WO2010004304A1 - Nouveaux composés et leurs procédés de production - Google Patents

Nouveaux composés et leurs procédés de production Download PDF

Info

Publication number
WO2010004304A1
WO2010004304A1 PCT/GB2009/050689 GB2009050689W WO2010004304A1 WO 2010004304 A1 WO2010004304 A1 WO 2010004304A1 GB 2009050689 W GB2009050689 W GB 2009050689W WO 2010004304 A1 WO2010004304 A1 WO 2010004304A1
Authority
WO
WIPO (PCT)
Prior art keywords
alkyl
acyl
strain
compound according
avermectin
Prior art date
Application number
PCT/GB2009/050689
Other languages
English (en)
Inventor
Steven James Moss
Barrie Wilkinson
Christine Janet Martin
Anna Elaine Stanley
Ursula Elisabeth Schell
Original Assignee
Biotica Technology Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB0811062A external-priority patent/GB0811062D0/en
Priority claimed from GB0904542A external-priority patent/GB0904542D0/en
Application filed by Biotica Technology Limited filed Critical Biotica Technology Limited
Priority to EP09785241A priority Critical patent/EP2313419A1/fr
Priority to JP2011514131A priority patent/JP2011524413A/ja
Publication of WO2010004304A1 publication Critical patent/WO2010004304A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D498/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D498/12—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and oxygen atoms as the only ring hetero atoms in which the condensed system contains three hetero rings
    • C07D498/18—Bridged systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/06—Antipsoriatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/10—Antimycotics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection

Definitions

  • the present invention relates to novel FK506 and FK520 analogues generated by feeding non-natural starter units to bacterial strains and to use of such compounds in therapy.
  • FK506 tacrolimus/fujimycin/Prograf
  • FK520 ascomycin or immunomycin
  • Figure 1 are lipophilic macrolides produced by a variety of actinomycetes, including Streptomyces tsukubuaensis No. 9993 (Hatanaka et al., 1989), Streptomyces sp, MA8858, Streptomyces sp.
  • FK525 also known as FR-900525 (Hatanaka H, et al., 1989)
  • FK523 also known as FR-900523
  • antascomicins Fehr, T., et al., 1996.
  • a number of semisynthetic derivatives of these molecules have also been shown to be of utility, including pimecrolimus (SDZ ASM 981 , Elidel), which is a derivative of FK520 (Meingassner et al., 1997).
  • PKS polyketide synthases
  • the avermectin PKS naturally incorporates branched chain keto acids (Ikeda et al., 1999), but has been found to additionally incorporate a variety of other non- natural carboxylic acids when fed exogenously to fermentation broths (Dutton et al., 1991 ).
  • This capability is encoded on the PKS by the loading module, which consists of a section of the PKS including an Acyltransferase domain (AT) and an Acyl Carrier Protein domain (ACP) (Ikeda et al., 1999).
  • PKS with loading modules with similar specificities to the avermectin PKS include nemadectin (Carter et al., 1988) and milbemycin (Takiguchi et al., 1980; Okazaki et al., 1983). Methods for elucidating the sequence of PKS gene clusters have been published previously, examples include using homologous probes to screen cosmid libraries (e.g. Oliynyk et al., 2003, Fang et al., 2007, Choi et al., 2007) and full genome sequencing is another approach.
  • FK506, FK520 and close analogues suppress the immune system by inhibiting signal transduction pathways required for T-cell activation and growth.
  • they have been shown to inhibit Ca 2+ -dependent T-cell proliferation, via initial formation of a complex with an FK-binding protein (FKBP), which binds to and blocks calcineurin (CaN).
  • FKBP FK-binding protein
  • This FK506-FKBP-CaN complex inhibits the activation of nuclear factor of activated t-cells (NF-AT), preventing its entrance into the nucleus, and subsequent activation of the promoter of lnterleukin-2 (IL-2), which initiates IL-2 production.
  • NF-AT nuclear factor of activated t-cells
  • IL-2 lnterleukin-2
  • FK506 can interfere with the action of calcineurin on substrates other than NFAT, including IKB, Na-K- ATPase and nitric oxide synthase, which may lead to some of the side-effects (Kapturczak et al., 2004).
  • TGF- ⁇ transforming growth factor beta
  • FK506 and FK520 also have antifungal activity (Heitman et al., 1991 , Brizuela et al., 1991 ).
  • USES: FK506 in particular, is an important immunosuppressant used to aid prevention of organ rejection after transplantation.
  • it is used intravenously and orally for the prevention of organ rejection after allogeneic liver or kidney transplantation and in bone marrow transplantation. It has been shown to have potential utility in a wide variety of autoimmune, inflammatory and respiratory disorders, including Crohn's disease, Behcet syndrome, uveitis, psoriasis, atopic dermatitis, rheumatoid arthritis, nephritic syndrome, aplastic anaemia, biliary cirrhosis, asthma, pulmonary fibrosis, chronic obstructive pulmonary disease (COPD) and celiac disease.
  • COPD chronic obstructive pulmonary disease
  • FK506 FK506, which include renal dysfunction, gastrointestinal effects, neurological effects, hyperthrichosis and gingival hyperplasia.
  • Pimecrolimus and FK506 are both used in topical formulations, such as ointments and creams, as treatments for a variety of skin conditions, in particular atopic dermatitis (Nghiem et al., 2002).
  • Cytochrome P450 3A4 (Cyp3A4) and Cyp3A5 are the most important contributors to FK506 metabolism while the P-glycoprotein pump (MDR-1 ) modulates its bioavailability (Roy et al., 2006). The complexity of FK506 dosing is therefore enhanced by significant drug-drug interactions (Kapturczak et al., 2004).
  • the mechanism of toxicity of FK506 and FK520 has been related to the mechanism of action of immunosuppression (F. Dumont et al., 1992). This strong link between the mechanism of action and the toxicity has presented significant challenges to improving the therapeutic index through chemical modification. Segregation of efficacy and toxicity of new analogues may be possible by altering distribution or metabolism (NH Signal et al., 1991 ). By limiting the exposure of the compound to organs that are sensitive to such inhibition, such as the kidney, systemic toxicity can be avoided. Additionally, topical administration of the calcineurin inhibitor at the site of administration (such as skin, lungs, gut, eye etc.) can be maximized. One way this can be achieved is by using a 'soft drug' approach, which involves designing compounds to have limited systemic exposure such as through increased metabolism, higher blood/plasma protein binding, poor absorption or bioavailability.
  • variable metabolism of FK506 leads to some of the toxicity, due to variable levels of systemic exposure, which led to the need for constant drug monitoring (Armstrong and Oellerich, 2001 ). Therefore, analogues of FK506 with reduced or less variable metabolism could be useful in reducing toxicity, and reducing the need for constant monitoring of drug levels.
  • FK506 is also poorly bioavailable (Tamura et al., 2003), which leads to variable systemic exposure when dosed orally, and the frequent need for intravenous dosing. Therefore, analogues with improved oral bioavailability would be very useful, to reduce systemic toxicity through incorrect dosing, and improve the ease of oral dosing. Therefore, there remains a need to identify novel FK506 and FK520 analogues, which may have utility in the maintenance of immunosuppression, both for organ transplantation, and for the treatment of inflammatory conditions, and for the treatment of fungal infections.
  • novel FK506 and FK520 analogues which have improved pharmaceutical properties compared with the currently available FK506 and FK520 analogues; these properties may be useful for therapies requiring good systemic bioavailability, including, but not limited to oral therapies to maintain immunosuppression, which in particular are expected to show improvements in respect of one or more of the following properties: increased metabolic stability, increased bioavailability, increased oral bioavailability, reduced efflux via membrane transporters and low plasma protein binding;
  • the novel FK506 and FK520 analogues may also be useful for therapies requiring local availability but with poor systemic availability, including, but not limited to topically administered therapies for inflammatory disorders such as atopic dermatitis, asthma and inflammatory bowel diseases, which in particular are expected to show improvements in respect of one or more of the following properties: decreased metabolic stability, decreased bioavailability, decreased oral bioavailability, increased efflux via membrane transporters and high plasma protein binding;
  • non-natural starter units are fed to strains normally producing FK506 or FK520 or analogues thereof, said strains optionally having been mutated to have targeted inactivation or deletion of one or more genes responsible for post-PKS modification, and/or targeted inactivation or deletion of one or more precursor supply genes, including fkbO and homologues thereof.
  • the natural loading module from the FK506 or FK520 polyketide synthase is replaced by the loading module from the avermectin or an avermectin-like polyketide synthase, and optionally non-natural starter units are fed to these strains, said strains optionally having been mutated to have targeted inactivation or deletion of one or more genes responsible for post-PKS modification, and/or targeted inactivation or deletion of one or more precursor supply genes, including bkd genes (Ward et al., 1999) and homologues thereof.
  • unnatural starter acids have been found to be incorporated at different levels into the FK506 and FK520 systems when compared to the rapamycin system.
  • pyrans are very well incorporated, leading to high yields of FK506 and FK520 analogues.
  • X a represents bond or CH 2 ;
  • Ri is selected from the group consisting of
  • R 10 , Rn and R 12 are independently selected from H, F, Cl, OR 13 , SR 13 and NHR 13 and R 13 is selected from H, CrC 4 alkyl and Ci-C 4 acyl; and
  • A is selected from O, S and NR 13a
  • R 13a represents H, CrC 4 alkyl or Ci-C 4 acyl
  • R 14 and R 15 are independently selected from H, CrC 4 alkyl, OR 16 , SR 16 and NHR 16
  • R 16 represents CrC 4 alkyl or Ci-C 4 acyl
  • X b represents a bond or CH 2
  • R 17 represents H and when X b is CH 2 then R 17 represents H, F, Cl, OH, SH, Ci-C 4 alkyl
  • OR i6a , SRi6a or NHR 163 and Ri 6a represents Ci-C 4 alkyl or Ci-C 4 acyl
  • Ri 6a represents Ci-C 4 alkyl or Ci-C 4 acyl
  • Ri3b represents H, Ci-C 4 alkyl, or Ci-C 4 acyl
  • Ri 4a represents Ci-C 4 alkyl
  • Ri6 represents Ci-C 4 alkyl or Ci-C 4 acyl
  • Ri 8 represents H, F, Cl, OH, SH, Ci-C 4 alkyl
  • R i6a represents Ci-C 4 alkyl or Ci-C 4 acyl
  • X c and X d independently represent bond or CH 2 provided that X c and X d do not both represent CH 2 and when X c is bond then Ri 7a represents H and when X c is CH 2 then Ri 7a represents H, F, Cl, OH, SH, Ci-C 4 alkyl, ORi 6b , SRi 6b or NHRi 6b , Ri 6b represents CrC 4 alkyl
  • Ri 9b and R 20 independently represent H, F, Cl, OH, SH, CrC 4 alkyl, ORi 6d , SRi 6d or NHRi 6d , and Ri 6d represents Ci-C 4 alkyl or CrC 4 acyl;
  • Ri 9c represents H, F, Cl, OH, SH, C r C 4 alkyl, ORi 6e , SRi 6e or NHRi 6e , and R i6e represents CrC 4 alkyl or CrC 4 acyl;
  • R 19d and R 2 Oa independently represent H, F, Cl, OH, SH, d-C 4 alkyl, ORi 6f , SRi6f or NHR 16 f and Ri 6 f represents CrC 4 alkyl or d-C 4 acyl ;
  • R 18a , Ri 9e and R 2Ob independently represent H, F, Cl, OH, SH, d-C 4 alkyl, ORi6g, SRi6g or NHR 16g and Ri 6g represents CrC 4 alkyl or d-C 4 acyl;
  • R 2 i, R 22 and R 23 independently represent H, F, Cl, OR 26 , SR 26 , CrC 4 alkyl or CN
  • R 26 represents H, d-C 4 alkyl or d-C 4 acyl
  • R 24 and R 25 independently represent H, F, Cl, OH, SH or CrC 4 alkyl, provided that at least one of R 2 i, R 22 and R 23 is not H or d-C 4 alkyl
  • R 2 i a , R22a and R 2 3a are independently selected from H, F, Cl, OR 26a , SR 26a , C1- C4 alkyl and CN
  • R 26a represents H, d-C 4 alkyl or d-C 4 acyl
  • R 24a and R 25a independently represent H, F, Cl, OH, SH or d-C 4 alkyl and provided that at least one of R 2 i a , R 22a and R 23a does not represent H or d-C 4 alky
  • the invention embraces all stereoisomers of the compounds defined by structure (I) as shown above.
  • the present invention provides FK506 or FK520 analogues such as compounds of formula (I) or a pharmaceutically acceptable salt thereof, for use as a pharmaceutical.
  • analogue means one analogue or more than one analogue.
  • analogue(s) refers to chemical compounds that are structurally similar to another but which differ slightly in composition (as in the replacement of one atom by another or in the presence or absence of a particular functional group).
  • FK506 and FK520 analogues refer to compounds related to FK506, FK520 and similar compounds in structure. Such compounds are 22-membered rings with one lactone and one amide bond. The N of the amide bond forms a 2-carboxyl piperidine or a 2-carboxyl pyrrolidine. This carboxyl group forms the lactone group, with an oxygen that is allylic to a double bond that is exo to the main 22-membered ring.
  • Such compounds include, without limitation, FK520, FK506, antascomicin, FK523, FK525, pimecrolimus and tsukubamycin as well as compounds of formula (I).
  • FK506 or FK520 producing strain refers to a strain (natural or recombinant) which is capable of producing one or more FK506 or FK520 analogues when fed appropriately.
  • recombinant strain of a FK506 or FK520 producing host refers to a recombinant strain based on a natural FK506 or FK520 producing strain which is capable of producing one or more FK506 or FK520 analogues when fed appropriately.
  • FK506 or FK520 cluster means the PKS and associated enzymes responsible for production of FK506 or FK520 analogues.
  • modifying gene(s) includes the genes required for post- polyketide synthase modifications of the polyketide, for example but without limitation cytochrome P-450 monooxygenases, ferredoxins and SAM-dependent O-methyltransferases.
  • these modifying genes include fkbD and fkbM, but a person of skill in the art will appreciate that PKS systems related to FK520 (for example but without limitation: FK506, antascomicin, FK523, FK525 and tsukubamycin) will have homologues of at least a subset of these genes, some of which are discussed further below.
  • precursor supply gene(s) includes the genes required for the supply of the natural or non-natural precursors, the genes required for the synthesis of any naturally or non-naturally incorporated precursors and the genes required for the incorporation of any naturally or non-naturally incorporated precursors.
  • these genes include fkbL, fkbO and fkbP but a person of skill in the art will appreciate that PKS systems related to FK506 and FK520 (for example but without limitation: antascomicin, FK523, FK525 and tsukubamycin) will have homologues of these genes, some of which are discussed further below.
  • auxiliary gene(s) includes references to modifying genes, precursor supply genes or both modifying genes and precursor supply genes.
  • One example of an auxiliary gene is an oxygenase which may hydroxylate the starter unit.
  • basic product refers to the initial product of the polyketide synthase enzyme before the action of any modifying genes.
  • non-natural starter unit refers to any compounds which can be incorporated as a starter unit in polyketide synthesis that are not the starter unit usually chosen (i.e. incorporated) by that PKS.
  • avermectin-like PKS means the PKS of a bacterium producing a avermectin-like polyketide such as nemadectin or milbemycin which contains a loading domain consisting of AT and ACP domain and which naturally incorporates branched chain starter acids such as those of the present invention.
  • C1-4 acyl groups include C2-4 acyl groups such as -COMe and -COEt, especially COMe. CHO is a further example which is less preferred.
  • C1-4 alkyl groups include Me, Et, n-Pr, i-Pr, n-Bu, especially Me.
  • Physiologically functional derivatives of compounds of formula (I) include physiologically acceptable salts, esters and solvates.
  • Pharmaceutically acceptable salts include the non-toxic acid addition salt forms of the compounds of formula (I).
  • the pharmaceutically acceptable acid addition salts can conveniently be obtained by treating the base form with such appropriate acid.
  • Appropriate acids comprise, for example, inorganic acids such as hydrohalic acids, e.g. hydrochloric or hydrobromic acid, sulphuric, nitric, phosphoric and the like acids; or organic acids such as, for example, acetic, propanoic, hydroxyacetic, lactic, pyruvic, oxalic (i.e. ethanedioic), malonic, succinic (i.e.
  • butanedioic acid maleic, fumaric, malic (i.e. hydroxyl- butanedioic acid), tartaric, citric, methanesulfonic, ethanesulfonic, benzenesulfonic, p-toluenesulfonic, cyclamic, salicylic, p-aminosalicylic, pamoic and the like acids.
  • salt forms can be converted by treatment with an appropriate base into the free base form.
  • Example esters include labile esters which are cleaved in the body, for example carboxylic acid esters formed with hydroxyl groups.
  • Example solvates include hydrates.
  • X a represents a bond. In another embodiment X a represents CH 2 . Preferably X a represents CH 2 .
  • X b represents bond.
  • X c represents bond
  • X d represents bond
  • R 1 represents [A]. In another embodiment R 1 represents [B]. In another embodiment R 1 represents [C]. In another embodiment R 1 represents [D]. In another embodiment R 1 represents [E]. In another embodiment R 1 represents [F]. In another embodiment R 1 represents [G]. In another embodiment R 1 represents [H]. In another embodiment R 1 represents [J]. In another embodiment R 1 represents [K].
  • Ri 0 represents OH.
  • Rn represent H.
  • Ri 2 represents H.
  • Ri 3 , Ri 3a and Ri 3b represent H.
  • A represents O or S.
  • Ri 4 represents H.
  • Ri 4a represents H.
  • Ri 5 represents H.
  • Ri 6 represents H.
  • Ri 6a represents H.
  • Ri 6 b represents H.
  • Ri 6c represents H.
  • Ri 6 d represents
  • Ri 6e represents H.
  • Ri 6f represents H.
  • Ri 6g represents H.
  • Ri 7 represents H.
  • Ri 7a represents H.
  • Ri 8 represents H.
  • Ri 8a represents H.
  • Ri 9 represents H.
  • Ri 9a represents H.
  • Ri 9b represents H.
  • Ri 9c represents H.
  • Ri 9e represents OH.
  • R 20 represents H.
  • R 20 b represents OH.
  • R 2 i represents H or F. More preferably R 2 i represents F.
  • R 2 i a represents H or F. More preferably R 2 i a represents F.
  • R 22 represents H or F. More preferably R 22 represents F.
  • R 22a represents H or F. More preferably R 22a represents F.
  • R 23 represents H or F. More preferably R 23 represents F.
  • R 23a represents H or F. More preferably R 23a represents F.
  • R 24 represents OH.
  • R 24a represents OH.
  • R 25 represents H
  • R 25a represents H.
  • R 26 and R 26a represent H.
  • Ri represents G
  • R 20 b represents OH
  • Ri 9e and Ri 8a represent H
  • R 2 represents CH 2 CH 3
  • R 3 0
  • X a represents CH 2 , as shown by the following s sttrruuccttuurree:
  • R 1 represents [J]
  • R 22 represents OH
  • R 2 i, R 23 , R 24 and R 25 represent H
  • R 2 represents CH 2 CH 3
  • R 3 0
  • X a represents CH 2 , as shown by the following structure:
  • R 1 represents [B]
  • A represents S
  • R 17 , R 1S , and R 14 represent H
  • X b represents bond
  • R 2 represents CH 2 CH 3
  • R 3 0
  • X a represents CH 2 , as shown by the following structure:
  • R 1 represents [B]
  • A represents O
  • Ri 7 , Ri 5 , and Ri 4 represent H
  • X b represents bond
  • R 2 represents CH 2 CH 3
  • R 3 0
  • X a represents CH 2 , as shown by the following structure, also known as Pyran FK520 or 28-des(3-c/s-methoxy-4- frans-hydroxycyclohexyl)-28-(4-tetrahydro-2H-pyran)FK520:
  • R 1 represents [E]
  • Ri 9c represents H
  • R 2 represents CH 2 CH 3
  • R 3 0
  • X a represents CH 2 , as shown by the following structure:
  • R 1 represents [D]
  • R 20 and Rigb represent H
  • R 2 represents CH 2 CH 3
  • R 3 0
  • X a represents CH 2 , as shown by the following structure:
  • R 1 represents [A]
  • R 12 represents OH
  • R 11 and R 10 represent H
  • R 2 represents CH 2 CH 3
  • R 3 0
  • X a represents CH 2 , as shown by the following structure:
  • R 1 represents G
  • R 2 Ob represents OH
  • R 19e and Ri 8a represent H
  • R3 0
  • X a represents CH 2 , as shown by the following structure:
  • R 1 represents [J]
  • R 22 represents OH
  • R 21 , R 23 , R 24 and R 25 represent H
  • R 3 0
  • X a represents CH 2 , as shown by the following structure:
  • R 1 represents [B]
  • A represents S
  • Ri 7 , Ri 5 , and Ri 4 represent H
  • X b represents bond
  • R3 0
  • X a represents CH 2 , as shown by the following structure:
  • Ri represents [B]
  • A represents O
  • Ri 7 , Ri 5 , and R 14 represent H
  • X b represents bond
  • X a represents CH 2 , as shown by the following structure, also known as Pyran FK520 or 28-des(3-c/s-methoxy-4- frans-hydroxycyclohexyl)-28-(4-tetrahydro-2H-pyran)FK520:
  • R 1 represents [E]
  • Ri 9c represents H
  • R3 0
  • X a represents CH 2 , as shown by the following structure:
  • R 1 represents [D]
  • R 20 and R 19b represent H
  • X a represents CH 2 , as shown by the following structure:
  • R 1 represents [A]
  • R 12 represents OH
  • R 11 and R 1 O represent H
  • R 3 0
  • X a represents CH 2 , as shown by the following structure:
  • Compounds of formula (I) may be produced by feeding an appropriate non-natural starter unit to an FK506 or FK520 producing strain, culturing the strain and optionally isolating the compounds thereafter.
  • the strain is mutated to have targeted inactivation or deletion of one or more genes that contribute to the biosynthesis or regulation of precursor supply.
  • the gene(s) that contribute to the biosynthesis or regulation of precursor supply may contribute to the biosynthesis or regulation of the a starter unit (starter acid) e.g. 4,5 dihydroxycyclohex-1-ene carboxylic acid, such as fkbO (Motamedi and Shafiee, 1998, Wu et al., 2000).
  • the strain has the natural loading module of the FK506 or FK520 PKS replaced with that of the avermectin PKS or an avermectin-like PKS (such as the nemadectin or milbemycin PKS), and is then fed appropriate starter units, the strain cultured and the compounds optionally isolated.
  • other genes may be inactivated, such as the gene(s) that contribute to the biosynthesis or regulation of precursor supply which may contribute to the biosynthesis or regulation of branched chain keto acid, such as bkd (Ward et al., 1999).
  • the strain may be mutated to inactivate or delete one or more genes responsible for biosynthesis of pipecolic acid, such as fkbL (Wu et al., 2000). Pipecolic is naturally incorporated into the chain as a final step prior to ring closure. This particular modification increases the yield of prolyl derivatives of formula (I) when proline is fed to the strain.
  • the strain may be mutated to have targeted inactivation or deletion of one or more genes responsible for post-PKS modification, for example the gene responsible for oxidation at the C-9 position, fkbJ (Motamedi and Shafiee, 1998, Wu et al., 2000). This particular modification increases the yield of C-9 desketo derivatives of formula (I).
  • avermectin loading module may be subject, after their isolation, to synthetic alteration using processes known to a skilled person e.g. alkylation of hydroxyl and amino groups and the like. It should be understood by one skilled in the art that it may be possible to use alternative junctions to join the avermectin loading module to the rapamycin PKS. Examples of this include taking just the Acyltransferase (AT) and Acyl Carrier Protein (ACP) domains from the avermectin or avermectin-like PKS and joining to the FK506/FK520 PKS before the fist ketosynthase (KS) domain.
  • AT Acyltransferase
  • ACP Acyl Carrier Protein
  • the junction may be made between the KS from the avermectin or avermectin-like PKS and the first extender AT from the FK506/FK520 PKS. Analogous possibilities are discussed in WO 98/01546. Additionally, homologues of the avermectin loading module may be used, such as those found in the milbemycin PKS or nemadectin PKS.
  • a precursor supply gene such as fkbO or an fkbO homologue or the bkd genes or homologues thereof may be manipulated by targeted inactivation or deletion or modified by other means such as exposing cells to UV radiation and selection of the phenotype indicating that starter unit biosynthesis or branched chain alpha keto acid biosynthesis has been disrupted.
  • the optional targeting of the post-PKS genes may occur via a variety of mechanisms, e.g. by integration, targeted deletion of a region of the FK506 or FK520 cluster including all or some of the post-PKS genes optionally followed by insertion of gene(s) or other methods of rendering the post-PKS genes or their encoded enzymes non-functional e.g. chemical inhibition, site-directed mutagenesis or mutagenesis of the cell for example by the use of UV radiation.
  • WO2004/007709 provides methods for the alteration of a gene system which comprises a core portion responsible for the production of a basic product, and a multiplicity of modifying genes responsible for effecting relatively small modifications to the basic product - e.g. effecting oxidation, reduction, alkylation, dealkylation, acylation or cyclisation of the basic product, and a multiplicity of precursor supply genes which are involved in the production of particular precursor compounds.
  • the basic product may be a modular polyketide and the modifying genes may be concerned with modifications of a polyketide chain (such as oxidation at the 9 position), and the precursor supply genes may be involved in the production and/or incorporation of natural or non-natural precursors (e.g. pipecolate and/or 4,5 dihydroxycyclohex-1-ene carboxylic acid).
  • the core portion may not function properly or even at all in the absence of a precursor supply gene (unless a natural or unnatural precursor compound is supplied or is otherwise available). Therefore, the deletion or inactivation of a precursor supply gene provides a system where it is possible to incorporate non-natural starter units with no competition from the natural starter unit.
  • the present invention provides a method for the incorporation of non-natural starter acids into FK506 and FK520 analogues, said method comprising feeding said starter units to a strain which contains a gene system in which the precursor supply gene has been deleted or inactivated, or the natural FK506/520 loading module has been replaced with the avermectin loading module, or a homologue thereof.
  • Suitable gene systems include, but are not limited to, antascomicin, FK520 (Wu et al., 2000; U.S. 6,150,513; AF235504), FK506 (Motamedi et al., 1996; Motamedi et al., 1997; Motamedi and Shafiee, 1998; AF082100,
  • the precursor supply gene which is deleted or inactivated is preferably fkbO or a homologue of fkbO.
  • the gene system is preferably the FK506 or FK520 cluster.
  • the precursor supply gene deleted or inactivated is more preferably fkbO.
  • the precursor gene which is deleted or inactivated is involved in branched chain keto acid formation, such as one of the bkd genes, when the loading module is replaced with the avermectin loading module.
  • fkbM and/or fkbl are deleted or inactivated in addition to fkbO.
  • the present invention provides a method of producing compounds of formula (I) comprising:
  • the precursor for which one or more starter genes have been deleted or inactivated may be a starter unit (e.g. starter acid). Additionally or instead the precursor for which one or more starter genes have been deleted or inactivated may be pipecolic acid. Optionally one or more genes responsible for post-PKS modification are also deleted or inactivated.
  • a starter unit e.g. starter acid
  • the precursor for which one or more starter genes have been deleted or inactivated may be pipecolic acid.
  • one or more genes responsible for post-PKS modification are also deleted or inactivated.
  • the natural KS1 module is replaced by the KS1 module of the avermectin or an avermectin-like PKS in addition to the loading module being so replaced as described above.
  • the natural KS1 module is replaced by the KS1 module of the avermectin or an avermectin-like PKS in addition to the loading module being so replaced as described above.
  • the recombinant strain is generated using the methods described in WO2004/007709 and in the examples below.
  • the host strain is a selected from the group consisting of Streptomyces tsukubaensis No. 9993 (Ferm BP-927), Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822), Streptomyces sp. AA6554, Streptomyces hygroscopicus var. ascomyceticus MA 6475 ATCC 14891 , Streptomyces hygroscopicus var. ascomyceticus MA 6678 ATCC 55087, Streptomyces hygroscopicus var. ascomyceticus MA 6674, Streptomyces hygroscopicus var.
  • the host strain is selected from the group consisting of: S. hygroscopicus var. ascomyceticus ATCC 14891 , Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822) or Streptomyces tsukubaensis No. 9993 (Ferm BP-927).
  • S. hygroscopicus var. ascomyceticus ATCC 14891 Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822) or Streptomyces tsukubaensis No. 9993 (Ferm BP-927).
  • DSM 40822 Streptomyces tsukubaensis No. 9993
  • auxiliary genes may be deleted or inactivated in the host strain.
  • one or more of the deleted or inactivated genes of the host strain may be reintroduced by complementation (e.g. at an attachment site, on
  • polyketide gene clusters may be expressed in heterologous hosts (Pfeifer et al., 2001 ). Accordingly, the present invention includes the transfer of the FK506 or FK520 biosynthetic gene cluster with or without resistance and regulatory genes, either complete, engineered, containing mutations or containing deletions, for complementation in heterologous hosts. Methods and vectors for the transfer as defined above of such large pieces of DNA are well known in the art (Rawlings, 2001 ; Staunton and Weissman, 2001 ) or are provided herein in the methods disclosed.
  • the present invention provides a method of producing compounds of formula (I) comprising: (a) generating a recombinant strain of a non-FK506 or FK520 producing host (i.e. a heterologous host) that contains a biosynthetic cluster that encodes polypeptides involved in FK506 and FK520 analogue synthesis in which at least one precursor supply gene is absent or non-functional or the natural loading module has been replaced by the loading module from the avermectin or an avermectin-like PKS; and (b) feeding a non-natural starter unit to said recombinant strain;
  • a non-FK506 or FK520 producing host i.e. a heterologous host
  • a biosynthetic cluster that encodes polypeptides involved in FK506 and FK520 analogue synthesis in which at least one precursor supply gene is absent or non-functional or the natural loading module has been replaced by the loading module from the avermectin
  • a non-natural starter unit to a recombinant strain of a non-FK506 or FK520 producing host (i.e. a heterologous host) that contains a biosynthetic cluster that encodes polypeptides involved in FK506 and FK520 analogue synthesis in which at least one precursor supply gene is absent or non-functional or the natural loading module has been replaced by the loading module from the avermectin or an avermectin-like PKS; (b) culturing said strain; and
  • a preferred heterologous host cell strain is a prokaryote, more preferably an actinomycete or Escherichia coli, still more preferably include, but are not limited to S. hygroscopicus, S. hygroscopicus sp. , S. hygroscopicus var.
  • PKS polyketide synthase
  • FK506 or FK520 analogue or other polyketide analogue a modified FK506 or FK520 analogue or other polyketide analogue.
  • PKS in a homologous or heterologous could be a hybrid PKS in which one or more domains have been removed, replaced or inserted, such replacements or insertions coming from other heterologous (or homologous) PKS clusters.
  • actinomycetes contain multiple biosynthetic gene clusters for different secondary metabolites, including polyketides and non-ribosomally synthesised peptides. Specifically, it has been demonstrated that strains of S. hygroscopicus produce a variety of polyketides and non-ribosomally synthesised peptides in addition to FK506, FK520, FK523, meridamycin, FK525, antascomicin or tsukubamycin.
  • biosynthetic gene clusters represent a competing requirement for biosynthetic precursors and an additional metabolic demand on the host strain.
  • elaiophylin elaiophylin, bialaphos, hygromycin, augustmycin, endomycin (A, B), glebomycin, hygroscopin, ossamycin and nigericin.
  • additional biosynthetic gene clusters represent a competing requirement for biosynthetic precursors and an additional metabolic demand on the host strain.
  • the starter unit is selected from the following carboxylic acids or carboxylic acid derivatives: wherein R 10 , Rn and Ri 2 are independently selected from H, F, Cl, ORi 3 , SRi 3 and NHRi 3 and Ri 3 is selected from H, d-C 4 alkyl and Ci-C 4 acyl; or
  • A is selected from O, S and NRi 3a
  • Ri 3a represents H, Ci-C 4 alkyl or Ci-C 4 acyl
  • Ri 4 and Ri 5 are independently selected from H, Ci-C 4 alkyl
  • Ri6 represents CrC 4 alkyl or Ci-C 4 acyl
  • X b represents a bond or CH 2
  • Ri 7 represents H and when X b is CH 2 then
  • R 17 represents H, F, Cl, OH, SH
  • ORi 63 , SRi 6a or NHRi 63 and Ri 6a represents Ci-C 4 alkyl or Ci-C 4 acyl; or
  • Ri 3 b represents H, Ci-C 4 alkyl, or Ci-C 4 acyl
  • Ri 4a represents Ci-C 4 alkyl
  • Ri6 represents Ci-C 4 alkyl or Ci-C 4 acyl
  • Ri 8 represents H, F, Cl, OH, SH, Ci-C 4 alkyl
  • R i6a represents Ci-C 4 alkyl or Ci-C 4 acyl
  • X c and X d independently represent bond or CH 2 provided that X c and X d do not both represent CH 2 and when X c is bond then Ri 7a represents H and when X c is CH 2 then Ri 7a represents H, F, Cl, OH, SH, Ci-C 4 alkyl, ORi 6b , SRi 6b or NHRi 6b , Ri 6b represents Cr
  • Ri 9b and R 2 o independently represent H, F, Cl, OH, SH, d-C 4 alkyl, ORi 6 d, SRi6d or NHRi6d, and Ri 6 d represents Ci-C 4 alkyl or d-C 4 acyl; or
  • Ri 9c represents H, F, Cl, OH, SH, C r C 4 alkyl, ORi 6e , SR 16e or NHRi 6e , and R i6 e represents d-C 4 alkyl or d-C 4 acyl; or
  • R 19d and R 2 Oa independently represent H, F, Cl, OH, SH, d-C 4 alkyl, ORi 6f ,
  • SRi6f or NHR 16 f and Ri 6 f represents d-C 4 alkyl or d-C 4 acyl ; or wherein R 18a , Ri9e and R 2 Ob independently represent H, F, Cl, OH, SH, d-C 4 alkyl, ORi6g, SRi6g or NHR 16g and Ri 6g represents CrC 4 alkyl or d-C 4 acyl; or
  • R 2 i, R 22 and R 2 3 independently represent H, F, Cl, OR 2 6, SR 2 6, CrC 4 alkyl or CN, R 2 6 represents H, d-C 4 alkyl or d-C 4 acyl, R 24 and R 25 independently represent H, F, Cl, OH, SH or CrC 4 alkyl, provided that at least one of R 2 i, R 22 and R 23 is not H or d-C 4 alkyl; or
  • R 21a , R 22a and R 23a are independently selected from H, F, Cl, OR 26 , SR 26 , C1- C4 alkyl and CN, R 26a represents H, d-C 4 alkyl or d-C 4 acyl, R 24a and R 25a independently represent H, F, Cl, OH, SH or d-C 4 alkyl and provided that at least one of R 2 i a , R 22a and R 23a does not represent H or d-C 4 alkyl.
  • Starter units are suitably provided as the free carboxylic acid, but derivatives that may be employed include salts and esters.
  • the aforementioned starter unit substances are either known or may be prepared by a skilled person using conventional methods.
  • Standard methods known to those of skill in the art may be used to culture the host or recombinant strain in order to produce compounds of formula (I). Such methods include, without limitation, those described in the examples below; additional methods may also be found in Reynolds and Demain, 1997 and references therein.
  • Compounds of formula (I) are useful as pharmaceuticals for example, but without limitation, having potential utility as immunosuppressants, antifungal agents, anticancer agents, neuroregenerative agents, or agents for the treatment of psoriasis, rheumatoid arthritis, fibrosis and other hyperproliferative diseases.
  • the invention provides for the use of a compound of formula (I) as disclosed herein, in the preparation of a medicament for the prophylaxis and/or treatment of organ rejection after transplantation, autoimmune diseases, inflammatory disorders, fungal infections, cancer, neurodegeneration, psoriasis, rheumatoid arthrisis, fibrosis and/or other hyperproliferative disorders.
  • the invention provides for a method of treatment or prophylaxis of organ rejection after transplantation, autoimmune diseases, fungal infections, cancer, neurodegeneration, psoriasis, rheumatoid arthrisis, fibrosis and/or other hyperproliferative disorders comprising administering a compound of formula (I) to a subject in need thereof.
  • the compounds of formula (I) disclosed herein may be used in the preparation of a medicament for the prevention of organ allograft rejection.
  • the compounds of formula (I) are used in the preparation of a medicament for the treatment of autoimmune diseases or inflammatory disorders.
  • the compounds of this invention are useful for inducing immunosuppression and therefore relate to methods of therapeutically or prophylactically inducing a suppression of a human's or an animal's immune system for the treatment or prevention of rejection of transplanted organs or tissue, the treatment of autoimmune, inflammatory, proliferative and hyperproliferative diseases (examples include but are not inclusively limited to autoimmune diseases, diabetes type I, acute or chronic rejection of an organ or tissue transplant, asthma, tumours or hyperprolific disorders, psoriasis, eczema, rheumatoid arthritis, fibrosis, allergies and food related allergies).
  • Such assays are well known to those of skill in the art, for example but without limitation: Immunosuppressant activity - Warner, LM.,et al., 1992, Kahan et al. (1991 ) & Kahan & Camardo, 2001 ); Allografts - Fishbein, T.M., et al., 2002, Kirchner et al. 2000; Autoimmune / Inflammatory / Asthma - Carlson, R.P. et al., 1993, Powell, N. et al., 2001 ; Diabetes I - Rabinovitch, A. et al., 2002; Psoriasis - Reitamo, S.
  • the ability of the compounds of this invention to induce immunosuppression may be demonstrated in standard tests used for this purpose.
  • the compounds of this invention are useful in relation to antifibrotic, neuroregenerative and anti-angiogenic mechanisms, one skilled in the art would be able by routine experimentation to determine the ability of these compounds to prevent angiogenesis (e.g. Guba, M.,et al., 2002, ).
  • the compounds of formula (I) are also, or in particular, expected to be useful as a therapeutic or prophylactic agents for one or more of the following conditions: rejection reactions after transplantation of organs or tissues (for example heart, kidney, liver, bone marrow, skin, cornea, lung, pancreas, small intestine, limb, muscle, nerve, intervertebral disc, trachea, myoblast and cartilage); graft-versus-host reactions following bone marrow transplantation; autoimmune diseases (for example rheumatoid arthritis, systemic lupus erythematosus, Hashimoto's thyroiditis, multiple sclerosis, myasthenia gravis, type I diabetes); infections caused by pathogenic microorganisms, in particular fungal infections; inflammatory or hyperproliferative skin diseases or cutaneous manifestations of immunologically-mediated diseases (for example psoriasis, atopic dermatitis, contact dermatitis, eczematoid dermatitis, py
  • the compounds of formula (I) may also be useful as a therapeutic or prophylactic agents for Bronchiolitis Obliterans Syndrome (BOS).
  • BOS Bronchiolitis Obliterans Syndrome
  • the aforementioned compounds of the invention or a formulation thereof may be administered by any conventional method including topically (for example by inhalation, vaginally, intranasally, or by eye or ear drop), enterally (for example orally or rectally) or parenterally (for example by intravenous, intracavernosal, subcutaneous, intramuscular, intracardiac or intraperitoneal injection) or via a medical device (for example via a stent).
  • the treatment may consist of a single dose or a plurality of doses over a period of time.
  • a compound of the invention Whilst it is possible for a compound of the invention to be administered alone, it is preferable to present it as a pharmaceutical formulation, together with one or more physiologically acceptable diluents or carriers.
  • the diluents or carrier(s) must be "physiologically acceptable” in the sense of being compatible with the compound of the invention and not deleterious to the recipients thereof. In some cases, the diluent or carrier will be water or saline which will be sterile and pyrogen free.
  • the formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. Such methods include the step of bringing into association the active ingredient (compound of the invention) with the carrier which constitutes one or more accessory ingredients. In general the formulations are prepared by uniformLy and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
  • Tablets may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxy-propylcellulose (HPC), sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included.
  • Solid compositions of a similar type may also be employed as fillers in gelatin capsules.
  • Preferred excipients in this regard include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols.
  • the compounds of the invention may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.
  • a tablet may be made by compression or moulding, optionally with one or more accessory ingredients.
  • Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder (eg povidone, gelatin, hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (eg sodium starch glycolate, cross-linked povidone, cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent.
  • Moulded tablets may be made by moulding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.
  • the tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethylcellulose in varying proportions to provide desired release profile.
  • Formulations in accordance with the present invention suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion.
  • the active ingredient may also be presented as a bolus, electuary or paste.
  • Aerosol formulations suitable for administering via inhalation can also be made using methods known in the art. Examples of this include administration of the compounds of the invention by inhalation in the form of a powder (e.g. micronized) or in the form of atomized solutions or suspensions.
  • the aerosol formulation may be placed in a suitable pressurized propellant, and may be used with additional equipment such as nebulizer or inhaler.
  • compositions are preferably applied as a topical ointment or cream.
  • the active agent may be employed with either a paraffinic or a water-miscible ointment base.
  • the active agent may be formulated in a cream with an oil-in-water cream base or a water-in-oil base.
  • a pharmaceutical composition of the invention can be administered with a needleless hypodermic injection device, such as the devices disclosed in U.S. 5,399,163; U.S. 5,383,851 ; U.S. 5,312,335; U.S. 5,064,413; U.S.
  • implants and modules useful in the present invention include : US 4,487,603, which discloses an implantable micro- infusion pump for dispensing medication at a controlled rate; US 4,486,194, which discloses a therapeutic device for administering medicaments through the skin; US 4,447,233, which discloses a medication infusion pump for delivering medication at a precise infusion rate; US 4,447,224, which discloses a variable flow implantable infusion apparatus for continuous drug delivery; US 4,439,196, which discloses an osmotic drug delivery system having multi- chamber compartments; and US 4,475,196, which discloses an osmotic drug delivery system. Many other such implants, delivery systems, and modules are known to those skilled in the art.
  • the compounds can be administered as the sole active agent, or in combination with other pharmaceutical agents, such as other agents that stimulate or inhibit cell proliferation of immune responses.
  • agents include e.g. cyclosporine, rapamycin, FK506, leflunomide, butenamides, corticosteroids, Doxorubicin, and the like.
  • each active ingredient can be administered either in accordance with its usual dosage range, or at a lower dose level.
  • the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example those suitable for oral administration may include flavouring agents.
  • Pharmaceutical compositions of the invention may optionally contain further active ingredients.
  • strains wherein the strain is a FK506 or FK520 producing strain which is Streptomyces hygroscopicus subsp hygroscopicus or Streptomyces tsukubaensis;
  • Figure 1 Diagram describing the methodology used for generation of a Streptomyces hygroscopicus subsp. hygroscopicus strain in which the fkbO gene has been inactivated by introducing a small deletion inducing a frameshift.
  • Figure 2 Diagram describing the methodology used for generation of a Streptomyces hygroscopicus subsp. hygroscopicus strain in which the fkbO gene has been inactivated by introducing a small deletion inducing a frameshift.
  • Figure 3 Diagram describing the methodology used for generation of a Streptomyces tsukubaensis strain in which the fkbO gene has been inactivated by introducing a small deletion inducing a frameshift.
  • FK506, FK520 or the Pyran FK520 as a single 1 mg/kg Lv. dose (filled diamonds) or 10mg/kg p.o. dose (open diamonds), with concentration measured in whole blood (mean of triplicates in ng/mL) compared to time after dosing (in hours).
  • Vector pKC1139B01 was obtained by inserting a linker into pKC1 139 (Bierman et al., 1992).
  • the 674bp BgIW PvuW fragment of pKC1 139 was replaced by the annealing product of oligos B01 and B02 to give the plasmid pKC1 139B01
  • Escherichia coli DH 10B (GibcoBRL) was grown in 2xTY medium as described by
  • E. coli VCS257 was used for transfection of in vitro packaged cosmids. According to the instructions of
  • E. coli transformants were selected for with 100 mg/L ampicillin or 50 mg/L apramycin.
  • the avermectin producer Streptomyces avermitilis (DSM41443 / ) was grown on TSB at 28 ° for genomic DNA isolation.
  • the FK506 producer Streptomyces tsukubaensis no. 9993 (FERM BP-927) (International Patent Organism Depositary, Tsukuba, Japan) and its derivatives were maintained on medium 1 agar plates or ISP4, ISP3,or ISP2 (see below) at 28 0 C.
  • FK520 was carried out by fermentation of Streptomyces hygroscopicus subsr. hygroscopicus (DSM 40822), also termed BIOT-4081. A single spore isolate of this strain, terme BIOT-4168, was also used. Streptomyces tsukubaensis no. 9993 (FERM BP-927), also termei
  • BIOT-31 19 was used for producing FK506.
  • BIOT-420f A single spore isolate of this strain, termed BIOT-420f was also used.
  • Polypropylene Centrifuge tubes (cat nc 227261 , purchased from Greiner Bio-One Ltd, Stonehouse, Gloucestershire, UK) with foam plugs or in Erlenmeyer flasks as described below.
  • the culture tubes were incubated at 28°C, 300 rpm (2. cm throw) for 48 h. From the seed culture 0.5 ml. was transferred into 7 ml. production maximr PYDG or PYDG+MES in 50-mL Centrifuge tubes with foam plugs. Cultivation was carried out for days at 28°C and 300 rpm (2.5 cm throw). If necessary a selected starter unit was fed to thi production medium 24 hours post inoculation. Enough feed was dissolved in 0.05 ml. to 0.1 m methanol and added to the culture to give final concentration of 2.12 mM of the feed compound.
  • Vegetativ cultures were prepared by removing 4-10 agar plugs (6 mm in diameter) from thn MAM, ISP4, ISP3 or ISP2 plate and inoculating into 50-250 ml. medium NGY in 250 ml. or 2000 m Erlenmeyer flasks with foam plugs. The seed flasks were incubated at 28°C, 200-250 rpm (5 or 2. cm throw) for 48 h. From the seed culture 2-10% v/v was transferred into 50 or 250 ml. productio medium PYDG (or PYDG + MES) in 250 ml. or 2000 ml.
  • PYDG or PYDG + MES
  • the pH may be maintained using acid or base addition on demand.
  • the selected feed starting unit for biosynthesis of target compound
  • thi production medium 12 - 24 hours post inoculation Enough feed was dissolved in 3 ml. to 5 m methanol and added to the culture to give final concentration of 2 mM of the feed compound. Th amount of methanol does not exceed 1 % of the total volume. Fermentation was continued fc further five days post-feeding Media Recipes
  • Medium 1 Modified A-medium (MAM) component Source g/L
  • Oatmeal is cooked/steamed in the water for 20 mins, strained through a muslin and more water added to replace lost volume.
  • ISP Trace Elements Solution is added and pH adjusted to 7.2 with NaOH.
  • Agar is added before autoclaving at 121 0 C, 15 minutes.
  • the medium is adjusted to pH 7.0, with NaOH and then sterilised by autoclaving 121 0 C, 15 minutes.
  • the medium is adjusted to pH 7.0 with NaOH, and then sterilised by autoclaving 121 0 C, 15 minutes.
  • a paste is made using a little cold water and the starch. This is brought up to a volume of 500 ml_. All other ingredients are then added, and the pH of the media is adjusted to pH 7.0-7.4. Sterilise by autoclaving 121 0 C, 15 minutes.
  • DNA manipulation and sequencing DNA manipulations were carried out as described in Sambrook et al. (1989).. DNA sequencing was performed as described previously (Gaisser et al., 2000). Genome sequencing was carried out using 454 technology (Margulies et al., 2005) at Cogenics and the University of Cambridge.
  • STE buffer supplemented with 2 mg/mL lysozyme were added and the resuspension incubated for 30 min at 37 0 C.
  • 20 DL of RNaseA (10 mg/mL) were added and the mixture incubated for another 30 min at 37 0 C. 4.8 mL EDTA (0.1 M final concentration) were added to stop the reaction.
  • 1.4 ml. 20% SDS were added.
  • the lysate was incubated on ice for 5 min, then extracted with one volume of phenol/chloroform/isoamylalcohol (25:24:1 ) and centrifuged at 2300 g and 4 0 C for at least 15 min up to 1 h.
  • Extractions were repeated until no more protein was visible at the interface, followed by a final chloroform/isoamylalcohol (49: 1 ) extraction.
  • the upper phase was precipitated with 1/10 vol. 5 M NaCI and 1 vol. cold isopropanol. After a few min, the DNA was spooled out with a glass rod and washed in ice cold 70% EtOH. After brief drying, the recovered DNA was dissolved in 0.5 - 1 ml. TE 10:1.
  • the proteinase K method (Kieser et al., 2000) was also applied successfully to recover genomic DNA from S. tsukubaensis.
  • a cosmid library of genomic DNA of S. tsukubaensis was constructed. High molecular weight DNA from several genomic DNA preps was partially digested with BfuC ⁇ , an isoschizomer of Sau3A, to a mean size of 30 - 60 kb, ligated to Supercos-1 , packaged into A phage using Gigapack® I I I XL Packaging Extract (Stratagene) and transfected into Escherichia coli VCS257. The titre was 6.7 x 10 5 cfu / ⁇ g vector. DNA of 10 cosmids was isolated and digested with EcoRI to check the insert size which was 40 kb on average.
  • 2000 clones were grown in 96-well microtitre plates (150 ⁇ l_ LB AmplOO Kan50 per well) at 37 0 C and frozen at -80 0 C after mixing wells with 50 ⁇ L LB/glycerol 1 :1.
  • a DIG labeled fkbO probe was used to detect cosmids containing this region of the FK506 biosynthetic cluster.
  • the probe was prepared by PCR using DIG labeled dNTP mix (Roche). It comprises 410 bp of 3'-terminal fkbO sequence. Sequence information for primer design had been obtained by 454 sequencing of BIOT-31 19 - see Fig. 1 and SEQ ID 1. Primer sequences were:
  • UES2for (Seq ID 2) 5'-CACTCCTTCGATCTCCACGAGCAGGTCGCCACGGGC-S' and UES2rev (Seq ID 3) 5'-ACCCTGCCGTCCTCACGGCACACCACTACCCCACGG-S'. Annealing temperatures between 66 and 71 0 C and extension for 20 sec at 68 0 C proved to be successful.
  • DNA was crosslinked by exposing membranes to UV (302nm) for 5 min. Membranes were kept between two sheets of filter paper soaked with 2xSSC at 4 0 C or used immediately for hybridization. Hybridization was carried out using standard hybridization buffer and DIG labeled fkbO probe (see above) at a hybridization temperature of 68 0 C. Stringent washes were performed at 68 0 C. The nonradioactive DIG Nucleic Acid Detection kit from Roche was used to identify 5 positive clones on 4 library plates. The procedure followed the instructions of the DIG Application Manual for Filter Hybridization (Roche).
  • Fresh spores were harvested in water from plates of Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822) and were heat-shocked at 50 0 C for 10 minutes. These were then mixed with the E. coli donor strain, which had been washed twice with 2xTY, in a ratio of 1 :3 streptomycete to E. coli, and plated on R6 medium, incubating at 28°C. After -20 hr, the plates were overlaid with water containing 2 mg of apramycin sulphate and 1 mg of nalidixic acid and incubation continued at 28°C.
  • Escherichia coli ET12567 harbouring the plasmid pUZ8002 (Macneil et al., 1992, Paget et al., 1999) was transformed with pAES10 by electroporation to generate the E. coli donor strain for conjugation.
  • This strain was used to transform Streptomyces tsukubaensis no. 9993 (FERM BP-927) by spore conjugation (Kieser et a 1.2000).
  • Fresh spores were harvested in water from plates of Streptomyces tsukubaensis no. 9993 (FERM BP-927) and were heat-shocked at 50 0 C for 10 minutes. These were then mixed with the E. coli donor strain, which had been washed twice with 2xTY, in a ratio of 3:1 Streptomycete to £. coli, and the mixture shaken at 37°C, 200 rpm, 1 " throw for 3 hr. The conjugation mixture was then plated on R6 medium, incubating at 37°C. After -20 hr, the plates were overlaid with water containing 2 mg of apramycin sulphate and 1 mg of nalidixic acid and incubation continued at 37°C. After 4-6 days, apramycin resistant colonies were seen, indicating integration of the pAESI O plasmid into the genome.
  • Culture broth (0.9 ml.) is added to an Eppendorf tube (2.0 ml.) and ethyl acetate (0.9 mL) added.
  • the broth is mixed with the solvent for 30 minutes on a shaking platform (vibrax) at 400 rpm.
  • the phases are then separated by centrifugation (10 minutes, 13,200 rpm).
  • An aliquot of the organic layer (0.1 mL) is then transferred to either a clean glass LC-vial or a vial containing 0.005 mg of pimecrolimus (as an internal standard for quantification).
  • the solvent is removed in vacuo and then residue re-dissolved in methanol (1 mL) by gentle agitation on a shaking platform (5 minutes).
  • the HPLC system comprised an Agilent HP1100 equipped with a Hyperclone ODS2,
  • LC samples that have been spiked with 0.005 mg/mL pimecrolimus were analysed on the same instrument and with the same chromatographic conditions.
  • MS was conducted in multiple reaction monitoring mode (MRM mode) in order to quantify the amount of FK analog in the sample. Details of the quantification are:
  • the amount of analyte present is then calculated by dividing the integral for the analyte transition (as detailed above) with that for the internal standard, pimecrolmius. This ratio is then compared with a standard calibration curve for FK520 or FK506 up to 100 ng on column with 50 ng on column pimecrolimus.
  • NMR spectra 1 H, 13 C, DQF-COSY, TOCSY, HMQC, HMBC, NOESY
  • 500 MHz for proton derived spectra, pro rata for other nuclei
  • Chemical shifts are described in parts per million (ppm) and are referenced to solvent signal e.g. CHCI3 at ⁇ 7.26 ( 1 H) and CHCI 3 at ⁇ c 77.0 ( 13 C). J values are given in Hertz (Hz).
  • NFAT-bla Jurkat cells were thawed and resuspended in Assay Media (OPTI-MEM, 0.5% dialyzed FBS, 0.1 mM NEAA, 1 mM Sodium Pyruvate, 100 U/mL/100 ⁇ g/mL Pen/Strep) to a concentration of 781 ,250 cells/mL.
  • 4 ⁇ L of a 10X serial dilution of the test compounds were added to appropriate wells of a TC-Treated assay plate.
  • 32 ⁇ L of cell suspension was added to the wells and pre- incubated at 37°C/5% CO 2 in a humidified incubator with test compounds for 30 minutes.
  • Anti CD4:CD8 activator at the pre-determined EC80 concentration was added to wells containing the test compounds. The plate was incubated for 5 hours at 37°C/5% CO 2 in a humidified incubator. 8 ⁇ L of 1 ⁇ M Substrate Loading Solution was added to each well and the plate was incubated for 2 hours at room temperature. The plate was read on a fluorescence plate reader.
  • Water solubility may be tested as follows: A 10 mM stock solution of the sanglifehrin analogue is prepared in 100% DMSO at room temperature. Triplicate 0.01 mL aliquots are made up to 0.5 mL with either 0.1 M PBS, pH 7.3 solution or 100% DMSO in amber vials. The resulting 0.2 mM solutions are shaken, at room temperature on an IKA® vibrax VXR shaker for 6 h, followed by transfer of the resulting solutions or suspensions into 2 mL Eppendorf tubes and centrifugation for 30 min at 13200 rpm. Aliquots of the supernatant fluid are then analysed by the LCMS method as described above. Assessment of cell permeability
  • Test compound was dissolved in DMSO and then diluted further in buffer to produce a final 1 ⁇ M dosing concentration. The fluorescence marker lucifer yellow was also included to monitor membrane integrity. Test compound was then applied to the apical surface of Caco-2 cell monolayers and compound permeation into the basolateral compartment is measured. This is performed in the reverse direction (basolateral to apical) to investigate active transport. LC-MS/MS was used to quantify levels of both the test and standard control compounds (such as Propanolol and Acebutolol).
  • In vivo assays may also be used to measure the bioavailability of a compound.
  • a compound is administered to a test animal (e.g. mouse) both intravenously (i.v.) and orally ⁇ p.o.) and blood samples are taken at regular intervals to examine how the plasma (or whole blood) concentration of the drug varies over time.
  • the time course of plasma (or whole blood) concentration over time can be used to calculate the absolute bioavailability of the compound as a percentage using standard models.
  • Example 1 Generation of a Streptomyces hygroscopicus subsp. hygroscopicus strain in which the fkbO gene has been inactivated by introducing a small deletion inducing a frameshift.
  • a 5' extension was designed in oligo SG167 to introduce the restriction site to aid cloning of the amplified fragment ( Figure 1 ) and SG168 included the restriction site present in the genomic sequence.
  • This 2034 bp fragment was cloned into pUC19 that had been linearised with Sma ⁇ , resulting in plasmid pAESBI and the insert verified by sequencing.
  • pAESABI The -1.7 kb Bgl ⁇ /Xho ⁇ fragment from pAESA5 and -2.0 kb Xho ⁇ /EcoR ⁇ fragment from pAESBI were cloned into the -5.9 kb Sg/ll/EcoRI fragment of pKC1 139 (Bierman et al., 1992) to make pAESABI .
  • pAESABI therefore contained the upstream and downstream regions such that the double crossover event would result in the desired small deletion, introducing a frameshift in the fkbO gene.
  • Escherichia coli ET12567 harbouring the plasmid pUZ8002, was transformed with pAESABI by electroporation to generate the E. coli donor strain for conjugation.
  • This strain was used to transform Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822) by spore conjugation (as described in General Methods). Exconjugants were plated on R6 agar and incubated at 28°C.
  • pAESABI is able to self-replicate in Streptomyces hygroscopicus subsp. hygroscopicus (DSM 40822) at 28°C.
  • Transformants were subcultured onto MAM plates with apramycin (0.050 mg/mL) at 28°C to ensure the pAESABI plasmid with resistance marker was present. Subculturing to allow secondary recombination was carried out as follows: the transformants were subcultured again on to MAM plates with apramycin at 37°C to induce the plasmid to integrate, as the plasmid cannot self-replicate at 37°C. The transformants were then subcultured for four subsequent rounds at 37°C on MAM plates with no antibiotic. The transformants from the fourth subculture on antibiotic free plates were plated for spore harvest on ISP3 medium at 28°C. Serial dilutions were made from the filtered collected spores and were plated on MAM plates to achieve single colonies.
  • FK production medium See Media Recipes
  • 50 ml. falcon tube at 28°C, 300 rpm with a 1 inch throw.
  • each falcon tube was fed with 0.050 ml. 0.32 M 4-trans- hydroxycyclohexane carboxylic acid to give a final concentration of 2.12 mM acid and shaking incubation was continued as before.
  • the cultures were sampled after 6 days growth and analysed by LC-MS, using the methods described above.
  • Example 2 Generation of a Streptomyces hygroscopicus subsp. hygroscopicus strain in which the fkbO gene has been inactivated by introducing a small deletion inducing a frameshift.
  • 2.1 Cloning of DNA homologous to the upstream flanking region of fkbO disruption.
  • Oligos SG165 SEQ ID NO: 1
  • SG166 SEQ ID NO: 2
  • aesFK520A SEQ ID NO: 10
  • DSM 40822 standard PCR reaction
  • genomic DNA Kieser et a/.2000
  • a 5' extension was designed in each oligo to include the restriction sites present in the genomic sequence to aid cloning of the amplified fragment ( Figure 2).
  • This 1727 bp fragment was cloned into pUC19 that had been linearised with Sma ⁇ , resulting in plasmid pAESA5 and the insert verified by sequencing.
  • a 5' extension was designed in oligo SG169 to introduce the restriction site to aid cloning of the amplified fragment (Figure 2) and SG168 included the restriction site present in the genomic sequence.
  • This 1460 bp fragment was cloned into pUC19 that had been linearised with Sma ⁇ , resulting in plasmid pAESC ⁇ and the insert verified by sequencing.
  • pAESAC4 therefore contained the upstream and downstream regions such that the double crossover event would result in the desired large deletion of the fkbO gene.
  • FK production medium See Media Recipes
  • 50 ml. falcon tube at 28°C, 300 rpm with a 1 inch throw.
  • each falcon tube was fed with 0.050 ml. 0.32 M 4-frans-hydroxy cyclohexane carboxylic acid to give a final concentration of 2.12 mM acid and shaking incubation was continued as before.
  • the cultures were sampled after 6 days growth and analysed by LC-MS using the methods described above.
  • Example 3 Generation of a Streptomyces tsukubaensis strain in which the fkbO gene has been inactivated by introducing a small deletion inducing a frameshift. 3.1 Cloning of DNA homologous to the upstream flanking region of fkbO disruption.
  • Oligos AES43 (SEQ ID NO: 6) and AES40 (SEQ ID NO: 7) were used to amplify a 2057 bp region of DNA, termed aesFK506D1 1 (SEQ ID NO: 13) from Streptomyces tsukubaensis no. 9993 (FERM BP-927) in a standard PCR reaction (Sambrook and Russell, 2001 ) using genomic DNA (Kieser et al., 2000) as the template and hot start KOD DNA polymerase.
  • a 5' extension was designed in each oligo to introduce the restriction sites to aid cloning of the amplified fragment (Figure 3). This 2057 bp fragment was cloned into pUC19 that had been linearised with Sma ⁇ , resulting in plasmid pAES ⁇ and the insert verified by sequencing.
  • Oligos AES41 SEQ ID NO: 8 and AES42 (SEQ ID NO: 9) were used to amplify a 1985 bp region of DNA, termed aesFK506E3 (SEQ ID NO: 14) from Streptomyces tsukubaensis no. 9993 (FERM BP-927) in a standard PCR reaction (Sambrook and Russell, 2001 ) using genomic DNA (Kieser et al., 2000) as the template and hot start KOD DNA polymerase.
  • a 5' extension was designed in each oligo to introduce the restriction sites to aid cloning of the amplified fragment ( Figure 3).
  • This 1985 bp fragment was cloned into pUC19 that had been linearised with Sma ⁇ , resulting in plasmid pAES9 and the insert verified by sequencing.
  • pAES10 therefore contained the upstream and downstream regions such that the double crossover event would result in the desired small deletion, introducing a frameshift in the fkbO gene.
  • Escherichia coli ET12567 harbouring the plasmid pUZ8002, was transformed with pAES10 by electroporation to generate the E. coli donor strain for conjugation.
  • This strain was used to transform Streptomyces tsukubaensis no. 9993 (FERM BP-927) by spore conjugation (as described in General Methods).
  • Exconjugants were plated on R6 agar and incubated at 37°C.
  • pAESIO is not able to self-replicate in Streptomyces tsukubaensis no. 9993 (FERM BP-927) at 37°C and must integrate into the genome.
  • Transformants were subcultured onto MAM plates with apramycin (0.050 mg/mL) at 37°C two to three times, to ensure that the pAESI O plasmid with resistance marker had integrated. Subculturing to allow secondary recombination was carried out as follows: the transformants were subcultured for two subsequent rounds at 37°C on MAM plates with no antibiotic and then a final time at 28°C. The transformants from the fourth subculture on antibiotic free plates were plated for spore harvest on ISP4 medium at 28°C. Serial dilutions were made from the filtered collected spores and plated on ISP4 plates at 28°C to achieve single colonies.
  • Example 4 Array feeding to BIOT-4131 with various starter units
  • Spore stocks of BIOT-4131 were prepared after growth on MAM, ISP4, ISP3 or ISP2 medium, and preserved in 20% w/v glycerol in distilled water and stored at -80 0 C. Spore stocks were recovered onto plates of MAM medium and incubated for 5 - 21 days at 28°C. Vegetative cultures (seed culture) were prepared by removing one agar plug (6 mm in diameter) from the MAM, ISP4, ISP3 or ISP2 plate and inoculating into 7 mL medium NGY in 50 mL Centrifuge tubes with foam plugs. The culture tubes were incubated at 28°C, 300 rpm (2.5 cm throw) for 48 h.
  • the solvent was removed under reduced pressure to impregnate the silica with the crude extract.
  • the impregnated silica was dry packed above silica (1 10 g) in a column with a 5 cm diameter.
  • the column was conditioned with and eluted with ethyl acetate / hexane (1 :1 , 1 litre), ethyl acetate (1 litre). After a 250 ml. pre-fraction, 50 ml. fractions were collected and the target compound identified in fractions 2 - 10. The fractions were combined and taken to dryness (500 mg).
  • This material was impregnated onto silica (4 g) and this material was dry- packed onto silica (20 cm x 2.5 cm diameter) and conditioned with ethyl acetate / hexane (1 :2, 300 ml.) and eluted with ethyl actate / hexane (1 :1 , 300 ml.) , ethyl acetate / hexane (2:1 , 300 ml.) and finally ethyl actate. After a prefraction (150 ml.) 15 ml. fractions were collected and the target compound was identified in fractions 13 to 20. These were combined and taken to dryness under reduced pressure (133 mg).
  • Example 6 Generation of a Streptomyces hygroscopicus subsp. hygroscopicus strain in which the loading module of the FK520 PKS (comprising DHCHCA CoA ligase-like domain, enoyl CoA reductase and ACP) is replaced by the loading module of the avermectin PKS (comprising AT and ACP) from Streptomyces avermitilis.
  • the loading module of the FK520 PKS comprising DHCHCA CoA ligase-like domain, enoyl CoA reductase and ACP
  • PCR1 1 F and PCR1 1 R were used to amplify a 2.19 kb region of DNA from Streptomyces hygroscopicus subsp. hygroscopicus (DSM40822) using genomic DNA template (Kieser et al., 2000) and the KOD Polymerase kit from Novagen. PCR samples were supplemented with 10% DMSO. Annealing temperatures between 65 and 70 0 C and extension for 1 min at 70 0 C were used. A 5' extension was designed for each oligo to introduce restriction sites (Spel, ⁇ / ⁇ tel) to aid cloning of the amplified fragment.
  • the Nde ⁇ site of PCR1 1 R comprises the loading module start codon (ATG), and the 3 non-coding bases upstream are mutated to CAT (replacing TCC).
  • the 2.19 kb PCR fragment was ligated with Sma ⁇ digested and SAP-treated pUC19, resulting in plasmid pUC19 PCR1 1.
  • the insert sequence was verified by sequencing.
  • PCR11 F (Seq ID 18) CGACTAGTGCAGCGCGAGCGTGTTGACGAACATGCCGATCAGG
  • a 5' extension was designed for each oligo to introduce restriction sites ⁇ Nhe ⁇ , Xba ⁇ ) to aid cloning of the amplified fragment.
  • the 2.20 kb PCR fragment was ligated with Sma ⁇ digested and SAP-treated pUC19.
  • a construct was selected with the insert orientated such that the Nhe ⁇ site of the PCR fragment would be close to the Nde ⁇ site of pUC19. This was relevant for the subsequent cloning procedure and the resulting plasmid was named pUC19 PCR13F.
  • the insert sequence was verified by sequencing.
  • PCR13F2 comprises the 5' end of KS1 and the choice of Nhe ⁇ introduces a mutation resulting in the KS1 N-terminal sequence of 'DPLA' instead of the original FK520 KS1 sequence 'DPVA'.
  • PCR13F2 (Seq ID 20)
  • Oligos PCR12F and PCR12R were used to amplify a 1.46 kb region of DNA from Streptomyces avermitilis (DSM41443 / ) using genomic DNA template (Kieser et al., 2000) and KOD Polymerase. PCR samples were supplemented with 1 0% DMSO . An nealing temperatures between 65 and 70 0 C and extension for 1 min at 70 0 C were used. A 5' extension was designed for each oligo to introduce restriction sites ( ⁇ /c/el, Apa ⁇ ) to aid cloning of the amplified fragment.
  • PCR12F comprises the 5' end of ave loading module and the choice of ⁇ /c/el introduces a mutation resulting in the N-terminal sequence of the loading module being 'MQR' instead of 'VQR' in the avermectin PKS.
  • PCR12R comprises the 5' end of KS1 and as mentioned for PCR13F2 the choice of Nhe ⁇ introduces a mutation resulting in the KS1 N-terminal sequence of 'DPLA' instead of 'DPVA' in the FK520 cluster and 'DPIA' in the avermectin cluster.
  • PCR12F (Seq ID 22)
  • Escherichia coli ET12567 (pUZ8002) was transformed with pUS4. This strain was used to transform Streptomyces hygroscopicus subsp. hygroscopicus by spore conjugation (as described in Materials & Methods). Exconjugants were plated on R6 agar, incubated at 37 0 C and overlaid with nalidixic acid (25 mg/L) and apramycin (50 mg/L) the next day. pUS4 is not able to self-replicate in Streptomyces hygroscopicus subsp. hygroscopicus at 37 0 C and is forced to integrate into the genome by recombination.
  • transformants were subcultured on MAM plates containing apramycin (50 mg/L) at 37 0 C to ensure the pUS4 plasmid with resistance marker was present.
  • Subculturing for two subsequent rounds at 37 0 C on MAM plates without apramycin was carried out to allow secondary recombination. This event would either cause the loss of the plasmid via the second region of homology, not the one by which it had originally integrated resulting in the desired gene replacement; or the loss of the plasmid via the same region of homology as the original integration resulting in a wildtype revertant. Unexpected recombination events could occur as well. This required single spore isolation of subcultured patches.
  • the transformants were subcultured on MAM plates without apramycin at 28°C and subsequently incubated at 28 0 C on ISP3 plates for spore harvest. Serial dilutions were made from the collected spores and plated on MAM plates to achieve single colonies.
  • FK production medium (see Media Recipes) in a 50 ml. falcon tube and incubated at 28 0 C, 300 rpm, 2.5 cm throw. The cultures were harvested after 6 days growth and analysed by LC-MS, using the methods described above. 61 out of 93 apramycin sensitive strains tested had undergone the desired recombination event. These strains produced FK520 derivates arising from the use of isobutyrate and 2-methylbutyrate starter units, most of them producing FK520 as well.
  • Example 7 Generation of a Streptomyces hygroscopicus subsp. hygroscopicus strain in which the loading module and KS1 of the FK520 PKS are replaced by the loading module and KS1 of the avermectin PKS from Streptomyces avermitilis.
  • Oligos PCR23F and PCR23R were used to amplify a 2.15 kb region of DNA from Streptomyces hygroscopicus subsp. hygroscopicus using genomic DNA template (Kieser et al., 2000) and KOD Polymerase. PCR samples were supplemented with 10% DMSO. Annealing temperatures between 65 and 70 0 C and extension for 1 min at 70 0 C proved to be most successful. A 5' extension was designed for each oligo to introduce restriction sites (Apa ⁇ , Xba ⁇ ) to aid cloning of the amplified fragment. The 2.15 kb PCR fragment was ligated with Sma ⁇ digested and SAP-treated pUC19.
  • PCR23F (Seq ID 24) TTGGGCCCTCGCGTGTGGAGTCGGGTGGTGATGGGTTG
  • Oligos PCR12F and PCR22R were used to amplify a 2.75 kb region of DNA from Streptomyces avermitilis using genomic DNA template (Kieser et al., 2000) and KOD Polymerase. PCR samples were supplemented with 10% DMSO. Annealing temperatures between 65 and 70 0 C and extension for 1.5 min at 70 0 C proved to be most successful. A 5' extension was designed for each oligo to introduce restriction sites ( ⁇ / ⁇ tel, Apa ⁇ ) to aid cloning of the amplified fragment.
  • PCR12F comprises the 5' end of ave loading module and the choice of Nde ⁇ introduces a mutation resulting in the N-terminal sequence of the loading module being 'MQR' instead of 'VQR' in the avermectin PKS.
  • PCR22R was designed such that the sequence of the amplified fragment ends slightly downstream of the KS1 gene where Apa ⁇ links to the FK520 sequence.
  • the Spe ⁇ Nde ⁇ fragment of pUC19PCR1 1 was ligated with Spe ⁇ Nde ⁇ cut pKC1139B01 resulting in pUS1. Since the pUC19PCR22 insert contains 2 internal Apa ⁇ sites, a third single- cutting restriction enzyme (C/al) was chosen to aid cloning. C/al is affected by dam methylation.
  • the dam " dcm " strain E. coli JM1 10 was transformed with pUC19PCR22 and the isolated plasmid digested with Nde ⁇ C/al and C/al Apa ⁇ .
  • a 3-part ligation was performed with the 1.76 kb Nde ⁇ C/al fragment, the 0.98 kb C/al Apa ⁇ fragment and pUC19PCR23F cut with Nde ⁇ Apa ⁇ resulting in plasmid pUS3.
  • the Nde ⁇ Xba ⁇ fragment of pUS3 was then cloned into pUS1 digested with Nde ⁇ Xba ⁇ , the final plasmid being pUS5.
  • Escherichia coli ET12567 (pUZ8002) was transformed with pUS5 by electroporation to generate the E. coli donor strain for conjugation. This strain was used to transform Streptomyces hygroscopicus subsp. hygroscopicus by spore conjugation (as described in Materials & Methods). Exconjugants were plated on R6 agar, incubated at 37°C and overlaid with nalidixic acid (25 mg/L) and apramycin (50 mg/L) the next day. pUS5 is not able to self- replicate in Streptomyces hygroscopicus subsp.
  • hygroscopicus at 37 0 C and is forced to integrate into the genome by recombination.
  • transformants Six days later, transformants were subcultured on MAM plates with apramycin (50 mg/L) at 37 0 C to ensure the pUS5 plasmid with resistance marker was present. Subculturing for two subsequent rounds at 37 0 C on MAM plates without apramycin was carried out to allow secondary recombination. This event would either cause the loss of the plasmid via the second region of homology, not the one by which it had originally integrated resulting in the desired gene replacement; or the loss of the plasmid via the same region of homology as the original integration resulting in a wildtype revertant. Unexpected recombination events could occur as well.
  • FK production medium (see Media Recipes) in a 50 ml. falcon tube and incubated at 28 0 C, 300 rpm, 2.5 cm throw. The cultures were harvested after 6 days growth and analysed by LC-MS, using the methods described above. 2 out of 93 apramycin sensitive strains tested had undergone the desired recombination event. These strains produced FK520 derivates arising from the use of isobutyrate and 2-methylbutyrate starter units (FK520 background). Feeding experiments were undertaken with the two strains to further confirm the integration of the ave loading module sequence. After inoculation of FK production medium (see above), tubes were incubated at 28 0 C, 300 rpm, 2.5 cm throw.
  • each falcon tube was fed with 50 ⁇ l_ 0.32 M cyclobutyl carboxylic acid to give a final concentration of 2.12 mM acid and shaking incubation was continued for five days.
  • Culture extracts were analysed by LC-MS, using the methods described above. Both isolates designated “#1-7” and “#1-8” incorporated cyclobutyl carboxylic acid as a starter unit. Isolate #1-7 was designated as "BIOT-4230".
  • Example 8 Generation of a Streptomyces tsukubaensis strain in which the loading module of the FK506 PKS (comprising DHCHCA CoA ligase-like domain, enoyl CoA reductase and ACP) is replaced by the loading module of the avermectin PKS (comprising AT and ACP) from Streptomyces avermitilis.
  • the loading module of the FK506 PKS comprising DHCHCA CoA ligase-like domain, enoyl CoA reductase and ACP
  • the avermectin PKS comprising AT and ACP
  • FK506 cluster including fkbO and fkbP, but neither of them covering fkbB sufficiently.
  • the 5 positive cosmids obtained via hybridization of the BIOT-31 19 cosmid library with an FK506 fkbO probe were end-sequenced.
  • the alignment of end sequences with the FK520 cluster sequence showed that two of the cosmids contained fkbO, P, B completely.
  • Oligos UES4_For and UES4_Rev were used to amplify a 2.27 kb region of DNA from Streptomyces tsukubaensis no. 9993 using cosmid 3G9 template and KOD Polymerase. PCR samples were supplemented with 10% DMSO. Annealing temperatures of 66 and 71 0 C and extension for 1 .5 min at 68 0 C were used. A 5' extension was designed for each oligo to introduce restriction sites (Spel, ⁇ / ⁇ tel) to aid cloning of the amplified fragment.
  • the Nde ⁇ site of UES4_For comprises the loading module start codon (ATG), and the 3 non-coding bases upstream are mutated to CAT (replacing TCC).
  • the 2.27 kb PCR fragment was ligated with Sma ⁇ digested and SAP-treated pUC19, resulting in plasmid 'pUC19 fkbP'O 506 left'. The insert sequence was
  • Oligos UES7_For and UES7_Rev were used to amplify a 2.29 kb region of DNA from Streptomyces tsukubaensis no. 9993 using 3G9 cosmid and KOD Polymerase. PCR samples were supplemented with 10% DMSO. Annealing temperatures between 66 and 71 0 C and extension for 1 .5min at 68 0 C proved to be successful. A 5' extension was designed for UES7_Rev to introduce an Xba ⁇ site.
  • UES7_For comprises the internal Pvu ⁇ site at the 5' end of ave KS1 followed by the internal Pvu ⁇ site of FK506 KS1 which was mutated to 'CCATCG'.
  • Oligos PCR12F and UES5_Rev were used to amplify a 1.46 kb region of DNA from Streptomyces avermitilis using genomic DNA template (Kieser et al., 2000) and KOD Polymerase. PCR samples were supplemented with 10% DMSO. Annealing temperatures between 66 and 71 0 C and extension for 1 .5 min at 68 0 C were used. A 5' extension was designed for PCR12F to introduce an Nde ⁇ site, whereas UES5_Rev comprises the internal Pvu ⁇ site at the 5'-end of ave KS1.
  • PCR12F comprises the 5' end of ave loading module and the choice of Nde ⁇ introduces a mutation resulting in the N-terminal sequence of the loading module being 'MQR' instead of 'VQR' in the avermectin PKS.
  • UES5_Rev comprises the 5' end of ave KS1 and introduces a mutation resulting in the KS1 N-terminal sequence of 'EPIA' instead of 'DPIA' in the avermectin cluster and as 'EPIA in the FK506 cluster (see 3.5).
  • Escherichia coli ET12567 (pUZ8002) was transformed with pUS14 by electroporation to generate the E. coli donor strain for conjugation. This strain was used to transform Streptomyces tsukubaensis by spore conjugation (as described in Materials & Methods). Exconjugants were plated on R6 agar and incubated at 37°C. pUS14 is not able to self- replicate in Streptomyces tsukubaensis at 37 0 C and must integrate into the genome.
  • Transformants were subcultured onto MAM plates with apramycin (100 mg/L) and nalidixic acid (50 mg/L) at 37 0 C and subcultured again onto MAM plates with apramycin (50 mg/L) and nalidixic acid (25 mg/L) at 37 0 C, and once more onto MAM plates containing apramycin (50 mg/L), to ensure that the pUS14 plasmid with resistance marker had integrated.
  • Subculturing to allow secondary recombination was carried out as follows: the transformants were subcultured for three subsequent rounds at 37 0 C on MAM plates with no antibiotic and a final time at 28 0 C. The transformants from the last subculture on antibiotic free plates were plated for spore harvest on ISP4 medium at 28 0 C. Serial dilutions were made from the filtered collected spores and plated on MAM plates to achieve single colonies.
  • Example 9 Generation of a Streptomyces tsukubaensis strain in which the loading module and KS1of the FK506 PKS are replaced by the loading module and KS1 of the avermectin PKS from Streptomyces avermitilis.
  • Oligos UES10_For and UES10_Rev were used to amplify a 2.23 kb region of DNA from Streptomyces tsukubaensis using cosmid 3G9 template and KOD polymerase. PCR samples were supplemented with 10% DMSO. Annealing temperatures between 66 and 71 0 C and extension for 1 .5 min at 68 0 C were used. A 5' extension was designed for each oligo to introduce restriction sites (Sfo ⁇ , Xba ⁇ ) to aid cloning of the amplified fragment.
  • the 2.23 kb PCR fragment was ligated with Sma ⁇ digested and SAP-treated pUC19 resulting in plasmid 'pUC19 fkbB" 506 right'.
  • the insert sequence was verified by sequencing.
  • the choice of Sfo ⁇ as restriction site immediately downstream of fkbB KS1 introduces a mutation (GTG to GCG) with the translated code changing from VPEVS' to 'APEVS' (see 4.4).
  • Oligos PCR12F and UES9_Rev were used to amplify a 2.75 kb region of DNA from Streptomyces avermitilis (DSM41443J using genomic DNA template (Kieser et al., 2000) and KOD Polymerase. PCR samples were su pplemented with 1 0% DMSO. Anneal ing temperatures between 66 and 71 0 C and extension for 1 .5 min at 68 0 C proved to be most successful. A 5' extension was designed for each oligo to introduce restriction sites ( ⁇ /c/el, Afe ⁇ ) to aid cloning of the amplified fragment.
  • PCR12F comprises the 5' end of ave loading module and the choice of ⁇ /c/el introduces a mutation resulting in the N-terminal sequence of the loading module being 'MQR' instead of 'VQR' in the avermectin PKS.
  • Escherichia coli ET12567 (pUZ8002) was transformed with pUS16 by electroporation to generate the E. coli donor strain for conjugation. This strain was used to transform Streptomyces tsukubaensis by spore conjugation (as described in Materials & Methods). Exconjugants were plated on R6 agar and incubated at 37°C. pUS16 is not able to self- replicate in Streptomyces tsukubaensis at 37 0 C and must integrate into the genome.
  • Transformants were subcultured onto MAM plates with apramycin (100 mg/L) and nalidixic acid (50 mg/L) at 37 0 C and subcultured again onto MAM plates with apramycin (50 mg/L) and nalidixic acid (25 mg/L) at 37 0 C, and once more onto MAM plates containing apramycin (50 mg/L), to ensure that the pUS16 plasmid with resistance marker had integrated.
  • Subculturing to allow secondary recombination was carried out as follows: the transformants were subcultured for three subsequent rounds at 37 0 C on MAM plates with no antibiotic and a final time at 28 0 C. The transformants from the last subculture on antibiotic free plates were plated for spore harvest on ISP4 medium at 28 0 C. Serial dilutions were made from the filtered collected spores and plated on MAM plates to achieve single colonies.
  • PYDG+MES medium See Media Recipes
  • Example 10 Array feeding to BIOT-4254 with various starter units
  • Spore stocks of BIOT-4254 were prepared after growth on MAM , ISP4, ISP3 or ISP2 medium, and preserved in 20% w/v glycerol in distilled water and stored at -80 0 C. Spore stocks were recovered onto plates of MAM medium and incubated for 5 - 21 days at 28°C. Vegetative cultures (seed culture) were prepared by removing one agar plug (6 mm in diameter) from the MAM, ISP4, ISP3 or ISP2 plate and inoculating into 7 ml. medium NGY in 50 ml. Centrifuge tubes with foam plugs. The culture tubes were incubated at 28°C, 300 rpm (2.5 cm throw) for 48 h. From the seed culture 0.5 ml.
  • Example 11 Biological data - In vitro evaluation of potency with a NFAT gene reporter.
  • IC50 values were additionally generated for FK506 and FK520 as controls.
  • Example 12 Biological data - In vitro evaluation of cell permeability and efflux.
  • both FK506 and FK520 show high levels of efflux, possibly due to the action of a transporter, such as Pgp.
  • a transporter such as Pgp.
  • 28-des(3-c/s-methoxy-4- frans-hydroxycyclohexyl)-28-(4-tetrahydro-2H-pyran)FK520 showed much higher apical to basolateral transport and lower basolateral to apical transport, suggesting that it is more permeable and less of a substrate for efflux, predicting improved and more consistent oral bioavailability.
  • Example 13 Biological data - In vivo evaluation of PK.
  • the oral bioavailability (F%) of the Pyran FK520 is higher than that for both FK506 and FK520, whilst the half life (T1/2) is shorter.
  • Example 14 Array feeding to BIOT-4225 with various starter units
  • Spore stocks of BIOT-4225 were prepared after growth on MAM, ISP4, ISP3 or ISP2 medium, and preserved in 20% w/v glycerol in distilled water and stored at -80 0 C. Spore stocks were recovered onto plates of MAM medium and incubated for 5 - 21 days at 28°C. Vegetative cultures (seed culture) were prepared by removing one agar plug (6 mm in diameter) from the MAM, ISP4, ISP3 or ISP2 plate and inoculating into 7 ml. medium NGY in 50 ml. Centrifuge tubes with foam plugs. The culture tubes were incubated at 28°C, 300 rpm (2.5 cm throw) for 48 h. From the seed culture 0.5 ml.
  • Example 15 Array feeding to BIOT-4276 with various starter units
  • Spore stocks of BIOT-4276 were prepared after growth on MAM , ISP4, ISP3 or ISP2 medium, and preserved in 20% w/v glycerol in distilled water and stored at -80 0 C. Spore stocks were recovered onto plates of MAM medium and incubated for 5 - 21 days at 28°C. Vegetative cultures (seed culture) were prepared by removing one agar plug (6 mm in diameter) from the MAM, ISP4, ISP3 or ISP2 plate and inoculating into 7 ml. medium NGY in 50 ml. Centrifuge tubes with foam plugs. The culture tubes were incubated at 28°C, 300 rpm (2.5 cm throw) for 48 h. From the seed culture 0.5 ml.
  • Streptomyces hygroscopicus analysis of the enzymatic domains in the modular polyketide synthase. Gene 169: 9-16.
  • Antascomicinc A, B, C, D and E Novel FKBP12 binding compounds from a
  • Rapamycin inhibits arterial intimal thickening caused by both alloimmune and mechanical injury. Its effect on cellular, growth factor and cytokine response in injured vessels.
  • FK 506-binding protein proline rotamase is a target for the immunosuppressive agent FK 506 in
  • Immunosuppressant FK506 promotes neurite outgrowth in cultures of PC12 cells and sensory ganglia. Proceedings of the National Academy of Sciences of the United States of America 91 :3191-3195. MacNeil, DJ. , Gewain, K.M., Ruby, C. L., Dezeny, G., Gibbons, P. H., and MacNeil, T. (1992) Analysis of Streptomyces avermitilis genes required for avermectin biosynthesis utilizing a novel integration vector. Gene 111 : 61-68. Maes, B. D. and Vanrenterghem, Y.F.Ch. (2004) Cyclosporine: Advantages Versus
  • Streptomyces hygroscopicus analysis of genes flanking the polyketide synthase. Gene 169: 1-7.
  • A mycophenolate mofetil, and sirolimus (rapamycin) inhibit allergen-induced proliferation and IL-5 production by PBMCs from atopic asthmatic patients.
  • the biosynthetic gene cluster for the polyketide immunosuppressant rapamycin is the biosynthetic gene cluster for the polyketide immunosuppressant rapamycin.
  • Streptomyces hygroscopicus var. ascomyceticus contains genes for biosynthesis of unusual polyketide extender units. Gene 251 : 81-90.
  • Hsp56 component of steroid receptor complexes binds to immobilized FK506 and shows homology to FKBP-12 and FKBP-13. Journal of
  • Rapamycin inhibits hepatic stellate cell proliferation in vitro and limits fibrogenesis in an in vivo model of liver fibrosis. Gastroenterology. 117(5): 1198-204.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Oncology (AREA)
  • Transplantation (AREA)
  • Communicable Diseases (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Dermatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Saccharide Compounds (AREA)

Abstract

Composés de formule (I), leur utilisation en tant que médicaments et aspects associés.
PCT/GB2009/050689 2008-06-17 2009-06-17 Nouveaux composés et leurs procédés de production WO2010004304A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
EP09785241A EP2313419A1 (fr) 2008-06-17 2009-06-17 Nouveaux composés et leurs procédés de production
JP2011514131A JP2011524413A (ja) 2008-06-17 2009-06-17 新規化合物、及びこれらの製造のための方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB0811062A GB0811062D0 (en) 2008-06-17 2008-06-17 Novel compounds and methods for their production
GB0811062.9 2008-06-17
GB0904542A GB0904542D0 (en) 2009-03-17 2009-03-17 Novel compounds and methods for their production
GB0904542.8 2009-03-17

Publications (1)

Publication Number Publication Date
WO2010004304A1 true WO2010004304A1 (fr) 2010-01-14

Family

ID=40973197

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2009/050689 WO2010004304A1 (fr) 2008-06-17 2009-06-17 Nouveaux composés et leurs procédés de production

Country Status (3)

Country Link
EP (1) EP2313419A1 (fr)
JP (1) JP2011524413A (fr)
WO (1) WO2010004304A1 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011004008A1 (fr) 2009-07-09 2011-01-13 Lek Pharmaceuticals D.D. Procédé pour préparation de tacrolimus
WO2012103520A1 (fr) 2011-01-28 2012-08-02 Board Of Regents Of The University Of Nebraska Procédés et compositions pour moduler la cyclophiline d
JP2015502973A (ja) * 2011-12-23 2015-01-29 バイオティカ テクノロジー リミテッド 新規なラパマイシン類似体
WO2017136708A1 (fr) * 2016-02-04 2017-08-10 The Johns Hopkins University Synthèse et composition de bibliothèques de rapafucine
CN112410353A (zh) * 2019-08-23 2021-02-26 上海医药工业研究院 一种fkbS基因、含其的基因工程菌及其制备方法和用途
US11066416B2 (en) 2016-02-04 2021-07-20 The Johns Hopkins University Rapafucin derivative compounds and methods of use thereof
US11555054B2 (en) 2016-02-04 2023-01-17 The Johns Hopkins University Rapadocins, inhibitors of equilibrative nucleoside transporter 1 and uses thereof
US11708391B2 (en) 2016-02-04 2023-07-25 The Johns Hopkins University Rapaglutins, novel inhibitors of GLUT and use thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995015328A1 (fr) * 1993-11-30 1995-06-08 Abbott Laboratories Immunomodulateurs macrocycliques a noveaux substituants du cycle clyclohexyle
GB2294460A (en) * 1994-10-25 1996-05-01 Merck & Co Inc Aryl and heteroaryl macrolides having immunosuppressive activity
US20030235614A1 (en) * 1998-03-26 2003-12-25 Fujisawa Pharmaceutical Co. Ltd. Sustained-release formulation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995015328A1 (fr) * 1993-11-30 1995-06-08 Abbott Laboratories Immunomodulateurs macrocycliques a noveaux substituants du cycle clyclohexyle
GB2294460A (en) * 1994-10-25 1996-05-01 Merck & Co Inc Aryl and heteroaryl macrolides having immunosuppressive activity
US20030235614A1 (en) * 1998-03-26 2003-12-25 Fujisawa Pharmaceutical Co. Ltd. Sustained-release formulation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BATCHELOR, MARK J. ET AL: "Total syntheses of close analogs of the immunosuppressant FK506", TETRAHEDRON , 50(3), 809-26 CODEN: TETRAB; ISSN: 0040-4020, 1994, XP002542788 *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2451955B1 (fr) * 2009-07-09 2018-01-24 LEK Pharmaceuticals d.d. Procédé de preparation de tacrolimus
WO2011004008A1 (fr) 2009-07-09 2011-01-13 Lek Pharmaceuticals D.D. Procédé pour préparation de tacrolimus
WO2012103520A1 (fr) 2011-01-28 2012-08-02 Board Of Regents Of The University Of Nebraska Procédés et compositions pour moduler la cyclophiline d
JP2015502973A (ja) * 2011-12-23 2015-01-29 バイオティカ テクノロジー リミテッド 新規なラパマイシン類似体
US10662220B2 (en) 2016-02-04 2020-05-26 The Johns Hopkins University Synthesis and composition of rapafucin libraries
CN108713028A (zh) * 2016-02-04 2018-10-26 约翰霍普金斯大学 rapafucin文库的合成和组合物
WO2017136708A1 (fr) * 2016-02-04 2017-08-10 The Johns Hopkins University Synthèse et composition de bibliothèques de rapafucine
US11066416B2 (en) 2016-02-04 2021-07-20 The Johns Hopkins University Rapafucin derivative compounds and methods of use thereof
CN108713028B (zh) * 2016-02-04 2021-12-28 约翰霍普金斯大学 rapafucin文库的合成和组合物
US11555054B2 (en) 2016-02-04 2023-01-17 The Johns Hopkins University Rapadocins, inhibitors of equilibrative nucleoside transporter 1 and uses thereof
US11708391B2 (en) 2016-02-04 2023-07-25 The Johns Hopkins University Rapaglutins, novel inhibitors of GLUT and use thereof
US11945827B2 (en) 2016-02-04 2024-04-02 The Johns Hopkins University Rapafucin derivative compounds and methods of use thereof
CN112410353A (zh) * 2019-08-23 2021-02-26 上海医药工业研究院 一种fkbS基因、含其的基因工程菌及其制备方法和用途
CN112410353B (zh) * 2019-08-23 2023-01-24 上海医药工业研究院 一种fkbS基因、含其的基因工程菌及其制备方法和用途

Also Published As

Publication number Publication date
JP2011524413A (ja) 2011-09-01
EP2313419A1 (fr) 2011-04-27

Similar Documents

Publication Publication Date Title
EP2471797B1 (fr) 17-desmethylrapamycine et ses analogues, procédés pour leur production et leur utilisation comme immunosuppresseurs, agents anticancéreux, agents antifongiques etc.
EP2313419A1 (fr) Nouveaux composés et leurs procédés de production
EP1589031B1 (fr) Production des polyketides et d'autres produits naturels
WO2011021036A1 (fr) Analogues de polycétides et leurs procédés de production
CA2567043A1 (fr) Groupe de genes biosynthetiques utilise dans la production d'un polyketide complexe
EP2658855A2 (fr) Nouveaux composés polycétides et leurs procédés de fabrication
WO2010106366A1 (fr) Analogues de fk506 et pk520 et leurs utilisations pharmaceutiques
WO2010011882A1 (fr) Groupe de gènes de biosynthèse pour la production d'un polycétide complexe
WO2011045594A1 (fr) Nouveaux macrocyles et leurs procédés de production
WO2011045593A1 (fr) Nouveaux macrocyles et leurs procédés de production
CA2621093A1 (fr) Production de polyketides et autres produits naturels

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09785241

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2011514131

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2009785241

Country of ref document: EP