WO2009101619A2 - Procédés pour prédire la réponse d'un patient à un traitement au lithium - Google Patents

Procédés pour prédire la réponse d'un patient à un traitement au lithium Download PDF

Info

Publication number
WO2009101619A2
WO2009101619A2 PCT/IL2009/000162 IL2009000162W WO2009101619A2 WO 2009101619 A2 WO2009101619 A2 WO 2009101619A2 IL 2009000162 W IL2009000162 W IL 2009000162W WO 2009101619 A2 WO2009101619 A2 WO 2009101619A2
Authority
WO
WIPO (PCT)
Prior art keywords
allele
snp
single nucleotide
polymorphism
nucleotide polymorphism
Prior art date
Application number
PCT/IL2009/000162
Other languages
English (en)
Other versions
WO2009101619A3 (fr
Inventor
Ruth Navon
Anat Levit
Gilad Silberberg
Original Assignee
Ramot At Tel-Aviv University Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ramot At Tel-Aviv University Ltd. filed Critical Ramot At Tel-Aviv University Ltd.
Publication of WO2009101619A2 publication Critical patent/WO2009101619A2/fr
Publication of WO2009101619A3 publication Critical patent/WO2009101619A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/172—Haplotypes

Definitions

  • This invention relates to methods for predicting the response to lithium therapy in patients with mental or psychiatric disorders, by analyzing the presence of specific SNPs in the Cacng2 gene.
  • Bipolar disorder BPD; also called manic-depressive illness
  • schizophrenia are severe, chronic and life threatening illnesses, both characterized by extremely high suicide rates (1).
  • Lithium carbonate lithium
  • Lithium is considered the treatment of choice for BPD and multiple studies have shown its efficacy in prophylactic treatment of BPD.
  • lithium is effective only in 60—80% of BPD patients (2).
  • Long-term lithium treatment has been shown to reduce the risk of suicide and normalize the increased cardiovascular mortality (3).
  • Lithium is known to affect neurotransmitter release, the metabolism of biogenic monoamines and neuronal signal transmission through perturbation of the distribution of sodium, magnesium, and calcium.
  • Lithium can inhibit depolarization-induced and calcium-dependent release of norepinephrine and dopamine and may stimulate the release of serotonin.
  • Direct molecular targets suggested to be inhibited by lithium include inositol monophosphatase phosphomonoesterases, and glycogen synthase kinase-3 ⁇ (GSK-3
  • the calcium channel ⁇ -2 subunit gene (CacngT) located at chromosome 22ql3.1 region was recently reported to be associated with schizophrenia (8). This finding is consistent with several previous studies reporting linkage of the chromosomal region 22ql2-13 to schizophrenia (9). In addition, the 22ql2-13 chromosomal region has been linked with BPD (10). The D22S278 marker, present in that region, revealed convincing evidence of linkage disequilibrium with both BPD (10) and schizophrenia (11).
  • WO 2007/047634 discloses specific SNPs in the CACNG2 gene associated with response to lithium treatment in bipolar patients.
  • Tanney B Psychiatric diagnoses and suicidal acts. New York, Guilford Press, 2000
  • Torrey EF Webster M, Knable M, Johnston N, Yolken RH: The Stanley foundation brain collection and neuropathology consortium. Schizophr Res 2000; 44(2): 151-5 - A -
  • Livak KJ, Schmittgen TD Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001; 25(4):402-8
  • the present invention provides the use of single nucleotide polymorphisms (SNPs) in the calcium channel ⁇ -2 subunit (Cacng2) gene located on chromosomal region 22ql3.1 as a predictive method of lithium response, wherein the SNP is selected from the group consisting of rs2284017, rs2284018, rs5750285 and any combination thereof.
  • SNPs single nucleotide polymorphisms
  • a method for identifying an increased likelihood for positive response to lithium treatment in a subject by determining allelic variants of Cacng2 gene present in a nucleic acid sample obtained from a subject, wherein the presence of certain allelic variants is indicative of an increased likelihood for a positive response of the subject to lithium treatment.
  • the allelic variants of Cacng2 gene of the present invention are selected from the group consisting of rs2284017, rs2284018 and rs5750285 and any combination thereof, wherein the C allele is indicative of a positive response to treatment.
  • the present invention is directed to a method for identifying an increased likelihood for positive response to lithium treatment in a subject, the method comprising testing a sample obtained from the subject for the presence of at least one polymorphism of the Cacng2 gene selected from the group consisting of: (i) allele C of the C/T single nucleotide polymorphism (SNP) rs2284017; (ii) allele C of the C/T single nucleotide polymorphism (SNP) rs2284018;
  • the presence of allele C of the C/T polymorphism rs2284017 and allele C of the C/T polymorphism rs2284018 is indicative of an increased likelihood for a positive response to lithium treatment in the subject.
  • the presence of allele C of the C/T polymorphism rs2284017 and allele C of the C/T polymorphism rs5750285 is indicative of an increased likelihood for a positive response to lithium treatment in the subject.
  • the presence of allele C of the C/T polymorphism rs2284018 and allele C of the C/T polymorphism rs5750285 is indicative of an increased likelihood for a positive response to lithium treatment in the subject.
  • the presence of allele C of the C/T polymorphism rs2284017, allele C of the C/T polymorphism rs2284018, and allele C of the C/T polymorphism rs5750285 is indicative of an increased likelihood for a positive response to lithium treatment in the subject.
  • the present invention provides a method for identifying a an increased likelihood for positive response to lithium treatment in a subject, comprising testing a sample obtained from the subject for the presence of at least one genotype of the Cacng2 gene selected from the group consisting of:
  • the methods of the present invention can be performed in combination with testing for the presence of at least one additional marker associated with response to lithium treatment.
  • the method for identifying an increased likelihood for positive response to lithium treatment can further comprise measuring a clinical symptom of the subject.
  • the subject of the method is human.
  • the subject can suffer from a mental disorder, a psychiatric disorder or a psychotic disorder.
  • the mental or psychiatric disorder can be a mood disorder.
  • the mood disorder for example, is a bipolar disorder.
  • the methods of the invention for identifying an increased likelihood for positive response to lithium treatment in a subject can be performed prior to treatment of the subject with lithium or during the treatment of the subject with lithium.
  • the sample is obtainable from a body fluid.
  • the later can be selected from the group consisting of blood, saliva, cerebrospinal fluid, urine, and sperm.
  • Testing for the presence of a polymorphism in the present invention can be performed by SNP genotyping, for example, by allele-specif ⁇ c PCR.
  • the presence of the polymorphism is determined by contacting nucleic acids obtained from a sample of the subject with a polynucleotide probe which hybridizes with at least one polymorphism of the Cacng2 gene selected from the group consisting of:
  • the present invention provides a nucleic acid probe comprising a nucleotide sequence which hybridizes to a polymorphism in the Cacng2 gene, wherein the polymorphism comprises at least one single nucleotide polymorphisms (SNP) selected from the group consisting of:
  • said nucleic acid probe is used for identifying an increased likelihood for a positive response to lithium treatment in a subject.
  • the probe of the present invention can further be used in combination with detection of at least one additional marker for response to lithium treatment.
  • the present invention further provides the use of a nucleotide sequence which hybridizes to a polymorphism in the Cacng2 gene, wherein the polymorphism comprises at least one single nucleotide polymorphisms (SNP) selected from the group consisting of:
  • the present invention is also directed to an array comprising a substrate having a plurality of segments, wherein at least one of the segments comprises a probe which hybridizes to a polymorphism in the Cacng2 gene, wherein the polymorphism is at least one single nucleotide polymorphisms (SNP) selected from the group consisting of: (i) allele C of the C/T single nucleotide polymorphism (SNP) rs2284017; (ii) allele C of the C/T single nucleotide polymorphism (SNP) rs2284018; (iii) allele C of the C/G single nucleotide polymorphism (SNP) rs5750285; (iv) allele T of the C/T single nucleotide polymorphism (SNP) rs2284017; (v) allele T of the C/T single nucleotide polymorphism (SNP) rs2284018; (vi
  • said array is used for identifying an increased likelihood for a positive response to lithium treatment in a subject.
  • the present invention also provides the use of an array comprising a substrate having a plurality of segments, wherein at least one of the segment comprises a probe which hybridizes to a polymorphism in the Cacng2 gene, in identifying an increased likelihood for a positive response to lithium treatment in a subject, wherein the polymorphism is at least one single nucleotide polymorphisms (SNP) selected from the group consisting of:
  • the present invention further provides a kit compartmentalized to receive at least one oligonucleotide probe which hybridizes to at least one single nucleotide polymorphisms (SNP) selected from the group consisting of:
  • the kit can further comprise at least one additional oligonucleotide that hybridizes with at least one additional marker for response to lithium treatment.
  • the oligonucleotide probe comprises at least 12, 14, 15, or 21 contiguous nucleotides selected from SEQ ID NO: 1-9.
  • the present invention further comprises a method for obtaining information regarding the increased likelihood for positive response to lithium treatment in a subject, the method comprising testing a sample obtained from the subject for the presence of at least one polymorphism of the Cacng2 gene selected from the group consisting of:
  • any combination thereof wherein presence of each of the polymorphisms indicates an increased likelihood for a positive response to lithium treatment in the subject.
  • the information can be used to classify a subject in a clinical trial.
  • the information can also be used to classify a population of subjects.
  • Figure 1 is a graph representing mRNA expression of Cacng2. Normalized mRNA expression levels for Cacng2 were analyzed by real-time PCR for schizophrenia, bipolar and control subjects. The mRNA expression level of every sample (RQ value) was normalized to the average mRNA expression level for the control group (av[RQ]). The y-axis units are arbitrary for relative comparison of individual samples within the three sample groups presented.
  • Figure 2 is a graph showing Genotypes (A, B) and allele (C, D) counts in lithium response categories in SNPs rs2284017 (A, C) and rs5750285 (B, D) in the Aberdeen population set.
  • a polynucleotide includes a plurality of polynucleotides and “the SNP” includes reference to one or more SNPs.
  • Lithium is a known medication in the psychiatric setting for use in treating bipolar disorders. In particular, it is used as a mood-altering drug. Lithium is typically suitable for both mania and depression. In some circumstances, Lithium is used to augment other psychiatric drugs.
  • an "allele” is a particular form of a genetic locus, distinguished from other forms by its particular nucleotide sequence, or one of the alternative polymorphisms found at a polymorphic site.
  • Bipolar disorder is a mood disorder characterized by alternating periods of extreme moods. Bipolar disorders shall encompass those characteristics and symptoms provided, for example, in DSM IV (American Psychiatric Association, 1994) criteria.
  • a “genotype” shall have its ordinary meaning in the art and encompass one or more nucleotide pair(s) found at a set of one or more polymorphic sites in a locus on a pair of homologous chromosomes in an individual. "Genotyping” shall encompass a process for determining a genotype.
  • haplotype shall have its ordinary meaning in the art and shall encompass one or more nucleotides found at a set of one or more polymorphic sites in a locus on a single chromosome in an individual. "Haplotyping” shall mean a process for determining one or more haplotypes.
  • mental illness or disorder or “psychiatric disease or illness or disorder” can be used herein interchangeably and refer to mood disorders, bipolar disorder, euphoric mania, Bipolar I, Rapid Cycling, dysphoric mania, PTSD, Panic Attacks or Panic Disorder, alcohol or substance dependence, History of Suicide Attempt, and any combination thereof.
  • a psychotic disorder refers to a condition that affects the mind, resulting in at least some loss of contact with reality. Symptoms of a psychotic disorder include are provided for example in DSM IV (American Psychiatric Association, 1994) criteria. Schizophrenia, schizophreniform disorder, delusional disorder, and brief psychotic disorder are examples of psychotic disorders.
  • a “mood disorder” refers to disruption of feeling tone or emotional state experienced by a subject for an extensive period of time.
  • Mood disorders include major depression disorder (i.e., unipolar disorder), mania, dysphoria, bipolar disorder, dysthymia, and cyclothymia.
  • a polymorphism shall encompass a sequence variation observed in a subject at a polymorphic site.
  • Polymorphic site or "PS” is a position on a chromosome or DNA molecule at which at least two alternative sequences are found in a populaattiion.
  • probe or “an oligonucleotide probe” or “a primer” refers herein to a nucleic acid molecule or a sequence complementary therewith, when used to detect the presence of complementary sequences in a sample. The detection is carried out by identification of hybridization complexes between the probe and the assayed sequence.
  • the probe in some embodiments, may be attached to a solid support or to a detectable label. The probe will generally be single stranded.
  • the probe(s) or primer(s) typically comprise 10 to 50 nucleotides. By way of non-limiting example, a probe or primer typically comprise 15 to 30 nucleotides. The particular properties of a probe will depend upon the particular use and are within the competence of one of ordinary skill in the art to determine.
  • a “subject” encompasses mammalian subject or human.
  • a “sample” refers to any biological sample obtained from a subject which is suitable for isolation of nucleic acids.
  • Such biological sample may be obtained from e.g. blood, saliva, cerebrospinal fluid, urine, feces or sperm.
  • Such sample comprises nucleic acid(s).
  • SNPs are single nucleotide variations at a polymorphic site that occur in a population.
  • Information concerning SNPs is obtainable from various repositories such as Ensembl, a joint project between EMBL - European Bioinformatics Institute (EBI) and the Wellcome Trust Sanger Institute (WTSI), or the dbSNP, the SNP repository maintained by NCBI, The Human Genetic Bi-Allelic Sequences Database (HGVBase) and The SNP Consortium Ltd. (TSC).
  • HapMap project seek to identify the genetic patterns of human DNA sequence variation. Information such as SNP genotypes, recombination rates may be downloaded from the HapMap website (www.hapmap.org).
  • SNPs are conventionally identified by their relative position within a nucleotide sequence. Typically, following identification of a SNP a database reference is provided, "rs" number/SNP ID number. Consequently, sequence and other information related with a given "rs" number/SNP ID number may be obtained by browsing, for example, the dbSNP of the Entrez SNP which is provided by the NCBI, at www.ncbi.nlm.nih.gov.
  • the present invention discloses genetic polymorphisms which are associated with response to lithium treatment. Specifically, the invention provides alleles, haplotypes and genotypes of the Cacng2 gene that are associated with positive response to lithium treatment of a subject.
  • polymorphisms of the present invention can be used in combination with additional known polymorphisms and optionally other known clinical tests.
  • the polymorphisms which are associated with dichotomized response to lithium treatment disclosed hereinbelow comprise at least one of the following single nucleotides polymorphisms (SNPs): (a) rs2284017; (b) rs2284018; and (c) rs5750285.
  • SNPs single nucleotides polymorphisms
  • SEQ ID NO:1 is a portion of the Cacng2 nucleotide sequence that comprises rs2284017.
  • the C/T single nucleotide polymorphism is denoted as (Y) in the sequence below. Position: at chromosome 22 at pos 35426873, band: 22ql2.3.
  • the sequence includes chromosome 22: positions 35426473-35427273 (Strand: +).
  • SEQ ID NO:2 is a portion of the Cacng2 nucleotide sequence that comprises rs2284018.
  • the C/T single nucleotide polymorphism is denoted as (Y) in the sequence below. Position: at chromosome 22 at pos 35427510, band: 22ql2.3.
  • the sequence includes chromosome 22: positions 35427210-35427810 (Strand: +).
  • SEQ ID NO:3 is a portion of the Cacng2 nucleotide sequence that comprises rs5750285.
  • the A/G single nucleotide polymorphism is denoted as (S) in the sequence below. Position: at chromosome 22 at pos 35434194, band: 22ql2.3.
  • the sequence includes chromosome 22: positions 35433794-35434594 (Strand: +).
  • rs2284017, rs2284018, and rs5750285 are single nucleotide polymorphisms located at an intronic non-coding region. The testing for the presence of one or more polymorphisms of these SNPs in a sample obtained from a subject indicates an increased likelihood for a positive response to lithium treatment in the subject.
  • an increased likelihood for a positive response to lithium treatment refers to a statistically significant increase in the probability of manifesting a positive response to lithium treatment in a subject having a polymorphism of the present invention selected from: allele C of the C/T single nucleotide polymorphism (SNP) rs2284017; allele C of the C/T single nucleotide polymorphism (SNP) rs2284018; allele C of the C/G single nucleotide polymorphism (SNP) rs5750285, compared with the probability in an individual lacking the polymorphisms.
  • SNP C/T single nucleotide polymorphism
  • lithium treatment refers to administration of a lithium based therapeutic substance intended to ameliorate symptoms associated with a psychiatric disease or illness or disorder or a psychotic disorder, to lessen the severity or, or to prevent at least partially the symptoms of the disease, illness or disorder.
  • Partial good response is identified by at least a marked reduction in frequency of episodes or admissions or significant morbidity, and is well within the understanding of a person skilled in the art (for example, see Mendelewicz J et al., 1973).
  • the detection of the presence or absence of the at least one polymorphism involves contacting a polymorphic site of polymorphisms associated with lithium response with a probe.
  • the probe is an oligonucleotide probe, where the probe selectively hybridizes with the polymorphic site.
  • Selective hybridization may be typically provided by way of achieving conditions of either low stringency, medium stringency, or high stringency.
  • Low stringency can be provided by use of 0.03M sodium chloride and 0.03M sodium citrate at approximately 4O 0 C.
  • Medium stringency can be achieved with same at approximately 50 0 C, while high stringency can be at approximately 60 0 C. Normally, high stringency conditions are used.
  • a nucleotide sequence which is capable of selective hybridizing will generally have at least 60%, 70%, 80%, 90%, 95% or 99% sequence identity with any of the nucleotide sequences of the present invention, SEQ ID NOS: 1- 9, spanning over a region of at least 8, at least 15, at least 20, at least 30, at least 50, or at least 100 contiguous nucleotides, or their entire length.
  • Oligonucleotide primers and probes of the present invention can be prepared by various methods known in the art. Cloning and restriction of appropriate sequences and direct chemical synthesis can be utilized for that purpose.
  • the probes and primers can comprise nucleic acid analogs and the like, such as, for example, locked nucleic acid analogs and morpholino analogs.
  • the 3' end of a probe can be functionalized with either a capture or otherwise detectable label.
  • the probes and primers of the present invention can be labeled. This is performed by incorporating a label measurable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means.
  • labels can comprise radioactive substances ( 32 P, 35 S, 3 H, 125 I), fluorescent dyes (digoxigenin, fluorescein, 5-bromodesoxyuridin, acetylaminofluorene), biotin, nanoparticles, and the like.
  • radioactive substances 32 P, 35 S, 3 H, 125 I
  • fluorescent dyes digoxigenin, fluorescein, 5-bromodesoxyuridin, acetylaminofluorene
  • biotin nanoparticles
  • nanoparticles and the like.
  • oligonucleotides are typically labeled at their 3' and 5' ends.
  • an oligonucleotide probe may span two or more polymorphic sites. Unless otherwise specified, an oligonucleotide probe can include one or more nucleic acid analogs, labels or other substituents or moieties as long as the base-pairing function is retained. Accordingly, the present invention provides a nucleic acid probe comprising a nucleotide sequence which hybridizes to a polymorphism in the Cacng2 gene, wherein the polymorphism comprises at least one single nucleotide polymorphisms (SNP) selected from the group consisting of:
  • SNP single nucleotide polymorphisms
  • the present invention discloses the use of the probe in identifying an increased likelihood for positive response to lithium treatment in a subject.
  • the present invention implicates those specific allelic variants which are indicative of positive response to lithium treatment.
  • the specific alleles indicating positive response to lithium treatment can be selected from the group consisting of:
  • the present invention provides a nucleic acid probe or primer comprising a nucleotide sequence which hybridizes to a polymorphism in the Cacng2 gene, wherein the polymorphism comprises at least one single nucleotide polymorphisms (SNP) selected from the group consisting of:
  • one or more additional marker(s) for response to lithium treatment can be analyzed.
  • ADRBK2 beta-adrenergic receptor kinase
  • NRRK2 neurotrophic tyrosine kinase receptor type 2
  • BDNF brain derived neurotrophic factor
  • GSK3B brain derived neurotrophic factor
  • GRK3 G protein receptor kinase 3
  • Inositol phosphatases Inositol phosphatases
  • an oligonucleotides probe or primer comprises a sequence selected from the following group:
  • CAAAGAGCTGACACCCCCACTCCCCCfC/TITCAACCTCCCCATGCCCTCCCCTCC (per rs2284018, denoted as SEQ ID NO: 6 and 7, respectively)
  • the oligonucleotide probes comprise at least 8 contiguous nucleotides sequence of any of SEQ ID NO: 1-9, wherein the nucleotides comprise the respective underlined polymorphic site.
  • the oligonucleotide probes can further comprise any of the foregoing sequences where a T is substituted for a U; or a complement sequence of any of the foregoing sequences.
  • the probe or primer used for the detection of any of the SNP of the present invention is chosen to complement the contiguous nucleotide sequences upstream and downstream from any of the polymorphic sites disclosed herein.
  • the probe or primer used for the detection of any of the SNP of the present invention is chosen to complement the contiguous nucleotide sequences upstream and downstream from any of the polymorphic sites disclosed herein.
  • about 10 nucleotides upstream and about 10 nucleotides downstream of the polymorphic site are utilized.
  • a specific haplotype or genotype may be determined using a nucleotide sequence comprising 12, 17, 24, 28, 40 or more nucleotides upstream, or indeed any number within these ranges, and 12, 17, 24, 28, 40 or more nucleotides downstream or any number within these ranges, with respect to a polymorphic site disclosed herein.
  • the probes and primers can be immobilized on a solid support.
  • Solid supports are known to those skilled in the art.
  • solid support includes magnetic beads, the walls of wells in a reaction tray, nitrocellulose strips, membranes, glass and the like.
  • the probes of the present invention can also be immobilized on a substrate, e.g. a chip.
  • the present invention also contemplates an array comprising a substrate having a plurality of segments, wherein at least one of said segments comprises a probe which hybridizes to a polymorphism in the Cacng2 gene, wherein said polymorphism is at least one single nucleotide polymorphisms (SNP) from the group consisting of:
  • Suitable methods for immobilizing oligonucleotides on a solid phase include covalent bonding and the like which are known in the art.
  • the oligonucleotide probes or primers of the invention can be immobilized on a solid support either individually or in groups of distinct oligonucleotides on a single solid support.
  • oligonucleotide probes or primers of the invention may be linked in an array wherein each oligonucleotide is attached to a distinct segment of the solid support.
  • Such oligonucleotide arrays typically enable access to the distinct segments in the array and the recordings of hybridization assay.
  • the oligonucleotide probes can be used in an oligonucleotide chip as disclosed in US 5,143,854 or WO 92/10092.
  • synthesis of materials such as oligonucleotides of the present invention on the surface of a substrate may be carried out using light-directed methods as described in., e.g. US 5,143,854 and WO 92/10092, or mechanical synthesis methods as described in 5,384,261.
  • these light-directed or photolithographic synthesis methods involve a photolysis step and a chemistry step.
  • the substrate surface comprises functional groups on its surface. These functional groups are photo-protected by photo labile protecting groups such that in a photolysis step, exposure to light or other activators, activates the functional groups to remove photoprotecting groups. Chemical monomers thereafter bind to the activated portion of the substrate through an unprotected functional group.
  • an array of oligonucleotides complementary to a polymorphism in the Cacng2 gene comprising any of: allele C of the C/T single nucleotide polymorphism (SNP) rs2284017; allele C of the C/T single nucleotide polymorphism (SNP) rs2284018; and allele C of the C/G single nucleotide polymorphism (SNP) rs5750285; is used to determine the particular allelic variance in a sample obtained from an subject.
  • a 4L tiled array is employed.
  • the tiled array contains 4L probes (one for each of 4 bases, L denoted the number of sets of the 4 probes). Accordingly, a perfect complement obtained for the subject will hybridize more strongly in comparison to a mismatched pairing. The hybridization is indicative of the particular allelic variance of the subject tested.
  • primers include those oligonucleotides comprising sequences that flank the underlined sequence i.e. the polymorphic site above.
  • the primers can include a sequence that contains the underlined nucleotide.
  • testing for the presence of a polymorphism of the present invention is performed by allele-specific PCR.
  • a polymorphism of the present invention can be tested by employing primers as follows: two tailed allele-specific primers, a reverse primer, and two universal energy-transfer (ET) labeled primers of which can be labeled with a green dye (fluorescein) and the other a red dye (sulforhodamine), as disclosed for example in Myakishev MV et al (14).
  • primers as follows: two tailed allele-specific primers, a reverse primer, and two universal energy-transfer (ET) labeled primers of which can be labeled with a green dye (fluorescein) and the other a red dye (sulforhodamine), as disclosed for example in Myakishev MV et al (14).
  • ET-labeled primers are known in the art and are commercially available, for example, Amplifluor® (by CHEMICON International, Inc. Temecula, CA) see also Nuovo GJ et al (20).
  • Each of the allele-specific primers comprises a single allele-specific nucleotide, i.e. the above underlined polymorphic site, at the 3' terminus.
  • the later can be preceded by 16 to 21 bases complementary to the Cacng2 gene which immediately precede the polymorphic site, i.e. the tail of the allele-specific primer.
  • the reverse primers for such reaction can be chosen to complement the Cacng2 gene at a suitable distance so as to avoid overlaps with the allele-specific and the ET-labeled primers (which could result with poor performance).
  • the distance between the allele-specific primer(s) and the respective reverse primer(s) can vary from 7 to 160 bp.
  • the structure of the ET-labeled primer involves a 3' primer sequence and a 5' hairpin region that is labeled with a unique energy transfer pair.
  • the 3' primer sequence comprises the tail of the corresponding allele-specific primer.
  • detection of a polymorphism can further be performed by enzymatic mutation detection, hybridization assay involving allele- specific probes, primer extension assays, a nucleotide amplification assay , genotyping using mass spectrometry, sequencing, and enzymatic cleavage such as cleavage of single base mismatches and alike. These methods are known to the person skilled in the art.
  • Testing for the presence of the polymorphisms as described herein facilitates the prediction of the response of a subject to lithium treatment, and therefore can be used by a physician to determine whether a lithium based medication is suitable for a subject.
  • the present invention provides a method for identifying an increased likelihood for positive response to lithium treatment in a subject, the method comprising testing a sample obtained from the subject for the presence of at least one polymorphism of the Cacng2 gene selected from the group consisting of: (i) allele C of the C/T single nucleotide polymorphism (SNP) rs2284017; (ii) allele C of the C/T single nucleotide polymorphism (SNP) rs2284018;
  • the presence of allele C of the C/T polymorphism rs2284017, and allele C of the C/T polymorphism rs2284018 is indicative of an increased likelihood for a positive response to lithium treatment in the subject.
  • the presence of allele C of the C/T polymorphism rs2284017, and allele C of the C/T polymorphism rs5750285 is indicative of an increased likelihood for a positive response to lithium treatment in the subject.
  • the presence of allele C of the C/T polymorphism rs2284018, and allele C of the C/T polymorphism rs5750285 is indicative of an increased likelihood for a positive response to lithium treatment in the subject.
  • allele C of the C/T polymorphism rs2284017, allele C of the C/T polymorphism rs2284018, and allele C of the C/T polymorphism rs5750285 is indicative of an increased likelihood for a positive response to lithium treatment in the subject.
  • a polynucleotide sample (such as DNA or RNA) is obtained from a subject's body fluid (e.g. blood or saliva).
  • a subject's body fluid e.g. blood or saliva.
  • the person skilled in the art would recognize that there are other manners by which the nucleotide sample can be obtained.
  • the subject's sample can then used to test for the presence of a polymorphism in a Cacng2 gene the polymorphism is selected from the allelic variants of polymorphisms rs2284017, rs2284018 and rs5750285 discloses herein.
  • the subject is either diagnosed as or susceptible to a psychiatric disease, illness or disorder, or a psychotic disorder selected from the group consisting of mood disorder, bipolar disorder, euphoric mania, dysphoric mania, Bipolar I, Rapid Cycling, History of Suicide Attempt, PTSD, Panic Attacks/Panic Disorder, Alcohol or Substance Dependence, and any combination thereof.
  • a psychotic disorder selected from the group consisting of mood disorder, bipolar disorder, euphoric mania, dysphoric mania, Bipolar I, Rapid Cycling, History of Suicide Attempt, PTSD, Panic Attacks/Panic Disorder, Alcohol or Substance Dependence, and any combination thereof.
  • kits useful for testing for the presence of a polymorphism associated with response to lithium treatment in subjects can include instructions for use and reagents such as, but not limited to, labels, agents for attaching a label to the probes disclosed herein and more.
  • the instructions can provide particulars of how to perform the test for predicting a subject's response to lithium treatment, as described herein.
  • the instructions can further refer to the manner of attaching a label to the probe, and to the manner by which to obtain a sample for the analysis from a subject.
  • the kit comprises a labeled oligonucleotide that hybridizes to a portion of Cacng2 gene.
  • the present invention provides a kit compartmentalized to receive a reagent for measuring a single nucleotide polymorphism (SNP) of the Cacng2 gene in a nucleic acid sample obtained from a subject, said reagent comprising at least one oligonucleotide which hybridizes to at least one single nucleotide polymorphisms (SNP) from the group consisting of:
  • the kit can comprise additional oligonucleotide(s) that hybridizes with at least one additional marker for response to lithium treatment.
  • the present invention facilitates combined use of known markers associated with response to lithium treatment and at least one single nucleotide polymorphisms (SNP) from the group consisting of:
  • the reagent of the kit can comprise at least one oligonucleotide selected from SEQ ID NO: 1-9 or any of the aforementioned oligonucleotides probes.
  • the kit can also include additional probe(s) that hybridize to other oligonucleotides.
  • the oligonucleotides in the kit of the invention can also be immobilized on or directly synthesized on a solid surface such as a microchip, bead, or glass slide (for methods of immobilizing oligonucleotides or synthesizing on a solid surface see, e.g., WO 98/20020 and WO 98/20019).
  • kits of the invention may also contain other components such as hybridization buffer.
  • the kit optionally further contains dideoxynucleotide triphosphates (ddNTPs) when the alleles at the polymorphic sites are detected by primer extension. Therefore, in one embodiment, the kit contains primer-extension oligonucleotides.
  • the kit may also contain a polymerase and a reaction buffer optimized for primer-extension mediated by the polymerase.
  • the kits optionally comprise detection reagents, e.g. biotin- or fluorescent-tagged oligonucleotides, ddNTPs, an enzyme-labeled antibody, and substrates capable of generating a detectable signal when acted on by the enzyme.
  • test kits can include devices and instructions that enable a subject to obtain the sample.
  • buccal cells or blood may thus be obtained without the assistance of a health care provider.
  • the kit can include container(s) for the sample, or the sample can be in a standard blood collection vial.
  • the methods of the present invention can be utilized during clinical trials.
  • the present invention allows monitoring of the correlation between the polymorphisms disclosed herein and a potentially dichotomized response to lithium based medication(s) or combination treatments comprising lithium. Accordingly, the response can be monitored before, and at various points during the treatment of a subject with the medication.
  • the present invention further encompasses a method for obtaining information regarding an increased likelihood for positive response to lithium treatment in a subject, said method comprising testing a sample obtained from the subject for the presence of at least one polymorphism of the Cacng2 gene selected from the group consisting of:
  • This information can thus be used to at least minimize or avoid therapeutic failure of lithium treatment.
  • a physician or clinician can apply the generated information in a clinical trial.
  • the information can therefore classify the subject in a clinical trial. It may also classify a population of subjects in a similar manner.
  • the clinical trial may be designed to test the efficacy of a lithium-based medication or the efficacy of a pharmaceutical composition comprising lithium.
  • the clinical trial can be designed to test the efficacy of a pharmaceutical composition which does not comprise lithium in combination with a pharmaceutical composition which comprises lithium.
  • Efficacy in the present context encompasses the result of the treatment, discontinuance rates of the treatment, and dose response curves.
  • the generated information can be used in correlating a polymorphism selected from rs2284017, rs2284018, and rs5750285 with an outcome of a lithium treatment.
  • RNA prepared from frozen human Post-mortem dorsolateral prefrontal cortex (DLPFC) brain samples was obtained from the Stanley Foundation Brain Collection and Neuropathology Consortium, Bethesda, Maryland (to R.N). All samples were from Brodmann's area 46. The collection is well matched for age, pH and gender (12). Schizophrenic and bi-polar patients were diagnosed according to DSM-IIIR (American Psychiatric Association, 1987) or DSM-IV (American Psychiatric Association, 1994) criteria.
  • DLPFC Post-mortem dorsolateral prefrontal cortex
  • RNA and reverse transcription - A total of 105 RNA samples (35 schizophrenia patients, 35 bipolar patients and 35 matched control subjects) were used in this study. The samples were reverse transcribed using 1 ⁇ g of DNase-treated RNA, 0.2 ⁇ l random hexamer primers (0.5 ⁇ g/ ⁇ l; Promega, Madison, WI), 10 units of Ribonuclease Inhibitor (Takara, Shiga, Japan) and 9 units of avian myeloblastosis virus (AMV) reverse transcriptase (Promega).
  • DNase-treated RNA 0.2 ⁇ l random hexamer primers (0.5 ⁇ g/ ⁇ l; Promega, Madison, WI)
  • 10 units of Ribonuclease Inhibitor Takara, Shiga, Japan
  • AMV avian myeloblastosis virus
  • mRNA quantification - Cacng2 mRNA quantification was performed by realtime PCR (RT-PCR) on the ABI Prism ® 7000 Sequence Detection System (Applied Biosystems, Foster City, CA) using the SYBR Green I assay, with ⁇ -2 microglobulin as an internal control.
  • Primer pairs for Cacng2 and ⁇ -2 microglobulin were designed such that at least one of the primers was located on an exon-exon junction of the cDNA sequence.
  • the cDNA sequences were derived from the UCSC Genome Browser Database (http://genome.ucsc.edu), and the primers were designed according to Applied Biosystems recommendations using the Primer Express 2.0 software and synthesized by Integrated DNA Technologies (Coralville, Iowa).
  • Primer * pairs for ? (?acng2 were:
  • the calibrator sample used was a calculated value of the mean of all control samples values.
  • the Cagliari sample included patients treated at the Lucio Bini Center for mood disorders, affiliated with the University of Cagliari, in Sardinia. Response to lithium was evaluated using prospective data in adult, DSM-IV bipolar I, or II disorder patients providing written, informed consent. Clinical assessments were made by research psychiatrists, during follow-up visits at intervals of 2-3 months, following semi- structured examination protocols and life-charts. Illness-onset and course prior to the study was defined as the time of first psychiatric intervention or by consensus from subjects and family members. Treatment consisted of uninterrupted, closely monitored maintenance therapy, using lithium as a primary option. Serum lithium was assayed quarterly.
  • Treatment response measures were based on percent-time-ill during maintenance treatment as the primary outcome and were divided into 4 categories: 1 - no response (no improvement or worsening of illness), 2 - was poor response (minor or modest improvement in frequency of episodes or admissions; significant morbidity), 3 - partial good response (marked improvement but not episode-free), and 4 - good response (complete remission).
  • the classification was done by prospective classification in the Cagliari set. Informed consent was obtained from each participant recruited for the study. Ethical approval for the study was granted by the appropriate local ethical committees and by the IOP/SLAM ethical committee. Power analysis was performed using the genetic power calculator (http://statgen.iop.kcl.ac.uk/gpc/). The Aberdeen set had >90% power to detect a heterozygote odds ratio of 2 associated with BPD at the 0.05 level for a risk allele frequency of 0.2.
  • SNPs selection A total of 12 SNPs in the Cacng2 gene were selected for genotyping. SNPs were selected according to the linkage disequilibrium (LD) map of the CEU (Caucasian) population in the HapMap Database (http://www.hapmap.org/index.html.en) only from LD blocks adjacent to exons. From each such block, tagging SNPs (the minimal group of SNPs required to define all haplotypes) were selected for genotyping. Thus, the chosen 12 SNPs defined 2 LD blocks.
  • LD linkage disequilibrium
  • Genotyping Allele-specific PCR assays were designed as previously described (14) and genotyping was performed under contract by Prevention Genetics (Marshfield, USA). These assays are based on competitive allele-specific PCR that allows the simultaneous amplification and detection of DNA within a closed reaction vessel.
  • the homogeneous assay utilizes two different fluorescently labeled universal primers; two unlabeled and tailed allele-specific primers, and a common reverse primer in a single well reaction.
  • Submicroliter PCR reactions were carried out with ArrayTape instrumentation and allele calls were generated based on the clustering of fluorescent signals (15), [http://www.global-array.com].
  • Statistical analyses Gene expression distribution normality was evaluated using the Shapiro-Wilk test. The Student's t-test was used to compare Cacng2 expression level between patients and controls using the SPSS 10.0 program (SPSS, Chicago, IL).
  • Outliers were detected by the median of the absolute deviation about the median (MAD) method (http://www.cee.vt.edu/ewr/environmental/teach/smprimer/outlier/ outlier.html and (16)). Correlations between genotypes and lithium response were estimated by Kendall's tau-b or by Fisher's exact ⁇ 2 test for the dichotomized data (with 10 6 permutations).
  • RT-PCR analysis showed that the Cacng2 gene is expressed in the dorsolateral prefrontal cortex (DLPFC) of both patient groups and controls.
  • Table Ia Genotypic and allelic distribution of rs2284017, rs2284018 and rs5750285, associations and odds ratios in the dichotomized lithium response groups: good vs. poor or no response (indices 3, 4 versus 0, 1, 2 respectively).
  • Table Ib Genotypic and allelic distribution of rs2284017 and rs5750285, associations and odds ratios in the dichotomized lithium response groups in the Aberdeen set when O-responders were excluded (good response vs. poor response).
  • haplotype analysis of the combined set was performed covarying for population membership, which still yielded positive results.
  • Response to lithium treatment was much better in the Cagliari sample than in the Aberdeen sample (good-response rates: 71.76%, 18.59%, respectively; P ⁇ 10 "24 ).
  • This difference may be explained largely by the fact that different criteria for response were used in the different sample sets, since no consensus on defining response has emerged to date. However, the results show that the same haplotypes show significant (or in some cases a trend to) association with lithium response in both groups.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention porte sur l'utilisation de polymorphismes spécifiques de nucléotide simple (SNP) dans le gène de la sous-unité γ-2 des canaux calciques (Cacng2) en tant qu'outil pour prédire une réponse à une thérapie à base de lithium dans des états psychiatriques, notamment chez des patients souffrant de troubles bipolaires. L'invention porte par conséquent sur des procédés pour identifier une probabilité accrue d'une réponse positive à un traitement au lithium chez un sujet par la détermination de variantes alléliques du gène Cacng2 présents dans un échantillon d'acide nucléique obtenu à partir d'un sujet, la présence de certains variantes alléliques étant indicatrice d'une probabilité accrue pour une réponse positive du sujet à un traitement au lithium. L'invention porte en outre sur des oligonucléotides utiles dans la détection des SNP ainsi que sur des coffrets pour la mise en œuvre des procédés de l'invention.
PCT/IL2009/000162 2008-02-11 2009-02-11 Procédés pour prédire la réponse d'un patient à un traitement au lithium WO2009101619A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US2771508P 2008-02-11 2008-02-11
US61/027,715 2008-02-11

Publications (2)

Publication Number Publication Date
WO2009101619A2 true WO2009101619A2 (fr) 2009-08-20
WO2009101619A3 WO2009101619A3 (fr) 2009-11-26

Family

ID=40782690

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2009/000162 WO2009101619A2 (fr) 2008-02-11 2009-02-11 Procédés pour prédire la réponse d'un patient à un traitement au lithium

Country Status (1)

Country Link
WO (1) WO2009101619A2 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ITPD20110258A1 (it) * 2011-08-03 2013-02-04 Univ Cagliari Metodo per la valutazione farmacogenetica della risposta al trattamento con sali di litio nel disturbo bipolare
WO2014120745A1 (fr) * 2013-01-29 2014-08-07 Academia Sinica Variants génétiques associés à une réponse au lithium dans des troubles bipolaires

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000050639A2 (fr) * 1999-02-22 2000-08-31 Variagenics, Inc. Variations de sequences geniques presentant une utilite pour la selection du traitement d'une maladie
WO2001021791A2 (fr) * 1999-09-23 2001-03-29 Glaxo Group Limited Nouvelle proteine
WO2007047634A2 (fr) * 2005-10-14 2007-04-26 The Regents Of The University Of California Procedes de diagnostic, de prediction de reponse de traitement, et de developpement de traitements pour des troubles psychiatriques au moyen de marqueurs

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000050639A2 (fr) * 1999-02-22 2000-08-31 Variagenics, Inc. Variations de sequences geniques presentant une utilite pour la selection du traitement d'une maladie
WO2001021791A2 (fr) * 1999-09-23 2001-03-29 Glaxo Group Limited Nouvelle proteine
WO2007047634A2 (fr) * 2005-10-14 2007-04-26 The Regents Of The University Of California Procedes de diagnostic, de prediction de reponse de traitement, et de developpement de traitements pour des troubles psychiatriques au moyen de marqueurs

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS: "SNP: Search by IDs on All Assemblies" DATABASE SNP, [Online] 2008, XP002533858 Retrieved from the Internet: URL:http://www.ncbi.nlm.nih.gov/projects/SNP/> [retrieved on 2009-07-14] *
DIMITROVA A ET AL: "Association study of myo-inositol monophosphatase 2 (IMPA2) polymorphisms with bipolar affective disorder and response to lithium treatment." THE PHARMACOGENOMICS JOURNAL 2005, vol. 5, no. 1, 2005, pages 35-41, XP002533853 ISSN: 1470-269X *
HWU HAI-GWO ET AL: "Systematic SNP polymorphism screening for schizophrenia candidate gene of calcium channel, voltage-dependent, gamma subunit (CACNG2)" 14TH WORLD CONGRESS ON PSYCHIATRIC GENETICS; CAGLIARI, ITALY; OCTOBER 28- NOVEMBER 01, 2006, WILEY INTERSCIENCE, vol. 141B, no. 7, 5 October 2006 (2006-10-05), page 802, XP008107597 *
IKEDA AKIFUMI ET AL: "Biological predictors of lithium response in bipolar disorder." PSYCHIATRY AND CLINICAL NEUROSCIENCES JUN 2003, vol. 57, no. 3, June 2003 (2003-06), pages 243-250, XP002533852 ISSN: 1323-1316 *
LIU Y ET AL: "Fine mapping of chromosome 22q12 reveals the novel vulnerability gene for schizophrenia, CACNG2: Association with impairment of sustained attention and executive function" 13TH WORLD CONGRESS ON PSYCHIATRIC GENETICS; BOSTON, MA, USA; SEPTEMBER 04-08, 2005, WILEY INTERSCIENCE, vol. 138B, no. 1, 5 September 2005 (2005-09-05), page 126, XP008107599 *
MENG HONGDI ET AL: "Stargazin mutation impairs cerebellar synaptogenesis, synaptic maturation and synaptic protein distribution." BRAIN RESEARCH 8 DEC 2006, vol. 1124, no. 1, 8 December 2006 (2006-12-08), pages 197-207, XP002533856 ISSN: 0006-8993 *
SERRETTI A ET AL: "Further evidence for a possible association between serotonin transporter gene and lithium prophylaxis in mood disorders." THE PHARMACOGENOMICS JOURNAL 2004, vol. 4, no. 4, 2004, pages 267-273, XP002533854 ISSN: 1470-269X *
SERRETTI A ET AL: "Serotonin receptor 2A, 2C, 1A genes and response to lithium prophylaxis in mood disorders." JOURNAL OF PSYCHIATRIC RESEARCH 2000 MAR-APR, vol. 34, no. 2, March 2000 (2000-03), pages 89-98, XP002533855 ISSN: 0022-3956 *
TOMITA SUSUMU ET AL: "Stargazin interacts functionally with the AMPA receptor glutamate-binding module." NEUROPHARMACOLOGY JAN 2007, vol. 52, no. 1, January 2007 (2007-01), pages 87-91, XP002533857 ISSN: 0028-3908 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ITPD20110258A1 (it) * 2011-08-03 2013-02-04 Univ Cagliari Metodo per la valutazione farmacogenetica della risposta al trattamento con sali di litio nel disturbo bipolare
WO2013017661A1 (fr) * 2011-08-03 2013-02-07 Universita' Degli Studi Di Cagliari Méthode d'évaluation de la réponse pharmacogénétique au traitement par des sels de lithium du trouble bipolaire
WO2014120745A1 (fr) * 2013-01-29 2014-08-07 Academia Sinica Variants génétiques associés à une réponse au lithium dans des troubles bipolaires
TWI510632B (zh) * 2013-01-29 2015-12-01 Academia Sinica 預測鋰鹽在雙極性情感疾病的預防療效之生物標記
CN105378105A (zh) * 2013-01-29 2016-03-02 中央研究院 预测锂盐在双极性情感疾病的预防疗效的生物标记
US9797015B2 (en) 2013-01-29 2017-10-24 Academia Sinica Genetic variants associated with lithium response in bipolar disorder
CN105378105B (zh) * 2013-01-29 2018-08-31 中央研究院 预测锂盐在双极性情感疾病的预防疗效的生物标记

Also Published As

Publication number Publication date
WO2009101619A3 (fr) 2009-11-26

Similar Documents

Publication Publication Date Title
US20180334717A1 (en) Personalized pain management and anesthesia: preemptive risk identification and therapeutic decision support
Kato Molecular genetics of bipolar disorder and depression
US20120053070A1 (en) Genetic Risk Analysis In Reward Deficiency Syndrome
US20050277129A1 (en) APOE genetic markers associated with age of onset of Alzheimer's disease
JP2013538589A (ja) 自閉症を診断するための組成物及び方法
Puri et al. Fine mapping by genetic association implicates the chromosome 1q23. 3 gene UHMK1, encoding a serine/threonine protein kinase, as a novel schizophrenia susceptibility gene
CA2657493A1 (fr) Methode de pronostic
US20140336181A1 (en) Use of polymorphisms for identifying individuals at risk of developing autism
US20100047798A1 (en) Adenosine a1 and a3 receptor gene sequence variations for predicting disease outcome and treatment outcome
US7906281B2 (en) Method to predict the response to lithium treatment
US20050255498A1 (en) APOC1 genetic markers associated with age of onset of Alzheimer's Disease
US20090042194A1 (en) Predicting a response to risperidone
US20130317006A1 (en) Use of polymorphisms for identifying individuals at risk of developing autism
WO2014151940A1 (fr) Procédé et système pour prévoir une réponse à un ssri
CA2667812A1 (fr) Methodes permettant d'identifier les patients risquant de developper des evenements indesirables au cours d'un traitement avec un medicament antidepresseur
WO2007121319A2 (fr) Compostions et procédés destinés à déterminer et à prevoir des réponses aux traitements de la dépression et de l'anxiété
WO2009101619A2 (fr) Procédés pour prédire la réponse d'un patient à un traitement au lithium
US20080213765A1 (en) Human Autism Susceptibility Genes Encoding a Neurotransmitter Transporter and Uses Thereof
US20140255930A1 (en) Materials and Methods Related to Dopamine Dysregulation Disorders
US20100233702A1 (en) Method to predict response to treatment for psychiatric illnesses
EP2059608A1 (fr) Utilisation de snp dans le diagnostic d'un haplotype de protection contre la douleur dans le gène de la gtp cyclohydrolase 1 (gch1)
KR20230005816A (ko) 신경전달물질 수송체 억제제의 효능을 평가하기 위한 조성물 및 방법
US20050255488A1 (en) NTRK1 genetic markers associated with age of onset of Alzheimer's Disease
JP2007517511A (ja) ヒトチオプリンｓ−メチルトランスフェラーゼ欠損に関連するハプロタイプおよび多型
EP3058098A1 (fr) Tests de génotypage et procédés d'évaluation des taux de créatine kinase dans le plasma

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09710234

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09710234

Country of ref document: EP

Kind code of ref document: A2