WO2009154393A2 - 인간 프로락틴의 용도 - Google Patents
인간 프로락틴의 용도 Download PDFInfo
- Publication number
- WO2009154393A2 WO2009154393A2 PCT/KR2009/003223 KR2009003223W WO2009154393A2 WO 2009154393 A2 WO2009154393 A2 WO 2009154393A2 KR 2009003223 W KR2009003223 W KR 2009003223W WO 2009154393 A2 WO2009154393 A2 WO 2009154393A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- skin
- composition
- ulcer
- hprl
- prolactin
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/22—Hormones
- A61K38/2257—Prolactin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
Definitions
- the present invention relates to a composition for improving skin conditions, a method for improving skin condition using the same, a composition for treating a wound or ulcer, and a method for treating a wound or ulcer using the same.
- Prolactin the anterior pituitary hormone
- Prolactin (PRL) and its receptor Actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice.Endocrine Reviews 19: 225 ⁇ 268 (1998); Goffin V, et al., Prolactin: the new biology of an old hormone .Annual Review of Physiology 64 7-67 (2002)).
- prolactin is known to regulate hair growth in various species (Lincoln G A, Significance of seasonal cycles in prolactin secretion in male mammals. Perspectives in Andrology 53: 299-306 (1989)).
- prolactin receptors have been found in hair follicles (Choy V J, et al., Distribution of prolactin receptor immunoreactivity in ovine skin and during the wool follicle growth cycle. Journal of Endocrinology 155: 265-275 (1997)).
- Prolactin is a peptide hormone that contains about 200 amino acids
- prolactin is synthesized in axtra-pituitary tissue, which results in local self-secreting and lateral secretion effects (Craven AJ, et al., Prolactin signaling influences the timing mechanism of the hair follicle: analysis of hair growth cycles in prolactin receptor knockout mice.Endocrinology 142: 2533-2539 (2001).
- numerous citations and patent documents are referenced and their citations are indicated. The disclosures of the cited documents and patents are incorporated herein by reference in their entirety, so that the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly explained. Detailed Description of the Invention
- the present inventors have completed the present invention by finding that the topical application of human prolactin to the skin can greatly improve skin condition and wounds / ulcers, as a result of research efforts to find new uses of human prolactin.
- an object of the present invention is to provide a composition for improving skin conditions.
- Another object of the present invention to provide a composition for treating wounds or ulcers.
- the present invention provides a composition for improving skin conditions (condit ions) comprising human prolactin as an active ingredient.
- the present invention provides a composition for treating wounds or ulcers comprising human prolactin as an active ingredient.
- the invention provides a method for improving skin conditions comprising administering to a human skin an effective amount of human prolactin.
- the invention provides a method of treating a wound or ulcer comprising administering to a human skin an effective amount of human prolactin.
- the present inventors have conducted research to find new uses of human prolactin and found that topical application of human prolactin to skin can greatly improve skin condition and wounds / ulcers.
- Human prolact in (hPRL) used as an active ingredient in the present invention can be used any polypeptide that exhibits human prolactin activity, for example, mature hPRL, Met-hPRL, hPRL variants, modi f ied-hPRL, Either hPRL fragment or hPRL analogue can be used.
- mature hPRL or Met-hPRL Preferably, mature hPRL or Met-hPRL.
- mature hPRL points to the human prolactin having the amino acid sequence of human prolactin state (raa or j) present in the human blood
- Met-hPRL is pointing to the human prolactin methionine added to the N- terminus of the mature hPRL
- hPRL vari nts are It refers to human prolactin having the amino acid sequence of human prolactin other than the main human prolactin present in the human body
- modi f ied hPRL is an additive containing a pegylat ion or glycat ion to one or more amino acid residues of human prolactin Human prolactin that has undergone adhesion, chemical modification including deamidat ion or phosphorylat ion, or other amino acid sequence at the N-terminus, C-terminus or intermediate of the amino acid sequence of hPRL using a fusion protein using genetic or biochemical methods.
- HPRL fragment refers to human prolactin from which a part of the amino acid sequence of human prolactin has been removed by genetic or biochemical methods, and hPRL analogue indicates the amino acid sequence of human prolactin by another genetic method.
- Human prolactin modified with Human prolactin of the invention can be specified by one of two methods. One can be specified by binding to human prolactin receptors and the other can be specified by methods of measuring the biological activity of human prolactin.
- the composition of the present invention has a liposome composition. That is, human prolactin as an active ingredient is preferably surrounded by liposomes and applied to the skin.
- the composition of the present invention has a composition of nanoliposomes.
- nanoliposomes refers to liposomes having the form of conventional liposomes with an average particle diameter of less than 201000 nm.
- the average particle diameter of the nanoliposomes is 50-500 nm, more preferably 50-350 nm, most preferably 50-250 nm.
- Liposomes are defined as spherical phospholipid vesicles of colloidal particles that self-assemble. Liposomes composed of amphiphilic molecules with water-soluble heads (hydrophilic groups) and soluble tails (hydrophobic groups) are spontaneously bound and aligned by their interactions. According to the size and lamination (Same l anywayity), it is classified into SUV (Smal l Uni lamel lar Vesicle), LUV (Large Uni lamel lar Vesicle) and MLV (Mult i Lamel lar Vesicle). Such liposomes exhibiting various laminations have a double membrane structure similar to that of cell membranes.
- the nanoliposomes surrounding the prolactin have a small unilamellar vesicle structure.
- the human prolactin surrounded by the nanoliposomes has an activity of 90-100% of the surrounding human prolactin.
- the (nano) liposomes in the present invention can be prepared using phospholipids, fleas, surfactants, fatty acids or / and water.
- Phospholipids used in the preparation of the (nano) liposomes of the present invention are used as amphoteric lipids, including natural phospholipids (eg, egg yolk lecithin or soy lecithin, sphingomyelin) and synthetic phospholipids (eg dipalmitoyl).
- Phosphatidylcholine or hydrogenated lecithin preferably lecithin. More preferably, the lecithin is naturally occurring unsaturated lecithin or saturated lecithin extracted from soybean or egg yolk.
- the polyol that can be used in the (nano) liposome of the present invention is not particularly limited, preferably propylene glycol, dipropylene glycol, 1,3-butylene glycol, glycerin, methylpropanediol, isoprene glycol, pentylene glycol, Includes Erisri, Zyri and Solbi.
- Surfactants that can be used in the preparation of the (nano) liposomes of the present invention may be any known in the art, for example, anionic surfactants (eg, alkylacylglutamate, alkylphosphate, alkyllactylate, Dial 3 ⁇ 4 phosphates and trialkyl phosphates), cationic surfactants, amphoteric surfactants and nonionic surfactants (e.g. alkoxylatedalkylethers, alkoxylatedalkylesters, alkylpliglycosides, polyglyceryl esters and sugar esters) Can be used.
- anionic surfactants eg, alkylacylglutamate, alkylphosphate, alkyllactylate, Dial 3 ⁇ 4 phosphates and trialkyl phosphates
- cationic surfactants e.g. alkoxylatedalkylethers, alkoxylatedalkylesters, alkylpliglycosides, polyg
- Fatty acids that can be used to prepare the (nano) liposomes of the present invention are higher fatty acids, preferably saturated or unsaturated fatty acids of C 12 -22 alkyl chains, for example, lauric acid, myristic acid, palmitic acid, stearic acid. Oleic acid and linoleic acid.
- the water used in the preparation of the (nano) liposomes of the present invention is generally desilverized distilled water.
- the (nano) liposomes of the present invention are prepared only with phospholipids and water, specific examples of which are described in the following examples.
- the hPRL′-containing nanoliposomes of the present invention are prepared by a process comprising the following steps: (a) Phospholipids capable of forming liposomes (preferably, egg yolk lecithin or soy lecithin) ) Is dissolved in an aqueous solution containing human prolactin; And (b) repeatedly passing the aqueous solution containing human prolactin and phospholipid into a high pressure homogenizer, but gradually increasing the content of phospholipid and the pressure of the high pressure homogenizer according to the number of passages to prepare a nanoliposome containing human prolactinol.
- Phospholipids capable of forming liposomes preferably, egg yolk lecithin or soy lecithin
- the aqueous solution containing human prolactin is preferably a complete solution of pH 6-8 Pa, preferably about pH 7, (eg, sodium phosphate complete solution). If sodium phosphate complete solution is used, the concentration is 5-100 mM, more preferably 5-60 mM, even more preferably 10-30 mM, most preferably about 20 mM.
- the most particular aspect is to pass a mixture of phospholipids and hPRL ⁇ aqueous solution several times through a high pressure homogenizer, and to sequentially increase the amount of phospholipids and the pressure of the homogenizer as the number of passes increases.
- the pressure of the homogenizer is sequentially increased to 0-1000 bar, preferably 0-800 bar.
- the output can be increased by 50 bar or 100 bar, preferably by 100 bar.
- the amount of phospholipid is sequentially increased to 5-40 w / v (%), preferably 5-30 w / v (3 ⁇ 4).
- hPRL-containing nanoliposomes are prepared, preferably liquid hPRL-containing nanoliposomes.
- the compositions of the present invention can be used to improve various skin conditions.
- the composition of the present invention is effective in improving wrinkles, removing blemishes or blemishes (blemishes or freckles) produced or promoted by ultraviolet rays, treating acne, whitening, improving skin elasticity, preventing skin aging, and improving skin moisturizing. It is preferably effective for improving wrinkles, removing blemishes (including blemishes, acne), whitening and improving skin elasticity.
- compositions of the present invention can be used for the healing of various wounds or ulcers.
- the compositions of the present invention can be used to treat wounds and ulcers in elderly or diabetic patients.
- Ulcers that can be cured by the compositions of the present invention include chronic ulcers and acute ulcers.
- the chronic ulcers include aneurysm ulcers, varicose ulcers, varicose vein ulcers, diabetic ulcers, diabetic foot ulcers, compression ulcers, systemic phlegal ulcers and pressure sores, wherein the acute ulcers are thermally damaged. injury, trauma, surgery, resection of skin cancer, fungal or bacterial infections, vasculitis, scleroderma or wounds caused by scalp, and burns.
- composition of the present invention may be prepared as a pharmaceutical composition, a functional cosmetic ((0331 ⁇ 61 £ 11) composition or a cosmetic composition.
- Ingredients included in the cosmetic or functional cosmetic composition of the present invention include ingredients commonly used in cosmetic compositions in addition to human prolactin or hPRL-containing liposomes as active ingredients, and include, for example, stabilizers, solubilizers, vitamins, pigments and flavorings. Conventional adjuvants and carriers.
- the cosmetic composition for protecting the skin of the present invention may be prepared in any formulation commonly prepared in the art, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactants- It may be formulated as containing cleansing oil, powder foundation, emulsion foundation, wax foundation and spray dung, but is not limited thereto. More specifically, supple lotion, nutrition lotion, nutrition cream, massage cream, essence It can be prepared in the form of eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray or powder.
- the carrier components include animal oil, vegetable oil wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide. Can be used.
- lactose, talc, silica, aluminum hydroxide, chamo silicate or polyamide powder may be used, in particular, in the case of spray, additionally nitrogen, chlorofluorohydrocarbon And may include propane / butane or dimethyl ether.
- a solvent, solubilizer or emulsifier is used as the carrier component, for example water, ethane, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, Fatty acid esters of 1,3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan.
- liquid carrier diluents such as water, ethanol or propylene glycol, sucrose isostearyl alcohol, suspending agents such as polyoxyethylene sorbitan ester and polyoxyethylene sorbitan ester, Microcrystalline cellulose, aluminum metahydroxy bentonite, agar or tracant and the like can be used.
- the formulation of the present invention is a surfactant-containing cleansing agent
- Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.
- composition of the present invention when prepared as a pharmaceutical composition, it may include a pharmaceutically acceptable carrier, for example, lactose, dextrose, sucrose, sorbbi, manny, starch, acacia rubber, calcium phosphate, Alginate gelatin, silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and / or Mineral oils.
- a pharmaceutically acceptable carrier for example, lactose, dextrose, sucrose, sorbbi, manny, starch, acacia rubber, calcium phosphate, Alginate gelatin, silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and / or Mineral oils.
- the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, and a preservative.
- a lubricant e.g., talc, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, kaolin, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol, mannitol
- the pharmaceutical composition of the present invention is developed for topical topical administration.
- Suitable dosages of the pharmaceutical compositions of the present invention may be prescribed in various ways depending on factors such as formulation method, mode of administration, age, weight, sex, morbidity of food, time of administration, route of administration, rate of excretion, and reaction response. Can be.
- the topical dose effective amount of the pharmaceutical composition of the present invention is preferably 0.001-100 ng / cm 2 (skin surface area) per day, more preferably 0.01-10 ng / cm 2 , and most preferably 0.1_2. ng / cm 2 .
- the term "effective amount" means a dose sufficient to achieve the pharmaceutical effect described above.
- compositions of the present invention may be prepared in unit dose form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporation into a multi-dose container.
- the formulation is most preferably in the form of a solution containing nanoliposomes.
- the composition of the present invention significantly inhibits skin aging, improves wrinkles and blemishes, treats acne and removes blotch. Shows whitening effect.
- the composition of this invention can make wound or ulcer healing high efficiency.
- the composition of the present invention is not only very safe for the human body, but also excellent in stability when prepared with nanoliposomes.
- composition for improving skin conditions, treating wounds or ulcers of the present invention contains human prolactin as an active ingredient.
- composition of the present invention can successfully exhibit skin condition improvement, wound or ulcer treatment efficacy even when applied topically to the skin surface.
- composition of the present invention is very safe for human body.
- 1 is a view showing the wrinkle improvement effect of Nanol ip hPRL or Nanol ipo-his-hPRL using a hairless mouse.
- Lipo-hPRL represents Nanol ipo-hPRL and Lipo_hiis-hPRL represents his-hPRL of Nanol ip.
- FIG. 2 is a diagram showing the effect on the skin elasticity and water loss of the nanoHpo-hPRL or Nanol ip his— hPRL using a hairless mouse.
- Figure 2a shows the results for the skin elasticity
- Figure 2b shows the results for the water loss, the average of the values measured three times as a result.
- Figure 3 is a diagram showing the effect on the skin epidermal thickening prevention of Nanol ipo-hPRL or Nanol ip his ⁇ hPRL using hairless mice.
- FIG. 4 is a diagram showing the effect on the inhibition of melanogenesis of Nanol ipo-hPRL using B16F1 melanoma cells.
- FIG. 5 is a diagram showing the effect on skin cell differentiation of hPRL with Nanol ip using Tegoscience Neoderm artificial skin.
- FIG. 6 is a view showing a process of applying the control group and the experimental group to pigs induced wounds.
- FIG. 7 is a view showing a change in wound size when applying Nanol ipo-hPRL.
- the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, and the scope of the present invention is not limited by these examples in accordance with the gist of the present invention to those skilled in the art. Will be self explanatory.
- Genomic DNA was obtained from HEF (Human embryonic fibroblast). This
- PCR was performed to obtain five axon DNA fragments encoding prolactin using a template after digestion with the same restriction enzyme purchaser used below.
- primers were designed so that some bases of the linking sites reached base pairs with each other, and PriraeSTA TM HS DNA polymerase (Takara, Japan) was used for all PCR.
- the primary PCR method for amplifying axons 1, 2, 3, 4 and 5 of prolactin is as follows. ⁇ HKTakara, Japan) using genomic DNA digested with a template as a template, and using PCR (30) using hPL 1U primer (Xioneer, Korea; same as where to buy the primer used below) and hPL 2D primer pair containing axon 1 Cycles; 98 ° C. 10 seconds, 55 ° C. 5 seconds, 72 ° C. 15 seconds), and amplification of axons 1,2 of 222 bp was obtained.
- the secondary PCR products 334 bp and 392 bp were used as templates, and the hPL 1U containing the cleavage site (GMTTC) and the hPL 8D primer pair containing the Kpn cleavage site (GGTACC) were added, followed by PCR (30 cycles).
- DNA and pUC-rnrnB (inserting rrnB terminator into pUC18 plasmid, Rigeron Co., Ltd.) obtained by the above method were digested with Kpnl, ligated into ⁇ 4 DNA ligase, and transformed into ToplOF strain. . After incubation for 15 hours at 37 ° C, three colonies were randomly selected and cultured, plasmids were obtained by alkali lysis method, and electrophoresed on a 1% agarose gel to confirm the size and sequence analysis. By selecting the desired plasmid (pUC-hPRL).
- Example 2 Preparation of Expression Vector Combining the narK Promoter and Met-Prolactin Removed from Signal Sequences
- PCR was performed to link the narK promoter with Met-prolactin from which the signal sequence was removed, and the 18 bases of the linking site were linked to each other in base pairs.
- the first PCR method is as follows. pNKmut plasmid (including 10 mutated narK promoter, Ligeron Co., Ltd., Republic of Korea Patent Application Publication No. 2006—0089086) as a template, PCR using PCR (0Y— 17 and r-narK D primer pair 30 cycles: 98 ° C. 10 seconds, 55 ° C. 5 seconds, 72 ° C. 25 seconds) to obtain 350 bp of narK promoter.
- the pUC-hPRL was used as a template, and PCR (30 cycles) was performed using hPL 9U and hPL 8D primer pairs. 98 ° C. 10 seconds, 55 ° C. 5 seconds, 72 ° C. 55 seconds) to obtain Met-prolactin with 626 bp signal sequence removed.
- 0Y-17 and Kpnl cleavage site (GGTACC) containing EcoRI cleavage site (GMTTC) were prepared using narK promoter (350 bp) and Met-prolactin (626 bp) obtained as described above as templates. Insert the included hPL 8D primer pair and perform PCR (30 cycles; 98 ° C 10 seconds, 55 ° C 5 minutes, 72 ° C 1 minute) to 958 bp fragments (narK promoter and Met- Section containing prolactinol).
- PCR was performed to link a gene encoding Met-prolactin protein to a vector containing a gene sequence encoding six histidines after the narK promoter, where 18 bases of the linking site were linked to each other in base pairs. .
- the first PCR method is as follows. PCR (30 cycles) using 0Y-17 and His-narK D primer pairs as a template with a pNKmut plasmid (including 10 mutated narK promoters, Ligeron Co., Ltd., Korean Patent Application Publication No. 2006-0089086) ; 98 ° C. 10 seconds, 55 ° C. 5 seconds, 72 ° C.
- PCR (30 cycles; 98 ° C. 10 seconds, 55 ° C. 5 seconds, 72 ° C. 55 seconds using hPL 11U and hPL 8D primer pairs as a template with the pUC-narK-Met-hP L plasmid as described in Example 2) ) was obtained 626 bp Met-prolactin gene.
- Secondary PCR reactions included the EcoRI cleavage site (GAATTC) as a template of 368 bp (narK promoter containing 6 histidineol-coding gene sequences) and 626 bp (Met-hPRL gene) obtained from the primary PCR reaction.
- 976 bp fragments were prepared by PCR (30 cycles; 98 ° C 10 sec, 55 ° C 5 min, 72 ° C 1 min) with a pair of hPL 8D primers containing 0Y ⁇ 17 and Kpnl cleavage site (GGTACC). (narK promoter-6 hist idine-Met-prolactin gene segments) were obtained.
- a device outlet (outlet) high-pressure homogenizer (max. Output 5 L / hr , max. Pressure 1200 bar, Model HS-1002, ( Note) chemical conversion machine (Korea)
- a temperature is 30 ° C unit of a heat exchanger does not exceed the After the heat exchanger was installed in ice water, the inside of the instrument was washed with distilled water and ready for operation.
- human prolactin or his ⁇ at 2 mg / concentration dissolved in a complete solution (20 mM NaH 2 P0 4 H 6.5-7.5, 1 mM EDTA) Phospholipids were added to the human prolactin solution at a rate of 10 w / v%, hydrated, stirred, and passed through a homogenizer of at least 3 h at low pressure using a homogenizer at room temperature. Subsequently, the phospholipid was added to a solution having undergone the homogenizer at a ratio of 14 w / v%, sufficiently hydrated and stirred, and passed through the homogenizer three times or more at 100 bar.
- phospholipid was added in an amount of 18 w / v%, sufficiently hydrated and stirred, and passed through the homogenizer three times or more at 200 bar. Then, to the solution passed through the homogenizer, phospholipid was added to a ratio of 20 w / v%, hydrated and stirred sufficiently, and passed through the homogenizer three times or more at 300 bar. Subsequently, phospholipid was added to a solution having undergone the homogenizer in a ratio of 22 w / v, hydrated and stirred, and passed through the homogenizer three times or more at 400 bar.
- the phospholipid was added at a ratio of 24 w / v%, sufficiently hydrated and stirred, and passed through the homogenizer three times or more at 500 bar. Then, to the solution passed through the homogenizer, phospholipid was added to a ratio of 26 w / v%, hydrated and stirred sufficiently, and passed through the homogenizer three times or more at 600 bar. Subsequently, the phospholipid was added to a solution having undergone the homogenizer in a ratio of 28 w / v%, hydrated, stirred, and passed through the homogenizer three times or more at 700 bar.
- the experimental animals purchased female SKH-1 hairless mice of 4 weeks of age from Dooyeol Biotech (Sungnam, Korea). The experimental animals were raised under conditions of temperature control of 24 cm 2 ° C, relative humidity of 50 ⁇ 10%, and light and dark circulation for 12 hours. After 2 weeks of incubation, the animals were randomly divided into 11 groups.
- UV irradiator was used VLX-3W stimulator (Yilber Lourmat, Marne la Vallee, France). UVB irradiation was carried out three times a week for a total of 11 weeks. The irradiation dose was 30 mJ / cra 2 for 1-2 weeks, 40 mJ / cm 2 for 3-4, 50 mJ / cm 2 for 5-9 weeks and 60 mJ / cra 2 for 10-11 weeks.
- Treatment of the protein and vehicle groups was applied 300 ⁇ each 5 times a week for a total of 11 weeks. EtOH (Merck) and retinoic acid (Sigma) groups were treated with 100 ⁇ .
- the sample was applied one hour before UV irradiation. For application, the sample prepared in advance was spread evenly over the entire back using a No. 3 brush for art (Hwasung, Chuncheon, Korea). Each protein treatment concentration is as follows.
- Nanolip had little effect on the skin elasticity of hPRL, but when compared with other experiments (moisture loss, wrinkle improvement, H & E staining, artificial skin test), the number of hairless mice was increased or applied in the long term. It is thought to increase skin elasticity (FIG. 2A). However, in terms of water loss, the Nanolipo-hPRL group (Group 6) and Nanolipo-his-hPRL (Group 7) compared to the EtOH group (Group 3), UV (+) group (Group 2) and liposome group (Group 5). The group showed a clear water loss prevention effect (FIG. 2B).
- Skin epidermal thickness measurement through tissue analysis was performed for 11 weeks, after extraction of the back skin tissue of female SKH-1 hairless mice treated with UV and respective coating agents, and soaked in 0.1M phosphate fixative with 4% paraformaldehyde at 4 ° C. After 0 / N treatment, the tissue was dehydrated and embedded in paraffin to prepare blocks. Next, the tissue was cut into 3 thick sections using a Leica microtome, and then slice sections were prepared to undergo deparaffinization and hydrolysis, followed by Herris's hemaroxylin (Hematoxylin, Sigma, USA) and eosin (eosin). , Alpha Chera, Inc, UK). Then, after observation with a Zeiss Ax i os tar Plus microscope, the film was taken using an AxioCam MR camera and the epidermal thickness was measured using Axiovision software.
- Herris's hemaroxylin Hematoxylin, Sigma, USA
- eosin eo
- B16F1 melanoma cells were plated in 6-well poolates (6 ⁇ 10 4 cells / well) and incubated for 24 hours in an incubator (5% C0 2 , 37 ° C), followed by DMEM containing a -MSH (sigma). Replace with medium and incubate for 72 hours with arbut in (sigma) and Nanol ipo-hPRL.
- Cell pellets were collected and centrifuged, and the supernatant was removed. The pellet was dried, and the melanin was dissolved in IN NaOH / 10% DMS0. The absorbance was measured at 405 ran with SPECTRA MAX 190 (Molecular Devices), and the melanin standard (Sigma). Inhibition rate of melanin production was calculated using the curve (3 ⁇ 4).
- Nanol ipo-hPRL of the present invention showed a significant inhibition of melanin production according to the concentration.
- Example 7 Nanol ipo- using artificial skin Measurement of epidermal thickness change of hPRL
- mice were sacrificed to obtain artificial skin from them, followed by 4% formalin (Yakuri, Japan) at room temperature.
- the acne treatment efficacy of the Nanolipo-hPRL of the present invention was investigated as follows: 60 women with acne on the face skin among 15-40 year old women were randomly divided into 3 groups of 20 people, and only Nanolipo-hPRL or liposomes were present. After washing the solution (Nanol ipo) twice a day for 3 weeks morning and evening It was used first. Other than that, there are no special restrictions on the cosmetics that are used. Then, according to the opinion of the user, the degree of improvement for acne was determined according to the following evaluation criteria. Test results table
- nanol ipo-hPRL of the present invention was investigated as follows: 20 randomly divided 60 groups of 60 to 60 females with blotch on the facial skin of the 40- 60 year old females were then randomly divided into 3 groups, followed by Nanol ipo-hPRL or liposomes only. The comparative solution was first used after washing face twice a day for 8 weeks in the morning. Other than that, there are no special restrictions on the cosmetics that are used. Then, according to the user's opinion, the degree of improvement for the mushroom was determined according to the following evaluation criteria. The test results are shown in Table 7. Evaluation standard : +++ : Very good improvement
- Example 11 Analysis of whitening efficacy of Nanol ipo-hPRL
- Nanol ipo-hPRL of the present invention was investigated as follows: 20 randomly selected groups of 20 20-60 year old women who had blemishes or freckles on their facial skin or thought their skin was dull After dividing, nanol iixHiPRL or liposome-only comparative solution was used for the first time after washing twice a day for 8 weeks morning and evening. Other than that, there are no special restrictions on the cosmetics that are used. Then, according to the opinion of the user, the degree of improvement (radiance effect) on blemishes, freckles, or skin dullness was determined according to the following evaluation criteria. The test results are shown in Table 8. Evaluation standard : +++ : Eliminates spots and freckles and has a very good improvement effect on skin brightening
- Nanolipo-hPRL of the present invention has a very good brightening effect on blemishes and freckles or dull skin, and this whitening effect began to be apparent from about 4 weeks after application.
- Example 12 Analysis of Skin Elasticity Improvement Ability of Nanolipo-hPRL
- the skin elasticity improvement effect of Nanolipo-hPRL was evaluated through a practical test.
- the nutritional cream of Formulation Example 3 was used. Twenty four 50-year-old women were randomly divided into two groups, and the cream of Formulation Example 3 was washed twice daily each morning / evening, and then the appropriate amount of cream was applied to the face and neck continuously for two months.
- the skin elasticity improvement effect of each subject was evaluated through the questionnaire as follows. Evaluation criteria: +++ (very good improvement), ++ (significant improvement), + (slight improvement), ⁇ (no improvement but not worsening),-(deteriorated) ).
- the wound or ulcer healing ability of the Nanolipo-hPRL of the present invention was investigated as follows.
- Nanolipo-hPRL of the present invention was applied to patients with wounds or ulcers, such as bedsores, diabetic foot ulcers and systemic lupus ulcer ulcers. Sixty patients with the wounds were divided into three groups of 20 randomly, and then a comparative solution containing only Nanolipo-hPRL or liposomes was applied to the wound site twice daily for eight weeks each morning / evening. Then, according to the opinion of the user, the degree of improvement for wounds was determined according to the following evaluation criteria. The test results are shown in Tables 10a-10c. Evaluation criteria: +++ (very good improvement), ++ (significant improvement), + (slightly improving), ⁇ (no improvement but not worsening) ,-(deteriorated) ). Table 10a
- Nanolipo-hPRL of the present invention showed an improvement effect on the representative examples of wounds or ulcers, namely pressure sores, diabetic foot ulcers and systemic populicular ulcers. This wound improvement began to manifest itself about 3-4 weeks after application.
- Example 14 Effect of topical treatment of Nanolipo-hPRL on wound healing
- the wound or ulcer healing ability of the Nanolipo-hPRL of the present invention was investigated as follows.
- the anesthesia was pre- and deep-anesthesia, for ketamine: 1 ml / 10 kg (Yuhan), xylazine: 1 ml / 10 kg (Intervet Korea), isoforane for oxygen: 2.5 2.5 Cardiac anesthesia was performed to make 10 wounds per head (Sino-Pharmaceuticals): 24 hours before fasting-12 hours after anesthesia.
- Induction of wounds was performed after cardiac anesthesia first, and then the hair was removed using a cliper, and the area of the back was marked with a pen at a size of 2 ⁇ 2 cm (4 cm 2 ) and a gap of 4 cm .
- skin was removed by using a skin motor to remove wounds of 2 ⁇ 2 cm (4 cm 2 ) width from the back area with 0.6 ⁇ thick skin.
- Dreseong was closed with dressing (Opsite) and fixed with mephix (tape) in both control and experimental groups. Big cloth). 6 is a diagram illustrating the above process.
- Wound treatments were performed every two days, with the following: Anesthesia was possible only with inhalation anesthesia because of simple dressing and skin extraction.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Endocrinology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Pharmacology & Pharmacy (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Dermatology (AREA)
- Birds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Cosmetics (AREA)
- Medicinal Preparation (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
본 발명은 인간 프로락틴을 유효성분으로 포함하는 피부 상태(conditions) 개선용 조성물 및 이를 이용하는 피부 상태 개선 방법에 관한 것이다. 또한, 본 발명은 인간 프로락틴을 유효성분으로 포함하는 창상 또는 궤양 치료용 조성물 및 이를 이용하는 창상 또는 궤양의 치료방법에 관한 것이다. 본 발명의 조성물은 피부 표면에 국소적으로 적용되는 경우에도 성공적으로 피부상태 개선, 창상 또는 궤양 치료 효능을 발휘할 수 있으며, 인체에 매우 안전하다.
Description
【명세서】
【발명의 명칭】
인간프로락틴의 용도 【기술분야】
본 발명은 피부 상태 (conditions) 개선용 조성물 및 이를 이용하는 피부 상태 개선 방법과 창상 또는 궤양 치료용 조성물 및 이를 이용하는 창상또는 궤양의 치료방법에 관한 것이다. 【배경기술】
뇌하수체 전엽 호르몬인 프로락틴은성장과 발달, 모발의 성장, 생식, 물과 전해질의 균형, 대사, 행동, 그리고 면역기능에 관여하는 것으로 알려져 있다 (Bole—Feysot C, et al., Prolactin (PRL) and its receptor: Actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocrine Reviews 19 :225ᅳ 268 (1998) ; Goffin V, et al . , Prolactin: the new biology of an old hormone . Annual Review of Physiology 64: 7-67 ( 2002 ) ) . 예를 들어 , 프로락틴은 다양한 생물종에서 모발의 성장을 조절하는 것으로 알려져 있다 (Lincoln G A, Significance of seasonal cycles in prolactin secretion in male mammals. Perspectives in Andrology 53: 299-306(1989) ) .
최근에는, 프로락틴 수용체가 모낭에서 발견되었다 (Choy V J, et al ., Distribution of prolactin receptor immunoreact ivity in ovine skin and during the wool follicle growth cycle. Journal of Endocrinology 155:265-275(1997)).
프로락틴은 펩타이드호르몬으로서 약 200 개의 아미노산을 포함하며 ,
23,000 kDa의 분자량을 갖는다 (Freeman M E, et al . , Prolactin: structure, function, and regulation of secretion. Physiological Reviews 80:1523ᅳ 1631(2000)). 순환하는 프로락틴은 락토트로프스 (lactotrophs)로
명명되는 특정 뇌하수체 세포에서 합성 및 방출되고 이 경우 시상하부 인자들의 조절을 받는다 (Freeman M E, et al . , Prolactin: structure, function, and regulation of secretion. Physiological Reviews 80: 1523- 1631(2000)). 또한, 프로락틴은 액스트라-뇌하수체 조직에서 합성되고 이는 국소적인 자가분비 및 측분비 효과가 나타나도록 한다 (Craven A J, et al . , Prolactin signaling influences the timing mechanism of the hair follicle: analysis of hair growth cycles in prolactin receptor knockout mice. Endocrinology 142:2533-2539(2001)) . 본 명세서 전체에 걸쳐 다수의 인용문헌 및 특허 문헌이 참조되고 그 인용이 표시되어 있다. 인용된 문헌 및 특허의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다명확하게 설명된다. 【발명의 상세한설명】
본 발명자들은 인간 프로락틴의 신규한 용도를 찾기 위하여 연구 노력한 결과, 인간 프로락틴을 피부에 국소적으로 적용하면 피부 상태 및 창상 /궤양을 크게 개선할 수 있다는 사실을 발견함으로써, 본 발명을 완성하게 되었다.
따라서 본 발명의 목적은 피부 상태 (conditions) 개선용 조성물올 제공하는 데 있다.
본 발명의 다른목적은 창상또는 궤양 치료용조성물을 제공하는 데 있다.
본 발명의 다른목적은 피부상태 개선 방법을 제공하는 데 있다. 본 발명의 다른 목적은 창상 또는 궤양의 치료방법을 제공하는 데 있다.
본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다. 본 발명의 일 양태에 따르면 , 본 발명은 인간 프로락틴을 유효성분으로 포함하는 피부 상태 (condit ions) 개선용 조성물을 제공한다. 본 발명의 다른 양태에 따르면, 본 발명은 인간 프로락틴을 유효성분으로 포함하는 창상 또는 궤양 치료용 조성물을 제공한다 .
본 발명의 또 다른 양태에 따르면, 본 발명은 인간 프로락틴의 유효량을 인간 피부에 투여하는 단계를 포함하는 피부 상태 (condit ions) 개선 방법을 제공한다.
본 발명의 또 다른 양태에 따르면 , 본 발명은 인간 프로락틴의 유효량을 인간 피부에 투여하는 단계를 포함하는 창상 또는 궤양의 치료방법을 제공한다. 본 발명자들은 인간 프로락틴의 신규한 용도를 찾기 위하여 연구 노력한 결과, 인간 프로락틴을 피부에 국소적으로 적용하면 피부 상태 및 창상 /궤양을 크게 개선할 수 있다는 사실을 발견하였다 .
본 발명에서 유효성분으로 이용되는 인간 프로락틴 (human prolact in: hPRL)으로는 인간 프로락틴 활성을 나타내는 어떠한 폴리펩타이드도 사용 가능하며 , 예컨대 , mature hPRL, Met-hPRL, hPRL variants , modi f ied-hPRL, hPRL 단편 또는 hPRL analogue 증 어느 하나를 이용할 수 있다. 바람직하게는, mature hPRL 또는 Met-hPRL 이다. mature hPRL 은 인체 혈액 내에 존재하는 주 (raajor) 인간 프로락틴의 아미노산서열을 가진 인간 프로락틴을 가리키고, Met-hPRL 은 mature hPRL 의 N-말단에 메티오닌이 첨가된 인간 프로락틴을 가리키고 , hPRL vari nts 는 인체 내에 존재하는 주 인간 프로락틴 이외의 인간 프로락틴의 아미노산서열을 가진 인간 프로락틴을 가리키고, modi f ied hPRL 은 인간 프로락틴의 하나 이상의 아미노산 잔기에 pegylat ion 이나 glycat ion 등을 포함하는 첨가물의
부착이나, deamidat ion 이나 phosphorylat ion 을 포함하는 화학적 변형이 가해진 인간 프로락틴이나, hPRL 의 아미노산서열의 N-말단, C-말단 또는 중간에 다른 아미노산서열을 유전공학적 방법이나 생화학적 방법을 이용하여 융합단백질로 변형한 형태를 포함하며 , hPRL 단편은 인간 프로락틴의 아미노산 서열 일부를 유전공학적 방법이나 생화학적 방법에 의해 제거시킨 인간 프로락틴을 가리키고, hPRL analogue 는 인간 프로락틴의 아미노산서열을 유전공학적 방법으로 다른 아미노산서열로 변형시킨 인간 프로락틴을 가리킨다. 본 발명의 인간 프로락틴은 두 가지 방법 중 하나에 의하여 특정될 수 있다. 하나는 인간 프로락틴 수용체와 결합하는지의 여부에 의하여 특정될 수 있고 다른 하나는 인간 프로락틴의 생물학적 활성 측정방법에 의하여 특정될 수 있다.
본 발명의 바람직한 구현 예에 따르면, 본 발명의 조성물은 리포좀 조성을 갖는다. 즉 , 유효성분인 인간 프로락틴은 리포좀에 포위되어 피부에 적용되는 것이 바람직하다. 본 발명의 보다 바람직한 구현 예에 따르면, 본 발명의 조성물은 나노리포좀의 조성을 갖는다. 본 명세서에서 , 용어 "나노리포좀" 은 통상적인 리포좀의 형태를 갖는 것으로서 평균 입자 지름이 2O1000 nm 미만인 리포좀을 의미한다. 본 발명의 바람직한 구현 예에 따르면, 나노리포좀의 평균 입자 지름은 50—500 nm 이고, 보다 바람직하게는, 50-350 nm 이며, 가장 바람직하게는 50—250 nm 이다.
리포좀은 자기 스스로 회합하는 콜로이드 입자들의 구형 인지질 베지클로 정의되는데 , 수용성 헤드 (친수기 )와 블용성 테일 (소수기 )을 가진 양친매성 분자로 구성된 리포좀은 이들의 상호작용에 의하여 자발적으로 결합하여 정렬된 구조를 보이는데 , 그 크기와 적층성 (Lame l iar ity)에 따라 SUV (Smal l Uni lamel lar Vesicle) , LUV (Large Uni lamel lar Vesicle) 및 MLV (Mult i Lamel lar Vesicle) 로 분류된다. 이와 같이 다양한 적층성을 나타내는 리포좀은 세포막과 유사한 이중막 구조를 갖는다.
본 발명의 바람직한 구현 예에 따르면, 프로락틴을 포위하는 나노리포좀은 소형 단일층 소포 (small unilamellar vesicle) 구조를 갖는다. 본 발명의 바람직한 구현 예에 따르면 , 상기 나노리포좀에 포위되어 있는 인간프로락틴은 포위전 인간 프로락틴의 90-100%의 활성을 갖는다. 본 발명에서의 (나노)리포좀은 인지질, 플리을, 계면활성제, 지방산 또는 /및 물을 이용하여 제조될 수 있다.
본 발명의 (나노)리포좀의 제조에 이용되는 성분인 인지질은 양쪽친화성 지질로 이용된 것으로서, 천연 인지질 (예: 난황 레시틴 또는 대두 레시틴, 스핑고마이엘린) 및 합성 인지질 (예: 디팔미토일포스파티딜콜린 또는 수첨 레시틴)을 포함하며, 바람직하게는 레시틴이다. 보다 바람직하게는, 상기 레시틴은 대두 또는 난황에서 추출한 천연 유래의 불포화 레시틴 또는 포화 레시틴이다.
본 발명의 (나노)리포좀에 이용될 수 있는 폴리올은 특히 제한되지 않으며, 바람직하게는 프로필렌글리콜, 디프로필렌글리콜, 1,3- 부틸렌글리콜, 글리세린, 메틸프로판디올, 이소프렌글리콜, 펜틸렌글리콜, 에리스리를, 자이리를 및 솔비를을 포함한다.
본 발명의 (나노)리포좀의 제조에 이용될 수 있는 계면활성제는 당업계에 공지된 어떠한 것도 사용할 수 있으며, 예를 들어, 음이온성 계면활성제 (예 : 알킬아실글루타메이트, 알킬포스페이트, 알킬락틸레이트, 디알 ¾포스페이트 및 트리알킬포스페이트) , 양이온성 계면활성제, 양성 계면활성제 및 비이온성 계면활성제 (예: 알콕시레이티드알킬에테르, 알콕시레이티드알킬에스테르, 알킬플리글리코사이드, 폴리글리세릴에스테르 및 슈가에스테르)가사용될 수 있다.
본 발명의 (나노)리포좀 제조에 이용될 수 있는 지방산은 고급 지방산으로서, 바람직하게는 C12-22 알킬 체인의 포화 또는 불포화 지방산으로서, 예컨대, 라우린산, 미리스트산, 팔미트산, 스테아린산, 올레산 및 리놀레산을 포함한다.
본 발명의 (나노)리포좀의 제조에 이용되는 물은 일반적으로 탈이은화된 증류수이다.
본 발명의 바람직한 구현 예에 따르면 , 본 발명의 (나노)리포좀은 인지질과 물만으로 제조되는 데, 이의 구체적인 예는 하기의 실시예에 기재되어 있다.
본 발명의 바람직한 구현 예에 따르면, 본 발명의 hPRLᅳ함유 나노리포좀은 다음의 단계를 포함하는 공정을 통해 제조된다: (a) 리포좀을 형성할 수 있는 인지질 (바람직하게는 , 난황 레시틴 또는 대두 레시틴)을 인간 프로락틴을 함유한 수용액에 용해하는 단계 ; 및 (b) 인간 프로락틴과 인지질을 함유한 수용액을 고압균질기에 반복적으로 통과시키되 통과 회수에 따라 인지질의 함량과 고압균질기의 압력을 점차적으로 증가시켜 인간 프로락틴올 함유하는 나노리포좀을 제조하는 단계 .
인간 프로락틴을 함유하는 수용액은 pH 6-8ᅳ 바람직하게는 약 pH 7 의 완층액 (예컨대, 소듐 포스페이트 완층액 )이 바람직하다. 소듐 포스페이트 완층액이 이용되는 경우에는, 그 농도는 5-100 mM, 보다 바람직하게는 5-60 mM, 보다 더 바람직하게는 10-30 mM, 가장 바람직하게는 약 20 mM 이다.
본 발명의 방법에 있어서, 가장 특이한 측면은 인지질과 hPRLᅳ함유 수용액의 흔합물을 고압균질기에 수회 통과시키는 데, 통과 횟수가 증가함에 따라 인지질의 양과 균질기의 압력을 순차적으로 증가시키는 데에 있다 . 본 발명의 바람직한 구현 예에 따르면 , 균질기의 압력은 0—1000 bar , 바람직하게는 0-800 bar 까지 순차적으로 증가시킨다. 얍력은 50 bar 또는 100 bar , 바람직하게는 100 bar 씩 증가시킬 수 있다. 본 발명의 바람직한 구현 예에 따르면, 인지질의 양은 5-40 w/v(%) , 바람직하게는 5- 30 w/v(¾)까지 순차적으로 증가시킨다.
이러한 순차적인 인지질 함량과 압력의 증가가 있는 고압균질 공정을 통해 , hPRL-함유 나노리포좀이 제조되며 , 바람직하게는 액상의 hPRL-함유 나노리포좀이 제조된다.
본 발명의 조성물은 다양한 피부 상태 (conditions)의 개선에 이용될 수 있다. 바람직하게는, 본 발명의 조성물은 주름개선, 자외선에 의해 생성 또는 촉진된 검버섯 또는 잡티 (기미 또는 주근깨) 제거, 여드름 치료, 미백, 피부탄력 개선, 피부노화 방지 및 피부보습 개선에 유효하며, 보다 바람직하게는 주름개선, 잡티 (검버섯 , 여드름 포함) 제거, 미백 및 피부탄력 개선에 유효하다.
본 발명의 조성물은 다양한 창상 또는 궤양의 치유에 이용될 수 있다. 바람직하게는, 본 발명의 조성물은 노인이나 당뇨병 환자의 창상 및 궤양 치료에 이용될 수 있다. 본 발명의 조성물에 의해 치유될 수 있는 궤양은 만성 궤양 및 급성 궤양을 포함한다. 상기 만성 궤양은, 동맥류성 궤양, 정맥류성 궤양, 정맥류성 하지 궤양, 당뇨병성 궤양, 당뇨병성 족부 궤양, 압박 궤양, 전신성 흥반성낭창 꿰양 및 욕창 궤양올 포함하며, 상기 급성 궤양은 열 손상 (thermal injury), 외상, 수술, 피부암의 절제, 진균 또는 박테리아 감염, 맥관염, 공피증 또는 천포창에 의해 야기된 창상, 그리고 화상을 포함한다.
본 발명의 조성물은, 약제학적 조성물, 기능성화장료 ( (:03111^61 £11) 조성물 또는 화장료 조성물로 제조될 수 있다.
본 발명의 화장료 또는 기능성 화장료 조성물에 포함되는 성분은 유효 성분으로서의 인간 프로락틴 또는 hPRL-함유 리포좀 이외에 화장료 조성물에 통상적으로 이용되는 성분들을 포함하며, 예컨대 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제, 그리고 담체를 포함한다.
본 발명의 피부보호용 화장료 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 페이스트, 겔, 크림, 로션, 파우더, 비누, 계면활성제 -함유 클린성 오일, 분말 파운데이션, 유탁액 파운데이션, 왁스 파운데이션 및 스프레이 둥으로 제형화될 수 있으나, 이에 한정되는 것은 아니다. 보다 상세하게는, 유연 화장수, 영양 화장수, 영양 크림, 마사지 크림, 에센스,
아이 크림, 클렌징 크림, 클렌징 포음, 클렌징 워터, 팩, 스프레이 또는 파우더의 제형으로 제조될 수 있다.
본 발명의 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물성유, 식물성유 왁스, 파라핀, 전분, 트라칸트, 셀를로오스 유도체, 플리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는산화아연 등이 이용될 수 있다.
본 발명의 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슴 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 질소, 클로로플루오로히드로카본, 프로판 /부탄 또는 디메틸 에테르와같은추진체를포함할수 있다.
본 발명의 제형이 용액 또는 유탁액인 경우에는 담체 성분으로서 용매, 용해화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄을, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코을, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일 , 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜또는소르비탄의 지방산 에스테르가 있다. 본 발명의 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에특실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비를 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀를로오스, 알루미늄 메타히드록시드 벤토나이트, 아가또는 트라칸트등이 이용될 수 있다.
본 발명의 제형이 계면-활성제 함유 클린징인 경우에는 담체 성분으로서 지방족 알코을 설페이트, 지방족 알코을 에테르 설페이트 , 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트 , 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코을, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르등이 이용될 수 있다.
본 발명의 조성물이 약제학적 조성물로 제조되는 경우에는, 약제학적으로 허용되는 담체를 포함할 수 있으며 , 예컨대, 락토스, 덱스트로스, 수크로스, 솔비를, 만니를, 전분, 아카시아 고무, 인산 칼슘, 알기네이트 젤라틴, 규산 칼슴, 미세결정성 셀를로스, 폴리비닐피롤리돈, 셀를로스, 물, 시럽, 메틸 셀를로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 /또는 미네랄 오일을 포함할 수 있다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제ᅳ 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington 's Pharmaceutical Sciences (19th ed. , 1995)에 상세히 기재되어 있다.
바람직하게는, 본 발명의 약제학적 조성물은 피부국소투여 목적으로 개발된다.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태 음식, 투여 시간, 투여 경로, 배설 속도 및 반웅 감웅성과 같은 요인들에 의해 다양하게 처방될 수 있다. 한편, 본 발명의 약제학적 조성물의 피부국소 투여 유효량은 바람직하게는 1 일 당 0.001-100 ng/ cm2 (피부표면적), 보다 바람직하게는 0.01-10 ng/cm2, 가장 바람직하게는 0.1_2 ng/cm2 이다. 본 명세서에서, 용어 "유효량" 은 상술한 약제학적 효과를 달성하는데 충분한 용량을 의미한다.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및 /또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 나노리포좀을포함하는용액 형태가가장바람직하다. 종합적으로, 본 발명의 조성물은 피부 노화를 크게 억제하며, 주름 및 잡티를 개선하는 작용을 하며, 여드름을 치료하고 검버섯을 제거하며
미백 효능을 나타낸다 . 또한, 본 발명의 조성물은 창상 또는 궤양 치유를 높은 효율로 할 수 있다. 또한, 본 발명의 조성물은 인체에 매우 안전할 뿐만 아니라, 나노리포좀으로 제조되는 경우에는 안정성도 매우 탁월하다. 본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 발명의 피부 상태 개선, 창상 또는 궤양 치료용 조성물은 인간 프로락틴을 유효성분으로 포함한다.
(b) 본 발명의 조성물은 피부 표면에 국소적으로 적용되는 경우에도 성공적으로 피부상태 개선 , 창상 또는 궤양 치료 효능을 발휘할 수 있다 .
(C) 본 발명의 조성물은 인체에 매우 안전하다 .
【도면의 간단한 설명】
도 1 은 무모 마우스를 이용하여 Nanol ip으 hPRL 또는 Nanol ipo-his- hPRL 의 주름개선 효과를 보여주는 도면이다. 도면에서 Lipo-hPRL 은 Nanol ipo-hPRL 을, Lipo_hiis-hPRL 은 Nanol ip으 his-hPRL 을 나타낸다.
도 2 는 무모 마우스를 이용하여 NanoHpo-hPRL 또는 Nanol ip으 his— hPRL 의 피부탄력도 및 수분손실도에 대한 효과를 보여주는 도면이다. 도 2a 는 피부탄력도에 대한 결과를, 도 2b 는 수분손실도에 대한 결과를 나타내며 , 각각 3 회 측정한 수치의 평균을 결과로 하였다.
도 3 은 무모 마우스를 이용하여 Nanol ipo-hPRL 또는 Nanol ip으 hisᅳ hPRL 의 피부표피 비후화 예방에 대한 효과를 보여주는 도면이다 .
도 4 는 B16F1 흑색종 (melanoma) 세포를 이용하여 Nanol ipo-hPRL 의 멜라닌 생성 억제에 대한 효과를 보여주는 도면이다.
도 5 는 인공피부인 Tegoscience Neoderm 을 이용하여 Nanol ip으 hPRL 의 피부 세포 분화에 대한 효과를 보여주는 도면이다.
도 6 은 창상을 유도한 돼지에 대조군 및 실험군을 도포하는 과정을 나타낸 도면이다.
도 7 은 Nanol ipo-hPRL 도포시 상처크기의 변화를 나타낸 도면이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다 . 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
【실시예】
실시예 1: 프로락틴 유전자의 클로닝
HEF (Human embryonic fibroblast)로부터 게놈 DNA를 얻었다. 이를
BaffRKTakara, Japan; 이하에 사용된 제한효소 구입처 동일)으로 절단한후 주형 (template)으로 사용하여 프로락틴을 코딩하는 5 개의 액손 DNA 절편들올 얻기 위한 PCR 을 실행하였다. 각각의 액손 DAN 절편들올 연결하기 위해 연결부위의 일부 염기들이 서로 염기쌍 (base pairing)올 이를 수 있도록 프라이머를 설계하였고, 모든 PCR 에는 PriraeSTA ™ HS DNA중합효소 (Takara, Japan)를사용하였다.
프로락틴의 액손 1, 2, 3, 4 및 5를 증폭하기 위한 1 차 PCR방법은 다음과 같다. ^HKTakara, Japan)으로 절단한 게놈 DNA 를 주형으로 공통 사용하고, 액손 1 을 포함하는 hPL 1U 프라이머 (Bioneer, Korea; 이하에서 사용된 프라이머의 구입처 동일)와 hPL 2D 프라이머 쌍을 이용하여 PCR(30싸이클; 98 °C 10초, 55°C 5초, 72 °C 15초)을수행한후, 222 bp의 액손 1,2를 증폭 획득했다. 동일한방법으로 hPL 3U와 hPL 4D 프라이머 쌍을 이용하여 131 bp 의 엑손 3 을, hPL 5U 와 hPL 6D 프라이머 쌍을 이용하여 202 bp의 액손 4를, 그리고 hPL 7U와 hPL 8D프라이머 쌍을 이용하여 209 bp의 액손 5를 얻었다.
2 차 PCR 에서는 상기 기술한 방법으로 획득한 액손 1 을 포함하는 액손 2(222 bp)와 액손 3(131 bp)을 주형으로 사용하여 hPL 1U 와 hPL 4D 프라이머쌍을 넣고 PCR(30 싸이클; 98 °C 10 초, 55°C 5 초, 72°C 25 초)올
수행하여 334 bp (액손 1 + 액손 2 + 엑손 3)을 증폭 획득하였고 , 동일한 방법으로 액손 3( 195 bp)과 액손 4(224 bp)를 주형으로 사용하여 hPL 5U 와 hPL 8D 프라이머 쌍을 넣고 동일한 방법으로 PCR 을 수행하여 392 bp (액손 4 +액손 5)를 증폭 획득하였다 .
3 차 PCR 에서는 상기 2 차 PCR 생성물인 334 bp 와 392 bp 를 주형으로 사용하여 절단부위 (GMTTC)가 포함된 hPL 1U 와 Kpn 절단부위 (GGTACC)가 포함된 hPL 8D 프라이머 쌍을 넣고 PCR(30 싸이클 ; 98 °C 10 초, 55°C 5 초, Ύ2Χ 45 초)을 수행하여 성숙 프로락틴을 코딩하는 DNA 를 포함하는 701 bp (액손 1 + 엑손 2 + 액손 3 + 엑손 4 + 엑손 5)를 증폭 획득하였다 .
상기 방법으로 얻은 성숙 프로락틴를 코딩하는 DNA 와 pUC- rrnB(pUC18 플라스미드에 rrnB 터미네이터 삽입, (주)리제론)를 과 Kpnl 으로 절단하고 , Τ4 DNA 리가제로 연결시킨 후, ToplOF ' 균주에 형 질전환시켰다. 이후 37°C에서 15 시간동안 배양한 후, 3 개의 콜로니들을 임의 선정하여 배양하고, 알칼리 라이시스 방법으로 플라스미드들올 얻은 후 , 1% 아가로스 겔에서 전기영동하여 크기를 확인 하고 염기서열을 분석함으로써 원하는 플라스미드를 선택하였다 (pUC-hPRL) . 실시예 2 : narK 프로모터와 시그널 서열이 제거된 Met-프로락틴이 결합된 발현백터 제조
narK 프로모터와 시그널 서열이 제거된 Met-프로락틴을 연결시키는 PCR 을 실행하였으며, 연결부위의 18 개 염기들이 서로 염기쌍을 이루어 연결되도록 하였다. 1 차 PCR 방법은 다음과 같다. pNKmut 플라스미드 (- 10 돌연변이된 narK 프로모터를 포함, (주)리제론 , 참조 : 대한민국 특허출원공개 제 2006—0089086 호)를 주형으로 하고, 0Y— 17 및 r-narK D 프라이머 쌍을 이용하여 PCR(30 싸이클 ; 98 °C 10 초, 55 °C 5 초, 72 °C 25 초)을 수행하여 350 bp 의 narK 프로모터를 얻었다. 상기 pUC-hPRL 을 주형으로 하고, hPL 9U 와 hPL 8D 프라이머 쌍을 이용하여 PCR(30 싸이클 ;
98 °C 10 초, 55°C 5 초, 72°C 55 초)을 수행하여 626 bp 의 시그널 서열이 제거된 Met-프로락틴를 얻었다.
2 차 PCR 에서는 상기 기술한 방법으로 획득한 narK 프로모터 (350 bp)와 Met-프로락틴 (626 bp)를 주형으로 사용하여 EcoRI 절단부위 (GMTTC)가 포함된 0Y-17 과 Kpnl 절단부위 (GGTACC)가 포함된 hPL 8D 프라이머 쌍을 넣고 다시 PCR(30 싸이클; 98 °C 10 초, 55 °C 5 분, 72 °C 1 분)을 수행하여 958 bp 의 절편 (narK 프로모터와 시그널 서열이 제거된 Met-프로락틴올 포함하는 절편)을 얻었다. 958 bp 의 절편 (r rK 프로모터와 시그널서열이 제거된 Met—프로락틴을 포함하는 절편)과 pUCᅳ rrnB(pUC18 풀라스미드에 rrnB 터미네이터 삽입, (주)리제론)를 EcoRI 과 Kpnl 으로 절단하고, T4 DNA 리가제로 연결시킨 후, ToplOF' 균주에 형질전환시켰다. 이후 37°C에서 15 시간동안 배양한 후, 3 개의 콜로니들을 임의 선정하여 배양하고, 알칼리 라이시스 방법으로 플라스미드들을 얻은 후, 1¾ 아가로스 겔에서 전기영동하여 크기를 확인 하고 염기서열을 분석함으로써 원하는 플라스미드를 선택하였다 (pUC-narK- Met-hPRL) .
【표 1】
프라이머 염기서열
r-nark D CATAGACACCTC GATACTCGTTTCG (26mer)
His-narK D CATATGATGATGATGATGATGAGACACCTC (30mer )
【표 2】
시그널서열이 제거된 Met-프로락틴 염기서열 (603 bp)
염기서열 (5' →3' )
atgttgcccatctgtcccggcggggctgcccgatgccaggtgacccttcgagacctgtttgaccgcgccgtcgtcctg tcccactacatccataacctctcctcagaaatgttcagcgaatttgataaacggtatacccatggccgggggttcatt accaaggccatcaacagctgccacacttcttcccttgccacccccgaagacaaggagcaagcccaacagatgaatcaa aaagactttctgagcctgatagtcagcatattgcgatcctggaatgagcctctgtatcatctggtcacggaagtacgt ggtatgcaagaagccccggaggctatcctatccaaagctgtagagattgaggagcaaaccaaacggcttctagagggc atggagctgatagtcagccaggttcatcctgaaaccaaagaaaatgagatctaccctgtctggtcgggacttccatcc ctgcagatggctgatgaagagtctcgcctttctgcttattataacctgctccactgcctacgcagggattcacataaa atcgacaattatctcaagctcctgaagtgccgaatcatccacaacaacaactgctaa 실시예 3: His-tagging 된 narK 프로모터와 시그널 서열이 제거된 Met- 프로락틴이 결합된 발현백터 제조
narK 프로모터 뒤에 6 개의 히스티딘 (histidine)을 암호화하는 유전자 서열이 들어간 백터에 Met-프로락틴 단백질을 암호화하는 유전자를 연결시키는 PCR 을 실행하였는데, 여기서 연결부위의 18 개 염기들이 서로 염기쌍을 이루어 연결되도톡 하였다. 1 차 PCR 방법은 다음과 같다. pNKmut 플라스미드 (-10 돌연변이된 narK 프로모터를 포함, (주)리제론, 참조: 대한민국 특허출원공개 제 2006-0089086 호)를 주형으로 0Y-17 와 His-narK D 프라이머 쌍을 이용하여 PCR(30 싸이클; 98 °C 10 초, 55 °C 5 초, 72°C 25 초)을 수행하여 368 bp 의 6 개의 histidine 을 암호화하는 유전자 서열을 포함하는 narK 프로모터를 얻었다. 실시예 2 에서 기술한 pUC-narK-Met-hP L플라즈미드를 주형으로 hPL 11U와 hPL 8D 프라이머 쌍을 이용하여 PCR(30 싸이클; 98 °C 10 초, 55 °C 5 초, 72 °C 55초)을 수행하여 626 bp의 Met-프로락틴 유전자를 얻었다.
2 차 PCR 반웅은 1 차 PCR 반웅에서 획득한 368 bp(6 개의 히스티딘올 암호화하는 유전자 서 열을 포함하는 narK 프로모터 )와 626 bp(Met-hPRL 유전자)를 주형으로 EcoRI 절단부위 (GAATTC)가 포함된 0Yᅳ 17 과 Kpnl 절단부위 (GGTACC)가 포함된 hPL 8D 프라이머 쌍을 넣고 PCR(30 싸이클 ; 98 °C 10 초 , 55°C 5 분, 72°C 1 분)을 수행하여 976 bp 의 절편 (narK 프로모터 -6 개의 hist idine-Met-프로락틴 유전자 절편 )을 얻었다 . 다음에 EcoRI 과 Kpnl 으로 double-digest ion 된 976 bp 의 절편 (narK 프로모터- 6 개의 hist idine-Met-프로락틴 유전자 절편 )과 pUC— rrnB(pUC18 플라스미드에 rrnB 터미네 이터 삽입, (주)리제론) 백터를 T4 DNA 리가제로 연결시킨 후 ToplOF' 균주에 형 질전환시켰다. 이후 37°C에서 15 시간동안 배양한 후, 3 개의 콜로니들을 임의 선정하여 배양하고, 알칼리 라이시스 방법으로 플라스미드들을 얻은 후, 1¾ 아가로스 겔에서 전기 영동하여 크기를 확인 하고 염 기서 열을 분석함으로써 원하는 플라스미드를 선택하였다 (pUOnarK-hi s-Met-hPRL) .
【표 3】
6 개의 히스티딘을 포함하는 Met-프로락틴 염 기서 열 (621 bp)
염기서 열 (5' →3' )
cat catcatca catcatatgttgcccatctgtcccggcggggctgcccgatgccaggtgaccct cgagacctgtt tgaccg cgccgtcgtcctgtcccactacatccataacctctcctcagaaatgttcagcgaat t tgataaacggtatacccatggccggg ggttcattaccaaggccatcaacagctgccacact tcttcccttgccacccccgaagacaaggagcaagcccaacagatgaat caaaaagactt tctgagcctgatagtcagcatattgcgatcctggaatgagcctctgtatcatctggtcacggaagtacgtgg tatgcaagaagccccggaggctatcctatccaaagctgtagagattgaggagcaaaccaaacggcttct agagggcatggagc tgatagtcagccaggttcatcctgaaaccaaagaaaatgagatctaccctgtctggtcgggacttccatccctgcagatggct gatgaagagtctcgcctttctgcttattataacctgctccactgcctacgcagggat tcacataaaatcgacaattatctcaa gctcctgaagtgccgaatcatccacaacaacaactgctaa 실시 예 4: Nanol ipo-hPRL과 Nanol ipo-his-hPRL 의 제조
인간 프로탁틴과 his-인간 프로락틴을 나노리포좀 제형화 하였다 . 이용된 인지 질은 대두 레시틴 (soybean lecithin; (주)신동방,
South Korea) , Metarin P(Degussa Texturant Systems Deutschland GmbH & Co. KG) , Nut ri pur S(Degussa Texturant Systems Deutschland GmbH & Co. KG) 또는 Emultop(Degussa Texturant Systems Deutschland GmbH & Co. KG) 이다.
기기 출구 (outlet)의 온도가 30°C가 넘지 않게 열교환기를 장치한 고압균질기 (max. output 5 L/hr, 최대압력 1200 bar, Model HS-1002, (주)화성기계 (Korea))의 열교환기를 얼음물속에 장치한 후 증류수로 기기 내부를 세척하여 작동준비한 후, 완층용액 (20 mM NaH2P04 H 6.5-7.5, 1 mM EDTA)에 용해되어 있는 2 mg/ 농도의 인간 프로락틴 혹은 hisᅳ인간 프로락틴 용액에 인지질을 10 w/v% 비율로 첨가하여 층분히 수화시켜 교반하고, 이를 상온에서 균질기를 이용하여 저압 0 bar 에서 3 희 이상 균질기를 통과시켰다. 이어, 상기 균질기 과정을 거친 용액에 인지질을 14 w/v% 비율이 되게 첨가하여 충분히 수화시켜 교반하고, 100 bar 에서 3 회 이상 균질기를 통과시켰다. 그런 다음, 상기 균질기의 과정을 거친 용액에 인지질을 18 w/v% 비율이 되게 첨가하여 충분히 수화시켜 교반하고, 200 bar 에서 3 회 이상 균질기를 통과시켰다. 그리고 나서, 상기 균질기의 과정을 거친 용액에 인지질을 20 w/v% 비율이 되게 첨가하여 층분히 수화시켜 교반하고, 300 bar 에서 3 회 이상 균질기를 통과시켰다. 이어, 상기 균질기의 과정을 거친 용액에 인지질을 22 w/v 비율이 되게 첨가하여 층분히 수화시켜 교반하고, 400 bar 에서 3 회 이상 균질기를 통과시켰다. 그런 다음, 상기 균질기의 과정을 거친 용액에 인지질을 24 w/v% 비율이 되게 첨가하여 층분히 수화시켜 교반하고, 500 bar 에서 3 회 이상 균질기를 통과시켰다. 그리고 나서, 상기 균질기의 과정을 거친 용액에 인지질을 26 w/v% 비율이 되게 첨가하여 층분히 수화시켜 교반하고, 600 bar 에서 3 회 이상 균질기를 통과시켰다. 이어, 상기 균질기의 과정을 거친 용액에 인지질을 28 w/v% 비율이 되게 첨가하여 층분히 수화시켜 교반하고, 700 bar 에서 3 회 이상 균질기를 통과시켰다. 그런 다음, 상기 균질기의 과정을 거친 용액을 800 bar 에서
3 회 이상 균질기를 통과한 후 균질기로부터 용액을 배출하고 15,000 X g에서 30분간 고속원심분리하여 상등액을분리하였다. 이때 리포좀 내에 들어가지 않은 프로락틴과 his-프로락틴은 젤 투과 크로마토그래피 (GE Healthcare, USA)로 제거하고 액상의 리포좀을수득하였다. 실시예 5: 무모 마우스 (Hairless nude mouse)를 이용한 주름 /피부탄력 /수분손실 /표피두께 평가
1. 실험동물의 준비
실험동물은 4 주령의 암컷 SKH-1 무모 마우스를 두열 바이오텍에서 구입하였다 (Sungnam, Korea) . 실험동물은 온도 24士 2°C, 상대습도 50土 10%, 명암순환이 12 시간 단위로 조절되는 조건에서 사육하였으며 2 주간 순치시킨 후 임의로 11개의 군으로나누어 이후실험을 진행하였다.
UV조사기기는 VLX-3W stimulator(Yilber Lourmat , Marne la Vallee, France)를 사용하였다. UVB 조사는 주당 3 회씩 총 11 주간 조사하였다. 조사량은 1-2주는 30 mJ/cra2, 3—4주는 40 mJ/cm2, 5-9주는 50 mJ/cm2, 10-11 주는 60 mJ/cra2로 조사하였다. 단백질 군 및 vehicle 군의 처리는 총 11 주 동안 매주 5 회 각각 300 ^씩 도포했다. EtOH(Merck)군과 레티노산 (retinoic acid, Sigma) 군은 100 ^씩 처리하였다. UV 를 처리하게 되는 날의 경우 UV 조사 한 시간 전에 샘플을 도포하여 주었다. 도포는 미리 준비된 샘플을 미술용 3 호 붓 (Hwasung, Chuncheon, Korea)을 이용하며 등 전체에 골고루 펴 발라 주었다. 각각의 단백질 처리 농도는 다음과 같다.
【표 4】
그룹별 단백질 처리농도
그룹 7 Lipo-his-hPRL(2 ug/ ft), UV(+)
2. 무모 마우스를 이용한 NanoHpo-hPRL의주름개선효능 분석
장기간에 걸쳐 지속적인 UV 가 조사될 경우 SKH-1 무모 마우스에서 굵고 깊은 주름이 생기는 것은 널리 알려져 있다. 본 실험의 육안적 피부 주름의 평가의 기준 또한 UV 조사에 의해 형성되는 깊은 주름의 생성을 기준으로 하여 11주 동안의 UV와 샘플 처리 종료 후 다음과 같은 기준으로 평가했다.
- : 관찰되지 않음 (Not observed)
* : 경도 두께 및 깊이의 주름 (Mi Id thick and deep winkle)
« : 경도 초과 중등도 미만 두께 및 깊이의 주름 (Mi Id to Morderate thick and deep winkle)
*** : 중등도 두께 및 깊이의 주름 (Morderate thick and deep winkle)
«** : 중등도 초과 중증 미만 두께 및 깊이의 주름 (Morderate to severe thick and deep winkle)
***** : 중증 두께 및 깊이의 주름 (Severely thick and deep winkle) 실험결과, 그룹 2 내지 3 및 그룹 5 에서 중등도 이상의 주름이 발견되었으나, 그룹 4 및 6 내지 7에서는 경도 또는 중등도 미만의 두께 및 깊이의 주름을 관찰할수 있었다 (도 1).
3. 무모 마우스를 이용한 Nanolip으 hPRL 의 피부탄력도 및 수분손실도 분석
피부 탄력도 및 수분손실량 측정은 11 주 동안의 uv 와 샘플 처리 종료 후 항온 항습실 (온도 22士 2°C, 습도 50士 10%)에서 피실험동물을 20 분간 안정화 시킨 다음 측정을 수행하였다. 피부 효능 기기 평가에 널리 사용되는 Multi Probe Adaptor systems, MPA580(Courage+K azaka ,
Germany)를 이용하여 등 (dorsal) 부위에 수분손실량을 Texameter, TM300 probe(Courage+Khazaka, Germany)를 사용하여 측정하고 탄력도는 Cutometer SEM 575 probe (Courage+Khazaka , Germany)로 각각 3 회 측정한 수치의 평균을 결과로 하였다 (Pressure : 500 mbar , Probe aperture: 2 mm, On— time: 1 seconds , Offᅳ time: 1 seconds , Repetitions'. 5) .
실험결과, Nanolip으 hPRL 의 피부탄력도에 대한 영향은 미미하였으나 다른 실험 (수분손실도, 주름개선, H&E 염색, 인공피부실험) 결과들과 비교 유추할 때 무모 마우스 마리 수를 늘리거나 장기적으로 적용하면 피부탄력도 증가시키리라 생각된다 (도 2a). 하지만, 수분손실도에서 EtOH 군 (그룹 3), UV(+)군 (그룹 2) 및 리포좀 군 (그룹 5)과 비교하여 Nanolipo- hPRL 군 (그룹 6) 및 Nanolipo-his-hPRL (그룹 7) 군은 명확한 수분 손실 방지 효과를 나타내었다 (도 2b).
4. 무모 마우스를 이용한 Nanolip으 hPRL의피부손상 억제효능 분석
조직 분석올 통한 피부 표피 두께 측정은 11 주 동안 UV 와 각각의 도포제를 처리한 암컷 SKH-1 무모 마우스의 등 피부조직을 적출하여 4% 파라포름알데히드가 첨가된 0.1M 인산염 고정액에 담가 4°C에 0/N 처리하였고, 조직의 탈수과정을 거친 후 파라핀으로 포매하여 블록을 제작하였다. 다음에 Leica microtome 를 이용하여 조직을 3 의 두께의 절편으로 자른 후, 절편슬라이드를 제작하여 탈파라핀과정과 함수과정올 거친 후, Herris' s 헤마록실린 (Hematoxylin, Sigma, U.S.A.)과 에오신 (eosin, Alpha Chera, Inc, U.K.)으로 염색하였다. 그리고나서 Zeiss Ax i os tar Plus 현미경으로 관찰 후, AxioCam MR 카메라를 이용하여 촬영하였고, Axiovision소프트웨어를 이용하여 표피두께를 측정하였다.
UV 조사에 의해 주름이 유발된 실험 동물에서 주름 개선에 효과가 있다고 알려진 많은 물질들이 UV 조사에 의한 피부 표피 (epidermis) 비후화를 예방하는 것으로 보고되고 있다. 도 3 에 나타난 바와 같이, UV 조사에 의해 유발된 피부 주름이 Nanolip으 hPRL 또는 Nanolipo-his-hPRL
처리로 현저하게 개선됐고 또한 조직학적으로 피부 표피 비후화가 감소되었다. 아마도 UV 조사에 의해 기저세포의 복제, 분화, 탈피되는 일련의 과정 이 비정상적으로 이루어져 나타나는 피부 표피 비후화가 프로락틴에 의해 피부 표피 기저세포의 항상성 (homeostasis)이 정상적으로 이루어져 표피 비후화를 예방하는 것으로 사료된다 . 실시예 6: Nanol ipo-hPRL 의 세포내 멜라닌 생성 억제 여부 측정
B16F1 흑색종 (melanoma) 세포를 6 웰 풀레이트에 깔고 (6 x 104 세포 /웰) 배양기에서 24 시간 배양한 (5% C02 , 37 °C ) 후 a -MSH(sigma)가 함유된 DMEM 배지로 교체하고 arbut in(sigma)과 Nanol ipo-hPRL 을 농도별로 처리하여 72 시간 배양한다. 세포 펠렛을 회수하여 원심 분리하고 상등액이 제거된 펠렛을 건조시킨 후 세포내의 멜라닌을 IN NaOH/10% DMS0 로 용해 시켜서 SPECTRA MAX 190(Molecular Devices)으로 405 ran에서 흡광도를 측정하고 melanin standard(Sigma) curve 를 이용하여 멜라닌 생성 저해율 (¾ 올 계산하였다. 도 4 에 나타난 바와 같이 , 본 발명의 Nanol ipo- hPRL 은 농도에 따라 유의미한 멜라닌 생성 억제율을 나타내었다. 실시예 7: 인공피부를 이용한 Nanol ipo-hPRL 의 표피층 두께 변화 측정
4.5cra2 면적의 인공피부 (Tegoscience. , South Korea)에 리포좀 (1%), l ipo-hPRL(2 / g/i ) , 10% EtOH, 레티노산 (0.01% in 10% EtOH)을 300 μί 씩
4 일 동안 처리하였다. 마지막 처리 후 24 시간이 지나 마우스를 희생시켜 이로부터 인공피부를 얻은 다음, 4% 포르말린 (Yakuri , Japan)으로 상온에서
5 시간 동안 고정시키고 , 파라핀 (McCormick, U. S.A. ) 블특을 준비하였다. 이 파라핀 블록을 5 크기로 절단하여 헤마록실린 (Hematoxyl in, Sigma, U.S.A. )과 에오신 (eosin, Alpha Chem, Inc U.K. )으로 염색하여 광학현미경 400 배로 관찰하였다.
도 5 에서 나타난 바와 같이, Nanolipo-hPRL 처리군에서 인공피부의 분화되는 세포층의 두께가 두꺼워진 것을 통해 볼 때, 본 발명의 Nanolipo- hPRL은 피부의 상태를 건강하게 하는데 효과가 있는 것으로 보인다. 실시예 8: Nanolipo-hPRL의 주름 개선 효능 분석
Nanolipo-hPRL 의 주름 개선 효능을 실제 사용 테스트를 통하여 평가하였다. 제형예 3 의 영양 크림을 사용하였다. 20 명의 4()ᅳ 50 세 여성을 무작위로 2 개군으로 나누어 제형예 3 의 크림을 매일 아침 /저녁 2회씩 세안 후 크림 적당량을 눈가를 중심으로 2 개월간 연속적으로 바르게 하였다. 각 피검자의 주름 개선 효과를 육안 관찰을 통하여 평가하였다. 실험 결과는 하기의 표 5에 기재되어 있다.
【표 5】
*총 피검자 중에서 주름 개선 효과가 있는 것으로 판정된 피검자의 수의 비율¬프로락틴이 없는 Nano liposome 제형 상기 표 5 에서 알 수 있듯이, 프로락틴은 명확한 주름 개선 효과를 나타내고 있다. 실시예 9: Nanolipo-hPRL의 여드름 치료 효능 분석
본 발명의 Nanolipo-hPRL 의 여드름 치료 효능을 다음과 같이 조사하였다: 15-40세의 여성 중 얼굴 피부에 여드름을 갖는 60명을 20명씩 무작위로 3 그룹으로 나눈 다음, Nanolipo-hPRL 또는 리포좀만 있는 비교용액 (Nanol ipo)을 각각 3 주간 아침 저녁으로 하루 2 번씩 세안 후
가장 먼저 사용하게 하였다. 그 외에는 평소에 사용하는 화장품에 대한 특별한 제한은 두지 않았다. 그런 다음 사용자의 의견에 따라 여드름에 대한 개선 정도를 하기의 평가기준에 따라 판정 하였다. 시험 결과는 표
6 에 나타나 있다. 평가 기준 :
+++ : 매우 양호한 개선효과가 있음
++ : 상당한 개선효과가 있음
+ : 약간의 개선효과가 있음
土 : 개선효과는 없으나 악화되지도 않음
- : 악화됨 .
【표 6】
표 6 에서 보는 바와 같이, 본 발명의 Nanol ip으 hPRL 은 여드름에 대한 개선 정도가 매우 우수함을 알 수 있으며, 여드름 개선 효과는 적용 후 약 2 주부터 명백하게 나타나기 시작하였다. 더욱이, 본 발명의 Nanol ipo-hPRL 은 피부에 대한 자극, 예컨대 , 흥반 또는 가려움증을 거의 유발하지 않았다. 실시예 10: Nanol ipo-hPRL 의 검버섯 제거 효능 분석
본 발명의 Nanol ipo-hPRL 의 검버섯 제거 효능을 다음과 같이 조사하였다: 40— 60 세의 여성 중 얼굴 피부에 검버섯을 갖는 60 명올 20 명씩 무작위로 3 그룹으로 나눈 다음, Nanol ipo-hPRL 또는 리포좀만 있는 비교용액을 각각 8 주간 아침 저닉으로 하루 2 번씩 세안 후 가장 먼저 사용하게 하였다. 그 외에는 평소에 사용하는 화장품에 대한 특별한 제한은 두지 않았다. 그런 다음, 사용자의 의견에 따라 검버섯에 대한 개선 정도를 하기의 평가기준에 따라 판정 하였다. 시험 결과는 표 7 에 나타나 있다. 평가 기준 :
+++ : 매우 양호한 개선효과가 있음
++ : 상당한 개선효과가 있음
+ : 약간의 개선효과가 있음
土 : 개선효과는 없으나 악화되지도 않음
- : 악화됨 .
【표 7]
표 7 에서 보는 바와 같이, 본 발명의 Nanol ipo-hPRL 은 검버섯에 대한 개선 정도가 상당히 우수함을 알 수 있으며 , 검버섯 개선 효과는 적용 후 약 5 주부터 명백하게 나타나기 시작하였다. 실시예 11: Nanol ipo-hPRL 의 미백 효능 분석
본 발명의 Nanol ipo-hPRL 의 미백 효능을 다음과 같이 조사하였다: 20-60 세의 여성 중 얼굴 피부에 기미 또는 주근깨가 있거나 자신의 피부가 칙칙하다고 생각하는 60 명을 20 명씩 무작위로 3 그룹으로 나눈 다음, Nanol iixHiPRL 또는 리포좀만 있는 비교용액을 각각 8 주간 아침 저녁으로 하루 2 번씩 세안 후 가장 먼저 사용하게 하였다 . 그 외에는 평소에 사용하는 화장품에 대한 특별한 제한은 두지 않았다. 그런 다음, 사용자의 의견에 따라 기미 , 주근깨, 또는 피부의 칙칙함에 대한 개선 (휘광 (Radiance)효과) 정도를 하기의 평가기준에 따라 판정 하였다. 시험 결과는 표 8 에 나타나 있다. 평가 기준 :
+++ : 기미.주근깨를 없애고 피부 휘광 회복에 매우 양호한 개선효과가 있음
++ : 상당한 개선효과가 있음
+ : 약간의 개선효과가 있음
士 : 개선효과는 없으나 악화되지도 않음
ᅳ : 악화됨.
【표 8】
표 8 에서 보는 바와 같이, 본 발명의 Nanolipo-hPRL 은 기미나 주근깨 개선 또는 칙칙한 피부에 대한 휘광 효과가 상당히 우수함을 알 수 있으며, 이러한 미백 효과는 적용 후 약 4 주부터 명백하게 나타나기 시작하였다. 실시예 12: Nanolipo-hPRL의 피부탄력 개선 능력 분석
Nanolipo-hPRL 의 피부탄력 개선 효능을 실제 사용 테스트를 통하여 평가하였다. 제형예 3 의 영양 크림을 사용하였다. 20 명의 4으 50 세 여성을 무작위로 2 개군으로 나누어 제형예 3 의 크림을 매일 아침 /저녁 2 회씩 세안 후 크림 적당량을 얼굴 및 목에 2 개월간 연속적으로 바르게 하였다. 각 피검자의 피부탄력 개선 효과를 설문조사를 통하여 아래와 같이 평가하였다.
평가 기준: +++ (매우 양호한 개선효과가 있음), ++ (상당한 개선효과가 있음), + (약간의 개선효과가 있음), 土 (개선효과는 없으나 악화되지도 않음), - (악화됨).
설문조사 결과는하기의 표 9에 기재되어 있다.
【표 9】
상기 표 9 에서 알 수 있듯이, 프로락틴은 명확한 피부탄력 효과를나타내고 있다. 실시예 13: Nanolipo-hPRL의 창상치유능력 분석
본 발명의 Nanolipo-hPRL 의 창상 또는 궤양 치유 능력을 다음과 같이 조사하였다.
본 발명의 Nanolipo-hPRL 을 창상 또는 궤양의 대표적인 예, 욕창, 당뇨병성 족부궤양 및 전신성 홍반성낭창 궤양 환자에게 적용하였다. 상기 창상을 갖는환자 60명을 20명씩 무작위로 3그룹으로 나눈 다음, Nanolipo-hPRL 또는 리포좀만 있는 비교 용액을 각각 8 주간 아침 /저녁으로하루 2번씩 창상부위에 도포하였다. 그런 다음, 사용자의 의견에 따라 창상에 대한 개선 정도를 하기의 평가기준에 따라 관정 하였다. 시험 결과는 표 10a-10c 에 나타나 있다. 평가 기준: +++ (매우 양호한 개선효과가 있음), ++ (상당한 개선효과가 있음), + (약간의 개선효과가 있음), 土 (개선효과는 없으나 악화되지도 않음), - (악화됨). 【표 10a]
4 주 + 土
5 주 ++ +
6 주 ++ +
7 주 ++ +
8 주 ++ +
【표 10b]
당뇨병성 족부궤양 환자에 대한 결과
기간 Nanol ipo-hPRL Nano 1 i o
1 주 土 土
2 주 士
3 주 + 土
4 주 + 士
5 주 + 土
6 주 ++
7 주 ++ 士
8 주 ++ 土
【표 10c]
전신성 홍반성낭창 궤양 환자에 대한 결과
기간 Nanol ipo-hPRL Nanol i o
1 주 士 土
2 주 土 土
3 주 + ±
4 주 + 土
5 주 + 土
6 주 ++ 土
7 주 ++
8 주 ++ ±
표 10a- 10c 에서 보는 바와 같이, 본 발명의 Nanolipo-hPRL 은 창상 또는 궤양의 대표적인 예, 즉 욕창, 당뇨병성 족부궤양 및 전신성 흥반성낭창 궤양에 대한 개선 효과를 나타내었다. 이러한 창상 개선 효과는 적용후 약 3-4주부터 명백하게 나타나기 시작하였다. 실시예 14: Nanolipo-hPRL 의 국소요법이 부분층식피술공요부의 창상치유에 미치는 영향분석
본 발명의 Nanolipo-hPRL 의 창상 또는 궤양 치유 능력을 다음과 같이 조사하였다.
실험기간은 3 주 (21 일)간 실시 하였으며, micropig (생후 4 개월, 수컷, 9.5 kg, 살색, 단모 (short hair))/l 마리를 이용하였다. 마취는 전마취와 심마취를 하였으며, 전마취의 경우 ketamine: 1 ml/10 kg (유한양행), xylazine: 1 ml/10 kg (인터벳코리아), 심마취의 경우 isoforane : 산소 = 2.5 : 2.5 (중외제약)로 마리당 10 개의 창상을 만들기 위해 심마취를실시 : 24시간 전부터 금식-마취후 12시간 절식시켰다. 창상의 유도는 먼저 심마취를 시킨 후, cliper 를 사용하여 피부 채취할 부위의 털을 제거해주고, 등부위에 2X2cm(4cm 2)의 크기, 4cm간격으로 펜으로 적출부위를 표시하였다. 베타딘으로 적출할등부위를 소독한 후 피부채취전동기를 사용하여 부분층식피편을 0.6麵 두께로 2X2cm(4cm2)넓이의 피부를등부위에서 제거하여 창상을 만들어준 후 피부를 채취하였다.
머리쪽으로부터 우측 1번째, 좌측 2변째 , 우측 3번째 , 좌측 4번째 및 우측 5번째 부위를 대조군 (C), 머리쪽으로부터 좌측 1번째, 우측 2번째 좌측 3 번째, 우측 4 번째 및 좌측 5 번째 부위를 실험군 (P)로 하였다. 도포방식은 표 11과 같다.
【표 11]
대조군 및 실험군의 도포
대조군
Carrier Ointment만도포
(창상 5군데 )
실험군 Carrier Ointment +인간프로락틴 최종농도 0.2
(창상 5군데 ) IU/ml(3.3microg/ml)
드레성은 대조군과 실험군 모두에 필름드레성 (Opsite)을 사용하여 폐쇄드레싱올 하고 mephix(tape)로 고정한 후 창상보호를 위해 붕대 (EB)로 몸통 전체를 감싸준 후 stockinet (4번째 사진에서 보이는 탄력성이 있는 큰 천)으로 마무리 하였다. 상기의 과정을 나타낸 도면이 도 6이다.
창상처치 (드레성)는 2 일 마다 시행, 다음을 병행하였다. 마취는 간단한 드레싱과 피부채취이므로 흡입마취만으로 가능하였다. 1) 창상면적측정- 일주일 간격 (7 일, 14 일, 21 일)으로 0HP 필름을 이용하여 창상부위 모양을 본뜬 후 planimeter 면적측정프로그램을 이용하여 면적을 측정한 다음, 최초 상처면적크기에 대한 상처크기를 비율로 환산한다. 2) 2 일마다 시료를 창상부위에 1ml 양의 시료를 도포 한다. 3) 각각의 시료가 상처에서 떨어지지 않도톡 4 cm X 4 cm 크기의 밀착포를 첩부한다. 4) 밀착포 주위를 micropore(3M사)로 처리한다. 5) stokinet 을 사용하여 몸 전체를 감싸주고, 상처 부위를 피하여 접착테이프로 고정한다
실험결과 상처크기의 변화는표 12와 같다 (도 7):
【표 12】
상처크기의 변화
Claims
【청구항 1】
인간 프로락틴을 유효성분으로 포함하는 피부 상태 (conditions) 개선용 조성물.
【청구항 2】
인간 프로락틴을 유효성분으로 포함하는 창상 또는 궤양 치료용 조성물.
【청구항 3】
제 1 항 또는 제 2 항에 있어서, 상기 인간 프로락틴은 리포좀에 포위된 것을 특징으로 하는 조성물.
【청구항 4]
제 3 항에 있어서, 상기 리포좀은 나노리포좀인 것을 특징으로 하는 조성물.
【청구항 5】
제 1 항에 있어서, 상기 피부 상태의 개선은 주름개선, 검버섯 제거, 피부 잡티 제거, 미백 여드름 치료, 피부탄력 개선 또는 피부노화 방지인 것을 특징으로하는조성물.
【청구항 6]
제 2 항에 있어서, 상기 창상 또는 궤양은 동맥류성 궤양, 정맥류성 궤양, 정맥류성 하지 궤양, 당뇨병성 궤양, 당뇨병성 족부 궤양, 압박 궤양, 전신성 홍반성낭창 궤양 또는 욕창인 것을 특징으로 하는 창상 또는 궤양 치료용 조성물.
【청구항 7]
제 1 항 또는 제 2 항에 있어서, 상기 조성물은 약제학적 조성물, 기능성화장료 (cosmeceutical) 조성물 또는 화장료 조성물인 것을 특징으로 하는조성물.
【청구항 8】
제 1 항 또는 제 2 항에 있어서, 상기 조성물은 피부 국소 도포용인 것을 특징으로 하는조성물.
【청구항 9]
인간 프로락틴의 유효량을 인간 피부에 투여하는 단계를 포함하는 피부상태 (conditions) 개선 방법.
【청구항 10]
인간 프로락틴의 유효량을 인간 피부에 투여하는 단계를 포함하는 창상또는 궤양의 치료방법 .
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR20080056400 | 2008-06-16 | ||
KR10-2008-0056400 | 2008-06-16 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2009154393A2 true WO2009154393A2 (ko) | 2009-12-23 |
WO2009154393A3 WO2009154393A3 (ko) | 2010-03-11 |
Family
ID=41434549
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2009/003223 WO2009154393A2 (ko) | 2008-06-16 | 2009-06-16 | 인간 프로락틴의 용도 |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR20110040768A (ko) |
WO (1) | WO2009154393A2 (ko) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5162303A (en) * | 1989-10-08 | 1992-11-10 | Amiad Research And Development | Pharmaceutical compositions containing prolactin and methods for the use thereof |
WO2005112890A1 (en) * | 2004-04-21 | 2005-12-01 | Postech Academy-Industry Foundation | Liposome and method of preparing the same |
-
2009
- 2009-06-16 WO PCT/KR2009/003223 patent/WO2009154393A2/ko active Application Filing
- 2009-06-16 KR KR1020107028670A patent/KR20110040768A/ko not_active Application Discontinuation
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5162303A (en) * | 1989-10-08 | 1992-11-10 | Amiad Research And Development | Pharmaceutical compositions containing prolactin and methods for the use thereof |
WO2005112890A1 (en) * | 2004-04-21 | 2005-12-01 | Postech Academy-Industry Foundation | Liposome and method of preparing the same |
Non-Patent Citations (2)
Title |
---|
R.PAUS: 'Does prolactin play a role in skin biology and pathology' MEDICAL HYPOTHESES vol. 36, 1991, pages 33 - 42 * |
TAKAHIKO FUJIKAWA ET AL.: 'Prolactin prevents acute stress-induced hypocalcemia and ulcerogenesis by acting in the brain of rat' ENDOCRINOLOGY vol. 145, no. 4, 2004, pages 2006 - 2013 * |
Also Published As
Publication number | Publication date |
---|---|
KR20110040768A (ko) | 2011-04-20 |
WO2009154393A3 (ko) | 2010-03-11 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20230000751A1 (en) | Stem cell stimulating compositions and methods | |
KR101934208B1 (ko) | 식물 태지 성분을 포함하는 피부 보습용 화장료 조성물 | |
CN104379177B (zh) | 短抗微生物脂肽 | |
JP2003081737A (ja) | レチノールを3重に安定化した化粧料 | |
JP5913117B2 (ja) | 孵化液酵素およびその使用 | |
EP2001460A2 (en) | Compositions for promoting hair growth | |
TW309428B (ko) | ||
KR102473093B1 (ko) | 햄프씨드오일, 식물캘러스배양여과물 및 펩타이드를 유효성분으로 함유하는 피부 상태 개선용 화장료 조성물 | |
EP2405888A1 (en) | Skin care product | |
KR100849020B1 (ko) | 나노리포좀으로 안정화된 가수분해 콜라겐 펩타이드를함유하는 화장료 조성물 | |
EP3389620B1 (en) | Stem cell stimulating compositions and methods of treating melasma | |
KR101165848B1 (ko) | 효소 및 아미노산을 함유하는 피부 화장료 조성물 | |
JP2001181176A (ja) | レチノール及び表皮成長因子を含有する皮膚保護用化粧料組成物 | |
KR100962566B1 (ko) | 인간 성장호르몬을 유효성분으로 포함하는 피부 상태 개선용 조성물 | |
KR20150085546A (ko) | 피부세포 배양배지를 유효성분으로 포함하는 피부상태 개선용 조성물 | |
KR101841118B1 (ko) | 세네데스무스 속 미세조류의 추출물을 유효성분으로 함유하는 피부 외용제 조성물 | |
KR20150018255A (ko) | 인간 열 활성화 단백질 90a의 절편을 유효성분으로 포함하는 피부상태 개선용 조성물 | |
KR101956155B1 (ko) | 데아닌 유도체를 함유하는 피부 외용제 조성물 | |
WO2009154393A2 (ko) | 인간 프로락틴의 용도 | |
KR101317872B1 (ko) | 인간 태반성 락토젠을 유효성분으로 포함하는 피부 상태 개선용 조성물 | |
KR100681701B1 (ko) | 헥사노일트리펩타이드를 유효성분으로 함유하는 여드름완화용 화장료 조성물 | |
RU2660359C2 (ru) | Косметические или дерматологические композиции, комбинирующие ретинальдегид и глицилглицин олеамид, и их косметические или дерматологические применения | |
JP2022550991A (ja) | 皮膚及びその付属器の、ペプチドに基づいた化粧品又は皮膚科学的な処置 | |
KR100616252B1 (ko) | 해양생물-유래 추출물을 포함하는 피부 보호용 화장료조성물 | |
KR100912462B1 (ko) | 인간 성장호르몬을 유효성분으로 포함하는 피부 상태개선용 조성물 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09766818 Country of ref document: EP Kind code of ref document: A2 |
|
NENP | Non-entry into the national phase in: |
Ref country code: DE |
|
ENP | Entry into the national phase in: |
Ref document number: 20107028670 Country of ref document: KR Kind code of ref document: A |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 09766818 Country of ref document: EP Kind code of ref document: A2 |