WO2010009337A2 - Signatures and pcdeterminants associated with prostate cancer and methods of use thereof - Google Patents

Signatures and pcdeterminants associated with prostate cancer and methods of use thereof Download PDF

Info

Publication number
WO2010009337A2
WO2010009337A2 PCT/US2009/050885 US2009050885W WO2010009337A2 WO 2010009337 A2 WO2010009337 A2 WO 2010009337A2 US 2009050885 W US2009050885 W US 2009050885W WO 2010009337 A2 WO2010009337 A2 WO 2010009337A2
Authority
WO
WIPO (PCT)
Prior art keywords
pcdeterminants
subject
cancer
sample
tumor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2009/050885
Other languages
English (en)
French (fr)
Other versions
WO2010009337A3 (en
WO2010009337A9 (en
Inventor
Ronald Depinho
Zhihu Ding
Lynda Chin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dana Farber Cancer Institute Inc
Original Assignee
Dana Farber Cancer Institute Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CA2730614A priority Critical patent/CA2730614A1/en
Priority to NZ590851A priority patent/NZ590851A/xx
Priority to BRPI0916229A priority patent/BRPI0916229A2/pt
Priority to US13/054,468 priority patent/US20110265197A1/en
Priority to MX2011000451A priority patent/MX2011000451A/es
Priority to JP2011518921A priority patent/JP2011528442A/ja
Priority to EP09744246A priority patent/EP2318543A2/en
Priority to CN2009801363207A priority patent/CN102159727A/zh
Application filed by Dana Farber Cancer Institute Inc filed Critical Dana Farber Cancer Institute Inc
Priority to AU2009270851A priority patent/AU2009270851A1/en
Publication of WO2010009337A2 publication Critical patent/WO2010009337A2/en
Publication of WO2010009337A9 publication Critical patent/WO2010009337A9/en
Publication of WO2010009337A3 publication Critical patent/WO2010009337A3/en
Priority to IL210681A priority patent/IL210681A0/en
Anticipated expiration legal-status Critical
Priority to ZA2011/01132A priority patent/ZA201101132B/en
Priority to US14/174,072 priority patent/US20140235479A1/en
Priority to US15/337,966 priority patent/US20170299594A1/en
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57555Immunoassay; Biospecific binding assay; Materials therefor for cancer of the prostate
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • A01K67/0275Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276Knock-out vertebrates
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/08Drugs for disorders of the urinary system of the prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/15Medicinal preparations ; Physical properties thereof, e.g. dissolubility
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/075Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/15Animals comprising multiple alterations of the genome, by transgenesis or homologous recombination, e.g. obtained by cross-breeding
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/20Animal model comprising regulated expression system
    • A01K2217/203Animal model comprising inducible/conditional expression system, e.g. hormones, tet
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0331Animal model for proliferative diseases
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/112Disease subtyping, staging or classification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/50Determining the risk of developing a disease
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/54Determining the risk of relapse
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/56Staging of a disease; Further complications associated with the disease
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A90/00Technologies having an indirect contribution to adaptation to climate change
    • Y02A90/10Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation

Definitions

  • the present invention relates generally to the identification of biological signatures associated with and genetic PCDETERMINANTS effecting cancer metastasis and methods of using such biological signatures and PCDETERMINANTS in the screening, prevention, diagnosis, therapy, monitoring, and prognosis of cancer.
  • the invention further relates to a genetically engineered mouse model of metastatic prostate cancer.
  • PCA Prostate cancer
  • the present invention relates in part to the discovery that certain biological markers (referred to herein as "PCDETERMINANTS "), such as proteins, nucleic acids, polymorphisms, metabolites, and other analytes, as well as certain physiological conditions and states, are present or altered in early stage cancers which endow these neoplasm with an increased risk of recurrence and progression to metastatic cancer.
  • the cancer is for example prostate cancer or breast cancer.
  • the invention provides a method with a predetermined level of predictability for assessing a risk of development of metastatic cancer in a subject. Risk of developing metastatic prostate cancer is determined by measuring the level of a PCDETERMINANT in a sample from the subject.
  • an increased risk of developing metastatic cancer in the subject is determined by measuring a clinically significant alteration in the level of the PCDETERMINANT in the sample.
  • an increased risk of developing metastatic cancer in the subject is determined by comparing the level of the effective amount PCDETERMINANT to a reference value.
  • the reference value is an index.
  • the invention provides a method with a predetermined level of predictability for assessing the progression of a tumor in a subject by detecting the level of PCDETERMINANTS in a first sample from the subject at a first period of time, detecting the level of PCDETERMINANTS in a second sample from the subject at a second period of time and comparing the level of the PCDETERMINANTS detected to a reference value.
  • the first sample is taken from the subject prior to being treated for the tumor and the second sample is taken from the subject after being treated for the tumor.
  • the invention provides a method with a predetermined level of predictability for monitoring the effectiveness of treatment or selecting a treatment regimen for metastatic cancer by detecting the level of PCDETERMINANTS in a first sample from the subject at a first period of time and optionally detecting the level of an effective amount of PCDETERMINANTS in a second sample from the subject at a second period of time.
  • the level of the effective amount of PCDETERMINANTS detected at the first period of time is compared to the level detected at the second period of time or alternatively a reference value. Effectiveness of treatment is monitored by a change in the level of the effective amount of PCDETERMINANTS from the subject.
  • a PCDETERMINANT includes for example DETERMINAT 1-372 described herein. One, two, three, four, five, ten or more PCDETERMINANTS are measured. In some embodiments least two PCDETERMINANTS selected from the PCDETERMINANTS listed on Table 2, 3, 4, 5, 6, or 7 are measured. Preferably, PTEN, SMAD4, cyclin Dl and SPPl are measured. Optionally, the methods of the invention further include measuring at least one standard parameters associated with a tumor. A standard parameter is for example Gleason Score. [00010] The level of a PCDETERMINANT is measured electrophoretically or immunochemically.
  • the level of the PCDETERMINANT is detected by radioimmunoassay, immunofluorescence assay or by an enzyme-linked immunosorbent assay.
  • the PCDETERMINANT is detected using non-invasive imaging technology.
  • the subject has a primary tumor, a recurrent tumor, or metastatic cancer.
  • the sample is taken for a subject that has previously been treated for the tumor.
  • the sample is taken from the subject prior to being treated for the tumor.
  • the sample is a tumor biopsy such as a core biopsy, an excisional tissue biopsy or an incisional tissue biopsy.
  • the sample is blood or a circulating tumor cell in a biological fluid.
  • metastatic prostate cancer reference expression profile containing a pattern of marker levels of an effective amount of two or more markers selected from PCDETERMINANTS 1-372.
  • the profile contains a pattern of marker levels of the PCDETERMINANTS listed on any one of Tables IA, IB, 2, 3, 4, 5, 6, or 7.
  • a machine readable media containing one or more metastatic tumor reference expression profiles and optionally, additional test results and subject information.
  • the invention provides a kit comprising a plurality of PCDETERMINANT detection reagents that detect the corresponding PCDETERMINANTS.
  • the kit includes PTEN, SMAD4, cyclin Dl and SPPl detection reagents.
  • the detection reagent is for example antibodies or fragments thereof, oligonucleotides or aptamers.
  • the invention provides a PCDETERMINANT panel containing one or more PCDETERMINANTS that are indicative of a physiological or biochemical pathway associated metastasis or the progression of a tumor.
  • the physiological or biochemical pathway includes for example, P13K, RAC-RHO, FAK, and RAS signaling pathways.
  • the invention provides a method of identifying a biomarker that is prognostic for a disease by identifying one or more genes that are differentially expressed in the disease compared to a control to produce a gene target list; and identifying one or more genes on the target list that is associated with a functional aspect of the progression of the disease.
  • the functional aspect is for example, cell migration, angiogenesis, distal colonization, extracellular matrix degradation or anoikis.
  • the method includes identifying one or more genes on the gene target list that comprise an evolutionarily conserved change to produce a second gene target list.
  • the disease is for example cancer such as invasive or metastatic cancer.
  • Compounds that modulates the activity or expression of a PCDETERMINANT are identified by providing a cell expressing the PCDETERMINANT, contacting (e.g., in vivo, ex vivo or in vitro) the cell with a composition comprising a candidate compound; and determining whether the substance alters the expression of activity of the PCDETERMINANT. If the alteration observed in the presence of the compound is not observed when the cell is contacted with a composition devoid of the compound, the compound identified modulates the activity or expression of a PCDETERMINANT.
  • Cancer is treated in a subject by administering to the subject a compound that modulates the activity or expression of a PCDETERMINANT or by administering to the subject an agent that modulates the activity or expression of a compound that is modulated by a PCDETERMINANT.
  • Cancer is treated by providing a subject whose cancer cells have clinically significant alteration in the level of the two or more of PCDETERMINANTS 1-372 and treating the subject with adjuvant therapy in addition to surgery or radiation.
  • the alteration in the level of the PCDETERMINANTS indicates an increased risk of cancer recurrence or developing metastatic cancer in the subject.
  • prostate cancer is treated in a subject in need thereof by obtaining information on the expression levels of PTEN, SMAD4, CYCLIN Dl and SPPl in a sample from prostate cancer tissue in the subject; and administering an SPPl inhibitor, a CD44 inhibitor, or both.
  • the subject is one identified as being at risk for recurrence of prostate cancer or development of metastatic cancer based on expression levels of PTEN, SMAD4, CYCLIN Dl and SPPl .
  • the invention provide a method of selecting a tumor patient in need of adjuvant treatment by assessing the risk of metastasis in the patient by measuring an effective amount of PC DETERMINANTS where a clinically significant alteration two or more PCDETERMINANTS in a tumor sample from the patient indicates that the patient is in need of adjuvant treatment.
  • the methods describes herein are useful in determining whether as particular subject is suitable for a clinical trial.
  • the invention provides a method of informing a treatment decision for a tumor patient by obtaining information on an effective amount of PCDETERMINANTS in a tumor sample from the patient, and selecting a treatment regimen that prevents or reduces tumor metastasis in the patient if two or more PCDETERMINANTS are altered in a clinically significant manner.
  • the assessment/monitoring is achieved with a predetermined level of predictability.
  • predetermined level of predictability is meant that that the method provides an acceptable level of clinical or diagnostic accuracy.
  • Clinical and diagnostic accuracy is determined by methods known in the art, such as by the methods described herein.
  • the invention further provides a transgenic double knockout mouse whose genome contains genetic modification that enables a homozygous disruption of both the endogenous Pten gene and Smad4 gene in the prostate epithelium.
  • this disruption can be achievement by recombinase-mediated excision of Pten or Smad genes with embedded Lo xP site (i.e., the current strain) or by for example mutational knock-in, and RNAi- mediated extinction of these genes either in a germline configuration or in somatic transduction of prostate epithelium in situ or in cell culture followed by reintroduction of these primary cells into the renal capsule or orthotopically.
  • Other engineering strategies are also obvious including chimera formation using targeted ES clones that avoid germline transmission.
  • the transgenic mouse exhibits an increased susceptibility to formation of prostate tumors as compared to a wild type mouse.
  • the mouse also exhibits an increased susceptibility to formation of metastatic prostate cancer as compared to a Pten-only single knockout transgenic mouse.
  • the cells are epithelial cells such as prostate epithelial cells, breast epithelial cells, lung epithelial cells or colon epithelial cells.
  • Figure 1 demonstrates that the loss of Pten prostate upregulated the level of p- Smad2/Smad3 and Smad4 expression.
  • A Ingenuity Canonical Pathway Analysis of differentially expressed genes between Pten pc / ⁇ mice (3331 probe sets, in blue) were compared to 10 randomly drawn gene sets of equal size.
  • B Western blot analysis of AP tissue from each genotype at 15 weeks shows pSmad2/3 level enhanced, Smad4 upregulation, and IdI induction in Pten pc / ⁇ mice compared to control mice.
  • FIG. 1 Boxed plot of Smad4 expression between human PCA and metastasis in Yu et al prostate expression dataset and Dhanasekaran et al (2001) prostate expression dataset (E).
  • Figure 2 demonstrate that the loss of Smad4 does not initiate prostate tumors but renders Pten-deficient carcinomas lethal.
  • A Histopathological analysis (haematoxylin/eosin staining) of anterior prostates (AP) in WT, Smad4 and Pten single and double mutants at 9 weeks of age reveals normal glands in WT and Smad pc" " mice but PIN lesions in Pten pc" " mice and invasion (arrow) in Pten pc” " ; Smad pc” " mice.
  • Figure 3 demonstrates that the loss of Smad4 enhanced proliferation and circumvented Pten-loss-induced cellular senescence.
  • A Histopathological and proliferation analysis of 15- week-old APs demonstrated increase in proliferation at some invasion foci (arrow, panel e) in Pten pc /" ; Smad pc /" double mutants (panel j). Tunel analysis of 15-week-old APs showed no significant difference in Pten pc /" ; Smad pc /" double mutants (panel i,j) and Pten pc /" prostate tumors (panel h). H&E, haematoxylin/eosin. Scale bars, 50 ⁇ m.
  • FIG. 5 demonstrates that the 284 PCDETERMINANTS from Table IA predict human prostate cancer aggressiveness and metastasis.
  • the 284 PCDETERMINTS listed on Table IA were derived from a comparison of 3 tumor samples from Pten and 3 tumor samples form Pten Smad4.
  • the 284 PCDETERMINANTS from Table IA were evaluated for prognostic utility from the Glinsky et al (2004) prostate cancer gene expression data set.
  • Biochemical recurrence (BCR) was defined by PSA levels (>0.2 ng/ml).
  • Patient samples were categorized into two major clusters (High-risk and Low-Risk group) defined by the 284 PCDETERMINANTS listed on Table IA .
  • Figure 6 illustrates that Cell Movement genes are differentially expressed in the metastastic Smad4/Pten prostate tumors compares to indolent Pten tumors.
  • Ingenuity Pathway Analysis (IPA) analysis on molecular functions of the differential expressed genes revealed that the cell movement genes ranks #18 vs. #1 for the Smad4/Pten prostate tumors when either are compared to Pten tumors.
  • IPA Ingenuity Pathway Analysis
  • Figure 7 illustrates gene profiling and promoter analysis reveals a subset of 66 putative Smad4 target genes differentially expressed between Pten pc / ⁇ ; Smad pc / ⁇ double mutants and Pten pc" ' ' mice.
  • A 66 genes differentially expressed between Pten pc / ⁇ ; Smad pc / ⁇ double mutants and Pten pc / ⁇ mice.
  • B Ingenuity Pathway Analysis (IPA) on molecular functions reveals that these 66 genes have roles in cell movement, cancer, cellular growth and proliferation, and ell death.
  • Figure 8 illustrates a 17 S mad- target gene signature can predictor cancer aggressiveness and metastasis.
  • a diagram representation of the development of 17 Smad target gene signature The 17 putative Smad target genes were subsequently evaluated for prognostic utility on a prostate cancer gene expression data set. Hierarchical clustering of the tumor samples (columns) and genes (rows) is provided.
  • FIG. 9 illustrates that loss of Smad4 does not initiate prostate tumors up to 2 years age. Histopathological analysis (haematoxylin/eosin staining) of anterior prostates (AP) in Smad4 single mutants at one year (A) and two year of age (B) reveals normal glands in Smad pc /" mice. Scale bars, 50 ⁇ m.
  • Figure 10 shows histopathological analysis of representative hydronephrosis in Pten pc /" ; Smad pc /" mice.
  • A Gross anatomy of representative Pten pc /" ; Smad pc /" with prostate tumor at 26 weeks of age with a huge prostate tumor (dashed circle). Scale bars, 2 cm.
  • B,C Histopathological analysis of representative kidney from Pten pc /" mice (B) and Pten pc /" ; Smad pc /" mice with hydronephrosis (arrow) (C). Stained with hematoxylin and eosin (H&E). Scale bars, 1 mm.
  • Figure 11 shows Microarray analysis of a subset of 284 (See Table IA) cancer biology related genes differentially expressed between Pten pc” “ ; Smad pc” “ double mutants and Pten pc” “ mice.
  • A 284 genes differentially expressed between Pten pc” “ ; Smad pc” “ double mutants and Pten pc” " mice.
  • B Ingenuity Pathway Analysis (IPA) on molecular functions reveals that these 284 genes have roles in cellular movement, cancer, cellular growth and proliferation, and cell death.
  • IPA Ingenuity Pathway Analysis
  • FIG. 12 The 66 putative Smad target genes were subsequently evaluated for prognostic utility on a prostate cancer gene expression data set. Hierarchical clustering of the tumor samples (columns) and genes (rows) is provided. Red indicates high relative levels of gene expression, while green represents low relative levels of gene expression. Horizontal bars above the heat maps indicate the recurrence status of each patient (1, biochemical or tumor recurrence; 0, recurrence-free). Patients were categorized into two major clusters defined by the 66-gene signature. Lymph node and other distal metastasis are indicated by arrow in red.
  • B Kaplan- Meier survival analysis based on the groups defined by the 66-gene cluster.
  • FIG. 13 shows that Smad4 loss can circumvent cellular senescence elicited by Pten loss in primary mouse embryonic fibroblasts (MEFs) through p53-dependent pathway.
  • A senescence staining of WT (Panel a), Smad " " (Panel b), Pten " " (Panel c), and Pten " " ; Smad " " (Panel d) MEFs. Representative sections from three independent MEFs of each genotype.
  • B Quantification of the ⁇ -Gal staining. Error bars represent s.d. for a representative experiment performed in triplicate.
  • Figure 14 shows prostate epithelial cells from Pten pc /" ; Smad pc /" double mutants form orthotopic metastatic tumors with prostate epithelial cell markers in nude mice.
  • A Orthotopic injection of prostate epithelial cells from Pten pc /" ; Smad pc /" double mutants form tumor in prostate (dashed circle) and form lung metastasis (arrows). Scale bars, 1 cm.
  • Figure 15 shows Prostate epithelial cells from Pten pc" " ; Smad pc” " double mutants form orthotopic metastatic tumors with prostate epithelial cell markers in nude mice.
  • B Immunohistochemical analyses show that kidney tumors and lung metastasis are CK8 positive and #AR positive (prostate epithelial markers).
  • Figure 16 shows that restoration of Smad4 in Pten-Smad4 double null prostate tumor cells decreases cell viability when treated with TGF ⁇ l .
  • A The restoration of Smad4 in Smad4- deficient prostate cancer cells decreases cell viability upon treatment with TGF ⁇ l .
  • Parental control cells (Contl) and Smad4-Tet on cells (Smad4) were treated with 0.016ng/mL, 0.031ng/mL, 0.063ng/mL, 0.125ng/mL, 0.25ng/mL,0.5ng/mL TGF ⁇ l in the presence or absence of 1 ⁇ g/mL doxycycline (Dox) in 5% charcoal-stripped FBS -containing medium, and then cell viability was assayed by adenosine triphosphate quantitation. Error bars represent s.d. for a representative experiment performed in triplicate.
  • FIG 19 illustrates the model of how Pten and Smad4 cooperate to control prostate cancer initiation and progression.
  • Pten loss in prostate result in the development of prostate tumor, but further progression was suppressed by proliferative block/senescence induced by Pten loss.
  • Both Pten and Smad4 loss circumvent the Pten-loss-induced proliferative block/senescence and possibly other cellular and intracellular suppression mechanisms such as those impeding cellular movement through PCDETERMINANTS 1-372 or a subset of PCDETERMINANTS 1- 372, and eventually led to the prostate tumor cells to progress to metastasis.
  • Figure 20 demonstrates cross-species triangulated differentially expressed genes between PterF c ⁇ ' ⁇ ; Smad4 pc ⁇ ' ⁇ double mutants and Pter? c ⁇ ' ⁇ mice are linked to clinical outcome in human PCA.
  • A A diagram representation of the development of a 56 gene set based on the overlap of differentially expressed genes between Pten pc ⁇ ' ; Smad4 pc ⁇ ' double mutants and Pterf c ⁇ ' mice (Table IB) with a human metastatic PCA datas ⁇ t 19 .
  • the 56 gene set (TABLE 7) was subsequently evaluated for prognostic utility on a prostate cancer gene expression data set.
  • Figure 21 illustrates approaches to identify PCDETERMINANTS that functionally drive or inhibit invasion in vitro.
  • Figure 22 demonstrates use of the invasion assay to functionally validate candidate genes.
  • (C) The table confirms the assay identifies invasion-promoting genes that are annotated as being involved in cellular movement, but also genes not classified as being involved in movement yet drive invasive and metastatic properties in vitro. A significantly higher frequency (P O.02, Fisher's Exact Test) of invasion- validated PCDETERMINANTS are annotated as cellular movement genes compared to those not from the cellular movement annotated genes.
  • Figure 23 demonstrates a FOUR (4) PCDETERMINANT gene signature PTEN- SMAD4- Cyclin Dl-SPPl which was informed by the Pten/Smad4 transcriptome data, the histopathological data and invasion validation data is linked to clinical outcome in human PCA.
  • Patient samples were categorized into two major clusters by K-mean (High-risk and Low risk groups) defined by the PTEN, SMAD4, Cyclin Dl, and SPPl signature.
  • PTEN, SMAD4, Cyclin Dl, and SPPl 4-gene set ranked as the most enriched among 244 bidirectional signatures curated in the Molecular Signature Databases of the Broad Institute (MSigDB, version 2.5), indicating the robust significance of this 4 gene signature in prediction of lethal outcome.
  • Figure 24 demonstrates cross-species triangulated differentially expressed genes between Pterf c ⁇ ' ; Smad4 pc ⁇ ' double mutants and Pterf c ⁇ ' mice are linked to clinical outcome in human breast cancer.
  • Figure 25 demonstrates that both prostate and breast cancer progression correlated PCDETERMINANTS are highly linked to clinical outcome in human breast cancer.
  • the present invention relates to the identification of signatures associated with and PCDETERMINANTS conferring subjects with metastatic prostate cancer or are at risk for developing metastatic prostate cancer.
  • the invention further provides a murine mouse model for invasive and metastatic prostate cancer, where the mouse prostate epithelium sustains deletion, or other means of mutational or epigenetic extinction of an initiating lesion such as the Pten and Smad4 gene. It would be recognized by one skilled in the art that other initiating lesion, including over-expression of oncogene trangenes could be coupled to the Smad4 deletion to enable malignant progression.
  • This mouse model can be used to identify cancer detection biomarkers.
  • loss of Pten function is one of the most significant genetic events in prostate carcinogenesis. Loss of Pten results in prostate tumorigenesis in the mouse prostate; however, it also provokes cellular senescence which may function as a further level of tumor suppressor to block the tumor cells progression to an invasive stage. Overriding senescence induced by Pten through inactivation of p53 contributes to the progression of prostate tumors from an indolent lesion to an invasive tumor. The inventors have discovered that Smad4 loss also can circumvent cellular senescence elicited by Pten loss. Overriding senescence by loss of Smad4 is cooperative to Pten loss and may contribute its role in the promotion of tumor cells.
  • receptor-phosporylated R-Smads oligomerizes with Smad4 and translocate to the nucleus and bind directly to Smad-binding elements on DNA where they can induce or repress a diverse array of genes.
  • TGF- ⁇ provides a mechanism to maintain homeostasis in the prostate.
  • this major arm of the TGF ⁇ plays a critical role in the prostate tumor progression suppression.
  • TGF ⁇ signaling The tumor suppressor role of TGF ⁇ signaling is underscored by the presence of inactivating TGF ⁇ receptor mutations and the extinction of Smad2, Smad3, and Smad4 proteins in multiple cancers including prostate cancer.
  • TGF ⁇ was shown to inhibit many normal cell types and tumor cell growth, TGF ⁇ was also reported to enhance malignant potential of epithelial tumors, including proliferation, migration, and epithelial-to-mesenchymal transition (EMT)-a process by which advanced carcinomas acquire a highly invasive, undifferentiated and metastatic phenotype.
  • EMT epithelial-to-mesenchymal transition
  • TGF ⁇ in the breast tumor microenvironment can prime cancer cells for metastasis to the lungs though induction of angiopoietin-like 4 (ANGPTL4) by TGF ⁇ via the Smad signaling pathway.
  • ANGPTL4 angiopoietin-like 4
  • These paradoxical activities of tumor suppression and promotion are probably dependent on the activities of other signaling pathways in given cells, which are dictated by the different cell contexts as well as the interplay with other tissue.
  • the Pten/Smad4 model has now clarified the role of the TGFb pathway in prostate cancer by clearly showing that Smad4 loss is not sufficient alone to initiate the development of prostate lesion, but promotes acceleration and progression of prostate tumor to metastasis with complete penetrance, at least on the background of Pten deficiency (Figure 3).
  • the Pten/Smad4 model study clearly demonstrated that Smad4 loss can override the senescence induced by Pten loss. Since override senescence by p53 loss in Pten deficiency background result in progression of indolent prostate tumor to invasive lesion, but not to metastasis. Senescence is thus considered to be an early barrier during the prostate tumorigenesis from indolent to invasive status. As restoration of Smad4 back into the Pten/Smad4 double mutant prostate tumor cells did not restore the senescence (data not shown). However, restoration of Smad4 decreased the viability of the cells upon the treatment of TGF ⁇ 1. The senescence barrier may be, therefore, a transient cellular response to the oncogenic signal(s) to block tumor progression.
  • the invention provides an animal model for metastatic prostate cancer.
  • the animal model of the instant invention thus finds particular utility as a screening tool to elucidate the mechanisms of the various genes involved in both normal and diseased patient populations.
  • the invention also provides methods for identifying subjects who have metastatic prostate cancer, or who at risk for experiencing metastatic prostate cancer by the detection of PCDETERMINANTS associated with the metastatic tumor, including those subjects who are asymptomatic for the metastatic tumor.
  • PCDETERMINANTS are also useful for monitoring subjects undergoing treatments and therapies for cancer, and for selecting or modifying therapies and treatments that would be efficacious in subjects having cancer, wherein selection and use of such treatments and therapies slow the progression of the tumor, or substantially delay or prevent its onset, or reduce or prevent the incidence of tumor metastasis.
  • TP true positives
  • TN true negatives
  • FP false negatives
  • FN false negatives
  • PCDETERMINANTS in the context of the present invention encompasses, without limitation, proteins, nucleic acids, and metabolites, together with their polymorphisms, mutations, variants, modifications, subunits, fragments, protein-ligand complexes, and degradation products, protein-ligand complexes, elements, related metabolites, and other analytes or sample-derived measures.
  • PCDETERMINANTS can also include mutated proteins or mutated nucleic acids.
  • PCDETERMINANTS also encompass non-blood borne factors or non-analyte physiological markers of health status, such as "clinical parameters" defined herein, as well as "traditional laboratory risk factors”, also defined herein.
  • PCDETERMINANTS also include any calculated indices created mathematically or combinations of any one or more of the foregoing measurements, including temporal trends and differences. Where available, and unless otherwise described herein, PCDETERMINANTS which are gene products are identified based on the official letter abbreviation or gene symbol assigned by the international Human Genome Organization Naming Committee (HGNC) and listed at the date of this filing at the US National Center for Biotechnology Information (NCBI) web site
  • PCDETERMINANT encompass one or more of all nucleic acids or polypeptides whose levels are changed in subjects who have metastatic prostate cancer or are predisposed to developing metastatic prostate cancer, or at risk of metastatic prostate cancer. Individual PCDETERMINANTS are summarized in Table 1 B and are collectively referred to herein as, inter alia, "metastatic tumor-associated proteins", “PCDETERMINANT polypeptides”, or “PCDETERMINANT proteins”.
  • the corresponding nucleic acids encoding the polypeptides are referred to as "metastatic tumor-associated nucleic acids", “metastatic tumor- associated genes”, “PCDETERMINANT nucleic acids”, or “PCDETERMINANT genes”. Unless indicated otherwise, “PCDETERMINANT”, “metastatic tumor -associated proteins”, “metastatic tumor -associated nucleic acids” are meant to refer to any of the sequences disclosed herein.
  • the corresponding metabolites of the PCDETERMINANT proteins or nucleic acids can also be measured, as well as any of the aforementioned traditional risk marker metabolites.
  • PCDETERMINANT physiology Physiological markers of health status (e.g., such as age, family history, and other measurements commonly used as traditional risk factors) are referred to as "PCDETERMINANT physiology”.
  • Calculated indices created from mathematically combining measurements of one or more, preferably two or more of the aforementioned classes of PCDETERMINANTS are referred to as "PCDETERMINANT indices”.
  • CEC Certhelial endothelial cell
  • CTC Cerculating tumor cell
  • TC is a tumor cell of epithelial origin which is shed from the primary tumor upon metastasis, and enters the circulation.
  • the number of circulating tumor cells in peripheral blood is associated with prognosis in patients with metastatic cancer.
  • These cells can be separated and quantified using immunologic methods that detect epithelial cells, and their expression of PCDETERMINANTS can be quantified by qRT-PCR, immunofluorescence, or other approaches.
  • FN is false negative, which for a disease state test means classifying a disease subject incorrectly as non-disease or normal.
  • FP is false positive, which for a disease state test means classifying a normal subject incorrectly as having disease.
  • a “formula,” “algorithm,” or “model” is any mathematical equation, algorithmic, analytical or programmed process, or statistical technique that takes one or more continuous or categorical inputs (herein called “parameters”) and calculates an output value, sometimes referred to as an "index” or “index value.”
  • Parameters continuous or categorical inputs
  • Non-limiting examples of “formulas” include sums, ratios, and regression operators, such as coefficients or exponents, biomarker value transformations and normalizations (including, without limitation, those normalization schemes based on clinical parameters, such as gender, age, or ethnicity), rules and guidelines, statistical classification models, and neural networks trained on historical populations.
  • PCDETERMINANTS Linear and non-linear equations and statistical classification analyses to determine the relationship between levels of PCDETERMINANTS detected in a subject sample and the subject's risk of metastatic disease.
  • structural and synactic statistical classification algorithms, and methods of risk index construction utilizing pattern recognition features, including established techniques such as cross-correlation, Principal Components Analysis (PCA), factor rotation, Logistic Regression (LogReg), Linear Discriminant Analysis (LDA), Eigengene Linear Discriminant Analysis (ELDA), Support Vector Machines (SVM), Random Forest (RF), Recursive Partitioning Tree (RPART), as well as other related decision tree classification techniques, Shrunken Centroids (SC), StepAIC, Kth-Nearest Neighbor, Boosting, Decision Trees, Neural Networks, Bayesian Networks, Support Vector Machines, and Hidden Markov Models, among others.
  • PCA Principal Components Analysis
  • LogReg Logistic Regression
  • LDA Linear Discriminant Analysis
  • ELDA Eigengene Linear Dis
  • the resulting predictive models may be validated in other studies, or cross-validated in the study they were originally trained in, using such techniques as Bootstrap, Leave-One-Out (LOO) and 10-Fold cross-validation (10-Fold CV).
  • LEO Leave-One-Out
  • 10-Fold cross-validation 10-Fold CV.
  • false discovery rates may be estimated by value permutation according to techniques known in the art.
  • a "health economic utility function" is a formula that is derived from a combination of the expected probability of a range of clinical outcomes in an idealized applicable patient population, both before and after the introduction of a diagnostic or therapeutic intervention into the standard of care.
  • a cost and/or value measurement associated with each outcome, which may be derived from actual health system costs of care (services, supplies, devices and drugs, etc.) and/or as an estimated acceptable value per quality adjusted life year (QALY) resulting in each outcome.
  • the sum, across all predicted outcomes, of the product of the predicted population size for an outcome multiplied by the respective outcome's expected utility is the total health economic utility of a given standard of care.
  • the difference between (i) the total health economic utility calculated for the standard of care with the intervention versus (ii) the total health economic utility for the standard of care without the intervention results in an overall measure of the health economic cost or value of the intervention.
  • This may itself be divided amongst the entire patient group being analyzed (or solely amongst the intervention group) to arrive at a cost per unit intervention, and to guide such decisions as market positioning, pricing, and assumptions of health system acceptance.
  • Such health economic utility functions are commonly used to compare the cost-effectiveness of the intervention, but may also be transformed to estimate the acceptable value per QALY the health care system is willing to pay, or the acceptable cost-effective clinical performance characteristics required of a new intervention.
  • a health economic utility function may preferentially favor sensitivity over specificity, or PPV over NPV based on the clinical situation and individual outcome costs and value, and thus provides another measure of health economic performance and value which may be different from more direct clinical or analytical performance measures.
  • Measurement or “measurement,” or alternatively “detecting” or “detection,” means assessing the presence, absence, quantity or amount (which can be an effective amount) of either a given substance within a clinical or subject-derived sample, including the derivation of qualitative or quantitative concentration levels of such substances, or otherwise evaluating the values or categorization of a subject's non-analyte clinical parameters.
  • NDV Neuronal predictive value
  • ROC Receiver Operating Characteristics
  • Analytical accuracy refers to the reproducibility and predictability of the measurement process itself, and may be summarized in such measurements as coefficients of variation, and tests of concordance and calibration of the same samples or controls with different times, users, equipment and/or reagents. These and other considerations in evaluating new biomarkers are also summarized in Vasan, 2006.
  • “Performance” is a term that relates to the overall usefulness and quality of a diagnostic or prognostic test, including, among others, clinical and analytical accuracy, other analytical and process characteristics, such as use characteristics (e.g., stability, ease of use), health economic value, and relative costs of components of the test. Any of these factors may be the source of superior performance and thus usefulness of the test, and may be measured by appropriate "performance metrics," such as AUC, time to result, shelf life, etc. as relevant.
  • “Positive predictive value” or “PPV” is calculated by TP/(TP+FP) or the true positive fraction of all positive test results. It is inherently impacted by the prevalence of the disease and pre-test probability of the population intended to be tested.
  • “Risk” in the context of the present invention relates to the probability that an event will occur over a specific time period, as in the conversion to metastatic events, and can mean a subject's "absolute” risk or “relative” risk.
  • Absolute risk can be measured with reference to either actual observation post-measurement for the relevant time cohort, or with reference to index values developed from statistically valid historical cohorts that have been followed for the relevant time period.
  • Relative risk refers to the ratio of absolute risks of a subject compared either to the absolute risks of low risk cohorts or an average population risk, which can vary by how clinical risk factors are assessed. Odds ratios, the proportion of positive events to negative events for a
  • disk evaluation or “evaluation of risk” in the context of the present invention encompasses making a prediction of the probability, odds, or likelihood that an event or disease state may occur, the rate of occurrence of the event or conversion from one disease state to another, i.e., from a primary tumor to metastatic prostate cancer or to one at risk of developing a metastatic, or from at risk of a primary metastatic event to a more secondary metastatic event.
  • Risk evaluation can also comprise prediction of future clinical parameters, traditional laboratory risk factor values, or other indices of cancer, either in absolute or relative terms in reference to a previously measured population.
  • the methods of the present invention may be used to make continuous or categorical measurements of the risk of metastatic prostate cancer thus diagnosing and defining the risk spectrum of a category of subjects defined as being at risk for metastatic tumor.
  • the invention can be used to discriminate between normal and other subject cohorts at higher risk for metastatic tumors.
  • Such differing use may require different PCDETERMINANT combinations and individualized panels, mathematical algorithms, and/or cut-off points, but be subject to the same aforementioned measurements of accuracy and performance for the respective intended use.
  • sample in the context of the present invention is a biological sample isolated from a subject and can include, by way of example and not limitation, tissue biopsies, whole blood, serum, plasma, blood cells, endothelial cells, circulating tumor cells, lymphatic fluid, ascites fluid, interstitial fluid (also known as "extracellular fluid” and encompasses the fluid found in spaces between cells, including, inter alia, gingival cevicular fluid), bone marrow, cerebrospinal fluid (CSF), saliva, mucous, sputum, sweat, urine, or any other secretion, excretion, or other bodily fluids.
  • tissue biopsies whole blood, serum, plasma, blood cells, endothelial cells, circulating tumor cells, lymphatic fluid, ascites fluid, interstitial fluid (also known as "extracellular fluid” and encompasses the fluid found in spaces between cells, including, inter alia, gingival cevicular fluid), bone marrow, cerebrospinal fluid (CSF), saliva, mucous, s
  • Specificity is calculated by TN/(TN+FP) or the true negative fraction of non-disease or normal subjects.
  • a "subject" in the context of the present invention is preferably a mammal.
  • the mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but are not limited to these examples. Mammals other than humans can be advantageously used as subjects that represent animal models of tumor metastasis.
  • a subject can be male or female.
  • a subject can be one who has been previously diagnosed or identified as having primary tumor or a metastatic tumor, and optionally has already undergone, or is undergoing, a therapeutic intervention for the tumor.
  • a subject can also be one who has not been previously diagnosed as having metastatic prostate cancer.
  • a subject can be one who exhibits one or more risk factors for metastatic prostate cancer.
  • TN is true negative, which for a disease state test means classifying a non-disease or normal subject correctly.
  • Traditional laboratory risk factors correspond to biomarkers isolated or derived from subject samples and which are currently evaluated in the clinical laboratory and used in traditional global risk assessment algorithms.
  • Traditional laboratory risk factors for tumor metastasis include for example Gleason score, depth of invasion, vessel density, proliferative index, etc.. Other traditional laboratory risk factors for tumor metastasis are known to those skilled in the art. [00086] Methods and Uses of the Invention
  • the methods disclosed herein are used with subjects at risk for developing metastatic prostate cancer, or other cancer subjects, such as those with breast cancer who may or may not have already been diagnosed with metastatic prostate cancer or other cancer types and subjects undergoing treatment and/or therapies for a primary tumor or metastatic prostate cancer and other cancer types.
  • the methods of the present invention can also be used to monitor or select a treatment regimen for a subject who has a primary tumor or metastatic prostate cancer and other cancer types, and to screen subjects who have not been previously diagnosed as having metastatic prostate cancer and other cancer types, such as subjects who exhibit risk factors for metastasis.
  • the methods of the present invention are used to identify and/or diagnose subjects who are asymptomatic for metastatic prostate cancer and other cancer types. "Asymptomatic" means not exhibiting the traditional signs and symptoms.
  • the methods of the present invention may also used to identify and/or diagnose subjects already at higher risk of developing metastatic prostate cancer and other metastatic cancer types based on solely on the traditional risk factors.
  • a subject having metastatic prostate cancer and other metastatic cancer types can be identified by measuring the amounts (including the presence or absence) of an effective number (which can be two or more) of PCDETERMINANTS in a subject-derived sample and the amounts are then compared to a reference value.
  • an effective number which can be two or more
  • PCDETERMINANTS PCDETERMINANTS
  • a reference value can be relative to a number or value derived from population studies, including without limitation, such subjects having the same cancer, subject having the same or similar age range, subjects in the same or similar ethnic group, subjects having family histories of cancer, or relative to the starting sample of a subject undergoing treatment for a cancer.
  • Such reference values can be derived from statistical analyses and/or risk prediction data of populations obtained from mathematical algorithms and computed indices of cancer metastasis.
  • Reference PCDETERMINANT indices can also be constructed and used using algorithms and other methods of statistical and structural classification.
  • the reference value is the amount of PCDETERMINANTS in a control sample derived from one or more subjects who are not at risk or at low risk for developing metastatic tumor.
  • the reference value is the amount of PCDETERMINANTS in a control sample derived from one or more subjects who are asymptomatic and/or lack traditional risk factors for metastatic prostate cancer.
  • such subjects are monitored and/or periodically retested for a diagnostically relevant period of time ("longitudinal studies") following such test to verify continued absence of metastatic prostate cancer (disease or event free survival).
  • Such period of time may be one year, two years, two to five years, five years, five to ten years, ten years, or ten or more years from the initial testing date for determination of the reference value.
  • retrospective measurement of PCDETERMINANTS in properly banked historical subject samples may be used in establishing these reference values, thus shortening the study time required.
  • a reference value can also comprise the amounts of PCDETERMINANTS derived from subjects who show an improvement in metastatic risk factors as a result of treatments and/or therapies for the cancer.
  • a reference value can also comprise the amounts of PCDETERMINANTS derived from subjects who have confirmed disease by known invasive or non-invasive techniques, or are at high risk for developing metastatic tumor, or who have suffered from metastatic prostate cancer.
  • the reference value is an index value or a baseline value.
  • An index value or baseline value is a composite sample of an effective amount of PCDETERMINANTS from one or more subjects who do not have metastatic tumor, or subjects who are asymptomatic a metastatic.
  • a baseline value can also comprise the amounts of PCDETERMINANTS in a sample derived from a subject who has shown an improvement in metastatic tumor risk factors as a result of cancer treatments or therapies.
  • the amounts of PCDETERMINANTS are similarly calculated and compared to the index value.
  • subjects identified as having metastatic tumor, or being at increased risk of developing metastatic prostate cancer are chosen to receive a therapeutic regimen to slow the progression the cancer, or decrease or prevent the risk of developing metastatic prostate cancer.
  • the progression of metastatic prostate cancer, or effectiveness of a cancer treatment regimen can be monitored by detecting a PCDETERMINANT in an effective amount (which may be two or more) of samples obtained from a subject over time and comparing the amount of PCDETERMINANTS detected. For example, a first sample can be obtained prior to the subject receiving treatment and one or more subsequent samples are taken after or during treatment of the subject.
  • the cancer is considered to be progressive (or, alternatively, the treatment does not prevent progression) if the amount of PCDETERMINANT changes over time relative to the reference value, whereas the cancer is not progressive if the amount of PCDETERMINANTS remains constant over time (relative to the reference population, or "constant" as used herein).
  • the term "constant" as used in the context of the present invention is construed to include changes over time with respect to the reference value.
  • the methods of the invention can be used to discriminate the aggressiveness/ and or accessing the stage of the tumor (e.g. Stage I, II, II or IV). This will allow patients to be stratified into high or low risk groups and treated accordingly.
  • therapeutic or prophylactic agents suitable for administration to a particular subject can be identified by detecting a PCDETERMINANT in an effective amount (which may be two or more) in a sample obtained from a subject, exposing the subject-derived sample to a test compound that determines the amount (which may be two or more) of PCDETERMINANTS in the subject-derived sample.
  • treatments or therapeutic regimens for use in subjects having a cancer, or subjects at risk for developing metastatic tumor can be selected based on the amounts of PCDETERMINANTS in samples obtained from the subjects and compared to a reference value. Two or more treatments or therapeutic regimens can be evaluated in parallel to determine which treatment or therapeutic regimen would be the most efficacious for use in a subject to delay onset, or slow progression of the cancer.
  • the present invention further provides a method for screening for changes in marker expression associated with metastatic prostate cancer, by determining the amount (which may be two or more) of PCDETERMINANTS in a subject-derived sample, comparing the amounts of the PCDETERMINANTS in a reference sample, and identifying alterations in amounts in the subject sample compared to the reference sample.
  • the present invention further provides a method of treating a patient with a tumor, by identifying a patient with a tumor where an effective amount of PCDETERMINANTS are altered in a clinically significant manner as measured in a sample from the tumor, an treating the patient with a therapeutic regimen that prevents or reduces tumor metastasis.
  • the invention provides a method of selecting a tumor patient in need of adjuvant treatment by assessing the risk of metastasis in the patient by measuring an effective amount of PCDETERMINANTS where a clinically significant alteration two or more PCDETERMINANTS in a tumor sample from the patient indicates that the patient is in need of adjuvant treatment.
  • Information regarding a treatment decision for a tumor patient by obtaining information on an effective amount of PCDETERMINANTS in a tumor sample from the patient, and selecting a treatment regimen that prevents or reduces tumor metastasis in the patient if two or more PCDETERMINANTS are altered in a clinically significant manner.
  • the reference sample e.g., a control sample
  • the reference sample is from a subject that does not have a metastatic cancer, or if the reference sample reflects a value that is relative to a person that has a high likelihood of rapid progression to metastatic prostate cancer, a similarity in the amount of the PCDETERMINANT in the test sample and the reference sample indicates that the treatment is efficacious.
  • a difference in the amount of the PCDETERMINANT in the test sample and the reference sample indicates a less favorable clinical outcome or prognosis.
  • efficacious it is meant that the treatment leads to a decrease in the amount or activity of a PCDETERMINANT protein, nucleic acid, polymorphism, metabolite, or other analyte. Assessment of the risk factors disclosed herein can be achieved using standard clinical protocols. Efficacy can be determined in association with any known method for diagnosing, identifying, or treating a metastatic disease.
  • the present invention also provides PCDETERMINANT panels including one or more PCDETERMINANTS that are indicative of a general physiological pathway associated with a metastatic lesion. For example, one or more PCDETERMINANTS that can be used to exclude or distinguish between different disease states or squeal associated with metastasis.
  • a single PCDETERMINANT may have several of the aforementioned characteristics according to the present invention, and may alternatively be used in replacement of one or more other PCDETERMINANTS where appropriate for the given application of the invention.
  • the present invention also comprises a kit with a detection reagent that binds to two or more PCDETERMINANT proteins, nucleic acids, polymorphisms, metabolites, or other analytes.
  • an array of detection reagents e.g., antibodies and/or oligonucleotides that can bind to two or more PCDETERMINANT proteins or nucleic acids, respectively.
  • the PCDETERMINANT are proteins and the array contains antibodies that bind two or more PCDETERMINANTS 1-372 sufficient to measure a statistically significant alteration in PCDETERMINANT expression compared to a reference value.
  • the PCDETERMINANTS are nucleic acids and the array contains oligonucleotides or aptamers that bind an effective amount of PCDETERMINANTS 1-372 sufficient to measure a statistically significant alteration in PCDETERMINANT expression compared to a reference value.
  • the PCDETERMINANT are proteins and the array contains antibodies that bind an effective amount of PCDETERMINANTS listed on any one of Tables 1-7 sufficient to measure a statistically significant alteration in PCDETERMINANT expression compared to a reference value.
  • the PCDETERMINANTS are nucleic acids and the array contains oligonucleotides or aptamers that bind an effective amount of PCDETERMINANTS listed on any one of Tables 1-7 sufficient to measure a statistically significant alteration in PCDETERMINANT expression compared to a reference value.
  • Also provided by the present invention is a method for treating one or more subjects at risk for developing a metastatic tumor by detecting the presence of altered amounts of an effective amount of PCDETERMINANTS present in a sample from the one or more subjects; and treating the one or more subjects with one or more cancer-modulating drugs until altered amounts or activity of the PCDETERMINANTS return to a baseline value measured in one or more subjects at low risk for developing a metastatic disease, or alternatively, in subjects who do not exhibit any of the traditional risk factors for metastatic disease.
  • Also provided by the present invention is a method for treating one or more subjects having metastatic tumor by detecting the presence of altered levels of an effective amount of PCDETERMINANTS present in a sample from the one or more subjects; and treating the one or more subjects with one or more cancer-modulating drugs until altered amounts or activity of the PCDETERMINANTS return to a baseline value measured in one or more subjects at low risk for developing metastatic tumor.
  • Also provided by the present invention is a method for evaluating changes in the risk of developing metastatic prostate cancer in a subject diagnosed with cancer, by detecting an effective amount of PCDETERMINANTS (which may be two or more) in a first sample from the subject at a first period of time, detecting the amounts of the PCDETERMINANTS in a second sample from the subject at a second period of time, and comparing the amounts of the PCDETERMINANTS detected at the first and second periods of time.
  • PCDETERMINANTS which may be two or more
  • the invention allows the diagnosis and prognosis of a primary, locally invasive and/or metastatic tumor such as prostate, breast, among cancer types.
  • the risk of developing metastatic prostate cancer can be detected by measuring an effective amount of PCDETERMINANT proteins, nucleic acids, polymorphisms, metabolites, and other analytes (which may be two or more) in a test sample (e.g., a subject derived sample), and comparing the effective amounts to reference or index values, often utilizing mathematical algorithms or formula in order to combine information from results of multiple individual PCDETERMINANTS and from non-analyte clinical parameters into a single measurement or index.
  • Subjects identified as having an increased risk of a metastatic prostate cancer or other metastatic cancer types can optionally be selected to receive treatment regimens, such as administration of prophylactic or therapeutic compounds to prevent or delay the onset of metastatic prostate cancer or other metastatic cancer types.
  • the amount of the PCDETERMINANT protein, nucleic acid, polymorphism, metabolite, or other analyte can be measured in a test sample and compared to the "normal control level," utilizing techniques such as reference limits, discrimination limits, or risk defining thresholds to define cutoff points and abnormal values.
  • the "normal control level” means the level of one or more PCDETERMINANTS or combined PCDETERMINANT indices typically found in a subject not suffering from a metastatic tumor.
  • Such normal control level and cutoff points may vary based on whether a PCDETERMINANT is used alone or in a formula combining with other PCDETERMINANTS into an index.
  • the normal control level can be a database of PCDETERMINANT patterns from previously tested subjects who did not develop a metastatic tumor over a clinically relevant time horizon.
  • the present invention may be used to make continuous or categorical measurements of the risk of conversion to metastatic prostate cancer, or other metastatic cancer types thus diagnosing and defining the risk spectrum of a category of subjects defined as at risk for having a metastatic event.
  • the methods of the present invention can be used to discriminate between normal and disease subject cohorts.
  • the present invention may be used so as to discriminate those at risk for having a metastatic event from those having more rapidly progressing (or alternatively those with a shorter probable time horizon to a metastatic event) to a metastatic event from those more slowly progressing (or with a longer time horizon to a metastatic event), or those having metastatic cancer from normal.
  • Such differing use may require different PCDETERMINANT combinations in individual panel, mathematical algorithm, and/or cut-off points, but be subject to the same aforementioned measurements of accuracy and other performance metrics relevant for the intended use.
  • Identifying the subject at risk of having a metastatic event enables the selection and initiation of various therapeutic interventions or treatment regimens in order to delay, reduce or prevent that subject's conversion to a metastatic disease state.
  • Levels of an effective amount of PCDETERMINANT proteins, nucleic acids, polymorphisms, metabolites, or other analytes also allows for the course of treatment of a metastatic disease or metastatic event to be monitored.
  • a biological sample can be provided from a subject undergoing treatment regimens, e.g., drag treatments, for cancer. If desired, biological samples are obtained from the subject at various time points before, during, or after treatment.
  • PCDETERMINANTS By virtue of some PCDETERMINANTS ' being functionally active, by elucidating its function, subjects with high PCDETERMINANTS, for example, can be managed with agents/drags that preferentially target such pathways, functioning through TGF ⁇ signaling, thus, subjects can be treated with agents that enhance of block various components of the TGF ⁇ signaling pathway.
  • the present invention can also be used to screen patient or subject populations in any number of settings.
  • a health maintenance organization, public health entity or school health program can screen a group of subjects to identify those requiring interventions, as described above, or for the collection of epidemiological data.
  • Insurance companies e.g., health, life or disability
  • Data collected in such population screens particularly when tied to any clinical progression to conditions like cancer or metastatic events, will be of value in the operations of, for example, health maintenance organizations, public health programs and insurance companies.
  • Such data arrays or collections can be stored in machine-readable media and used in any number of health- related data management systems to provide improved healthcare services, cost effective healthcare, improved insurance operation, etc.
  • a machine-readable storage medium can comprise a data storage material encoded with machine readable data or data arrays which, when using a machine programmed with instructions for using said data, is capable of use for a variety of purposes, such as, without limitation, subject information relating to metastatic disease risk factors over time or in response drag therapies.
  • Measurements of effective amounts of the biomarkers of the invention and/or the resulting evaluation of risk from those biomarkers can implemented in computer programs executing on programmable computers, comprising, inter alia, a processor, a data storage system (including volatile and non-volatile memory and/or storage elements), at least one input device, and at least one output device.
  • Program code can be applied to input data to perform the functions described above and generate output information.
  • the output information can be applied to one or more output devices, according to methods known in the art.
  • the computer may be, for example, a personal computer, microcomputer, or workstation of conventional design.
  • Each program can be implemented in a high level procedural or object oriented programming language to communicate with a computer system. However, the programs can be implemented in assembly or machine language, if desired. The language can be a compiled or interpreted language.
  • Each such computer program can be stored on a storage media or device (e.g., ROM or magnetic diskette or others as defined elsewhere in this disclosure) readable by a general or special purpose programmable computer, for configuring and operating the computer when the storage media or device is read by the computer to perform the procedures described herein.
  • the health-related data management system of the invention may also be considered to be implemented as a computer-readable storage medium, configured with a computer program, where the storage medium so configured causes a computer to operate in a specific and predefined manner to perform various functions described herein.
  • Levels of an effective amount of PCDETERMINANT proteins, nucleic acids, polymorphisms, metabolites, or other analytes can then be determined and compared to a reference value, e.g. a control subject or population whose metastatic state is known or an index value or baseline value.
  • the reference sample or index value or baseline value may be taken or derived from one or more subjects who have been exposed to the treatment, or may be taken or derived from one or more subjects who are at low risk of developing cancer or a metastatic event, or may be taken or derived from subjects who have shown improvements in as a result of exposure to treatment.
  • the reference sample or index value or baseline value may be taken or derived from one or more subjects who have not been exposed to the treatment.
  • samples may be collected from subjects who have received initial treatment for caner or a metastatic event and subsequent treatment for cancer or a metastatic event to monitor the progress of the treatment.
  • a reference value can also comprise a value derived from risk prediction algorithms or computed indices from population studies such as those disclosed herein.
  • the P CDETERMIN ANT S of the present invention can thus be used to generate a "reference PCDETERMINANT profile" of those subjects who do not have cancer or are not at risk of having a metastatic event, and would not be expected to develop cancer or a metastatic event.
  • the PCDETERMINANTS disclosed herein can also be used to generate a "subject PCDETERMINANT profile" taken from subjects who have cancer or are at risk for having a metastatic event.
  • the subject PCDETERMINANT profiles can be compared to a reference PCDETERMINANT profile to diagnose or identify subjects at risk for developing cancer or a metastatic event, to monitor the progression of disease, as well as the rate of progression of disease, and to monitor the effectiveness of treatment modalities.
  • the reference and subject PCDETERMINANT profiles of the present invention can be contained in a machine-readable medium, such as but not limited to, analog tapes like those readable by a VCR, CD-ROM, DVD- ROM, USB flash media, among others.
  • Such machine-readable media can also contain additional test results, such as, without limitation, measurements of clinical parameters and traditional laboratory risk factors.
  • the machine-readable media can also comprise subject information such as medical history and any relevant family history.
  • the machine-readable media can also contain information relating to other disease-risk algorithms and computed indices such as those described herein.
  • a test sample from the subject can also be exposed to a therapeutic agent or a drug, and the level of one or more of PCDETERMINANT proteins, nucleic acids, polymorphisms, metabolites or other analytes can be determined.
  • the level of one or more PCDETERMINANTS can be compared to sample derived from the subject before and after treatment or exposure to a therapeutic agent or a drug, or can be compared to samples derived from one or more subjects who have shown improvements in risk factors (e.g., clinical parameters or traditional laboratory risk factors) as a result of such treatment or exposure.
  • a subject cell i.e., a cell isolated from a subject
  • a candidate agent i.e., a cell isolated from a subject
  • the pattern of PCDETERMINANT expression in the test sample is measured and compared to a reference profile, e.g., a metastatic disease reference expression profile or a non- disease reference expression profile or an index value or baseline value.
  • the test agent can be any compound or composition or combination thereof, including, dietary supplements.
  • the test agents are agents frequently used in cancer treatment regimens and are described herein.
  • the aforementioned methods of the invention can be used to evaluate or monitor the progression and/or improvement of subjects who have been diagnosed with a cancer, and who have undergone surgical interventions.
  • the performance and thus absolute and relative clinical usefulness of the invention may be assessed in multiple ways as noted above.
  • the invention is intended to provide accuracy in clinical diagnosis and prognosis.
  • the accuracy of a diagnostic or prognostic test, assay, or method concerns the ability of the test, assay, or method to distinguish between subjects having cancer, or at risk for cancer or a metastatic event, is based on whether the subjects have , a "significant alteration” (e.g., clinically significant "diagnostically significant) in the levels of a PCDETERMINANT.
  • a "significant alteration" e.g., clinically significant "diagnostically significant
  • effective amount it is meant that the measurement of an appropriate number of PCDETERMINANTS (which may be one or more) to produce a "significant alteration,” (e.g.
  • PCDETERMINANT level of expression or activity of a PCDETERMINANT
  • the difference in the level of PCDETERMINANT between normal and abnormal is preferably statistically significant.
  • achieving statistical significance, and thus the preferred analytical, diagnostic, and clinical accuracy generally but not always requires that combinations of several PCDETERMINANTS be used together in panels and combined with mathematical algorithms in order to achieve a statistically significant PCDETERMINANT index.
  • an "acceptable degree of diagnostic accuracy” is herein defined as a test or assay (such as the test of the invention for determining the clinically significant presence of P CDETERMIN ANT S , which thereby indicates the presence of cancer and/or a risk of having a metastatic event) in which the AUC (area under the ROC curve for the test or assay) is at least 0.60, desirably at least 0.65, more desirably at least 0.70, preferably at least 0.75, more preferably at least 0.80, and most preferably at least 0.85.
  • a "very high degree of diagnostic accuracy” it is meant a test or assay in which the AUC (area under the ROC curve for the test or assay) is at least 0.75, 0.80, desirably at least 0.85, more desirably at least 0.875, preferably at least 0.90, more preferably at least 0.925, and most preferably at least 0.95.
  • the methods predict the presence or absence of a cancer, metastatic cancer or response to therapy with at least 75% accuracy, more preferably 80%, 85%, 90%, 95%, 97%, 98%, 99% or greater accuracy.
  • the predictive value of any test depends on the sensitivity and specificity of the test, and on the prevalence of the condition in the population being tested. This notion, based on Bayes' theorem, provides that the greater the likelihood that the condition being screened for is present in an individual or in the population (pre-test probability), the greater the validity of a positive test and the greater the likelihood that the result is a true positive. Thus, the problem with using a test in any population where there is a low likelihood of the condition being present is that a positive result has limited value (i.e., more likely to be a false positive). Similarly, in populations at very high risk, a negative test result is more likely to be a false negative.
  • ROC and AUC can be misleading as to the clinical utility of a test in low disease prevalence tested populations (defined as those with less than 1% rate of occurrences (incidence) per annum, or less than 10% cumulative prevalence over a specified time horizon).
  • absolute risk and relative risk ratios as defined elsewhere in this disclosure can be employed to determine the degree of clinical utility.
  • Populations of subjects to be tested can also be categorized into quartiles by the test's measurement values, where the top quartile (25% of the population) comprises the group of subjects with the highest relative risk for developing cancer or metastatic event, and the bottom quartile comprising the group of subjects having the lowest relative risk for developing cancer or a metastatic event.
  • values derived from tests or assays having over 2.5 times the relative risk from top to bottom quartile in a low prevalence population are considered to have a "high degree of diagnostic accuracy," and those with five to seven times the relative risk for each quartile are considered to have a "very high degree of diagnostic accuracy.” Nonetheless, values derived from tests or assays having only 1.2 to 2.5 times the relative risk for each quartile remain clinically useful are widely used as risk factors for a disease; such is the case with total cholesterol and for many inflammatory biomarkers with respect to their prediction of future metastatic events. Often such lower diagnostic accuracy tests must be combined with additional parameters in order to derive meaningful clinical thresholds for therapeutic intervention, as is done with the aforementioned global risk assessment indices.
  • a health economic utility function is an yet another means of measuring the performance and clinical value of a given test, consisting of weighting the potential categorical test outcomes based on actual measures of clinical and economic value for each.
  • Health economic performance is closely related to accuracy, as a health economic utility function specifically assigns an economic value for the benefits of correct classification and the costs of misclassification of tested subjects.
  • As a performance measure it is not unusual to require a test to achieve a level of performance which results in an increase in health economic value per test (prior to testing costs) in excess of the target price of the test.
  • diagnostic accuracy In general, alternative methods of determining diagnostic accuracy are commonly used for continuous measures, when a disease category or risk category (such as those attic risk for having a metastatic event) has not yet been clearly defined by the relevant medical societies and practice of medicine, where thresholds for therapeutic use are not yet established, or where there is no existing gold standard for diagnosis of the pre-disease.
  • measures of diagnostic accuracy for a calculated index are typically based on curve fit and calibration between the predicted continuous value and the actual observed values (or a historical index calculated value) and utilize measures such as R squared, Hosmer- Lemeshow P-value statistics and confidence intervals.
  • biomarkers and methods of the present invention allow one of skill in the art to identify, diagnose, or otherwise assess those subjects who do not exhibit any symptoms of cancer or a metastatic event, but who nonetheless may be at risk for developing cancer or a metastatic event.
  • mice for invasive and metastatic prostate cancer, where the mouse prostate epithelium sustains deletion of Pten and Smad4 gene.
  • Table 1 A comprises two hundred and eighty-four (284) overexpressed/amplified or downregulated/deleted genes.
  • Table IB comprises the three hundred and seventy -two (372) overexpressed/amplified or downregulated/deleted phentotype correlated human homologue PCDETERMINANTS of the present invention.
  • PCDETERMINANTS encompasses all forms and variants, including but not limited to, polymorphisms, isoforms, mutants, derivatives, precursors including nucleic acids and pro-proteins, cleavage products, receptors (including soluble and transmembrane receptors), ligands, protein-ligand complexes, and post-translationally modified variants (such as cross-linking or glycosylation), fragments, and degradation products, as well as any multi-unit nucleic acid, protein, and glycoprotein structures comprised of any of the PCDETERMINANTS as constituent sub-units of the fully assembled structure.
  • PCDETERMINANTS come from a diverse set of physiological and biological pathways, including many which are not commonly accepted to be related to metastatic disease. These groupings of different PCDETERMINANTS, even within those high significance segments, may presage differing signals of the stage or rate of the progression of the disease. Such distinct groupings of PCDETERMINANTS may allow a more biologically detailed and clinically useful signal from the PCDETERMINANTS as well as opportunities for pattern recognition within the PCDETERMINANT algorithms combining the multiple PCDETERMINANT signals.
  • the present invention concerns, in one aspect, a subset of PCDETERMINANTS ; other PCDETERMINANTS and even biomarkers which are not listed in the above Table 1, but related to these physiological and biological pathways, may prove to be useful given the signal and information provided from these studies.
  • biomarker pathway participants i.e., other biomarker participants in common pathways with those biomarkers contained within the list of PCDETERMINANTS in the above Table 1
  • they may be functional equivalents to the biomarkers thus far disclosed in Table 1.
  • biomarkers will be very highly correlated with the biomarkers listed as PCDETERMINANTS in Table 1 (for the purpose of this application, any two variables will be considered to be "very highly correlated" when they have a Coefficient of Determination (R ) of 0.5 or greater).
  • the present invention encompasses such functional and statistical equivalents to the aforementioned PCDETERMINANTS.
  • the statistical utility of such additional PCDETERMINANTS is substantially dependent on the cross-correlation between multiple biomarkers and any new biomarkers will often be required to operate within a panel in order to elaborate the meaning of the underlying biology.
  • One or more, preferably two or more of the listed PCDETERMINANTS can be detected in the practice of the present invention. For example, two (2), three (3), four (4), five (5), ten (10), fifteen (15), twenty (20), forty (40), fifty (50), seventy-five (75), one hundred (100), one hundred and twenty five (125), one hundred and fifty (150), one hundred and seventy-five (175), two hundred (200), two hundred and ten (210), two hundred and twenty (220), two hundred and thirty (230), two hundred and forty (240), two hundred and fifty (250), two hundred and sixty (260) or more, two hundred and seventy (270) or more, two hundred and eighty (280) or more, two hundred and ninety (290) or more, three hundred (300) or more, three hundred and ten (310) or more, three hundred and twenty (320) or more, three hundred and thirty (330) or more, three hundred and forty (340) or more, three hundred and fifty (350) or more, three hundred and sixty
  • all 372 PCDETERMINANTS listed herein can be detected.
  • Preferred ranges from which the number of PCDETERMINANTS can be detected include ranges bounded by any minimum selected from between one and 372, particularly two, four, five, ten, twenty, fifty, seventy-five, one hundred, one hundred and twenty five, one hundred and fifty, one hundred and seventy-five, two hundred, two hundred and ten, two hundred and twenty, two hundred and thirty, two hundred and forty, two hundred and fifty, paired with any maximum up to the total known P CDETERMIN ANT S , particularly four, five, ten, twenty, fifty, and seventy- five.
  • Particularly preferred ranges include two to five (2-5), two to ten (2-10), two to fifty (2-50), two to seventy-five (2-75), two to one hundred (2-100), five to ten (5-10), five to twenty (5-20), five to fifty (5-50), five to seventy-five (5-75), five to one hundred (5-100), ten to twenty (10-20), ten to fifty (10-50), ten to seventy-five (10-75), ten to one hundred (10-100), twenty to fifty (20-50), twenty to seventy-five (20-75), twenty to one hundred (20-100), fifty to seventy-five (50-75), fifty to one hundred (50-100), one hundred to one hundred and twenty-five (100-125), one hundred and twenty- five to one hundred and fifty (125-150), one hundred and fifty to one hundred and seventy five (150-175), one hundred and seventy-five to two hundred (175-200), two hundred to two hundred and ten (200-210), two hundred and ten to two hundred and twenty (210-220), two
  • a "panel” within the context of the present invention means a group of biomarkers (whether they are PCDETERMINANTS, clinical parameters, or traditional laboratory risk factors) that includes more than one PCDETERMINANT.
  • a panel can also comprise additional biomarkers, e.g., clinical parameters, traditional laboratory risk factors, known to be present or associated with cancer or cancer metastasis, in combination with a selected group of the PCDETERMINANTS listed in Table 1.
  • a common measure of statistical significance is the p-value, which indicates the probability that an observation has arisen by chance alone; preferably, such p-values are 0.05 or less, representing a 5% or less chance that the observation of interest arose by chance. Such p- values depend significantly on the power of the study performed.
  • PCDETERMINANTS can also be used as multi-biomarker panels comprising combinations of PCDETERMINANTS that are known to be involved in one or more physiological or biological pathways, and that such information can be combined and made clinically useful through the use of various formulae, including statistical classification algorithms and others, combining and in many cases extending the performance characteristics of the combination beyond that of the individual PCDETERMINANTS .
  • These specific combinations show an acceptable level of diagnostic accuracy, and, when sufficient information from multiple PCDETERMINANTS is combined in a trained formula, often reliably achieve a high level of diagnostic accuracy transportable from one population to another.
  • the suboptimal performance in terms of high false positive rates on a single biomarker measured alone may very well be an indicator that some important additional information is contained within the biomarker results - information which would not be elucidated absent the combination with a second biomarker and a mathematical formula.
  • formula such as statistical classification algorithms can be directly used to both select PCDETERMINANTS and to generate and train the optimal formula necessary to combine the results from multiple PCDETERMINANTS into a single index.
  • techniques such as forward (from zero potential explanatory parameters) and backwards selection (from all available potential explanatory parameters) are used, and information criteria, such as AIC or BIC, are used to quantify the tradeoff between the performance and diagnostic accuracy of the panel and the number of PCDETERMINANTS used.
  • information criteria such as AIC or BIC
  • any formula may be used to combine PCDETERMINANT results into indices useful in the practice of the invention.
  • indices may indicate, among the various other indications, the probability, likelihood, absolute or relative risk, time to or rate of conversion from one to another disease states, or make predictions of future biomarker measurements of metastatic disease. This may be for a specific time period or horizon, or for remaining lifetime risk, or simply be provided as an index relative to another reference subject population.
  • model and formula types beyond those mentioned herein and in the definitions above are well known to one skilled in the art.
  • the actual model type or formula used may itself be selected from the field of potential models based on the performance and diagnostic accuracy characteristics of its results in a training population.
  • the specifics of the formula itself may commonly be derived from PCDETERMINANT results in the relevant training population.
  • such formula may be intended to map the feature space derived from one or more PCDETERMINANT inputs to a set of subject classes (e.g. useful in predicting class membership of subjects as normal, at risk for having a metastatic event, having cancer), to derive an estimation of a probability function of risk using a Bayesian approach (e.g. the risk of cancer or a metastatic event), or to estimate the class-conditional probabilities, then use Bayes' rule to produce the class probability function as in the previous case.
  • subject classes e.g. useful in predicting class membership of subjects as normal, at risk for having a metastatic event, having cancer
  • Bayesian approach
  • Preferred formulas include the broad class of statistical classification algorithms, and in particular the use of discriminant analysis.
  • the goal of discriminant analysis is to predict class membership from a previously identified set of features.
  • LDA linear discriminant analysis
  • features can be identified for LDA using an eigengene based approach with different thresholds (ELDA) or a stepping algorithm based on a multivariate analysis of variance (MANOVA). Forward, backward, and stepwise algorithms can be performed that minimize the probability of no separation based on the Hotelling-Lawley statistic.
  • ELDA Eigengene -based Linear Discriminant Analysis
  • the formula selects features (e.g. biomarkers) in a multivariate framework using a modified eigen analysis to identify features associated with the most important eigenvectors. "Important” is defined as those eigenvectors that explain the most variance in the differences among samples that are trying to be classified relative to some threshold.
  • SVM support vector machine
  • a support vector machine (SVM) is a classification formula that attempts to find a hyperplane that separates two classes. This hyperplane contains support vectors, data points that are exactly the margin distance away from the hyperplane.
  • an overall predictive formula for all subjects, or any known class of subjects may itself be recalibrated or otherwise adjusted based on adjustment for a population's expected prevalence and mean biomarker parameter values, according to the technique outlined in D'Agostino et al, (2001) JAMA 286: 180-187, or other similar normalization and recalibration techniques.
  • Such epidemiological adjustment statistics may be captured, confirmed, improved and updated continuously through a registry of past data presented to the model, which may be machine readable or otherwise, or occasionally through the retrospective query of stored samples or reference to historical studies of such parameters and statistics. Additional examples that may be the subject of formula recalibration or other adjustments include statistics used in studies by Pepe, M.S.
  • numeric result of a classifier formula itself may be transformed post-processing by its reference to an actual clinical population and study results and observed endpoints, in order to calibrate to absolute risk and provide confidence intervals for varying numeric results of the classifier or risk formula.
  • An example of this is the presentation of absolute risk, and confidence intervals for that risk, derived using an actual clinical study, chosen with reference to the output of the recurrence score formula in the Oncotype Dx product of Genomic Health, Inc. (Redwood City, CA).
  • a further modification is to adjust for smaller sub-populations of the study based on the output of the classifier or risk formula and defined and selected by their Clinical Parameters, such as age or sex.
  • Clinical Parameters may be used in the practice of the invention as a PCDETERMINANT input to a formula or as a pre-selection criteria defining a relevant population to be measured using a particular PCDETERMINANT panel and formula.
  • Clinical Parameters may also be useful in the biomarker normalization and preprocessing, or in PCDETERMINANT selection, panel construction, formula type selection and derivation, and formula result post-processing.
  • a similar approach can be taken with the Traditional Laboratory Risk Factors, as either an input to a formula or as a pre-selection criterium.
  • PCDETERMINANTS can be determined at the protein or nucleic acid level using any method known in the art. For example, at the nucleic acid level, Northern and Southern hybridization analysis, as well as ribonuclease protection assays using probes which specifically recognize one or more of these sequences can be used to determine gene expression. Alternatively, amounts of PCDETERMINANTS can be measured using reverse-transcription-based PCR assays (RT-PCR), e.g., using primers specific for the differentially expressed sequence of genes or by branch-chain RNA amplification and detection methods by Panomics, Inc.
  • RT-PCR reverse-transcription-based PCR assays
  • Amounts of PCDETERMINANTS can also be determined at the protein level, e.g., by measuring the levels of peptides encoded by the gene products described herein, or subcellular localization or activities thereof using technological platform such as for example AQUA® (HistoRx, New Haven, CT) or US Patent No . 7,219,016.
  • Such methods are well known in the art and include, e.g., immunoassays based on antibodies to proteins encoded by the genes, aptamers or molecular imprints. Any biological material can be used for the detection/quantification of the protein or its activity.
  • a suitable method can be selected to determine the activity of proteins encoded by the marker genes according to the activity of each protein analyzed.
  • the PCDETERMINANT proteins, polypeptides, mutations, and polymorphisms thereof can be detected in any suitable manner, but is typically detected by contacting a sample from the subject with an antibody which binds the PCDETERMINANT protein, polypeptide, mutation, or polymorphism and then detecting the presence or absence of a reaction product.
  • the antibody may be monoclonal, polyclonal, chimeric, or a fragment of the foregoing, as discussed in detail above, and the step of detecting the reaction product may be carried out with any suitable immunoassay.
  • the sample from the subject is typically a biological fluid as described above, and may be the same sample of biological fluid used to conduct the method described above.
  • Immunoassays carried out in accordance with the present invention may be homogeneous assays or heterogeneous assays.
  • the immunological reaction usually involves the specific antibody (e.g., anti- PCDETERMINANT protein antibody), a labeled analyte, and the sample of interest.
  • the signal arising from the label is modified, directly or indirectly, upon the binding of the antibody to the labeled analyte.
  • Both the immunological reaction and detection of the extent thereof can be carried out in a homogeneous solution.
  • Immunochemical labels which may be employed include free radicals, radioisotopes, fluorescent dyes, enzymes, bacteriophages, or coenzymes.
  • the reagents are usually the sample, the antibody, and means for producing a detectable signal.
  • Samples as described above may be used.
  • the antibody can be immobilized on a support, such as a bead (such as protein A and protein G agarose beads), plate or slide, and contacted with the specimen suspected of containing the antigen in a liquid phase.
  • the support is then separated from the liquid phase and either the support phase or the liquid phase is examined for a detectable signal employing means for producing such signal.
  • the signal is related to the presence of the analyte in the sample.
  • Means for producing a detectable signal include the use of radioactive labels, fluorescent labels, or enzyme labels.
  • an antibody which binds to that site can be conjugated to a detectable group and added to the liquid phase reaction solution before the separation step.
  • the presence of the detectable group on the solid support indicates the presence of the antigen in the test sample.
  • suitable immunoassays are oligonucleotides, immunoblotting, immunofluorescence methods, immunoprecipitation, chemiluminescence methods, electrochemiluminescence (ECL) or enzyme-linked immunoassays.
  • Antibodies can be conjugated to a solid support suitable for a diagnostic assay (e.g., beads such as protein A or protein G agarose, microspheres, plates, slides or wells formed from materials such as latex or polystyrene) in accordance with known techniques, such as passive binding.
  • a diagnostic assay e.g., beads such as protein A or protein G agarose, microspheres, plates, slides or wells formed from materials such as latex or polystyrene
  • Antibodies as described herein may likewise be conjugated to detectable labels or groups such as radiolabels (e.g., 35 S, 125 I, 131 I), enzyme labels (e.g., horseradish peroxidase, alkaline phosphatase), and fluorescent labels (e.g., fluorescein, Alexa, green fluorescent protein, rhodamine) in accordance with known techniques.
  • radiolabels e.g., 35 S, 125 I, 131 I
  • enzyme labels e.g., horseradish peroxidase, alkaline phosphatase
  • fluorescent labels e.g., fluorescein, Alexa, green fluorescent protein, rhodamine
  • Antibodies can also be useful for detecting post-translational modifications of PCDETERMINANT proteins, polypeptides, mutations, and polymorphisms, such as tyrosine phosphorylation, threonine phosphorylation, serine phosphorylation, glycosylation (e.g., O- GIcNAc).
  • Such antibodies specifically detect the phosphorylated amino acids in a protein or proteins of interest, and can be used in immunoblotting, immunofluorescence, and ELISA assays described herein. These antibodies are well-known to those skilled in the art, and commercially available.
  • Post-translational modifications can also be determined using metastable ions in reflector matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI- TOF) (Wirth, U. et al. (2002) Proteomics 2(10): 1445-51).
  • MALDI- TOF reflector matrix-assisted laser desorption ionization-time of flight mass spectrometry
  • PCDETERMINANT proteins, polypeptides, mutations, and polymorphisms known to have enzymatic activity the activities can be determined in vitro using enzyme assays known in the art.
  • enzyme assays include, without limitation, kinase assays, phosphatase assays, reductase assays, among many others.
  • Modulation of the kinetics of enzyme activities can be determined by measuring the rate constant K M using known algorithms, such as the Hill plot, Michaelis-Menten equation, linear regression plots such as Lineweaver-Burk analysis, and Scatchard plot.
  • sequence information provided by the database entries for the PCDETERMINANT sequences expression of the PCDETERMINANT sequences can be detected (if present) and measured using techniques well known to one of ordinary skill in the art.
  • sequences within the sequence database entries corresponding to PCDETERMINANT sequences, or within the sequences disclosed herein can be used to construct probes for detecting PCDETERMINANT RNA sequences in, e.g., Northern blot hybridization analyses or methods which specifically, and, preferably, quantitatively amplify specific nucleic acid sequences.
  • sequences can be used to construct primers for specifically amplifying the PCDETERMINANT sequences in, e.g., amplification-based detection methods such as reverse- transcription based polymerase chain reaction (RT-PCR).
  • amplification-based detection methods such as reverse- transcription based polymerase chain reaction (RT-PCR).
  • RT-PCR reverse- transcription based polymerase chain reaction
  • sequence comparisons in test and reference populations can be made by comparing relative amounts of the examined DNA sequences in the test and reference cell populations.
  • RNA levels can be measured at the RNA level using any method known in the art. For example, Northern hybridization analysis using probes which specifically recognize one or more of these sequences can be used to determine gene expression. Alternatively, expression can be measured using reverse-transcription-based PCR assays (RT- PCR), e.g., using primers specific for the differentially expressed sequences. RNA can also be quantified using, for example, other target amplification methods (e.g., TMA, SDA, NASBA), or signal amplification methods (e.g., bDNA), and the like.
  • RT-PCR reverse-transcription-based PCR assays
  • RNA can also be quantified using, for example, other target amplification methods (e.g., TMA, SDA, NASBA), or signal amplification methods (e.g., bDNA), and the like.
  • PCDETERMINANT protein and nucleic acid metabolites can be measured.
  • the term "metabolite” includes any chemical or biochemical product of a metabolic process, such as any compound produced by the processing, cleavage or consumption of a biological molecule (e.g., a protein, nucleic acid, carbohydrate, or lipid).
  • Metabolites can be detected in a variety of ways known to one of skill in the art, including the refractive index spectroscopy (RI), ultra-violet spectroscopy (UV), fluorescence analysis, radiochemical analysis, near-infrared spectroscopy (near-IR), nuclear magnetic resonance spectroscopy (NMR), light scattering analysis (LS), mass spectrometry, pyrolysis mass spectrometry, nephelometry, dispersive Raman spectroscopy, gas chromatography combined with mass spectrometry, liquid chromatography combined with mass spectrometry, matrix-assisted laser desorption ionization- time of flight (MALDI-TOF) combined with mass spectrometry, ion spray spectroscopy combined with mass spectrometry, capillary electrophoresis, NMR and IR detection.
  • RI refractive index spectroscopy
  • UV ultra-violet spectroscopy
  • fluorescence analysis radiochemical analysis
  • radiochemical analysis near-inf
  • PCDETERMINANT analytes can be measured using the above-mentioned detection methods, or other methods known to the skilled artisan.
  • circulating calcium ions Ca 2+
  • fluorescent dyes such as the Fluo series, Fura-2A, Rhod- 2, among others.
  • Other PCDETERMINANT metabolites can be similarly detected using reagents that are specifically designed or tailored to detect such metabolites.
  • the invention also includes a PCDETERMINANT-detection reagent, e.g., nucleic acids that specifically identify one or more PCDETERMINANT nucleic acids by having homologous nucleic acid sequences, such as oligonucleotide sequences, complementary to a portion of the PCDETERMINANT nucleic acids or antibodies to proteins encoded by the PCDETERMINANT nucleic acids packaged together in the form of a kit.
  • the oligonucleotides can be fragments of the PCDETERMINANT genes.
  • the oligonucleotides can be 200, 150, 100, 50, 25, 10 or less nucleotides in length.
  • the kit may contain in separate containers a nucleic acid or antibody (either already bound to a solid matrix or packaged separately with reagents for binding them to the matrix), control formulations (positive and/or negative), and/or a detectable label such as fluorescein, green fluorescent protein, rhodamine, cyanine dyes, Alexa dyes, luciferase, radiolabels, among others.
  • Instructions e.g., written, tape, VCR, CD-ROM, etc.
  • the assay may for example be in the form of a Northern hybridization or a sandwich ELISA as known in the art.
  • PCDETERMINANT detection reagents can be immobilized on a solid matrix such as a porous strip to form at least one PCDETERMINANT detection site.
  • the measurement or detection region of the porous strip may include a plurality of sites containing a nucleic acid.
  • a test strip may also contain sites for negative and/or positive controls. Alternatively, control sites can be located on a separate strip from the test strip.
  • the different detection sites may contain different amounts of immobilized nucleic acids, e.g., a higher amount in the first detection site and lesser amounts in subsequent sites.
  • the number of sites displaying a detectable signal provides a quantitative indication of the amount of PCDETERMINANTS present in the sample.
  • the detection sites may be configured in any suitably detectable shape and are typically in the shape of a bar or dot spanning the width of a test strip.
  • the kit contains a nucleic acid substrate array comprising one or more nucleic acid sequences.
  • the nucleic acids on the array specifically identify one or more nucleic acid sequences represented by PCDETERMINANTS 1-372.
  • the expression of 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 40, 50, 100, 125, 150, 175, 200, 250, 275 or more of the sequences represented by PCDETERMINANTS 1-372 can be identified by virtue of binding to the array.
  • the substrate array can be on, e.g., a solid substrate, e.g., a "chip" as described in U.S. Patent No.5,744,305.
  • the substrate array can be a solution array, e.g., xMAP (Luminex, Austin, TX), Cyvera (Illumina, San Diego, CA), CellCard (Vitra Bioscience, Mountain View, CA) and Quantum Dots' Mosaic (Invitrogen, Carlsbad, CA).
  • xMAP Luminex, Austin, TX
  • Cyvera Illumina, San Diego, CA
  • CellCard Vitra Bioscience, Mountain View, CA
  • Quantum Dots' Mosaic Invitrogen, Carlsbad, CA.
  • Suitable sources for antibodies for the detection of PCDETERMINANTS include commercially available sources such as, for example, Abazyme, Abnova, Affinity Biologicals, AntibodyShop, Biogenesis, Biosense Laboratories, Calbiochem, Cell Sciences, Chemicon International, Chemokine, Clontech, Cytolab, DAKO, Diagnostic BioSystems, eBioscience, Endocrine Technologies, Enzo Biochem, Eurogentec, Fusion Antibodies, Genesis Biotech, GloboZymes, Haematologic Technologies, Immunodetect, Immunodiagnostik, Immunometrics, Immunostar, Immunovision, Biogenex, Invitrogen, Jackson ImmunoResearch Laboratory, KMI Diagnostics, Koma Biotech, LabFrontier Life Science Institute, Lee Laboratories, Lifescreen, Maine Biotechnology Services, Mediclone, MicroPharm Ltd., ModiQuest, Molecular Innovations, Molecular Probes, Neoclone, Neuromics, New England Biolabs, Novocastra, Novus
  • the invention provides a method for treating, preventing or alleviating a symptom of cancer in a subject by decreasing expression or activity of PCDETERMINANTS 1-245 or increasing expression or activity of PCDETERMINANTS 246-272
  • Therapeutic compounds are administered prophylactically or therapeutically to subject suffering from at risk of (or susceptible to) developing cancer. Such subjects are identified using standard clinical methods or by detecting an aberrant level of expression or activity of (e.g., PCDETERMINANTS 1-372).
  • Therapeutic agents include inhibitors of cell cycle regulation, cell proliferation, and protein kinase activity.
  • the therapeutic method includes increasing the expression, or function, or both of one or more gene products of genes whose expression is decreased ("underexpressed genes") in a cancer cell relative to normal cells of the same tissue type from which the cancer cells are derived.
  • underexpressed genes genes whose expression is decreased
  • the subject is treated with an effective amount of a compound, which increases the amount of one of more of the underexpressed genes in the subject.
  • Administration can be systemic or local.
  • Therapeutic compounds include a polypeptide product of an underexpressed gene, or a biologically active fragment thereof a nucleic acid encoding an underexpressed gene and having expression control elements permitting expression in the cancer cells; for example an agent which increases the level of expression of such gene endogenous to the cancer cells (i.e., which up-regulates expression of the underexpressed gene or genes).
  • an agent which increases the level of expression of such gene endogenous to the cancer cells i.e., which up-regulates expression of the underexpressed gene or genes.
  • Administration of such compounds counter the effects of aberrantly -under expressed of the gene or genes in the subject's cells and improves the clinical condition of the subject
  • the method also includes decreasing the expression, or function, or both, of one or more gene products of genes whose expression is aberrantly increased (“overexpressed gene") in cancer cells relative to normal cells.
  • Expression is inhibited in any of several ways known in the art. For example, expression is inhibited by administering to the subject a nucleic acid that inhibits, or antagonizes, the expression of the overexpressed gene or genes, e.g., an antisense oligonucleotide which disrupts expression of the overexpressed gene or genes.
  • function of one or more gene products of the overexpressed genes is inhibited by administering a compound that binds to or otherwise inhibits the function of the gene products.
  • the compound is an antibody which binds to the overexpressed gene product or gene products.
  • modulatory methods are performed ex vivo or in vitro ⁇ e.g., by culturing the cell with the agent) or, alternatively, in vivo ⁇ e.g., by administering the agent to a subject).
  • the method involves administering a protein or combination of proteins or a nucleic acid molecule or combination of nucleic acid, molecules as therapy to counteract aberrant expression or activity of the differentially expressed genes.
  • Diseases and disorders that are characterized by increased (relative to a subject not suffering from the disease or disorder) levels or biological activity of the genes may be treated with therapeutics that antagonize ⁇ i.e., reduce or inhibit) activity of the overexpressed gene or genes.
  • Therapeutics that antagonize activity are administered therapeutically or prophylactically. (e.g. vaccines)
  • Therapeutics that may be utilized include, e.g., ( ⁇ ) a polypeptide, or analogs, derivatives, fragments or homologs thereof of the overexpressed or underexpressed sequence or sequences; (H) antibodies to the overexpressed or underexpressed sequence or sequences; (Hi) nucleic acids encoding the over or underexpressed sequence or sequences; (iv) antisense nucleic acids or nucleic acids that are "dysfunctional" (i.e., due to a heterologous insertion within the coding sequences of coding sequences of one or more overexpressed or underexpressed sequences); or (v) modulators (i.e., inhibitors, agonists and antagonists that alter the interaction between an over/underexpressed polypeptide and its binding partner.
  • modulators i.e., inhibitors, agonists and antagonists that alter the interaction between an over/underexpressed polypeptide and its binding partner.
  • the dysfunctional antisense molecule are utilized to "knockout" endogenous function of a polypeptide by homologous recombination (see, e.g., Capecchi, Science 244: 1288-1292 1989)
  • Diseases and disorders that are characterized by decreased (relative to a subject not suffering from the disease or disorder) levels or biological activity may be treated with therapeutics that increase (i.e., are agonists to) activity.
  • Therapeutics that upregulate activity may be administered in a therapeutic or prophylactic manner.
  • Therapeutics that may be utilized include, but are not limited to, a polypeptide (or analogs, derivatives, fragments or homologs thereof) or an agonist that increases bioavailability.
  • Transgenic animals of the invention have one or both endogenous alleles of the Pten and Smad4 genes in nonfunctional form. Inactivation can be achieved by modification of the endogenous gene, usually, a deletion, substitution or addition to a coding region of the gene. The modification can prevent synthesis of a gene product or can result in a gene product lacking functional activity. Typical modifications are the introduction of an exogenous segment, such as a selection marker, within an exon thereby disrupting the exon or the deletion of an exon. [000190] Inactivation of endogenous genes in mice can be achieved by homologous recombination between an endogenous gene in a mouse embryonic stem (ES) cell and a targeting construct.
  • ES mouse embryonic stem
  • the targeting construct contains a positive selection marker flanked by segments of the gene to be targeted.
  • the segments are from the same species as the gene to be targeted (e.g., mouse).
  • the segments can be obtained from another species, such as human, provided they have sufficient sequence identity with the gene to be targeted to undergo homologous recombination with it.
  • the construct also contains a negative selection marker positioned outside one or both of the segments designed to undergo homologous recombination with the endogenous gene (see U.S. Pat. No. 6,204,061).
  • the construct also contains a pair of site-specific recombination sites, such as frt, position within or at the ends of the segments designed to undergo homologous recombination with the endogenous gene.
  • the construct is introduced into ES cells, usually by electroporation, and undergoes homologous recombination with the endogenous gene introducing the positive selection marker and parts of the flanking segments (and frt sites, if present) into the endogenous gene.
  • ES cells having undergone the desired recombination can be selected by positive and negative selection. Positive selection selects for cells that have undergone the desired homologous recombination, and negative selection selects against cells that have undergone negative recombination.
  • ES cells are obtained from preimplantation embryos cultured in vitro. Bradley et al., Nature 309, 255 258 (1984) (incorporated by reference in its entirety for all purposes).
  • Transformed ES cells are combined with blastocysts from a non-human animal. The ES cells colonize the embryo and in some embryos form or contribute to the germline of the resulting chimeric animal. See Jaenisch, Science, 240, 1468 1474 (1988) (incorporated by reference in its entirety for all purposes).
  • Chimeric animals can be bred with nontransgenic animals to generate heterozygous transgenic animals. Heterozygous animals can be bred with each other to generate homozygous animals.
  • Either heterozygous or homozygous animals can be bred with a transgenic animal expressing the flp recombinase. Expression of the recombinase results in excision of the portion of DNA between introduced frt sites, if present.
  • Functional inactivation can also be achieved for other species, such as rats, rabbits and other rodents, bovines such as sheep, caprines such as goats, porcines such as pigs, and bovines such as cattle and buffalo, are suitable.
  • animals other than mice nuclear transfer technology is preferred for generating functionally inactivated genes. See Lai et al., Sciences 295, 1089 92 (2002).
  • Various types of cells can be employed as donors for nuclei to be transferred into oocytes, including ES cells and fetal fibrocytes.
  • Donor nuclei are obtained from cells cultured in vitro into which a construct has been introduced and undergone homologous recombination with an endogenous gene, as described above (see WO 98/37183 and WO 98/39416, each incorporated by reference in their entirety for all purposes). Donor nuclei are introduced into oocytes by means of fusion, induced electrically or chemically (see any one of WO 97/07669, WO 98/30683 and WO 98/39416), or by microinjection (see WO 99/37143, incorporated by reference in its entirety for all purposes).
  • Transplanted oocytes are subsequently cultured to develop into embryos which are subsequently implanted in the oviducts of pseudopregnant female animals, resulting in birth of transgenic offspring (see any one of WO 97/07669, WO 98/30683 and WO 98/39416).
  • Transgenic animals bearing heterozygous transgenes can be bred with each other to generate transgenic animals bearing homozygous transgenes.
  • Some transgenic animals of the invention have both an inactivation of one or both alleles of Pten and Smad4 genes and a second transgene that confers an additional phenotype related to prostate cancer, its pathology or underlying biochemical processes.
  • This disruption can be achievement by recombinase-mediated excision of Pten or Smad genes with embedded LoxP site (i.e., the current strain) or by for example mutational knock-in, and RNAi-mediated extinction of these genes either in a germline configuration or in somatic transduction of prostate epithelium in situ or in cell culture followed by reintroduction of these primary cells into the renal capsule or orthotopically.
  • Other engineering strategies are also obvious including chimera formation using targeted ES clones that avoid germline transmission.
  • Pten and Smad4 conditional alleles, senotypins and expression analysis [000195] The Pten loxP and Smad4 loxP conditional knockout alleles have been described elsewhere. Prostate epithelium-specific deletion was effected by the PB-Cre4 25 .
  • the PCR genotyping strategy for (i) Pten utilizes primers 1 (5'- CTTCGGAGCATGTCTGGCAATGC -3'), 2 (5'-CTGCACGAGACTAGTGAGACGTGC-S'), and 3 (5' -AAGGAAGAGGGTGGGGAT ACS') and (ii) Smad4 utilizes primers 1 (5'-GGGAACAGAGCACAGGCCTCTGTGACAG-S ') and 2 (5'- TTCACTGTGTAGCCCCGCCTGTCCTGGA-S'). TO detect the Smad4 deleted allele, primers 2 and 3 (5'- TGCTCTGAGCTCACAATTCTCCT-3') were used.
  • Prostate cancer tissue was dissected from Pten loxp/loxp ;Smad4 loxp/loxp ;PB-Cre4 + mouse, minced, and digested with 0.5% type I collagenase (Invitrogen) as described previously. After filtering through a 40- ⁇ m mesh, the trapped fragments were plated in tissue culture dishes coated with type I collagen (BD Pharmingen). Cells with typical epithelial morphology were collected, and single cells were seeded into each well of a 96-well plate.
  • type I collagenase Invitrogen
  • DMEM fetal bovine serum
  • FBS fetal bovine serum
  • bovine pituitary extract 25 ⁇ g/mL bovine pituitary extract
  • 5 ⁇ g/mL bovine insulin 5 ⁇ g/mL bovine insulin
  • 6 ng/mL recombinant human epidermal growth factor Sigma- Aldrich.
  • Smad4 inducible cell lines the mouse Pten/Smad4 null prostate tumor cell lines were transduced with pTRE-Tight vector (Clontech) containing the human SMAD4 coding region and tet-on stable cell lines were established according to the manufacturer's protocol.
  • SMAD4 induction was achieved with 1 ⁇ g/ml doxycycline (dox) and verified by Western blot analysis.
  • dox ⁇ g/ml doxycycline
  • prostate epithelial cells were plated in 96-well plates at 5000 cells/well in 100 ⁇ l of 5% charcoal-stripped FBS-containing medium. After 2 days incubation, the medium was replaced. Cells viability was measured on day 4 using CellTiter-Glo Luminescent Cell Viability Kit (Promega, Madison, WI) according to the manufacturer's protocol.
  • Trans criptomic. genomic and in silico promoter analyses were used.
  • the TFBS module was also used to scan for binding sites within the 3-kb promoter sequences, which were downloaded from Ensembl via Biomart. The observed transcription factor binding sites in the target gene set were compared to those in a randomly selected background (mouse genome) gene set. A z-score and p-value (Statistics: :Distributions from CPAN) were calculated to determine if a given binding site was over-represented in the target gene set.
  • Prostate-specific deletion of the Pten tumor suppressor results in prostate intraepithelial neoplasia (PIN) and, following a long latency, occasional lesions can progress to adenocarcinoma, albeit with minimally invasive and metastatic features.
  • PIN prostate intraepithelial neoplasia
  • TGF ⁇ superfamily of ligands comprising of TGF ⁇ , bone morphogenetic proteins (BMPs), and activins families, bind to a type II receptor, which recruits and phosphorylates a type I receptor.
  • the type I receptor in turn phosphorylates receptor-regulated SMADs (R-SMADs).
  • R-SMADs receptor-regulated SMADs
  • Pb-Cre4 prostate-specific deleter
  • EXAMPLE 6 INTEGRATIVE ANALYSES DEFINE A SET OF PREDICTED SMAD4 TARGETS IN METASTATIC-CAPABLE PRIMARY TUMORS.
  • EXAMPLE 7 CROSS-SPECIES TRIANGULATED SMAD4 TRANSCRIPTIONAL TARGETS ARE LINKED TO CLINICAL OUTCOME
  • EXAMPLE 9 PCDETERMINANTS EXHIBIT PROGRESSION CORRELATED EXPRESSION IN HUMAN PROSTATE CANCER
  • This metastasis signature comprising of 372 PCDETERMINANTS differentially expressed at the RNA level in metastatic-prone versus indolent mouse tumors was next interfaced with a large compendium of genes that reside in copy number aberrations (CNAs) in a human metastatic prostate cancer datasct 19 .
  • CNAs copy number aberrations
  • Common orthologous genes showing significant differential expression between Pten pc ⁇ ' and Pten pc ⁇ ' Smad4 pc ⁇ ' mouse prostate tumors as well as copy number alteration in metastatic human prostate tumors were selected for further computational analysis. .
  • This analysis identified 56 PCDETERMINANTS (Table 7 which are differentially expressed at the RNA level in metastasis-prone mouse tumors and the DNA level in metastatic human prostate cancer (Figre 6A).
  • the 56 gene set (Table 7) was subsequently evaluated for prognostic utility on a prostate cancer gene expression data set.
  • Patient samples were categorized into two major clusters (low risk group and high risk group) defined by the 56-gene signature.
  • Kaplan-Meier analysis of biochemical recurrence (BCR) PSA level (>0.2 ng/ml) based on the groups defined by the 56-gene cluster.
  • EXAMPLE 11 GENETIC SCREENS TO IDENTIFY PCDETERMINANTS FUNCTIONALLY
  • EXAMPLE 14 PCDETERMINANTS ARE PROGNOSTIC IN BREAST
  • PCDETERMINANTS While discovered in the context of prostate cancer, PCDETERMINANTS likely regulate core metastatic processes relevant to multiple cancer types.
  • PCDETERMINANTS While discovered in the context of prostate cancer, PCDETERMINANTS likely regulate core metastatic processes relevant to multiple cancer types.
  • Table 7 the56 cross-species/cross-platform-filtered PCDETERMINANTS (Table 7) for prognostic utility on a breast adenocarcinoma dataset.
  • TGFbeta the molecular Jekyll and Hyde of cancer. Nat. Rev. Cancer 6, 506-520 (2006).
  • TGFbeta primes breast tumors for lung metastasis seeding through angiopoietin-like 4.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Urology & Nephrology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Environmental Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Plant Pathology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Husbandry (AREA)
PCT/US2009/050885 2008-07-16 2009-07-16 Signatures and pcdeterminants associated with prostate cancer and methods of use thereof Ceased WO2010009337A2 (en)

Priority Applications (13)

Application Number Priority Date Filing Date Title
CN2009801363207A CN102159727A (zh) 2008-07-16 2009-07-16 与前列腺癌有关的信号和胆碱磷酸决定子以及它们的使用方法
NZ590851A NZ590851A (en) 2008-07-16 2009-07-16 Signatures and pcdeterminants associated with prostate cancer and methods of use thereof
AU2009270851A AU2009270851A1 (en) 2008-07-16 2009-07-16 Signatures and PCDETERMINANTS associated with prostate cancer and methods of use thereof
US13/054,468 US20110265197A1 (en) 2008-07-16 2009-07-16 Signatures and PCDeterminants Associated with Prostate Cancer and Methods of Use Thereof
MX2011000451A MX2011000451A (es) 2008-07-16 2009-07-16 Distintivos y determinantes asociados con cancer de próstata y métodos para utilizarlos.
JP2011518921A JP2011528442A (ja) 2008-07-16 2009-07-16 前立腺癌に関連した兆候およびpcdeterminant、ならびにそれらの使用方法
EP09744246A EP2318543A2 (en) 2008-07-16 2009-07-16 Signatures and pcdeterminants associated with prostate cancer and methods of use thereof
CA2730614A CA2730614A1 (en) 2008-07-16 2009-07-16 Signatures and pcdeterminants associated with prostate cancer and methods of use thereof
BRPI0916229A BRPI0916229A2 (pt) 2008-07-16 2009-07-16 assinaturas e determinantes pcs associados com câncer de próstata e métodos de utilização dos mesmos
IL210681A IL210681A0 (en) 2008-07-16 2011-01-16 Signatures and pcdeterminants associated with prostate cancer and methods of use thereof
ZA2011/01132A ZA201101132B (en) 2008-07-16 2011-02-11 Signatures and pcdeterminants associated with prostate cancer and methods of use thereof
US14/174,072 US20140235479A1 (en) 2008-07-16 2014-02-06 Signatures and pcdeterminants associated with prostate cancer and methods of use thereof
US15/337,966 US20170299594A1 (en) 2008-07-16 2016-10-28 Signatures and pcdeterminants associated with prostate cancer and methods of use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US8128608P 2008-07-16 2008-07-16
US61/081,286 2008-07-16

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US13/054,468 A-371-Of-International US20110265197A1 (en) 2008-07-16 2009-07-16 Signatures and PCDeterminants Associated with Prostate Cancer and Methods of Use Thereof
US14/174,072 Continuation US20140235479A1 (en) 2008-07-16 2014-02-06 Signatures and pcdeterminants associated with prostate cancer and methods of use thereof

Publications (3)

Publication Number Publication Date
WO2010009337A2 true WO2010009337A2 (en) 2010-01-21
WO2010009337A9 WO2010009337A9 (en) 2010-03-04
WO2010009337A3 WO2010009337A3 (en) 2010-07-22

Family

ID=41551019

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/050885 Ceased WO2010009337A2 (en) 2008-07-16 2009-07-16 Signatures and pcdeterminants associated with prostate cancer and methods of use thereof

Country Status (14)

Country Link
US (3) US20110265197A1 (https=)
EP (1) EP2318543A2 (https=)
JP (1) JP2011528442A (https=)
KR (1) KR20110052627A (https=)
CN (1) CN102159727A (https=)
AU (1) AU2009270851A1 (https=)
BR (1) BRPI0916229A2 (https=)
CA (1) CA2730614A1 (https=)
IL (1) IL210681A0 (https=)
MX (1) MX2011000451A (https=)
NZ (1) NZ590851A (https=)
RU (1) RU2011105627A (https=)
WO (1) WO2010009337A2 (https=)
ZA (1) ZA201101132B (https=)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012061510A3 (en) * 2010-11-03 2012-06-28 Merck Sharp & Dohme Corp. Methods of predicting cancer cell response to therapeutic agents
WO2013031757A1 (ja) * 2011-08-29 2013-03-07 東レ株式会社 膵癌、乳癌、肺癌又は前立腺癌の検出用マーカー及び検査方法
US8725426B2 (en) 2012-01-31 2014-05-13 Genomic Health, Inc. Gene expression profile algorithm and test for determining prognosis of prostate cancer
JP2014516552A (ja) * 2011-06-02 2014-07-17 アルマック ダイアグノスティックス リミテッド 癌の分子的診断検査
EP2917373A4 (en) * 2012-11-09 2016-06-01 Dana Farber Cancer Inst Inc METABOLIC PROFILING IN TISSUE AND SERUM AS INDICATOR FOR TUMOR-SPECIFICATION IN PROSTATE CANCER
US9458510B2 (en) 2011-06-27 2016-10-04 Mietamark Genetics, Inc. Signatures and determinants associated with prostate cancer progression and methods of use thereof
US10260104B2 (en) 2010-07-27 2019-04-16 Genomic Health, Inc. Method for using gene expression to determine prognosis of prostate cancer
US10280468B2 (en) 2014-02-07 2019-05-07 Almac Diagnostics Limited Molecular diagnostic test for predicting response to anti-angiogenic drugs and prognosis of cancer
US11091809B2 (en) 2012-12-03 2021-08-17 Almac Diagnostic Services Limited Molecular diagnostic test for cancer
US11639528B2 (en) 2015-11-05 2023-05-02 Board Of Trustees Of The University Of Illinois Process for the identification of patients at risk for OSCC
US11694802B2 (en) 2016-01-22 2023-07-04 Otraces Inc. Systems and methods for improving diseases diagnosis
US11699527B2 (en) 2013-03-14 2023-07-11 Otraces, Inc. Method for improving disease diagnosis using measured analytes

Families Citing this family (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2840472A1 (en) * 2011-06-22 2012-12-27 Oncocyte Corporation Methods and compositions for the treatment and diagnosis of bladder cancer
WO2013163134A2 (en) * 2012-04-23 2013-10-31 The Trustees Of Columbia University In The City Of New York Biomolecular events in cancer revealed by attractor metagenes
NZ703411A (en) 2012-06-27 2017-09-29 Berg Llc Use of markers in the diagnosis and treatment of prostate cancer
US20140011685A1 (en) * 2012-07-03 2014-01-09 Yixin Wang Genomic diagnostics using circulating endothelial cells
KR101456683B1 (ko) * 2013-01-04 2014-11-06 서울대학교산학협력단 폐암 진단용 마커
WO2014152443A2 (en) * 2013-03-14 2014-09-25 The Board Of Regents Of The University Of Texas System Single-cell analysis as a sensitive and specific method for early prostate cancer detection
CN103602720A (zh) * 2013-06-24 2014-02-26 复旦大学附属肿瘤医院 前列腺癌基因标记物在标记前列腺癌复发和转移中的用途及方法
GB201322034D0 (en) 2013-12-12 2014-01-29 Almac Diagnostics Ltd Prostate cancer classification
AU2014375206B2 (en) * 2014-01-03 2021-09-30 Innosign B.V. Assessment of the PI3K cellular signaling pathway activity using mathematical modelling of target gene expression.
BR112016017132B1 (pt) 2014-01-28 2024-01-30 Quest Diagnostics Investments Incorporated Métodos para identificar uma zona de célula tipo tronco de câncer, uma zona de transição de adenoma-adenocarcinoma, um tumor de cólon, células-tronco de câncer, um indivíduo com câncer colorretal provável de responder favoravelmente ao tratamento com uma terapia alvejada pela via nf-kb, um indivíduo com perda genômica de 18q/smad4 e de 10q/pten, para diagnosticar um indivíduo com alto grau de adenoma de cólon e adenocarcinoma inicial, e para determinar a probabilidade de um tumor de cólon em um indivíduo passar por uma transformação invasiva se deixado sem tratamento e a probabilidade de um indivíduo com câncer colorretal (crc) responder favoravelmente ao tratamento com uma terapia alvejada pela via tgf-beta, e, kit para identificar uma região de transição de (...).
US9994912B2 (en) 2014-07-03 2018-06-12 Abbott Molecular Inc. Materials and methods for assessing progression of prostate cancer
SG10202012249YA (en) 2014-12-08 2021-01-28 Berg Llc Use of markers including filamin a in the diagnosis and treatment of prostate cancer
US11174518B2 (en) 2015-10-05 2021-11-16 Cedars-Sinai Medical Center Method of classifying and diagnosing cancer
US11079745B2 (en) * 2015-11-25 2021-08-03 Lawrence Livermore National Security, Llc Rapid closed-loop control based on machine learning
KR101881874B1 (ko) * 2016-04-29 2018-07-26 한국수력원자력 주식회사 저선량 방사선 조사에 의한 암화 예방 방법
US10927070B2 (en) 2016-06-09 2021-02-23 Cedars-Sinai Medical Center Compositions and methods for treating cancer
EP3507360A4 (en) * 2016-08-30 2020-07-29 Beth Israel Deaconess Medical Center Inc. COMPOSITIONS AND TREATMENT METHODS FOR TUMOR SUPPRESSOR-DEFICIENT CANCER
US10487365B2 (en) 2016-09-20 2019-11-26 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Methods for detecting expression of lnc-FANCI-2 in cervical cells
CA2984267A1 (en) * 2016-11-01 2018-05-01 Medarchon, Inc. Patient handoff device, system and predictive method
EP4001437A1 (en) * 2016-11-07 2022-05-25 The United States of America, as represented by The Secretary, Department of Health and Human Services Methods for selecting therapy for a cancer patient
US10767164B2 (en) 2017-03-30 2020-09-08 The Research Foundation For The State University Of New York Microenvironments for self-assembly of islet organoids from stem cells differentiation
WO2019213133A1 (en) * 2018-04-30 2019-11-07 City Of Hope Cancer detection and ablation system and method
MY204234A (en) 2018-08-27 2024-08-16 Regeneron Pharma Use of raman spectroscopy in downstream purification
JP6888123B2 (ja) * 2018-10-15 2021-06-16 イルミナ インコーポレイテッド 深層畳み込みニューラルネットワークを事前訓練するための深層学習ベースの技術
CA3126432A1 (en) * 2019-02-01 2020-08-06 Health Research, Inc. Methods and compositions for treating resistant and recurrent forms of cancer
WO2020163581A1 (en) 2019-02-06 2020-08-13 Berg Llc Markers for the diagnosis of biochemical recurrence in prostate cancer
WO2021062261A1 (en) * 2019-09-25 2021-04-01 The Trustees Of Columbia University In The City Of New York Prognostic markers of metastatic cancer
KR102380529B1 (ko) * 2020-04-29 2022-03-31 인제대학교 산학협력단 전이성 전립선 암의 진단 및 예후 예측을 위한 혈중종양세포 기반 바이오 마커 조성물
US12271832B2 (en) * 2021-02-12 2025-04-08 Tempus Ai, Inc. Artificial intelligence engine for directed hypothesis generation and ranking
WO2026078234A1 (en) * 2024-10-10 2026-04-16 Consiglio Nazionale Delle Ricerche Prognostic signature for prostate cancer classification

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7526387B2 (en) * 2003-07-10 2009-04-28 Genomic Health, Inc. Expression profile algorithm and test for cancer prognosis
WO2006086345A2 (en) * 2005-02-07 2006-08-17 The Trustees Of Columbia University In The City Of New York Methods to treat or prevent hormone-resistant prostate cancer using sirna specific for protocadherin-pc, or other inhibitors of protocadherin-pc expression or activity
CN101454331A (zh) * 2006-03-24 2009-06-10 菲诺梅诺米发现公司 有效用于诊断前列腺癌的生物标记,及其方法

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
None

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10260104B2 (en) 2010-07-27 2019-04-16 Genomic Health, Inc. Method for using gene expression to determine prognosis of prostate cancer
WO2012061515A3 (en) * 2010-11-03 2012-06-28 Merck Sharp & Dohme Corp. Methods of classifying human subjects with regard to cancer prognosis
WO2012061510A3 (en) * 2010-11-03 2012-06-28 Merck Sharp & Dohme Corp. Methods of predicting cancer cell response to therapeutic agents
US10260097B2 (en) 2011-06-02 2019-04-16 Almac Diagnostics Limited Method of using a gene expression profile to determine cancer responsiveness to an anti-angiogenic agent
JP2014516552A (ja) * 2011-06-02 2014-07-17 アルマック ダイアグノスティックス リミテッド 癌の分子的診断検査
US9458510B2 (en) 2011-06-27 2016-10-04 Mietamark Genetics, Inc. Signatures and determinants associated with prostate cancer progression and methods of use thereof
WO2013031757A1 (ja) * 2011-08-29 2013-03-07 東レ株式会社 膵癌、乳癌、肺癌又は前立腺癌の検出用マーカー及び検査方法
US8725426B2 (en) 2012-01-31 2014-05-13 Genomic Health, Inc. Gene expression profile algorithm and test for determining prognosis of prostate cancer
US11011252B1 (en) 2012-01-31 2021-05-18 Genomic Health, Inc. Gene expression profile algorithm and test for determining prognosis of prostate cancer
EP2917373A4 (en) * 2012-11-09 2016-06-01 Dana Farber Cancer Inst Inc METABOLIC PROFILING IN TISSUE AND SERUM AS INDICATOR FOR TUMOR-SPECIFICATION IN PROSTATE CANCER
US11091809B2 (en) 2012-12-03 2021-08-17 Almac Diagnostic Services Limited Molecular diagnostic test for cancer
US11699527B2 (en) 2013-03-14 2023-07-11 Otraces, Inc. Method for improving disease diagnosis using measured analytes
US10280468B2 (en) 2014-02-07 2019-05-07 Almac Diagnostics Limited Molecular diagnostic test for predicting response to anti-angiogenic drugs and prognosis of cancer
US11639528B2 (en) 2015-11-05 2023-05-02 Board Of Trustees Of The University Of Illinois Process for the identification of patients at risk for OSCC
US11694802B2 (en) 2016-01-22 2023-07-04 Otraces Inc. Systems and methods for improving diseases diagnosis

Also Published As

Publication number Publication date
EP2318543A2 (en) 2011-05-11
US20110265197A1 (en) 2011-10-27
JP2011528442A (ja) 2011-11-17
US20140235479A1 (en) 2014-08-21
AU2009270851A1 (en) 2010-01-21
ZA201101132B (en) 2012-07-25
MX2011000451A (es) 2011-10-12
WO2010009337A3 (en) 2010-07-22
KR20110052627A (ko) 2011-05-18
IL210681A0 (en) 2011-03-31
CN102159727A (zh) 2011-08-17
WO2010009337A9 (en) 2010-03-04
NZ590851A (en) 2012-08-31
BRPI0916229A2 (pt) 2015-11-03
RU2011105627A (ru) 2012-08-27
US20170299594A1 (en) 2017-10-19
CA2730614A1 (en) 2010-01-21

Similar Documents

Publication Publication Date Title
WO2010009337A2 (en) Signatures and pcdeterminants associated with prostate cancer and methods of use thereof
US20200232988A1 (en) Signatures and determinants associated with prostate cancer progression and methods of use thereof
Wilkinson et al. Nascent prostate cancer heterogeneity drives evolution and resistance to intense hormonal therapy
Morton et al. LKB1 haploinsufficiency cooperates with Kras to promote pancreatic cancer through suppression of p21-dependent growth arrest
Mithal et al. PTEN loss in biopsy tissue predicts poor clinical outcomes in prostate cancer
Ishikawa et al. ADAM8 as a novel serological and histochemical marker for lung cancer
US20110182881A1 (en) Signature and determinants associated with metastasis and methods of use thereof
Linn et al. Deletion of interstitial genes between TMPRSS2 and ERG promotes prostate cancer progression
FitzGerald et al. Investigation of the relationship between prostate cancer and MSMB and NCOA4 genetic variants and protein expression
Van De Stolpe et al. RNA based approaches to profile oncogenic pathways from low quantity samples to drive precision oncology strategies
Correnti et al. The protease‐inhibitor SerpinB3 as a critical modulator of the stem‐like subset in human cholangiocarcinoma
Ho et al. Prostate cancer cell phenotypes based on AGR2 and CD10 expression
Donovan et al. Predicting high-risk disease using tissue biomarkers
Steffen et al. Molecular features of lymph node metastasis in T1/2 colorectal cancer from formalin-fixed paraffin-embedded archival specimens
US20070128639A1 (en) Molecular profiling of cancer
Lee et al. Loss of LPAR6 and CAB39L dysregulates the basal-to-luminal urothelial differentiation program, contributing to bladder carcinogenesis
WO2022082317A1 (en) Gene signature for predicting progression and progress of urinary cancers and methods of use thereof
Grbesa et al. SPOP mutation confers sensitivity to AR-targeted therapy in prostate cancer by reshaping the androgen-driven chromatin landscape
Huang et al. IR-B deficiency and fatty acid dysregulation accelerate prostate cancer progression via PI3K/AKT signaling
Threadgill et al. ERBB2 deficiency enhances colorectal cancer progression through EGFR-dependent compensatory mechanisms
Hornick et al. EDUCATION COMMITTEE
WO2023209401A1 (en) Prostate cancer markers
Magers et al. Molecular Pathology of Genitourinary Cancers: Translating the Cancer Genome to the Clinic
MORTON et al. BASIC—LIVER, PANCREAS, AND BILIARY TRACT
Zhou et al. www. impactjournals. com/oncotarget

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200980136320.7

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09744246

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2730614

Country of ref document: CA

Ref document number: 2011518921

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2011/000451

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 283/KOLNP/2011

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2009744246

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 590851

Country of ref document: NZ

Ref document number: 2009270851

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 20117003408

Country of ref document: KR

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2011105627

Country of ref document: RU

ENP Entry into the national phase

Ref document number: 2009270851

Country of ref document: AU

Date of ref document: 20090716

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 13054468

Country of ref document: US

ENP Entry into the national phase

Ref document number: PI0916229

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20110117