WO2009108021A2 - 과색소침착성 피부 진단용 바이오 마커 - Google Patents

과색소침착성 피부 진단용 바이오 마커 Download PDF

Info

Publication number
WO2009108021A2
WO2009108021A2 PCT/KR2009/000979 KR2009000979W WO2009108021A2 WO 2009108021 A2 WO2009108021 A2 WO 2009108021A2 KR 2009000979 W KR2009000979 W KR 2009000979W WO 2009108021 A2 WO2009108021 A2 WO 2009108021A2
Authority
WO
WIPO (PCT)
Prior art keywords
skin
polynucleotide
protein
hyperpigmentation
gene
Prior art date
Application number
PCT/KR2009/000979
Other languages
English (en)
French (fr)
Other versions
WO2009108021A3 (ko
Inventor
장희경
김수정
안수미
황재성
윤태진
이증훈
김진화
Original Assignee
(주)아모레퍼시픽
경상대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)아모레퍼시픽, 경상대학교산학협력단 filed Critical (주)아모레퍼시픽
Publication of WO2009108021A2 publication Critical patent/WO2009108021A2/ko
Publication of WO2009108021A3 publication Critical patent/WO2009108021A3/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals

Definitions

  • the present invention relates to a biomarker for diagnosing hyperpigmentation skin and a kit for diagnosing hyperpigmentation skin comprising the same.
  • the present invention also relates to a method for screening a whitening agent that effectively prevents and improves hyperpigmentation.
  • Melanin pigment produced by the melanocytes of the skin of the body is a phenolic polymer material having a complex form of a black pigment and protein, and plays an important role in inhibiting skin damage by ultraviolet radiation from the sun.
  • melanin not only cause serious aesthetic problems such as blemishes, freckles, and senile lentigo on the skin, but also promote skin aging and cause skin cancer (see Hearing VJ). et al., FASEB J., 5: 2902-2909, 1991).
  • the human genome is estimated to have approximately 50,000 genes, and the number of functional genes expressed in one cell is estimated to be approximately 10,000. That is, only about 10,000 proteins out of 50,000 genes are selectively produced, and the functional characteristics of the cell are determined by which proteins are produced and how they interact. In the past, it was customary to find such changes in gene expression from a one-to-one relationship, but the past approach is very limited when one considers that the action of a particular protein is not limited to one protein and is involved in the expression of various proteins. . In general, it is judged that the characteristics of cells are not determined by a specific protein but by the overall harmony of the characteristics of various proteins.
  • the response of a cell to a specific external stimulus is not determined by any gene, but rather by interaction at the gene and protein levels inherent in the cell.
  • gene function is largely due to the cascade effect, not directly on the relevant phenotype, but on the effects of numerous consecutive lower-level genes.
  • individual genes are not only involved in specific reactions, but in various reactions.
  • small changes in a hub gene can cause large changes in the shape and function of the entire cell and even the individual.
  • the hub gene has a distinct change in expression due to stimulation, and is defined as having a much greater relationship with the number of genes or proteins that can interact with each other than general genes.
  • Biomarker for hyperpigmentation skin diagnosis is characterized in that it comprises a gene selected from the group consisting of the genes described in Table 1 herein.
  • Biomarker for diagnosing hyperpigmented skin is characterized in that it comprises a protein selected from the group consisting of the proteins described in Table 1 herein.
  • Hyperpigmented skin diagnostic kit according to an embodiment of the present invention, a polynucleotide or a fragment thereof of the gene described in Table 1 herein, wherein the fragment is at least one polynucleotide comprising at least 10 consecutive nucleotides,
  • the amount of the transcript hybridized to the polynucleotide is increased or decreased compared to the normal value, it is characterized in that it is diagnosed as skin-adherent skin.
  • a hyperpigmented skin diagnostic kit comprises at least one polynucleotide comprising 18-22 consecutive nucleotides as a fragment of a polynucleotide of a gene described in Table 1 herein;
  • Kit for diagnosing hyperpigmentation skin comprises a monoclonal antibody against the proteins described in Table 1 herein,
  • the amount of the antigen bound to the antibody is increased or decreased than the normal value is characterized in that the diagnosis is hyperpigmented skin.
  • Screening method of the skin hyperpigmentation inhibitor according to an embodiment of the present invention, the step of treating a test substance to the gene described in Table 1 herein; And confirming whether the test substance promotes or inhibits expression of the gene.
  • Screening method of the skin hyperpigmentation inhibitor according to another embodiment of the present invention the step of treating a test substance to the protein described in Table 1 herein; And confirming whether the test substance promotes or inhibits the activity of the protein.
  • the possibility of skin pigmentation in the skin can be predicted sensitively and quickly by using 136 kinds of genes representing the central gene among the genes expressing changes by induction of skin pigmentation as skin pigmentation marker genes.
  • 1 is a graph showing PCR results of 15 representative genes for hyperpigmentation skin diagnosis.
  • Figure 2 is a network written in each time slot (0.5, 3, 12, 24h) using the interaction between protein domains encoded by 2,431 genes.
  • Figure 4 shows the top 53 networks with a large number of changes in binding partners of the genes of FIG.
  • FIG. 5 shows only the genes in which the expressions of the 53 networks of FIG. 4 increased or decreased more than two times.
  • the inventors of the present invention after irradiating UV rays to normal melanocytes to induce pigmentation, find a gene whose expression is increased or decreased after UV irradiation using a microarray technique, and use bioinformatics techniques for the found genes.
  • a protein binding network By constructing a protein binding network, 136 species of hub molecules were selected as shown in Table 1 below.
  • the polynucleotide used as a probe includes the full length or fragment thereof of the hyperpigmented skin marker gene described in Table 1 above.
  • the length of the fragment preferably includes at least 10 contiguous nucleotides because non-specifically bound probes are less than 10 bps in length.
  • Polynucleotide used as a primer in the hyperpigmented skin diagnostic kit according to another embodiment of the present invention is preferably 18-22 lengths. This is because if the length of the primer is less than 18bps non-specific binding, if it exceeds 22bps, the primers are self-combining with each other, the efficiency is lowered, and even in production, it is unproductive in terms of cost and technical.
  • a monoclonal antibody against a protein involved in skin pigmentation is prepared by a general monoclonal antibody production method.
  • Serum-free melanocyte culture medium containing 0.5 ⁇ g hydrocortisone, 5 ng epidermal growth factor, 5 ⁇ g insulin, and 0.5% fetal pituitary extract per ml of pure cultured melanocytes (NHEMs) isolated from the epidermis of newborns. Clonetics, Walkersville, MD). UVB (20mJ / cm 2 ) was irradiated to cells passaged 3-5 times at each time (0.5, 3, 12, 24 h).
  • Trizol (Invitrogen, Carlsbad, Calif., USA) was added to purify the RNA of the cell prepared in 1, and the cells were pulverized and chloroform was added to separate the supernatant RNA. In order to concentrate the RNA of the obtained supernatant, an equal amount of isopropanol was added and centrifuged to obtain precipitated RNA, and the precipitated RNA was washed with 70% ethanol for base removal.
  • Microarrays were performed to compare the expression patterns of mRNA obtained from each sample.
  • the oligonucleotide (70-mer) microarray (Microarray inc, human 48.5K) was used. Fluorescently stained cDNA probes were prepared from an amino-allyl cDNA labeling kit (Ambion, Austin, Texas, USA) from 20 ⁇ g of RNA.
  • RNA isolated from melanin forming cells (NHEM) not irradiated with UV was labeled with Cy3 and used as a common control.
  • RNA obtained at each time zone was labeled with Cy5 and used as an experimental group. Hybridization was performed at 55 ° C. for 16 hours.
  • RNA collected in step 2 was reverse transcription reaction buffer containing 50 mM Tris-HCl (Tris-HCl, pH 8.3), 75 mM KCl, 3 mM MgCl 2 , 0.1 M DTT, 10 mM dNTP, 40 units / ⁇ l RNase inhibitor
  • a primer of 0.5 ⁇ g / ⁇ l oligo (dT) 16 and reverse transcriptase of 200 units of SuperScript II (GiboBRL) were added and reacted at 42 ° C. for 1 hour.
  • PSIMAP structural classification of proteins in the protein data bank
  • Gene clusters that increase and decrease with time are selected based on hub molecules that are actively interacting in four networks for each time (0.5, 3, 12, 24 h) prepared in 1. above.
  • Some of the results are shown in FIG. 3.
  • the top 53 of the four genes that have changed or changed the binding partner among the central genes that become the binding partner and the genes more than doubled at each time point are shown.
  • Selection made 53 smaller networks again.
  • the result is shown in FIG.
  • FIG. 5 After 53 small networks were made, only the genes increased or decreased more than two times among the 53 central gene network possible genes were made again, and the result is shown in FIG. 5.
  • there were 140 genes used the list of which is shown in Table 1 above.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Hematology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Wood Science & Technology (AREA)
  • Food Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • General Engineering & Computer Science (AREA)
  • Tropical Medicine & Parasitology (AREA)

Abstract

본 발명에 따른 과색소침착성 피부 진단용 바이오 마커는 본원 명세서 표 1에 기재된 유전자들로 구성된 군으로부터 선택된 유전자 또는 본원 명세서 표 1에 기재된 단백질들로 구성된 군으로부터 선택된 단백질을 포함하는 것을 특징으로 한다.

Description

과색소침착성 피부 진단용 바이오 마커
본 발명은 과색소침착(hyperpigmentation)성 피부를 진단하기 위한 바이오 마커 및 이를 포함하는 과색소침착성 피부 진단용 키트에 관한 것이다. 또한, 본 발명은 과색소침착을 효과적으로 예방 및 개선시키는 미백제를 스크리닝하는 방법에 관한 것이다.
신체 피부의 멜라닌 세포에서 생성되는 멜라닌 색소는 검은 색소와 단백질의 복합체 형태를 갖는 페놀계 고분자 물질로서, 태양으로부터 조사되는 자외선에 의한 피부손상 저해에 중요한 역할을 담당한다. 그러나, 멜라닌이라는 색소의 과잉 합성 및 축적은 피부에 기미, 주근깨 및 노인성 흑자(senile lentigo)등 심각한 미적(美的) 문제를 일으킬 뿐만 아니라, 피부노화를 촉진하며 피부암을 유발하기도 한다(참고: Hearing V.J. et al., FASEB J., 5: 2902-2909, 1991).
사람의 유전체는 대략 5 만개의 유전자를 가지고 있는 것으로 추측되며, 하나의 세포에서 발현되는 기능성 유전자의 개수는 대략 10,000개 정도로 추정된다. 즉, 50,000개의 유전자 중 약 10,000개의 단백질만을 선택적으로 만들어내고 있으며, 어떤 단백질을 만들어내고 그 단백질들이 어떻게 상호 작용하느냐에 따라 그 세포의 기능적 특성이 결정된다. 기존에는 이러한 유전자 발현의 변화를 일대일의 관계로부터 찾는 것이 관례였으나, 특정 단백질의 작용이 하나의 단백질에 국한되는 것만은 아니며 다양한 단백질의 발현에 상호 관여한다고 생각할 때 과거의 접근은 매우 제한적일 수 밖에 없다. 또 일반적 관점에서 세포의 특성은 특정 단백질 하나에 의하여 결정되는 것이 아니라 다양한 단백질들의 특성이 총체적으로 조화를 이룸으로써 결정된다고 판단된다. 이러한 관점에서, 특정 외부 자극에 대한 세포의 반응은 어떤 한 유전자에 의해서 결정이 되는 것이 아니라, 세포 내에 내재적으로 존재하고 있는 유전자와 단백질 수준에서 상호 작용을 통해 결정이 되므로, 최근에는 생물정보학 기법을 이용하여, 외부 자극에 의해 변화를 유도한 상황에서 가장 핵심적인 역할을 수행하는 허브 몰레큘(hub molecule)을 발굴하는 작업에 대한 관심이 증대되고 있다. 생체 내에서 유전자 기능은 대부분 관련된 표현형에 직접적으로 작용하는 것이 아니라 수 많은 연속적인 하위 단계 유전자들에 대한 영향을 거쳐 발휘되게 되어 있다(cascade effect). 더구나 일반적으로 개개의 유전자들은 특정 반응에만 관계하는 것이 아니라 여러 다양한 반응들에 관여하게 되어 있다. 따라서 유전자 기능의 이와 같은 속성 때문에 어떤 유전자(hub gene)의 작은 변화는 세포 전체 나아가 개체의 형태 및 기능에 큰 변화를 야기할 수 있다. 일반적으로 중심유전자(hub gene)는 자극에 의한 발현 변화가 뚜렷하며, 일반 유전자들에 비해 상호작용이 가능한 유전자 혹은 단백질의 수와 관계가 월등히 많은 것으로 정의되어 있다.
자외선이 피부에서 색소침착을 야기하는 주요 자극임은 분명한 사실이다. 그러나, 자외선 조사에 의해 세포 내에서 어떠한 변화가 일어나며, 그것을 대변하는 각종 유전자와 단백질의 발현 변화가 일어나는 지에 대해 보고된 바 없다. 또한, 상호 작용의 변화 중에 어떤 기전이 핵심이 되는 것이며, 어떤 유전자가 중심유전자인지에 대한 보고 역시 거의 없는 상황이다.
본 발명의 일실시예의 목적은 과색소침착성 피부를 진단하는 바이오 마커를 제공하는 것이다.
본 발명의 또 다른 일실시예의 목적은 과색소침착성 피부를 진단하는 키트를 제공하는 것이다.
본 발명의 또 다른 일실시예의 목적은 미백에 효과적인 물질을 스크리닝하는 방법 및 키트를 제공하는 것이다.
본 발명의 또 다른 일실시예의 목적은 피부의 색소 침착 문제를 유발한 원인과 해결 방안을 효과적으로 예측하는 것이다.
본 발명의 일실시예에 따른 과색소침착성 피부 진단용 바이오 마커는 본원 명세서 표 1에 기재된 유전자들로 구성된 군으로부터 선택된 유전자를 포함하는 것을 특징으로 한다.
본 발명의 또 다른 일실시예에 따른 과색소침착성 피부 진단용 바이오 마커는, 본원 명세서 표 1에 기재된 단백질들로 구성된 군으로부터 선택된 단백질을 포함하는 것을 특징으로 한다.
본 발명의 일실시예에 따른 과색소침착성 피부 진단 키트는, 본원 명세서 표1에 기재된 유전자의 폴리뉴클레오티드 또는 그 단편으로서, 상기 단편은 10개 이상의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드,
또는 상기 폴리뉴클레오티드 및 그 단편에 상보적인 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 표면에 결합시킨 고상 지지체를 포함하며,
상기 폴리뉴클레오티드에 혼성화된 전사체의 양이 정상치에 비해 증가하거나 감소하면 과피부침착성 피부인 것으로 진단하는 것을 특징으로 한다.
본 발명의 또 다른 일실시예에 따른 과색소침착성 피부 진단용 키트는, 본원 명세서 표1에 기재된 유전자의 폴리뉴클레오티드의 단편으로서 18-22개의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드; 및
본원 명세서 표1에 기재된 유전자의 폴리뉴클레오티드에 상보적인 폴리뉴클레오티드의 단편으로서 18-22개의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드을 포함하며,
상기 폴리뉴클레오티드들을 프라이머로 하여 증폭된 cDNA 양이 정상치에 비해 증가하거나 감소하면 과색소침착성 피부인 것으로 진단하는 것을 특징으로 한다.
본 발명의 또 다른 일실시예에 따른 과색소침착성 피부 진단용 키트는, 본원 명세서 표1에 기재된 단백질에 대한 모노클로날 항체를 포함하며,
상기 항체에 결합된 항원의 양이 정상치보다 증가하거나 감소하면 과색소침착성 피부인 것으로 진단하는 것을 특징으로 한다.
본 발명의 일실시예에 따른 피부 과색소침착 억제제의 스크리닝방법은, 본원 명세서 표1에 기재된 유전자에 시험 물질을 처리하는 단계; 및 상기 시험 물질이 상기 유전자의 발현을 촉진 또는 억제하는지를 확인하는 단계를 포함하는 것을 특징으로 한다.
본 발명의 또 다른 일실시예에 따른 피부 과색소침착 억제제의 스크리닝방법은, 본원 명세서 표1에 기재된 단백질에 시험 물질을 처리하는 단계; 및 상기 시험 물질이 상기 단백질의 활성을 촉진 또는 억제하는지를 확인하는 단계를 포함하는 것을 특징으로 한다.
본 발명에 따르면 피부색소침착 유도에 의해 변화를 나타내는 유전자들중 중심유전자가 되는 136종의 유전자를 피부색소침착 마커 유전자로 하여 피부에서의 피부 색소침착 가능성을 민감하고 빠르게 예측할 수 있다.
도 1은 대표적인 과색소침착성 피부 진단용 유전자 15종의 PCR 결과를 나타낸 그래프이다.
도 2는 2,431개의 유전자가 코딩하는 단백질 도메인 간의 상호작용을 이용하여 각 시간대별(0.5, 3, 12, 24h)로 작성된 네트워크이다.
도 3은 상호작용이 활발한 중심 유전자를 중심으로 시간 별로 증감하는 유전자 클러스터를 나타낸 것이다.
도 4는 상기 도 3의 유전자들 중 결합 파트너의 변화가 많은 상위 53개 네트워크를 선별하여 나타낸 것이다.
도 5는 상기 도 4의 53개 네트워크 중 발현이 2배 이상 증감한 유전자만을 모아 네트워크로 나타낸 것이다.
본 발명자들은 정상 멜라닌형성세포에 자외선을 조사하여 색소 침착을 유발시킨 후, 마이크로어레이 기법을 이용하여 자외선 조사 후 발현이 증가 혹은 감소하는 유전자를 찾아내고, 그 찾아낸 유전자들을 대상으로 생물정보학 기법을 활용하여, 단백질 결합 네트워크를 구성하여, 하기 표 1과 같이 hub molecule 136종을 선별하였다.
표 1
No. Symbol ID Name
1 CBL NM_005188 Cas-Br-M (murine) ecotropic retroviral transforming sequence
2 FSTL5 NM_020116 Follistatin-like 5
3 BARD1 NM_000465 BRCA1 associated RING domain 1
4 MID1 NM_000381 Midline 1 (Opitz/BBB syndrome)
5 PDGFRA NM_006206 Platelet-derived growth factor receptor, alpha polypeptide
6 FLT1 NM_002019 Fms-related tyrosine kinase 1 (vascular endothelial growth factor)
7 KDR NM_002253 Kinase insert domain receptor (a type III receptor tyrosine kinase)
8 OBSCN NM_052843 Obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
9 CDC42BPA NM_003607 CDC42 binding protein kinase alpha (DMPK-like)
10 SH2B3 NM_005475 SH2B adaptor protein 3
11 PRKD3 NM_005813 Protein kinase D3
12 RASL11B NM_023940 RAS-like, family 11, member B
13 RHOD NM_014578 Ras homolog gene family, member D
14 RIT1 NM_006912 Ras-like without CAAX 1
15 SRMS NM_080823 Src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites
16 ARL8B NM_018184 ADP-ribosylation factor-like 8B
17 YES1 NM_005433 V-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
18 MYOM2 NM_003970 Myomesin (M-protein) 2, 165kDa
19 PIGR NM_002644 Polymeric immunoglobulin receptor
20 CDK9 NM_001261 Cyclin-dependent kinase 9 (CDC2-related kinase)
21 PLK2 NM_006622 Polo-like kinase 2 (Drosophila)
22 SNF1LK NM_173354 SNF1-like kinase
23 TANC1 NM_033394 Tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
24 TAOK2 NM_016151 TAO kinase 2
25 TRIB1 NM_025195 Tribbles homolog 1 (Drosophila)
26 CXorf9 NM_018990 Chromosome X open reading frame 9
27 FBXO8 NM_012180 F-box protein 8
28 PLK3 NM_004073 Polo-like kinase 3 (Drosophila)
29 STAT4 NM_003151 Signal transducer and activator of transcription 4
30 THBD NM_000361 Thrombomodulin
31 ACTN2 NM_001103 Actinin, alpha 2
32 BTRC NM_033637 Beta-transducin repeat containing
33 C6 NM_000065 Complement component 6
34 RCBTB2 NM_001268 Regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2
35 COMP NM_000095 Cartilage oligomeric matrix protein
36 PTGS2 NM_000963 Prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
37 DUSP5 NM_004419 Dual specificity phosphatase 5
38 ZNF776 NM_173632 Zinc finger protein 776
39 PLEKHA7 NM_175058 Pleckstrin homology domain containing, family A member 7
40 PTPRZ1 NM_002851 Protein tyrosine phosphatase, receptor-type, Z polypeptide 1
41 ANKRA2 NM_023039 Ankyrin repeat, family A (RFXANK-like), 2
42 CELSR2 NM_001408 Cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila)
43 FAT NM_005245 FAT tumor suppressor homolog 1 (Drosophila)
44 F2 NM_000506 Coagulation factor II (thrombin)
45 KCNB2 NM_004770 Potassium voltage-gated channel, Shab-related subfamily, member 2
46 LAMC1 NM_002293 Laminin, gamma 1 (formerly LAMB2)
47 GPR126 NM_020455 G protein-coupled receptor 126
48 GUCA1B NM_002098 Guanylate cyclase activator 1B (retina)
49 MPN2 NM_183062 Marapsin 2
50 RNF135 NM_032322 Ring finger protein 135
51 RNF26 NM_032015 Ring finger protein 26
52 TRIM22 NM_006074 Tripartite motif-containing 22
53 TRIM35 NM_171982 Tripartite motif-containing 35
54 TRAIP NM_005879 TRAF interacting protein
55 APBA2 NM_005503 Amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)
56 C20orf23 NM_024704 Chromosome 20 open reading frame 23
57 CACNA2D1 NM_000722 Calcium channel, voltage-dependent, alpha 2/delta subunit 1
58 CFD BQ712715 Complement factor D (adipsin)
59 KCNJ2 NM_000891 Potassium inwardly-rectifying channel, subfamily J, member 2
60 KCNN4 NM_002250 Potassium intermediate/small conductance calcium-activated channel, subfamily N
61 PIK3CD NM_005026 Phosphoinositide-3-kinase, catalytic, delta polypeptide
62 PPFIBP2 NM_003621 PTPRF interacting protein, binding protein 2 (liprin beta 2)
63 ZBTB9 NM_152735 Zinc finger and BTB domain containing 9
64 ULBP2 NM_025217 UL16 binding protein 2
65 ZBTB43 NM_014007 Zinc finger and BTB domain containing 43
66 BTAF1 NM_003972 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa
67 CD55 NM_000574 CD55 molecule, decay accelerating factor for complement (Cromer blood group)
68 ZNFX1 NM_021035 Zinc finger, NFX1-type containing 1
69 KPNA3 NM_002267 Karyopherin alpha 3 (importin alpha 4)
70 RANBP5 NM_002271 RAN binding protein 5
71 ZBTB6 NM_006626 Zinc finger and BTB domain containing 6
72 GCN1L1 NM_006836 GCN1 general control of amino-acid synthesis 1-like 1 (yeast)
73 HERC3 NM_014606 Hect domain and RLD 3
74 ITCH NM_031483 Itchy homolog E3 ubiquitin protein ligase (mouse)
75 KCNC1 NM_004976 Potassium voltage-gated channel, Shaw-related subfamily, member 1
76 LRP10 NM_014045 Low density lipoprotein receptor-related protein 10
77 MGC11102 NM_032325 Hypothetical protein MGC11102
78 PPP3CA NM_000944 Protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform
79 EGR3 NM_004430 Early growth response 3
80 EMILIN2 NM_032048 Elastin microfibril interfacer 2
81 IGF2BP2 NM_006548 Insulin-like growth factor 2 mRNA binding protein 2
82 ZBTB39 NM_014830 Zinc finger and BTB domain containing 39
83 WWC3 NM_015691 WWC family member 3
84 KLF1 NM_006563 Kruppel-like factor 1 (erythroid)
85 KLF5 NM_001730 Kruppel-like factor 5 (intestinal)
86 KLHL21 NM_014851 Kelch-like 21 (Drosophila)
87 LIF NM_002309 Leukemia inhibitory factor
88 NEDD4L NM_015277 Neural precursor cell expressed, developmentally down-regulated 4-like
89 P4HB NM_000918 Procollagen-proline, 2-oxoglutarate 4-dioxygenase, beta polypeptide
90 POU6F2 NM_007252 POU domain, class 6, transcription factor 2
91 PPIL1 NM_016059 Peptidylprolyl isomerase (cyclophilin)-like 1
92 SP4 NM_003112 Sp4 transcription factor
93 KBTBD8 NM_032505 Kelch repeat and BTB (POZ) domain containing 8
94 TNFRSF10D NM_003840 Tumor necrosis factor receptor superfamily, decoy with truncated death domain
95 TNFSF9 NM_003811 Tumor necrosis factor (ligand) superfamily, member 9
96 ZNF14 NM_021030 Zinc finger protein 14
97 ZNF295 NM_020727 Zinc finger protein 295
98 ZNF396 NM_145756 Zinc finger protein 396
99 ZNF498 NM_145115 Zinc finger protein 498
100 ZNF510 NM_014930 Zinc finger protein 510
101 ZNF79 NM_007135 Zinc finger protein 79
102 ANKRD27 NM_032139 Ankyrin repeat domain 27 (VPS9 domain)
103 EDG1 NM_001400 Endothelial differentiation, sphingolipid G-protein-coupled receptor, 1
104 IL10RA NM_001558 Interleukin 10 receptor, alpha
105 MAPK8 NM_002750 Mitogen-activated protein kinase 8
106 OR7A17 NM_030901 Olfactory receptor, family 7, subfamily A, member 17
107 PPIG NM_004792 Peptidylprolyl isomerase G (cyclophilin G)
108 SYT11 NM_152280 Synaptotagmin XI
109 ARL4D NM_001661 ADP-ribosylation factor-like 4D
110 ARFGEF2 NM_006420 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)
111 BAG1 NM_004323 BCL2-associated athanogene
112 BTN3A2 NM_007047 Butyrophilin, subfamily 3, member A2
113 CIB2 NM_006383 Calcium and integrin binding family member 2
114 CPEB2 NM_182485 Cytoplasmic polyadenylation element binding protein 2
115 DDX6 NM_004397 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6
116 DOCK10 NM_014689 Dedicator of cytokinesis 10
117 LINGO2 NM_152570 Leucine rich repeat and Ig domain containing 2
118 GBP4 NM_052941 Guanylate binding protein 4
119 GNA13 NM_006572 Guanine nucleotide binding protein (G protein), alpha 13
120 GPR25 NM_005298 G protein-coupled receptor 25
121 GPR32 NM_001506 G protein-coupled receptor 32
122 GUCY2F NM_001522 Guanylate cyclase 2F, retinal
123 IL6R NM_000565 Interleukin 6 receptor
124 KCNK3 NM_002246 Potassium channel, subfamily K, member 3
125 PPIL4 NM_139126 Peptidylprolyl isomerase (cyclophilin)-like 4
126 LMTK2 NM_014916 Lemur tyrosine kinase 2
127 MAP3K14 NM_003954 Mitogen-activated protein kinase kinase kinase 14
128 MAPK14 NM_001315 Mitogen-activated protein kinase 14
129 C1orf89 NM_030907 Chromosome 1 open reading frame 89
130 PARD6B NM_032521 Par-6 partitioning defective 6 homolog beta (C. elegans)
131 PHOX2B NM_003924 Paired-like homeobox 2b
132 POU3F2 NM_005604 POU domain, class 3, transcription factor 2
133 RBM22 NM_018047 RNA binding motif protein 22
134 RNF34 NM_194271 Ring finger protein 34
135 SIX4 NM_017420 Sine oculis homeobox homolog 4 (Drosophila)
136 WDR40C NM_001013628 WD repeat domain 40C
본 발명의 일실시예에 따른 과색소침착성 피부 진단용 키트에서, 프로브로 사용되는 폴리뉴클레오티드는 상기 표 1에 기재된 과색소침착성 피부 마커 유전자의 전장(full length) 또는 그의 단편을 포함한다. 단편의 길이는 10개 이상의 연속 뉴클레오티드를 포함하는 것이 바람직한데, 이는 프로브의 길이가 10bps 미만이면 비특이적으로 결합되기 때문이다.
본 발명의 또 다른 일실시예에 따른 과색소침착성 피부 진단 키트에서 프라이머로 사용되는 폴리뉴클레오티드는 그 길이가 18-22개인 것이 바람직하다. 이는 프라이머의 길이가 18bps미만이면 비특이적으로 결합되고, 22bps를 초과하면 프라이머끼리 자체 결합하여 효율성이 떨어지며, 제작시에도 비용과 기술적인 면에서 비생산적이기 때문이다.
본 발명의 또 다른 일실시예에 따른 과색소침착성 피부 진단 키트에서 피부 색소침착에 관여하는 단백질에 대한 모노클로날 항체는 일반적인 모노클로날 항체 제조방법으로 제조된다.
이하, 구체예를 들어 본 발명을 더욱 구체적으로 설명한다. 하기 구체예는 본 발명을 설명하기 위한 것이고 한정하기 위한 것은 아니다.
<실시예 1: 자외선에 의해 발현의 변화를 보이는 유전자 선별>
1. 인체 세포의 획득 및 자외선 조사
신생아의 표피에서 분리하여 순수배양된 멜라닌형성세포(NHEMs)를 1 ml 당 0.5 μg 하이드로코티손, 5 ng 표피성장인자, 5 μg 인슐린, 0.5% 우태아 뇌하수체 추출물을 함유한 무혈청 멜라닌세포배양 배지 (Clonetics, Walkersville, MD)에서 배양하였다. 3~5차례 계대배양된 세포에 각 시간 별 (0.5, 3, 12, 24 h)로 UVB (20mJ/cm2)를 조사하였다.
2.인체 세포로부터 RNA 채취
1에서 준비된 세포의 RNA를 정제하기 위해 트리졸(trizol)(Invitrogen, Carlsbad, CA, USA)을 첨가해 세포를 분쇄시킨 후 클로로포름을 넣어 상층액의 RNA를 분리하였다. 얻어진 상층액의 RNA를 농축하기 위해 동량의 이소프로파놀을 넣고 원심분리하여 침전된 RNA를 얻고, 염기 제거를 위해 70% 에탄올로 침전된 RNA를 세척하였다.
3.마이크로어레이 실험
각각의 시료에서 얻은 mRNA의 발현 양상을 비교하기 위해 마이크로어레이(microarray)를 수행하였으며, 사용한 유전자 칩은 oligonucleotide (70-mer) microarray (Microarray inc, human 48.5K)이다. RNA 20 μg으로부터 amino-allyl cDNA labeling kit (Ambion, Austin, Texas, USA)을 이용하여 형광 염색된 cDNA 프로브를 제작하였다. 자외선 조사를 하지 않은 멜라닌 형성세포(NHEM)로부터 분리한 RNA를 Cy3로 표지하여 공통 대조군으로 활용하였다. 각 시간대별로 얻은 RNA를 각각 Cy5로 표지하여 실험군으로 사용하였다. 16 시간 동안 55°C에서 혼성화(hybridization)를 수행하였다. 통계학적으로는 1-Way ANOVA test를 이용하여 의미 있는 (P<0.05) 유전자만을 추출하였다. 3회 실시한 마이크로어레이 실험 (UVB-0.5, 3, 12, 24 h)에서 통계적으로 의미 있게 증감한 유전자들 중에서 각 시점에서 2ⅹ이상 증감한 유전자 2431 종을 확보하였다.
4. Real-Time PCR
상기 2.에서 채취한 동일한 RNA 1 ㎍을 50mM 트리스-HCl(Tris-HCl, pH 8.3), 75mM KCl, 3mM MgCl2, 0.1M DTT, 10mM dNTP, 40유닛/μl RNase 저해제가 함유된 역전사 반응 완충액 25μl에 넣고, 0.5μg/μl 올리고(dT)16의 프라이머와 200유닛 수퍼스크립트 II[SuperScript II, 집코비알엘(GiboBRL)]의 역전사 중합효소를 첨가하여 42℃에서 1시간 반응시켰다. 이후 역전사 반응 용액 2.5μl를 엠플리택(AmpliTaq)DNA 중합효소[0.04U, 퍼킨 엘멀, 쉘튼, 씨티(Perkin Elmer, Shelton, CT)], 50mM 트리스(pH 8.3), 0.25mg/ml 우혈청알부민, 3mM MgCl2, 0.25mM dNTPs, SYBR 그린 I의 1/50,000 희석액[몰레큘라 프로브, 유진, 오알(Molecular Probes, Eugene, OR)]이 함유된 PCR 반응 완충액 50리터에 섞고, 10μM의 프라이머 센스 및 안티센스(하기 표 2 참조)를 첨가하여 94℃에서 30초, 53℃에서 30초, 72℃에서 1분인 사이클을 30사이클을 수행하였다. 상대적인 mRNA 레벨은 아이사이클러(ICycler) 소프트웨어를 이용하여 SYBR 그린 I 형광 변화를 측정함으로써 분석하여 도 1에 나타내었다. 자외선 처리 0시간대의 발현양 기준 1로 정한 후 각 연령별 시료의 상대적인 mRNA 레벨을 그래프화 시켰다. 그 결과, 시간대별 대표 유전자 15종의 Real-time PCR 결과는 마이크로 어레이 결과와 일치함을 알 수 있다.
표 2
유전자 기호 프라이머 종류 프라이머 서열
RHOD 센스(서열번호 1) GAGCGGTACATGGTCAACCT
안티센스(서열번호 2) TAGGTCACAGGCTCCAATCC
TRIM22 센스(서열번호 3) CCTGGAGCTCCTGACAGAAC
안티센스(서열번호 4) CATTCCTTGACCACCTCGTT
PLK2 센스(서열번호 5) AGGGACTCTTGGCAGCTGTA
안티센스(서열번호 6) GGCCAAGCTCTGCGTAATAG
GUCA1B 센스(서열번호 7) ACACCATCGACTTCCTGGAG
안티센스(서열번호 8) TCTGCAGCATCTTCATCACC
KCNJ2 센스(서열번호 9) TGCTGTTTTCATGGTGGTGT
안티센스(서열번호 10) GGAGTGTTGGGGACTTCGTA
PTGS2 센스(서열번호 11) GCAGTTGTTCCAGACAAGCA
안티센스(서열번호 12) CAGGATACAGCTCCACAGCA
DAF 센스(서열번호 13) ATGAGTGCCGTCCAGGTTAC
안티센스(서열번호 14) CTGAACTGTTGGTGGGACCT
Pou6F2 센스(서열번호 15) AAACTGAACCCTGGCCTTTT
안티센스(서열번호 16) TTAAGGGCTCCAAAGGGACT
LIF 센스(서열번호 17) TGCCAATGCCCTCTTTATTC
안티센스(서열번호 18) GTTGACAGCCCAGCTTCTTC
TNFSF9 센스(서열번호 19) GCCCAAAATGTTCTGCTGAT
안티센스(서열번호 20) TTATTCCGACCTCGGTGAAG
CXORf9 센스(서열번호 21) GGAAGAGTGGCAAAAAGCTG
안티센스(서열번호 22) TCAGCGAGTCGTGGTCATAG
SNFILK 센스(서열번호 23) ACCTCAGTGGTTTGGAGGTG
안티센스(서열번호 24) TGTCAGAGCTGGTTCCCTCT
EDG1 센스(서열번호 25) AACTGACCTCGGTGGTGTTC
안티센스(서열번호 26) AGTTATTGCTCCCGTTGTGG
TRIM35 센스(서열번호 27) TACCGCGTCTGGAAGAAGAT
안티센스(서열번호 28) GCTCCGCGTCATAGAAAGAC
RIT1 센스(서열번호 29) TAGGGAAGAGTGCCATGACC
안티센스(서열번호 30) TGTTTCCCACAAGAACCACA
<실시예 2: 피부 색소침착 기전의 중심 유전자 선정>
1. PSIMAP을 이용한 유전자 네트워크 작성
유전자가 번역(translation)된다는 가정하에, 그리고 protein data bank (PDB)에 있는 단백질의 structural classification (SCOP)에 따라 각 유전자의 단백질이 상호작용하는 것을 예측하는 PSIMAP을 이용하여 그들 간의 네트워크를 작성하였다. 2,431개의 유전자가 가지고 있는 단백질 도메인간의 상호작용을 이용하여 각 시간대 별 (0.5, 3, 12, 24 h)로 네트워크를 작성하였고, 도 2에 그 결과를 나타내었다.
2. Network에서 hub molecules 선정
상기 1.에서 작성된 각 시간 별 (0.5, 3, 12, 24 h) 4개의 네트워크에서 상호 작용이 활발한 중심 유전자 (hub molecules)를 중심으로 시간 별로 증감하는 유전자 클러스터(cluster)를 선별하였다. 그 결과의 일부를 도 3에 나타내었다. 도 3과 같이 4개 전체 네트워크에서 각 시점(time point) 별로 2배 이상 증감한 유전자들과 결합 파트너(binding partner)가 되는 중심 유전자들 중 결합 파트너(binding partner)의 변화가 많은 상위 53개를 선별(selection) 하여 다시 작은 네트워크 53개를 작성하였다. 그 결과는 도 4에 표기하였다. 이렇게 53개의 소 네트워크(small network)로 만들어 놓은 후, 이들 53개 중심 유전자 네트워크 가능한 유전자들 중 2배 이상 증감한 유전자만을 모아 다시 네트워크를 만들었고, 그 결과는 도 5와 같다. 이때 사용된 유전자는 140개였으며, 그 목록은 상기 표 1과 같다.

Claims (9)

  1. 본원 명세서 표 1에 기재된 유전자들로 구성된 군으로부터 선택된 유전자를 포함하는 과색소침착성 피부 진단용 바이오 마커.
  2. 제1항에 있어서, 상기 유전자는 자외선 조사에 의해 그 발현이 증감하는 것을 특징으로 하는 과색소침착성 피부 진단용 바이오 마커.
  3. 본원 명세서 표 1에 기재된 단백질들로 구성된 군으로부터 선택된 단백질을 포함하는 과색소침착성 피부 진단용 바이오 마커.
  4. 제3항에 있어서, 상기 단백질은 자외선 조사에 의해 그 발현양이 증감하는 것을 특징으로 하는 과색소침착성 피부 진단용 바이오 마커.
  5. 본원 명세서 표1에 기재된 유전자의 폴리뉴클레오티드 또는 그 단편으로서,
    상기 단편은 10개 이상의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드,
    또는 상기 폴리뉴클레오티드 및 그 단편에 상보적인 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 표면에 결합시킨 고상 지지체를 포함하며,
    상기 폴리뉴클레오티드에 혼성화된 전사체의 양이 정상치에 비해 증가하거나 감소하면 과색소침착성 피부인 것으로 진단하는 것을 특징으로 하는 과색소침착성 피부 진단 키트.
  6. 본원 명세서 표1에 기재된 유전자의 폴리뉴클레오티드의 단편으로서 18-22개의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드; 및
    본원 명세서 표1에 기재된 유전자의 폴리뉴클레오티드에 상보적인 폴리뉴클레오티드의 단편으로서 18-22개의 연속 뉴클레오티드를 포함하는 하나 이상의 폴리뉴클레오티드을 포함하며,
    상기 폴리뉴클레오티드들을 프라이머로 하여 증폭된 cDNA 양이 정상치에 비해 증가하거나 감소하면 과색소침착성 피부인 것으로 진단하는 것을 특징으로 하는 과색소침착성 피부 진단용 키트.
  7. 본원 명세서 표1에 기재된 단백질에 대한 모노클로날 항체를 포함하며,
    상기 항체에 결합된 항원의 양이 정상치보다 증가하거나 감소하면 과색소침착성 피부인 것으로 진단하는 것을 특징으로 하는 과색소침착성 피부 진단용 키트.
  8. 본원 명세서 표1에 기재된 유전자에 시험 물질을 처리하는 단계; 및
    상기 시험 물질이 상기 유전자의 발현을 촉진 또는 억제하는지를 확인하는 단계를 포함하는 것을 특징으로 하는 피부 과색소침착 억제제의 스크리닝방법.
  9. 본원 명세서 표1에 기재된 단백질에 시험 물질을 처리하는 단계; 및
    상기 시험 물질이 상기 단백질의 활성을 촉진 또는 억제하는지를 확인하는 단계를 포함하는 것을 특징으로 하는 피부 과색소침착 억제제의 스크리닝방법.
PCT/KR2009/000979 2008-02-29 2009-02-27 과색소침착성 피부 진단용 바이오 마커 WO2009108021A2 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2008-0018672 2008-02-29
KR20080018672A KR100981816B1 (ko) 2008-02-29 2008-02-29 과색소침착성 피부 진단용 바이오 마커

Publications (2)

Publication Number Publication Date
WO2009108021A2 true WO2009108021A2 (ko) 2009-09-03
WO2009108021A3 WO2009108021A3 (ko) 2010-02-18

Family

ID=41016609

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2009/000979 WO2009108021A2 (ko) 2008-02-29 2009-02-27 과색소침착성 피부 진단용 바이오 마커

Country Status (2)

Country Link
KR (1) KR100981816B1 (ko)
WO (1) WO2009108021A2 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110257527A (zh) * 2018-03-12 2019-09-20 华中农业大学 Flt1基因多态性作为猪产仔数性状的遗传标记及应用

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101904918B1 (ko) * 2011-11-09 2018-10-08 (주)아모레퍼시픽 피부 색소 침착 조절물질을 스크리닝하는 방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
RUTAO CUI ET AL.: 'Central Role of p53 in the Suntan Response and Pathologic Hyperpigmentation' CELL vol. 128, 09 March 2007, pages 853 - 864 *
SEBASTIEN CORRE ET AL.: 'In Vivo and Ex UV-Induced Analysis of Pigmentation Gene Expressions' JOURNAL OF INVESTIGATIVE DERMATOLOGY vol. 126, 02 February 2006, pages 917 - 919 *
SEBASTIEN CORRE ET AL.: 'UV-induced Expression of Key Component of the Tanning Process, the POMC and MCIR Genes, Is Dependent on the p-38-activated Upstream Stimulating Factor-1' THE JOURNAL OF BIOLOGICAL CHEMISTRY vol. 279, no. 49, 03 December 2004, pages 51226 - 51233 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110257527A (zh) * 2018-03-12 2019-09-20 华中农业大学 Flt1基因多态性作为猪产仔数性状的遗传标记及应用
CN110257527B (zh) * 2018-03-12 2021-01-29 华中农业大学 Flt1基因多态性作为猪产仔数性状的遗传标记及应用

Also Published As

Publication number Publication date
KR20090093245A (ko) 2009-09-02
KR100981816B1 (ko) 2010-09-13
WO2009108021A3 (ko) 2010-02-18

Similar Documents

Publication Publication Date Title
US7122373B1 (en) Human genes and gene expression products V
KR100999261B1 (ko) 여성호르몬 결핍으로 초래되는 여성 피부의 노화 억제제 스크리닝 방법
KR101618950B1 (ko) 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법
Hawkins et al. Gene expression differences in quiescent versus regenerating hair cells of avian sensory epithelia: implications for human hearing and balance disorders
Williams et al. Candidate downstream regulated genes of HOX group 13 transcription factors with and without monomeric DNA binding capability
WO2010011642A2 (en) Methods and compositions using splicing regulatory proteins involved in tumor suppression
Valéry et al. Identification by cDNA microarray technology of genes modulated by artificial ultraviolet radiation in normal human melanocytes: relation to melanocarcinogenesis
Darnell Developing global insight into RNA regulation
WO2009108021A2 (ko) 과색소침착성 피부 진단용 바이오 마커
US20070048740A1 (en) Full-length cDNA
KR100901128B1 (ko) 탈리도마이드 처리에 따른, 최기형성 유발 약물 검색용마커유전자 및 이를 이용한 검색 방법
McAllan et al. Integrative genomic analyses in adipocytes implicate DNA methylation in human obesity and diabetes
KR100947738B1 (ko) 피부 노화 진단 키트 및 피부 노화 진단 방법
Ahmed et al. Gene expression profile of the rat eye iridocorneal angle: NEIBank expressed sequence tag analysis
Van Diepen et al. The molluscan RING-finger protein L-TRIM is essential for neuronal outgrowth
Dickinson et al. Genomic profiling of Mixer and Sox17β targets during Xenopus endoderm development
KR100974228B1 (ko) 최기형성 및 부작용 유발 약물 검색용 바이오마커 및 이를이용한 최기형성 및 부작용 유발 약물 검색 방법
De Felice et al. Effect of selenocystine on gene expression profiles in human keloid fibroblasts
KR20100058439A (ko) 과색소침착성 피부 진단용 키트
Stoss et al. Misregulation of pre-mRNA splicing that causes human diseases. Concepts and therapeutic strategies
CN112522396A (zh) 一种piRNA NU13作为检测靶点的儿童胚胎性恶性肿瘤诊断试剂
CN111534587A (zh) 分子标志物5-tRF-His、乳腺癌检测试剂盒及其应用
KR20180099123A (ko) 항암제에 대한 저항성 예측용 바이오마커
Allen Identification of downstream targets of the putative transcription factor PRDM8
Xiang et al. Effect of follicular dendritic cell secreted protein on gene expression of human periodontal ligament cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09715681

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09715681

Country of ref document: EP

Kind code of ref document: A2