06 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11525162B2 (en) | 2010-05-18 | 2022-12-13 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US12221653B2 (en) | 2010-05-18 | 2025-02-11 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11746376B2 (en) | 2010-05-18 | 2023-09-05 | Natera, Inc. | Methods for amplification of cell-free DNA using ligated adaptors and universal and inner target-specific primers for multiplexed nested PCR |
| US12270073B2 (en) | 2010-05-18 | 2025-04-08 | Natera, Inc. | Methods for preparing a biological sample obtained from an individual for use in a genetic testing assay |
| EP2505666A1 (en) * | 2011-04-02 | 2012-10-03 | New England Biolabs, Inc. | Methods and compositions for enriching either target polynucleotides or non-target polynucleotides from a mixture of target and non-target polynucleotides |
| CN102732506A (zh) * | 2011-04-02 | 2012-10-17 | 新英格兰生物实验室公司 | 自目标多核苷酸和非目标多核苷酸的混合物富集目标多核苷酸或非目标多核苷酸的方法和组合物 |
| WO2012149339A2 (en) | 2011-04-29 | 2012-11-01 | Sequenom, Inc. | Quantification of a minority nucleic acid species |
| EP3378954A1 (en) | 2011-04-29 | 2018-09-26 | Sequenom, Inc. | Quantification of a minority nucleic acid species |
| US11004537B2 (en) | 2011-06-24 | 2021-05-11 | Sequenom, Inc. | Methods and processes for non invasive assessment of a genetic variation |
| US12400736B2 (en) | 2011-06-24 | 2025-08-26 | Sequenom, Inc. | Methods and processes for non-invasive estimation of fetal fraction |
| US9984198B2 (en) | 2011-10-06 | 2018-05-29 | Sequenom, Inc. | Reducing sequence read count error in assessment of complex genetic variations |
| US10424394B2 (en) | 2011-10-06 | 2019-09-24 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US12534758B2 (en) | 2011-10-06 | 2026-01-27 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US11560586B2 (en) | 2011-10-06 | 2023-01-24 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US11437121B2 (en) | 2011-10-06 | 2022-09-06 | Sequenom, Inc. | Methods and processes for non-invasive detection of a microduplication or a microdeletion with reduced sequence read count error |
| US10323268B2 (en) | 2011-10-06 | 2019-06-18 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP3922731A2 (en) | 2011-10-06 | 2021-12-15 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2013052907A2 (en) | 2011-10-06 | 2013-04-11 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2013052913A2 (en) | 2011-10-06 | 2013-04-11 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US11001884B2 (en) | 2011-10-06 | 2021-05-11 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US10196681B2 (en) | 2011-10-06 | 2019-02-05 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US11492659B2 (en) | 2011-10-06 | 2022-11-08 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2013055817A1 (en) | 2011-10-11 | 2013-04-18 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US8688388B2 (en) | 2011-10-11 | 2014-04-01 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP3243908A1 (en) | 2011-10-11 | 2017-11-15 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US11697849B2 (en) | 2012-01-20 | 2023-07-11 | Sequenom, Inc. | Methods for non-invasive assessment of fetal genetic variations that factor experimental conditions |
| US11312997B2 (en) | 2012-03-02 | 2022-04-26 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP3757210A1 (en) | 2012-03-02 | 2020-12-30 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US9605313B2 (en) | 2012-03-02 | 2017-03-28 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP4155401A1 (en) | 2012-03-02 | 2023-03-29 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US10738359B2 (en) | 2012-03-02 | 2020-08-11 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP3401399A1 (en) | 2012-03-02 | 2018-11-14 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP3978621A1 (en) | 2012-05-21 | 2022-04-06 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2013177086A1 (en) | 2012-05-21 | 2013-11-28 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP4276194A2 (en) | 2012-05-21 | 2023-11-15 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP3663409A1 (en) | 2012-05-21 | 2020-06-10 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US11306354B2 (en) | 2012-05-21 | 2022-04-19 | Sequenom, Inc. | Methods and compositions for analyzing nucleic acid |
| US9920361B2 (en) | 2012-05-21 | 2018-03-20 | Sequenom, Inc. | Methods and compositions for analyzing nucleic acid |
| US10497461B2 (en) | 2012-06-22 | 2019-12-03 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2013192562A1 (en) | 2012-06-22 | 2013-12-27 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP4682267A2 (en) | 2012-06-22 | 2026-01-21 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP4137579A1 (en) | 2012-06-22 | 2023-02-22 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP3473731A1 (en) | 2012-06-22 | 2019-04-24 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2014011928A1 (en) | 2012-07-13 | 2014-01-16 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
| US11332791B2 (en) | 2012-07-13 | 2022-05-17 | Sequenom, Inc. | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses |
| US12100478B2 (en) | 2012-08-17 | 2024-09-24 | Natera, Inc. | Method for non-invasive prenatal testing using parental mosaicism data |
| EP3591067A1 (en) | 2012-10-04 | 2020-01-08 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2014055790A2 (en) | 2012-10-04 | 2014-04-10 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US12112832B2 (en) | 2012-10-04 | 2024-10-08 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2014055774A1 (en) | 2012-10-04 | 2014-04-10 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US10482994B2 (en) | 2012-10-04 | 2019-11-19 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP4009329A1 (en) | 2012-10-04 | 2022-06-08 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US12176067B2 (en) | 2012-12-20 | 2024-12-24 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US10504613B2 (en) | 2012-12-20 | 2019-12-10 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US12437838B2 (en) | 2013-01-25 | 2025-10-07 | Sequenom, Inc. | Methods and processes for non-invasive analysis of cell-free fetal nucleic acid according to sequence read quantifications for chromosomes 13, 18, and 21 |
| EP4261828A2 (en) | 2013-01-25 | 2023-10-18 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2014116598A2 (en) | 2013-01-25 | 2014-07-31 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US10497462B2 (en) | 2013-01-25 | 2019-12-03 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2014164838A1 (en) | 2013-03-12 | 2014-10-09 | Sequenom, Inc. | Quantification of cell-specific nucleic acid markers having a particular methylation state |
| WO2014168711A1 (en) | 2013-03-13 | 2014-10-16 | Sequenom, Inc. | Primers for dna methylation analysis |
| US10204771B2 (en) | 2013-03-13 | 2019-02-12 | Agena Bioscience, Inc. | Preparation enhancements and methods of use for MALDI mass spectrometry |
| EP3597774A1 (en) | 2013-03-13 | 2020-01-22 | Sequenom, Inc. | Primers for dna methylation analysis |
| US9305756B2 (en) | 2013-03-13 | 2016-04-05 | Agena Bioscience, Inc. | Preparation enhancements and methods of use for MALDI mass spectrometry |
| US11060145B2 (en) | 2013-03-13 | 2021-07-13 | Sequenom, Inc. | Methods and compositions for identifying presence or absence of hypermethylation or hypomethylation locus |
| US10930368B2 (en) | 2013-04-03 | 2021-02-23 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2014165596A1 (en) | 2013-04-03 | 2014-10-09 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP4187543A1 (en) | 2013-04-03 | 2023-05-31 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US11462298B2 (en) | 2013-05-24 | 2022-10-04 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP3578670A1 (en) | 2013-05-24 | 2019-12-11 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US10699800B2 (en) | 2013-05-24 | 2020-06-30 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP4604127A2 (en) | 2013-05-24 | 2025-08-20 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP3540076A1 (en) | 2013-06-21 | 2019-09-18 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP4574993A2 (en) | 2013-06-21 | 2025-06-25 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US10622094B2 (en) | 2013-06-21 | 2020-04-14 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP4258269A2 (en) | 2013-10-04 | 2023-10-11 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2015051163A2 (en) | 2013-10-04 | 2015-04-09 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US10964409B2 (en) | 2013-10-04 | 2021-03-30 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US12198786B2 (en) | 2013-10-04 | 2025-01-14 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2015054080A1 (en) | 2013-10-07 | 2015-04-16 | Sequenom, Inc. | Methods and processes for non-invasive assessment of chromosome alterations |
| EP4738371A2 (en) | 2013-10-07 | 2026-05-06 | Sequenom, Inc. | Methods and processes for non-invasive assessment of chromosome alterations |
| US11929146B2 (en) | 2013-10-07 | 2024-03-12 | Sequenom, Inc. | Systems for non-invasive assessment of chromosome alterations using changes in subsequence mappability |
| EP3851539A1 (en) | 2013-10-07 | 2021-07-21 | Sequenom, Inc. | Methods and processes for non-invasive assessment of chromosome alterations |
| EP3495496A1 (en) | 2013-10-07 | 2019-06-12 | Sequenom, Inc. | Methods and processes for non-invasive assessment of chromosome alterations |
| US11365447B2 (en) | 2014-03-13 | 2022-06-21 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US12410475B2 (en) | 2014-03-13 | 2025-09-09 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US11414709B2 (en) | 2014-04-21 | 2022-08-16 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US11319595B2 (en) | 2014-04-21 | 2022-05-03 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US12486542B2 (en) | 2014-04-21 | 2025-12-02 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US12492429B2 (en) | 2014-04-21 | 2025-12-09 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US11319596B2 (en) | 2014-04-21 | 2022-05-03 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US11371100B2 (en) | 2014-04-21 | 2022-06-28 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US12203142B2 (en) | 2014-04-21 | 2025-01-21 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US11486008B2 (en) | 2014-04-21 | 2022-11-01 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US11390916B2 (en) | 2014-04-21 | 2022-07-19 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11530454B2 (en) | 2014-04-21 | 2022-12-20 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| US12305229B2 (en) | 2014-04-21 | 2025-05-20 | Natera, Inc. | Methods for simultaneous amplification of target loci |
| US11408037B2 (en) | 2014-04-21 | 2022-08-09 | Natera, Inc. | Detecting mutations and ploidy in chromosomal segments |
| EP2942400A1 (en) | 2014-05-09 | 2015-11-11 | Lifecodexx AG | Multiplex detection of DNA that originates from a specific cell-type |
| US11965207B2 (en) | 2014-05-09 | 2024-04-23 | Eurofins Lifecodexx Gmbh | Detection of DNA that originates from a specific cell-type and related methods |
| US9822413B2 (en) | 2014-05-09 | 2017-11-21 | Lifecodexx Ag | Multiplex detection of DNA that originates from a specific cell-type |
| EP3521454A1 (en) | 2014-05-09 | 2019-08-07 | LifeCodexx AG | Detection of dna that originates from a specific cell-type and related methods |
| US10017818B2 (en) | 2014-05-09 | 2018-07-10 | Lifecodexx Ag | Multiplex detection of DNA that originates from a specific cell-type |
| WO2015169947A1 (en) * | 2014-05-09 | 2015-11-12 | Lifecodexx Ag | Detection of dna that originates from a specific cell-type and related methods |
| US10801067B2 (en) | 2014-05-09 | 2020-10-13 | Eurofins Lifecodexx Gmbh | Detection of DNA that originates from a specific cell-type and related methods |
| US9822412B2 (en) | 2014-05-09 | 2017-11-21 | Lifecodexx Ag | Detection of DNA that originates from a specific cell-type |
| EP2942401A1 (en) | 2014-05-09 | 2015-11-11 | Lifecodexx AG | Detection of DNA that originates from a specific cell-type |
| WO2015183872A1 (en) | 2014-05-30 | 2015-12-03 | Sequenom, Inc. | Chromosome representation determinations |
| EP3598452A1 (en) | 2014-05-30 | 2020-01-22 | Sequenom, Inc. | Chromosome representation determinations |
| US12260934B2 (en) | 2014-06-05 | 2025-03-25 | Natera, Inc. | Systems and methods for detection of aneuploidy |
| EP3760739A1 (en) | 2014-07-30 | 2021-01-06 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| US11783911B2 (en) | 2014-07-30 | 2023-10-10 | Sequenom, Inc | Methods and processes for non-invasive assessment of genetic variations |
| EP3730629A1 (en) | 2014-10-10 | 2020-10-28 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| WO2016057901A1 (en) | 2014-10-10 | 2016-04-14 | Sequenom, Inc. | Methods and processes for non-invasive assessment of genetic variations |
| EP3018213A1 (en) | 2014-11-04 | 2016-05-11 | Genesupport SA | Method for determining the presence of a biological condition by determining total and relative amounts of two different nucleic acids |
| WO2016071369A1 (en) | 2014-11-04 | 2016-05-12 | Genesupport Sa | Method for determining the presence of a biological condition by determining total and relative amounts of two different nucleic acids |
| IL255346B2 (en) * | 2015-05-06 | 2023-06-01 | Seracare Life Sciences Inc | Liposomal preparations for non-invasive prenatal or cancer screening |
| AU2016258171B2 (en) * | 2015-05-06 | 2021-12-09 | LGC Clinical Diagnostics, Inc. | Liposomal preparations for non-invasive-prenatal or cancer screening |
| US11243212B2 (en) | 2015-05-06 | 2022-02-08 | Seracare Life Sciences, Inc. | Liposomal preparations for non-invasive-prenatal or cancer screening |
| EP3292221A4 (en) * | 2015-05-06 | 2019-01-02 | Seracare Life Sciences Inc. | Liposomal preparations for non-invasive-prenatal or cancer screening |
| US11479812B2 (en) | 2015-05-11 | 2022-10-25 | Natera, Inc. | Methods and compositions for determining ploidy |
| US11946101B2 (en) | 2015-05-11 | 2024-04-02 | Natera, Inc. | Methods and compositions for determining ploidy |
| US11753684B2 (en) | 2015-11-10 | 2023-09-12 | Eurofins Lifecodexx Gmbh | Detection of fetal chromosomal aneuploidies using DNA regions that are differentially methylated between the fetus and the pregnant female |
| US12146195B2 (en) | 2016-04-15 | 2024-11-19 | Natera, Inc. | Methods for lung cancer detection |
| WO2017205826A1 (en) | 2016-05-27 | 2017-11-30 | Sequenom, Inc. | Methods for detecting genetic variations |
| EP4043581A1 (en) | 2016-05-27 | 2022-08-17 | Sequenom, Inc. | Method for generating a paralog assay system |
| US11299780B2 (en) | 2016-07-15 | 2022-04-12 | The Regents Of The University Of California | Methods of producing nucleic acid libraries |
| WO2018022890A1 (en) | 2016-07-27 | 2018-02-01 | Sequenom, Inc. | Genetic copy number alteration classifications |
| WO2018022906A1 (en) | 2016-07-27 | 2018-02-01 | Sequenom, Inc. | Methods for non-invasive assessment of genomic instability |
| US11200963B2 (en) | 2016-07-27 | 2021-12-14 | Sequenom, Inc. | Genetic copy number alteration classifications |
| US11515003B2 (en) | 2016-07-27 | 2022-11-29 | Sequenom, Inc. | Copy number alteration and reference genome mapping |
| US11485996B2 (en) | 2016-10-04 | 2022-11-01 | Natera, Inc. | Methods for characterizing copy number variation using proximity-litigation sequencing |
| US12460264B2 (en) | 2016-11-02 | 2025-11-04 | Natera, Inc. | Method of detecting tumour recurrence |
| US11530442B2 (en) | 2016-12-07 | 2022-12-20 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
| US12571034B2 (en) | 2016-12-07 | 2026-03-10 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
| US11519028B2 (en) | 2016-12-07 | 2022-12-06 | Natera, Inc. | Compositions and methods for identifying nucleic acid molecules |
| WO2018136882A1 (en) | 2017-01-20 | 2018-07-26 | Sequenom, Inc. | Methods for non-invasive assessment of copy number alterations |
| WO2018136888A1 (en) | 2017-01-20 | 2018-07-26 | Sequenom, Inc. | Methods for non-invasive assessment of genetic alterations |
| WO2018136881A1 (en) | 2017-01-20 | 2018-07-26 | Sequenom, Inc. | Sequencing adapter manufacture and use |
| EP4235676A2 (en) | 2017-01-20 | 2023-08-30 | Sequenom, Inc. | Methods for non-invasive assessment of genetic alterations |
| WO2018140521A1 (en) | 2017-01-24 | 2018-08-02 | Sequenom, Inc. | Methods and processes for assessment of genetic variations |
| US11694768B2 (en) | 2017-01-24 | 2023-07-04 | Sequenom, Inc. | Methods and processes for assessment of genetic variations |
| US12421550B2 (en) | 2017-03-17 | 2025-09-23 | Sequenom, Inc. | Methods and processes for assessment of genetic mosaicism |
| EP3998350A1 (en) | 2017-03-17 | 2022-05-18 | Sequenom, Inc. | Methods and processes for assessment of genetic mosaicism |
| WO2018170511A1 (en) | 2017-03-17 | 2018-09-20 | Sequenom, Inc. | Methods and processes for assessment of genetic mosaicism |
| US12084720B2 (en) | 2017-12-14 | 2024-09-10 | Natera, Inc. | Assessing graft suitability for transplantation |
| WO2019140201A1 (en) | 2018-01-12 | 2019-07-18 | Claret Bioscience, Llc | Methods and compositions for analyzing nucleic acid |
| US11584929B2 (en) | 2018-01-12 | 2023-02-21 | Claret Bioscience, Llc | Methods and compositions for analyzing nucleic acid |
| US12385096B2 (en) | 2018-04-14 | 2025-08-12 | Natera, Inc. | Methods for cancer detection and monitoring |
| US12024738B2 (en) | 2018-04-14 | 2024-07-02 | Natera, Inc. | Methods for cancer detection and monitoring |
| US11629345B2 (en) | 2018-06-06 | 2023-04-18 | The Regents Of The University Of California | Methods of producing nucleic acid libraries and compositions and kits for practicing same |
| US12234509B2 (en) | 2018-07-03 | 2025-02-25 | Natera, Inc. | Methods for detection of donor-derived cell-free DNA |
| US20210198733A1 (en) | 2018-07-03 | 2021-07-01 | Natera, Inc. | Methods for detection of donor-derived cell-free dna |
| EP4524263A3 (en) * | 2018-10-31 | 2025-05-28 | Guardant Health, Inc. | Methods, compositions and systems for calibrating epigenetic partitioning assays |
| WO2020092807A1 (en) * | 2018-10-31 | 2020-05-07 | Guardant Health, Inc. | Methods, compositions and systems for calibrating epigenetic partitioning assays |
| EP4538390A2 (en) | 2019-04-05 | 2025-04-16 | Claret Bioscience, LLC | Methods and compositions for analyzing nucleic acid |
| WO2020206143A1 (en) | 2019-04-05 | 2020-10-08 | Claret Bioscience, Llc | Methods and compositions for analyzing nucleic acid |
| EP3973081A4 (en) * | 2019-05-23 | 2022-09-07 | American Molecular Laboratories, Inc. | METHODS FOR DETECTING RARE DNA SEQUENCES IN FECAL SAMPLES |
| US12305235B2 (en) | 2019-06-06 | 2025-05-20 | Natera, Inc. | Methods for detecting immune cell DNA and monitoring immune system |
| WO2020264051A1 (en) * | 2019-06-24 | 2020-12-30 | ChromaCode, Inc. | Methods for differentially quantifying nucleic acids |
| WO2021072037A1 (en) | 2019-10-09 | 2021-04-15 | Claret Bioscience, Llc | Methods and compositions for analyzing nucleic acid |
| WO2021087491A1 (en) | 2019-10-31 | 2021-05-06 | Sequenom, Inc. | Application of mosaicism ratio in multifetal gestations and personalized risk assessment |
| WO2021262805A1 (en) | 2020-06-24 | 2021-12-30 | Claret Bioscience, Llc | Methods and compositions for analyzing nucleic acid |
| EP4428244A2 (en) | 2020-06-24 | 2024-09-11 | Claret Bioscience, LLC | Methods and compositions for analyzing nucleic acid |
| WO2022076574A1 (en) | 2020-10-08 | 2022-04-14 | Claret Bioscience, Llc | Methods and compositions for analyzing nucleic acid |
| WO2024186778A1 (en) | 2023-03-03 | 2024-09-12 | Laboratory Corporation Of America Holdings | Methods and systems for positive cfdna screening on genetic variations using mosaicism ratio |
| WO2024238593A1 (en) | 2023-05-15 | 2024-11-21 | Laboratory Corporation Of America Holdings | Machine-learning approaches to pan-cancer screening in whole genome sequencing |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2329021A2 (en) | 2011-06-08 |
| CN102216456A (zh) | 2011-10-12 |
| JP5727375B2 (ja) | 2015-06-03 |
| JP2015126748A (ja) | 2015-07-09 |
| EP2329021B1 (en) | 2016-08-10 |
| JP2014223088A (ja) | 2014-12-04 |
| AU2009293232B2 (en) | 2015-05-14 |
| EP2329021A4 (en) | 2012-05-23 |
| CA3073079C (en) | 2023-09-26 |
| JP2018064595A (ja) | 2018-04-26 |
| AU2009293232A1 (en) | 2010-03-25 |
| JP5923571B2 (ja) | 2016-05-24 |
| CA3209378A1 (en) | 2025-04-11 |
| EP3103871B1 (en) | 2020-07-29 |
| JP2018064594A (ja) | 2018-04-26 |
| JP2012502631A (ja) | 2012-02-02 |
| CA3073079A1 (en) | 2010-03-25 |
| ES2599967T3 (es) | 2017-02-06 |
| CA2737200A1 (en) | 2010-03-25 |
| JP6634105B2 (ja) | 2020-01-22 |
| CA3209502A1 (en) | 2010-03-25 |
| HK1158256A1 (zh) | 2012-07-13 |
| JP2021003138A (ja) | 2021-01-14 |
| EP3770255A1 (en) | 2021-01-27 |
| EP3103871A1 (en) | 2016-12-14 |
| DK2329021T3 (en) | 2016-10-24 |
| CA2737200C (en) | 2020-03-31 |
| WO2010033639A9 (en) | 2011-02-17 |
| JP2023115354A (ja) | 2023-08-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200362414A1 (en) | Processes and Compositions for Methylation-Based Enrichment of Fetal Nucleic Acid From a Maternal Sample Useful for Non-Invasive Prenatal Diagnoses | |
| US10612086B2 (en) | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses | |
| DK2329021T3 (en) | Methods and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample suitable for non-invasive prenatal diagnoses | |
| CA2878979C (en) | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses | |
| AU2017251674B2 (en) | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses | |
| HK40043946A (en) | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses | |
| HK40036431A (en) | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses | |
| HK1254596B (en) | Processes for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non-invasive prenatal diagnoses | |
| HK1229846A1 (en) | Processes for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for fetal nucleic acid quantification | |
| HK1229846B (en) | Processes for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for fetal nucleic acid quantification | |
| HK1158256B (en) | Processes and compositions for methylation-based enrichment of fetal nucleic acid from a maternal sample useful for non invasive prenatal diagnoses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200980145856.5 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09815148 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2737200 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2011527069 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009293232 Country of ref document: AU |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2009815148 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009815148 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2476/DELNP/2011 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 2009293232 Country of ref document: AU Date of ref document: 20090916 Kind code of ref document: A |