WO2009088994A1 - Système de criblage par double hybride en levure basé sur un affichage en surface - Google Patents

Système de criblage par double hybride en levure basé sur un affichage en surface Download PDF

Info

Publication number
WO2009088994A1
WO2009088994A1 PCT/US2009/000046 US2009000046W WO2009088994A1 WO 2009088994 A1 WO2009088994 A1 WO 2009088994A1 US 2009000046 W US2009000046 W US 2009000046W WO 2009088994 A1 WO2009088994 A1 WO 2009088994A1
Authority
WO
WIPO (PCT)
Prior art keywords
yeast
reporter
cells
protein
cell
Prior art date
Application number
PCT/US2009/000046
Other languages
English (en)
Inventor
Hong Cai
Jun Chen
Original Assignee
Los Alamos National Security, Llc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Los Alamos National Security, Llc filed Critical Los Alamos National Security, Llc
Publication of WO2009088994A1 publication Critical patent/WO2009088994A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1037—Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display

Definitions

  • the yeast two-hybrid (Y2H) system was developed as a tool for the in vivo identification of protein-protein interactions many years ago (1).
  • the Y2H system is a genetic screen, wherein the interaction between two proteins of interest is detected via the functional reconstitution of the distinct DNA binding and activation domains of a transcription factor, and the subsequent activation of reporter expression controlled by the transcription factor.
  • the Y2H screening system has been used extensively in the past decade to catalogue protein-protein interactions on genome-wide scales.
  • Y2H has been the main working horse for the discovery of novel interactions in large cDNA libraries, where a bait protein is often screened against a entire library consisting of tens of thousands expressed genes.
  • a bait protein is often screened against a entire library consisting of tens of thousands expressed genes.
  • the Y2H system is the most widely used approach for generating large-scale interactome maps in virus, bacteria, yeast, worm, fly and recently, human (5-8).
  • yeast two hybrid (Y2H) system for protein-protein interaction analysis and discovery
  • conventional Y2H assays are not well suited for high throughput screening of protein interaction network ("interactome") at genomic scale due to these limitations. It would therefore be highly desirably to have a Y2H system which does not require the use of labor-intensive and expensive plate-based cell culture, and provides more reliable and quantifiable results.
  • the invention provides a novel surface display-based Y2H (sdY2H) library screening system with uniquely integrated surface display antigen(s) that may be utilized as affinity tags for rapid immunomagnetic capture in order to enrich for and/or substantially isolate cells harboring positive protein-protein interacting pairs.
  • the sdY2H system may be used in combination with growth selection markers, as is well known, and provides highly efficient isolation of cells positive for protein-protein interactions.
  • the system of the invention may be further enhanced by the use of a fluorescent protein reporter used in combination with the cell surface display reporter. Accordingly, the invention further provides a sdY2H system that also incorporates a fluorescent protein reporter, enabling subsequent screening using flow cytometry.
  • the incorporation of a fluorescent protein reporter enables a highly quantitative approach to selection, generating fewer false positives, particularly after the library has been very substantially enriched for positive interactions using immunomagnetic capture in the sdY2H system.
  • the invention utilizes a liquid culture based method, thereby eliminating perhaps the biggest limitation on conventional Y2H systems.
  • the invention provides a yeast two-hybrid assay or system in which at least one reporter is a cell surface display reporter (sdY2H).
  • a cell surface display reporter sdY2H
  • such an sdY2H assay or system further comprises a fluorescent protein reporter, which in some embodiments may be the surface display reporter.
  • yeast reporter cells containing prey and bait protein constructs are initially screened/captured by affinity enrichment for cells expressing the surface display reporter. Affinity enrichment may be conducted using various known methods, including immunoaffinity methods. In one embodiment, affinity enrichment is conducted using immunomagnetic affinity enrichment.
  • the population of cells isolated by affinity enrichment are further screened by measuring fluorescence generated by the fluorescent reporter using flow cytometry.
  • the fluorescent protein reporter is yEGFP.
  • the surface display reporter is hemagglutination antigen (HA) and the fluorescent protein reporter is yEGFP.
  • the fluorescent protein reporter and/or the surface display reporter may be encoded within the genome of a yeast reporter cell.
  • the yeast reporter cell is a S. cerevisiae cell or a S. cerevisiae strain AH109 cell.
  • yeast reporter cells are grown in liquid culture for at least 12 hours, more preferably 12-24 hours, and still more preferably 24 hours or longer prior to affinity enrichment for cells containing interacting protein pairs.
  • FIG.1 Scheme of the sdY2H system.
  • the DNA binding domain (BD) and the transcriptional activation domain(AD) will be reconstituted to an active transcription factor to trigger the expression of reporters including surface display HA (sdHA) and yEGFP.
  • the sdHA positive cells can be enriched by a simple magnetic separation (MACS) before plating or sorted by flow cytometry (FACS) based on yEGFP fluorescence.
  • MCS simple magnetic separation
  • FACS flow cytometry
  • FIG. 2 Evaluation of sdHA expression and sdHA-mediated magnetic separation by flow cytometry.
  • A Flow cytometric measurement of the sdHA and yEGFP reporter expression in sdY2H host cells. The AH109-YDC cells containing negative (Lam/T) and positive (p53/T) control pairs were grown in SD-L-T for 16hrs before harvest. The collected cells are either directly analyzed for yEGFP expression (A, upper panels) or labeled with the PE conjugated HA antibody for sdHA expression (A, bottom panels).
  • B The sdHA-mediated magnetic enrichment was analyzed by the flow cytometric yEGFP measurement on the cells undergone MACS separation.
  • the red histogram cells containing negative control Lam/T; Blue histogram: cells containing positive control p53/T without MACS enrichment; Green histogram: cells containing positive control p53/T with MACS enrichment.
  • the percentage of the yEGFP positive cells in M1 region was shown in the figure.
  • FIG. 3 Time course study of the sdHA-mediated magnetic enrichment efficiency as a function of post-mating cell growth.
  • the AH109-YDC cells containing bait protein p53 were mated with Y187 cells containing prey T. After mating, the cell mixture was grown in SD-L-T-H selective medium for 16hrs, 20hrs, 24hrs and 40hrs respectively before harvest.
  • the yEGFP fluorescence analysis was performed on the cells collected before (upper panel), and after the magnetic enrichment (lower panel).
  • a “yeast two-hybrid assay” or “yeast two-hybrid system” are used interchangeably herein and refer to an assay or system for the detection of interactions between protein pairs.
  • a transcription factor is split into two separate fragments, the binding domain (BD) and the activation domain (AD), each of which are provided on separate plasmids, and each of which is fused to a protein of interest.
  • the yeast two-hybrid assay system comprises (i) a "bait" vector, comprising a bait protein and the BD of the transcription factor utilized in the system; (ii) a "prey” vector, comprising a prey protein (or a library of prey proteins to be screened for interaction with the bait protein) and the AD of the transcription factor; (iii) a suitable reporter yeast strain containing the activation sequence for the transcription factor used in the system, which drives the expression of one or more reporter proteins.
  • the bait and prey vectors are introduced into the reporter yeast strain, wherein if the expressed bait and prey proteins may interact. Interacting bait and prey protein pairs result in the reconstitution and activation of the transcription factor, which then binds to its compatible activation domain provided in the reporter yeast strain, which in turn triggers the expression of the reporter gene, which may then be detected.
  • fluorescent protein as used herein is a protein that has intrinsic fluorescence.
  • a fluorescent protein has a structure that includes an 1 1 -stranded beta- barrel.
  • yEGFP refers to a yeast codon-optimized variant of Enhanced Green Fluorescent Protein(EGFP), as described in Cormack et al., 1997, Microbiol. 143: 303-311.
  • Physical linkage refers to any method known in the art for functionally connecting two or more molecules or domains (which are termed “physically linked”), including without limitation, recombinant fusion with or without intervening domains, intein-mediated fusion, non-covalent association, covalent bonding (e.g., disulfide bonding and other covalent bonding), hydrogen bonding; electrostatic bonding; and conformational bonding, e.g., antibody-antigen, and biotin- avidin associations.
  • physical linkage refers to any method known in the art for functionally connecting two or more molecules or domains (which are termed “physically linked”), including without limitation, recombinant fusion with or without intervening domains, intein-mediated fusion, non-covalent association, covalent bonding (e.g., disulfide bonding and other covalent bonding), hydrogen bonding; electrostatic bonding; and conformational bonding, e.g., antibody-antigen, and biotin- avidin associations.
  • a “fusion protein” refers to a chimeric molecule formed by the joining of two or more polypeptides through a bond formed one polypeptide and another polypeptide. Fusion proteins may also contain a linker polypeptide in between the constituent polypeptides of the fusion protein.
  • the term “fusion construct” or “fusion protein construct” is generally meant to refer to a polynucleotide encoding a fusion protein.
  • heterologous when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature.
  • a nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a nucleic acid encoding a fluorescent protein from one source and a nucleic acid encoding a peptide sequence from another source.
  • a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).
  • reporter molecule has a detectable phenotype.
  • the reporter molecule is a polypeptide, such as an enzyme, or a fluorescent polypeptide.
  • a reporter polypeptide may have intrinsic activity.
  • a reporter molecule has a detectable phenotype associated with correct folding or solubility of the reporter molecule.
  • the reporter could be an enzyme or a fluorescent polypeptide.
  • the detectable phenotype would then be the ability to turn over a substrate giving a detectable product or change in substrate concentration or physical state.
  • the activity would be the emission of fluorescence upon excitation by the appropriate wavelength(s) of light.
  • nucleic acid or protein when applied to a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state. It is preferably in a homogeneous state although it can be in either a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein which is the predominant species present in a preparation is substantially purified. In particular, an isolated gene is separated from open reading frames which flank the gene and encode a protein other than the gene of interest. The term “purified” denotes that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. Particularly, it means that the nucleic acid or protein is at least 85% pure, more preferably at least 95% pure, and most preferably at least 99% pure.
  • Nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form.
  • the term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs).
  • PNAs peptide-nucleic acids
  • nucleic acid is used interchangeably with gene, cDNA, mRNA, oligonucleotide, and polynucleotide.
  • polypeptide peptide
  • protein protein
  • amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.
  • amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
  • Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, ⁇ -carboxyglutamate, and O-phosphoserine.
  • Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an ⁇ carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.
  • Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
  • Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
  • amino acid sequences one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid.
  • Conservative substitution tables providing functionally similar amino acids are well known in the art. For example, substitutions may be made wherein an aliphatic amino acid (G, A, I, L 1 or V) is substituted with another member of the group.
  • an aliphatic polar-uncharged group such as C, S 1 T, M, N, or Q, may be substituted with another member of the group; and basic residues, e.g., K, R, or H, may be substituted for one another.
  • an amino acid with an acidic side chain, E or D may be substituted with its uncharged counterpart, Q or N, respectively; or vice versa.
  • Each of the following eight groups contains other exemplary amino acids that are conservative substitutions for one another:
  • recombinant when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified.
  • recombinant cells express genes that are not found within the native (nonrecombinant) form of the cell or express native genes that are otherwise abnormally expressed, under-expressed or not expressed at all.
  • an "expression vector” is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a host cell.
  • the expression vector can be part of a plasmid, virus, or nucleic acid fragment.
  • the expression vector includes a nucleic acid to be transcribed operably linked to a promoter.
  • the invention provides a surface display-based yeast two hybrid system for rapid and large cDNA library scale protein interactome networking screening at affordable cost without the involvement of time consuming plating and cell sorting.
  • the system's principal advantage results from its utilization of a combination of surface display markers, highly efficient yeast mating resulting in high transformation efficiencies, and positive cell enrichment using a robust immunomagentic affinity purification.
  • the system of the invention can be combined with multiparameter fluorescence markers allowing further quantitative fluorescence analysis/sorting, enabling a significant reduction in the number of false positives.
  • the system uses liquid culture, rather than plate-based culture, resulting in substantially shortened cell culturing times that significantly reduce background fluorescence, allowing better discrimination of positive cells.
  • the invention represents the first operational large-scale cDNA library yeast two hybrid screening method, enabling non-plating based liquid culture, and suitable for fully automated and high-throughput large scale cDNA library screening.
  • conventional agarose gel plating-based screening requires preparing ⁇ 100 agarose plates for each bait screening, manual picking of positive cell colonies that survive the nutrient markers selection, followed by further qualitative confirmation using a costly beta-Gal substrate for the development of colorimetric signals (5-10 hours), which involves replica plating, a process that can not be easily automated without several sophisticated and expensive robots.
  • the system provides a simple, cost- effective, and efficient alternative to the cumbersome processes required with conventional methods.
  • Yeast surface display techniques have been developed and applied successfully in many library screening applications (9-14) and the cells with surface displayed antigen can be analyzed and sorted by either flow cytometry or magnetic beads (9, 15, 16). Magnetic separation is convenient, simple, fast and has been utilized in many applications for cell isolation (17). The pre-enrichment of target cells from a library greater than 10 8 cells was previously demonstrated (18, 19).
  • a reporter protein that is expressed on the surface of yeast cells is incorporated into the Y2H system of the invention.
  • This approach enables the use of immunological affinity capture methods to select for cells within a large library of potential interacting "prey" proteins and the "bait” protein used in the assay.
  • any protein or polypeptide that can be expressed as a cell surface marker on yeast cells may be used.
  • Antibodies, or other affinity binding ligands may be used to immunologically capture positive cells via binding to an epitope on the cell surface displayed protein.
  • immunoaffinity methodology may be used to capture positive cells from a cell library
  • a preferred method involves immunomagnetic capture, wherein magnetic beads functionalized with the antibody or other affinity binding ligand are used to efficiently capture positive cells from the library.
  • a principal advantage of the inventions is the elimination of agar plate-based culture typical of all Y2H systems available today, as the invention achieves yeast growth in liquid culture.
  • the invention provides a simple alternative to the cumbersome replica plating characteristic of conventional Y2H systems, inasmuch as positive Y2H targets are quickly isolated from library cells by a simple affinity enrichment screen.
  • immunomagnetic capture may be sufficient, alone, to capture a wide range of cells containing protein-protein interacting pairs.
  • the surface display marker is combined with a fluorescent reporter enabling flow cytometric selection following an immunomagnetic enrichment step, as is further described, infra.
  • yeast surface display system whereby a desirable ligand may be expressed as a fusion with a yeast cell- surface expressed protein.
  • yeast surface display systems have been described and are widely available for screening combinatorial peptide libraries. In one such system (Boder et al., 1997, Nature Biotecchnology 15: 553-57), a protein of interest is displayed as a C-terminal fusion to the Aga2p mating adhesion receptor of Saccharomyces cerevisiae on the surface of yeast. The Aga2p protein is naturally used by yeast to mediate cell-cell contacts during yeast cell mating.
  • any number of cell surface proteins that can be expressed in and localized to the yeast cell surface may be used as surface display markers, including yeast proteins and a broad range of heterologous proteins.
  • Example 1 describes the use of the hemagglutination antigen (HA).
  • HA hemagglutination antigen
  • Many other heterologous cell surface and transmembrane proteins e.g., eukaryotic cell surface proteins, such as mammalian cell surface proteins
  • Some examples include numerous CD cell markers (e.g., CD4, CD8, CD45, etc.) and transmembrane receptor molecules (e.g., EGFR 1 G-protein coupled receptors, insulin receptor).
  • proteins and polypeptides not naturally expressed on the cell surface may be engineered to contain targeting domains that will direct the protein to be expressed and localized to the cell surface, as will be generally appreciated by those skilled in the art.
  • any affinity capture methodology may be used to enrich for yeast cells expressing the surface display reporter, typically an immunoaffinity approach will be used.
  • magnetic (i.e., immunomagnetic) affinity capture is employed. Magnetic affinity capture refers to methods which utilize the ability of a ligand binder-functionalized magnetic bead to bind to the surface of a particle or cell, thereby permitting the application of a magnetic filed to isolate the particle or cell of interest from other contents in a sample containing such particles or cells, and include for example immunomagnetic affinity capture methodologies.
  • the affinity ligand is typically an antibody capable of recognizing and binding to a surface display reporter.
  • a ligand-functionalized magnetic bead is magnetic bead coated or functionalized with an antibody which recognizes and binds to a surface display reporter expressed in the yeast cell.
  • a yeast two-hybrid system in which both surface display and fluorescent reporters are utilized is provided.
  • the interaction of a prey protein with the bait protein triggers the activation of the transcription factor and expression of the reporters under the control of the responsive promoter used in the system.
  • Expression of the cell surface display reporter enables the use of affinity capture to enrich for positive cells.
  • Expression of the fluorescent reporter enables flow cytometric detection and quantitation of fluorescence.
  • the use of a flow cytometric screen (typically, following an affinity enrichment for surface display reporter expressing cells) further reduces the false positive rate based on the quantitative GFP analysis.
  • the improved specificity attributed to the use of multiple reporters (sdHA, GFP and conventional nutrient markers), and the convenience of cell culturing in combination offers a greatly streamlined process for high throughput and high volume library screen applications.
  • the fluorescent protein yEGFP is used as the fluorescent protein reporter.
  • yEGFP is integrated into the yeast reporter strain genome.
  • An example of such a yeast reporter cell line is the S. cerevisiae AH 109 strain used in the MatchmakerTM Y2H system available from Clontech Laboratories (Mountain View, California) (see Examples, infra).
  • the yEGFP expressing AH109 strain may be used in combination with the MatchmakerTM Y2H bait and prey plasmids, also available from Clontech.
  • This system is a GAL4-based Y2H system, and it has been thoroughly characterized in the Examples, infra.
  • the "MatchmakerTM GAL4 Two- Hybrid System 3 & Libraries User Manual" from Clontech may be obtained from Clontech and is hereby specifically incorporated by reference herein in its entirety.
  • yeast Saccharomyces cerevisiae are particularly suitable in embodiments of the invention, in part because their genome has been extensively studied, and because they enjoy GRAS ("Generally Regarded As Safe") status with the Food and Drug Administration. Saccharomyces cerevisiae is recognized as a model eukaryote capable of rapid growth and with a versatile DNA transformation system. Background information and exemplary methods and media for growing, testing an d preserving yeast in general and S.
  • an existing system may be modified by integrating yEGFP as at least one of the reporters whose expression is driven by the transcription factor that is activated upon protein-protein interacting pairs.
  • yEGFP as at least one of the reporters whose expression is driven by the transcription factor that is activated upon protein-protein interacting pairs.
  • many other Y2H systems may be similarly improved by introducing yEGFP into the yeast reporter strain genome, as will be appreciated by those skilled in the art.
  • transcription factors useful in yeast two-hybrid systems have been described and/or are commercially available, including without limitation GAL4, GCN4, ARD1 , the human estrogen receptor, E. coli LexA and B42 proteins, herpes simplex virus VP16, NF-kB p65, and the like.
  • hybrid transcriptional activators composed of a DNA binding domain from one transcriptional activator and an activation domain from another transcriptional activator are also known.
  • transcription suppressors examples include the Kruppel protein, the engrailed protein, the knirps protein, the paired protein and the even-skipped protein, all from Drosophila; the SIN3, GAL80, and TUP1 proteins, all from Saccharomyces cerevisiae; the tet repressor; the EgM , WT1 , RARa, KRAB, verbA, YY1 , ADE1 B, E4B4, SCIP, kid-1 , Znf2, and kox-1 proteins; and the like.
  • the corresponding transcriptional elements specifically interacting with the transcriptional activators or repressors are well known in the art (see, for example, Hanna-Rose and Hansen, 1996, Trends. Genet., 12:229-234).
  • fluorescent proteins are known and are suitable for use as a fluorescent protein marker/reporter for enabling cell sorting.
  • Fluorescent proteins such as the prototypic the Green Fluorescent Protein isolated from Aequorea victoria (GFP), generally share a common tertiary structure comprising an 11 -stranded beta-barrel structure surrounding a centrally-located self-activating chromophore.
  • GFP Green Fluorescent Protein isolated from Aequorea victoria
  • GFP Green Fluorescent Protein isolated from Aequorea victoria
  • GFP Green Fluorescent Protein isolated from Aequorea victoria
  • GFP Green Fluorescent Protein isolated from Aequorea victoria
  • GFP Green Fluorescent Protein isolated from Aequorea victoria
  • GFP Green Fluorescent Protein isolated from Aequorea victoria
  • GFP Green Fluorescent Protein isolated from Aequorea victoria
  • GFP Green Fluorescent Protein isolated from Aequorea victori
  • the surface display and fluorescent protein reporters are one in the same. More specifically, the fluorescent protein reporter (e.g., yEFGP) is expressed on the surface of the yeast cell as a fusion protein with a protein capable of orienting the fluorescent protein on the cell surface using well known yeast surface display methodologies. Affinity enrichment may be conducted using, e.g., an antibody specific for yEGFP, and fluorescence measured by flow cytometry.
  • the fluorescent protein reporter e.g., yEFGP
  • Affinity enrichment may be conducted using, e.g., an antibody specific for yEGFP, and fluorescence measured by flow cytometry.
  • Additional/multiple reporters/selection markers may also be incorporated into the reporter strains, as is common in existing Y2H systems today.
  • a positive selection reporter such various nutrient selection reporters.
  • auxotrophic markers are common and include without limitation URA3, HIS3, TRP1 , LEU2, LYS2, ADE2, and the like.
  • the HIS3 gene encoding a protein required for histidine synthesis
  • the LEU2 gene encoding a protein required for leucine synthesis
  • URA3 gene encoding a protein required for uracil synthesis
  • the yeast host cells transformed with bait vector and/or prey vector are cultured in a medium lacking a particular nutrient. Only yeast cells transformed with bait and prey vectors that result in a positive interaction between the bait and prey fusion proteins will survive selection on media requiring the expression of the nutrient selector.
  • selection markers complement the host strains in which the bait and/or prey vectors are expressed - i.e., a yeast strain lacking the selection marker gene (or having mutation in the corresponding gene) is used as yeast reporter strain.
  • yeast strains and derivatives thereof corresponding to various selection markers are well known in the art and/or commercially available, many of which have been developed specifically for yeast two-hybrid systems.
  • the application and optional modification of such strains with respect to the present invention is well within the ordinary skill in the art.
  • selectable markers are not based on auxotrophies, but rather on resistance or sensitivity to an antibiotic or other xenobiotics. Examples include, but are not limited to, chloramphenicol acetyl transferase (CAT) gene, which confers resistance to chloramphenicol; CAN1 gene, which encodes an arginine permease and thereby renders cells sensitive to canavanine (see Sikorski et al., 1991 , Meth.
  • CAT chloramphenicol acetyl transferase
  • Selection markers may be used alone or in combination, as is well known in the art.
  • One or more selection markers can be included in a particular bait or prey vector.
  • the bait vector and prey vector may have the same or different selection markers.
  • the selection pressure can be placed on the transformed host cells either before or after mating the haploid yeast cells., including but not limited to.
  • Reporter proteins are preferably integrated into the yeast reporter strain chromosome, as in the specific embodiments described by way of the Examples, infra.
  • plasmid-based reporters may also be utilized.
  • expression vectors in which the reporter proteins are under the transcriptional control of the GaI 1 promoter may be used.
  • Vectors enabling PCR cloning of desired reporters into the vector are commercially available (i.e. pYM vectors, EUROSCARF, Frankfurt, Germany).
  • the bait and prey vectors may be introduced into the yeast cell by various means, including by co-transformation. Alternatively, these vectors may be introduced into two yeast cells having different mating types, which are subsequently mated.
  • the optimized interaction-mating protocol of Soellick and Uhrig is used (22) (see, also, Example 1, infra).
  • This method requires far fewer cells for magnetic separation (MACS), 1X10 9 versus 10 10 cells using a standard transformation approach. Introduction efficiency is also higher using this mating protocol versus standard transformation.
  • a highly flexible reporter cassette containing five reporter genes including yEGFP, surface displayed HA tag, HIS3, MEL1 and LacZ was constructed to allow simultaneous selection of conventional nutrient markers, surface display markers and yEGFP fluorescence markers in liquid cultures.
  • the results obtained showed that the sufficient surface display HA reporter expression can be triggered by positive bait and prey interactions (Fig.2A), and subsequently mediate an efficient enrichment of positive cells from large numbers of library cells via a simple immune-magnetic separation (Fig. 2B and Table 1).
  • the data shows that the sdHA-mediated enrichment was able to select positive cells with lower levels of marker expression than fluorescence-based analysis of yEGFP and or PE-anti-HA.
  • the surface display immune-magnetic selection lacks the quantitative features of the fluorescence selections, it is an extremely sensitive and efficient means to enrich interaction-positive cells.
  • the invention is adaptable to high-throughput format and can be used for large-scale cDNA screening for interacting proteins with high sensitivity and low signal: noise ratios.
  • the invention's Y2H assay/system offers convenient, quantitative and faster reporter analysis compatible with existing liquid handling robots, and also reduces labor requirements in screening cDNA libraries.
  • the invention's sdY2H system may be particularly useful in large scale library screening.
  • the sdY2H system's performance demonstrates that it is a simple yet powerful approach with single copy sensitivity for a typical human cDNA library (consisting of one million independent clones, with the target to background ratio of 1 :1 ,000,000).
  • the sensitivity of sdY2H screening is at least comparable with the classical Y2H plating method, if not better (as evidenced by the capability of recovering the spike T targets in Table 2).
  • T/p53 model system (Example 1) also demonstrated the superior specificity of the sdY2H system, almost all the positive candidates screened from the sdY2H approached are true positives (Table 2, as judged by the standard MEL1/ ⁇ -X-gal confirmation after the initial screening with SD-L-T-H plus sdHA enrichment) compared to a ⁇ 20% (7/38, Table 2) of positive rate using the conventional Y2H approach.
  • This superior specificity can be explained by simultaneous scoring of multiple reporters including the conventional nutrient marks, HIS3 as well as the sdHA and yEGFP reporter in the liquid cultures.
  • the kit includes the bait vector pGBKT7 (containing GAL4 DNA binding domain) and prey vector pGADT7 (containing GAL4 activation domain) along with the negative interaction control pGBKT7-Lam/pGADT7-T pair (Lam/T), and the positive interaction control pGBKT7-p53/pGADT7-T pair (p53/T).
  • the bait p53 is a mouse p53 gene segment encoding the amino acid residues from 72 to 390.
  • the prey T is the large T antigen of the SV40 virus.
  • a strong trigger of reporter gene expression, PCL1 plasmid encoding an intact Gal4 transcription factor was also included in the kit.
  • the yEGFP reporter cassettes and the toolbox for PCR based tagging kit were purchased from EUROSCARF (EUROpean Saccharomyces cerevisiae ARchive for Functional analysis).
  • EUROSCARF EUROpean Saccharomyces cerevisiae ARchive for Functional analysis.
  • the yeast surface display system based on ⁇ -agglutinin gene (14, 20) was constructed as follows. Firstly, two complementary oligos encoding the secretion signal of the glucoamylase precursor protein:
  • the amplified PCR products were digested with Sfi ⁇ and Hpa ⁇ and inserted into the corresponding sites of pYMN22S, resulting the pYM-N22S-Agg plasmid.
  • HA-F 5 1 AATTCTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCG GACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTGATS' [SEQ ID NO: 5]
  • encoding 3 repeats of HA antigen were synthesized, annealed and inserted into EcoR ⁇ IEcoFN sites of pYM-N22S-Agg plasmid, resulting the pYM-N22-YDC plasmid.
  • the resulting surface display DNA fragment cassette containing the GaM promoter, glucoamylase secretion signal, 3HA and the c-terminal of the ⁇ -agglutinin gene was further PCR amplified with two primers,
  • the Y2H recipient (host) strain of the Matchmaker system, S. cerevisiae AH109 has the genotypes of (MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4 ⁇ , gal80 ⁇ , LYS::GAL 1UAS-GAL1 T ATA-HIS3, GAL2 UA S-GAL2TATA-ADE2, URA3::MEL1 ⁇ AS -MEL1 TATA -lacZ).
  • the culturing of all yeast strains was performed using the standard protocol suggested by the manufacture. Nutrient selective plates were made with minimum synthetic medium SD (Clontech) supplemented with the amino acids of the appropriate Dropout Mixture (Clontech).
  • the protein-protein interaction assays were performed essentially according to the instruction manual provided by Clontech.
  • the yEGFP-AH109 cells were made by replacing the ADE2 coding region with the yEGFP gene in AH 109 cells (21).
  • the AH109-YDC cells were made by replacing the non-coding gene fragment downstream of MEL1 gene with the HA surface display cassette in pYM16-GaIYDC plasmid. Briefly, the HA surface display cassette, including the GaM promoter, 3HA and agglutinin gene, and the hygromycine resistance gene in pYM16-GaIYDC plasmid was amplified with two primers
  • the PCR products were cleaned with the Qiagen gel extraction kit and then transformed into the yEGFP-AH109 strains by standard LiAc/PEG method.
  • the hygromycine resistant colonies were selected on the YPD plates supplemented with 100 ⁇ g/ml G418 and 400 ⁇ g/ml Hygromycine. Three independent colonies were picked for further evaluation as the HA surface display reporter host.
  • the positive plasmid controls, p53/ T and PCL1/PGBKT7 pairs, and the negative control plasmid pair, Lam/ T were transformed into these three hygromycine resistant yeast hosts respectively and spread onto SD-L-T (SD medium lacking amino acids, Leucine and Tryptophan) plate supplemented with 100 ⁇ g/ml G418 and 100 ⁇ g/ml hygromycine.
  • SD-L-T SD medium lacking amino acids, Leucine and Tryptophan
  • the transformants were stained with PE (phycoerythrin)-conjugated anti-HA antibody and yeast cell fluorescence measured by flow cytometry as described below.
  • the candidates that generated the highest PE signals upon the triggering of PCL1 and p53/T positive controls were picked and named AH109-YDC.
  • the chromosomal integration of the HA display cassette gene fragment was further confirmed by PCR and sequencing.
  • AH 109-YDC cells were evaluated upon activation by two positive triggers (PCL1 , p53/ T) and a negative trigger (Lam/ T). After the transformants grew up on the SD-L-T plates, 3 individual colonies were picked into SD-L-T liquid media and grew over night.
  • the AH109-YDC reporter yeast host cells carrying various bait and prey pairs were grown on SD-T-L+G418+Hyg selective medium to ensure all the yeast cells were under the same growth and selection conditions.
  • the yeast cells were harvested, washed once with the incubation buffer (PBS/0.5%BSA), resuspended in 250 ⁇ l incubation buffer plus 1 ⁇ g mouse PE-conjugated HA antibody (Santa Cruz), and incubated on ice for 30 minutes.
  • the stained cells were washed once with the incubation buffer and the PE and yEGFP fluorescent signals were measured using a FACSCalibur flow cytometer (Becton Dickson, San Jose, CA ⁇ USA).
  • the instrument settings were as follows: Log forward scatter (FSC) E00; Log side scatter (SSC) at 299V; Log FL1 fluorescence at 600 V; Log FL2 fluorescence at 580 V. Both the PE and the yEGFP reporter were excited at 488nm.
  • the PE fluorescence was collected through 585/42nm bandpass filter on the FL2 channel and the yEGFP fluorescence was collected through 530/30nm bandpass filter on the FL1 channel.
  • the yeast singlet cell population was gated on FSC and SSC.
  • the typical sampling rate was 12 ⁇ l/min ( ⁇ 200 cell/second) and the typical sample size was 10,000 cells per measurement unless otherwise stated.
  • the data were analyzed with WinMDI 2.8 software (Joseph Trotter/The Scripps Research Institute).
  • MACS buffer PBS/0.5%BSA/2mM EDTA
  • the stained cells were washed twice with MACS buffer, resuspended in 70 ⁇ l MACS buffer supplemented with Goat anti-mouse IgG microbeads (Miltenyi Biotech, 20 ⁇ l beads per 10 7 cells) and incubated for 15 minutes at 4 degree.
  • the stained cells were washed once with MACS buffer and resuspended in MACS buffer (500 ⁇ l per 10 8 cells).
  • the 500 ⁇ l cells were loaded onto the pre-equilibrated MS column and washed three times with MACS buffer. Then the column was removed from the magnetic stand apparatus, and the cells were eluted with 1 ml MACS buffer. The eluted cells were either analyzed directly by flow cytometry or spread onto the plates containing selective media.
  • a set of cDNA library samples was prepared by spiking 10000, 1000, 100 Y187/T (prey target) into a pre-transformed human HeIa cell cDNA library in Y187 (10 8 cfu, Clontech).
  • Bait protein p53 containing cells ( ⁇ 3x10 8 AH109- YDC-p53) were mated with the prey library cells according to the protocol described by Soellick and Uhrig (22). After mating, an aliquot of mating mixture was taken and spread onto SD-L-T plates to determine the mating efficiency.
  • the rest of mating mixtures was split into two parts, one was used to carry out the conventional plating- based screening by spreading the cells onto fifteen 15cm SD-L-T-H (SD medium lacking amino acids, Leucine, Tryptophan and Histidine) plates (P), and the other was used to perform sdY2H screening by growing the cells in SD-L-T-H liquid medium for 24hrs before the magnetic enrichment.
  • SD-L-T-H SD medium lacking amino acids, Leucine, Tryptophan and Histidine
  • the captured cells were eluted with 5ml PBS buffer, and then split into two 2.5 ml aliquots with one being spread onto the SD-L-T-H plates to obtain single colonies (M+P), the other one being sorted (FACSAria, Becton Dickson, San Jose, CA, USA) according to yEGFP fluorescence and subsequently plated onto the SD-L-T-H plates (M+F+P).
  • M+P single colonies
  • F+F+P yEGFP fluorescence
  • the sd-L-T-H positive colonies (after a 3-day growth period) were picked onto a master plate, and then replicated onto MEL1/ ⁇ -X- gal plates to determine the real Y2H positive cells.
  • the positive clones were further confirmed with the sequence analysis using either colony PCR test or Sanger sequencing described below. Sequence analysis by colony PCR and Sanger sequencing: T antigen specific PCR test was designed with the amplification primers,
  • a surface display affinity tag in this example, HA
  • HA surface display affinity tag
  • the reporter cassette containing the GaM promoter, glucoamylase secretion signal, 3HA and the c-terminal of ⁇ -agglutinin gene was constructed (14, 20) as described, supra.
  • the surface display reporter cassette along with a hygromycine resistance gene were integrated into the yEGFP-AH109 strains resulting AH109-YDC, which has five reporter genes including yEGFP, sdHA, HIS3, MEL1 and LacZ.
  • HA surface expression in sdY2H system To evaluate if surface HA reporter could be co-expressed with the yEGFP reporter in the sdY2H system, a positive interaction control, p53/T, was employed to trigger yEGFP/HA expression.
  • Surface HAs were labeled with PE conjugated HA antibodies, and yEGFP and PE fluorescence measured by flow cytometry (Fig.2A).
  • ⁇ 17% cells are doubly positive for PE/yEGFP demonstrating the co-expression of dual HA and yEGFP reporters of the sdY2H system.
  • not all of the positive control cells are positive for the reporter markers. This may reflect a cell cycle-dependence of bait, prey, and reporter expression that is not visible in plate-based growth selection over multiple generations.
  • the sdHA reporter-mediated immune-magnetic affinity enrichment To demonstrate the enrichment by HA-mediated magnetic separation, ⁇ 10 7 AH109-YDC cells expressing p53/T or Lam/T control interaction pairs were prepared, labeled with HA- antibody, and the cell mixture applied to magnetic separation column. Recovery efficiency was determined by counting the cells before and after the magnetic separation. The cell count study revealed a recovery of 56.1 % for p53/T positive control cells (compared to a background of 0.17% for Lam/T negative control).
  • Flow cytometry analysis for yEGFP on the enriched p53/T cell population showed that 82% of cells are yEGFP-positive (Fig 2B) 1 indicating that some enriched sdHA cells are not detectable by a threshold-based analysis (% positive) of yEGFP fluorescence.
  • % positive a threshold-based analysis of yEGFP fluorescence.
  • the recovery efficiency was determined by the ratio of the cell counts before and after magnetic separation.
  • the recovery efficiencies were 2.6%, 8.4%, 42.7% and 43.4% at 16, 20, 24 and 40 hrs, respectively, with the plateau at 24 hr time point.
  • Further yEGFP fluorescence analysis on enriched cell population also showed that the 24-hour growth dramatically enriched yEGFP positive cells yielding to 27.5% positive rate (Fig. 3).
  • Fig. 3 The recovery efficiency showed that a 24-hour post-mating cell growth was optimal for HA surface expression-mediated magnetic enrichment of p53/T positive cells. This 24-hour time point was used for the cDNA library screening described immediately following.
  • Human cDNA library screening using the sdY2H system To demonstrate the utility of the new sdY2H approach, the p53/T interaction complex from a human HeIa cDNA library cells were screened. Pre-transformed human HeIa cDNA library cells ( ⁇ 10 8 live cells) containing different T target/library cell ratios of 1 :10,000, 1:100,000, and 1 :1 ,000,000 were prepared and used to mate with the p53 bait containing AH109-YDC cells respectively. To ensure a good statistical coverage of independent clones in a human cDNA library (which typically contains ⁇ 1 millions of independent clones), at least 5 million co-transformants were screened (Table 2, Row 2).
  • both sdY2H and the conventional Y2H approaches produced high 100% MEL1 positive rate suggesting the dominating growth of the cells containing p53/T interaction pairs.
  • PCBP1 poly(rC) binding protein 1
  • p53 amino acid residue 206-393
  • CKAP5 amino acid residues 1331-1972
  • p53 is known to form dimmers and tetramers, and the dimerization domains (amino acid residues 325-356) are highly conserved between the mouse and human p53 proteins (23).
  • the p53 dimer interaction identified from this screen is probably authentic.
  • the CKAP5 protein, cytoskeleton associated protein 5, was previously reported to be in the complex of TACC1-CKAP5-AuroraA, and the p53 is known to be a substrate of AuroraA suggesting the possible interaction of p53 and CKAP5 (24-26).
  • the identification of genes other than the spiked T targets further validated the sdY2H- mediated screening approach.
  • a library sample containing 1500 targets (AH109-YDC cells containing p53/T) and 10 9 background cells (AH109-YDC cells) was labeled with the HA antibody and subjected to the MACS separation procedure.
  • the cell count for the background and target cells was determined by spreading an aliquot of sample onto YPD and SD-L-T plates respectively.
  • the recovery efficiency was determined by the ratio of the target cell count before and after the MACS separation.
  • the depletion efficiency was determined by the ratio of the background cell count before and after MACS separation.
  • Target/library cell ratio 1 :10,000 1 :100,000 1 :1 ,000,000
  • the comparison of the conventional Y2H and the new sdY2H library screening was performed on a set of human HeIa cDNA library samples containing different T antigen target to background ratios of 1 :10,000, 1 :100,000 and 1 : 1 ,000,000. Briefly, 100, 1000, 10000 T target cells were spiked into a pretransformed library cells ( ⁇ 10 8 cfu). After mating with the AH 109- YDC cells containing p53 bait, an aliquot of cells was spread onto the SD-L-T plates for calculating the mating efficiency and the total transformants (Row 2).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Virology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne un système à double hybride en levure basé sur un affichage en surface (sdY2H) pour le criblage rapide et à grande échelle de l'interactome de protéines de bibliothèques d'ADNc. Le système sdY2H fait appel à une combinaison de marqueurs d'affichage en surface, à une conjugaison de levure hautement efficace donnant des efficacités élevées de transformation et un enrichissement de cellules positives au moyen d'une purification robuste par affinité immunomagnétique. De plus, le système de l'invention peut être combiné avec des marqueurs de fluorescence multiparamétrés aux fins d'analyse/triage par fluorescence quantitatifs, ce qui permet de réduire sensiblement le nombre de faux positifs. Dans certains modes de réalisation, le système utilise des cultures liquides, et non des cultures sur plaques, avec pour résultat un raccourcissement notable des temps de culture cellulaire permettant de réduire sensiblement la fluorescence de fond et permet de mieux distinguer les cellules positives.
PCT/US2009/000046 2008-01-03 2009-01-05 Système de criblage par double hybride en levure basé sur un affichage en surface WO2009088994A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US1008508P 2008-01-03 2008-01-03
US61/010,085 2008-01-03

Publications (1)

Publication Number Publication Date
WO2009088994A1 true WO2009088994A1 (fr) 2009-07-16

Family

ID=40853400

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2009/000043 WO2009088991A2 (fr) 2008-01-03 2009-01-05 Système de criblage par double hybride en levure à base gfp avec cytométrie de flux
PCT/US2009/000046 WO2009088994A1 (fr) 2008-01-03 2009-01-05 Système de criblage par double hybride en levure basé sur un affichage en surface

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/US2009/000043 WO2009088991A2 (fr) 2008-01-03 2009-01-05 Système de criblage par double hybride en levure à base gfp avec cytométrie de flux

Country Status (1)

Country Link
WO (2) WO2009088991A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102590528A (zh) * 2012-01-18 2012-07-18 厦门大学 一种蛋白相互作用的检测方法

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5695946A (en) * 1991-02-14 1997-12-09 Vicam, Lp Assay method for detecting presence of bacteria
WO2006026712A2 (fr) * 2004-08-31 2006-03-09 Fox Chase Cancer Center Systeme double hybride de levure/bacterie et leurs procedes d'utilisation

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002064834A1 (fr) * 2001-01-04 2002-08-22 Myriad Genetics, Inc. Nouveau systeme bi-hybride et utilisation associee
FR2867783B1 (fr) * 2004-03-16 2008-02-01 Cytomics Systems Procede de criblage d'agent modulant l'ubiquitination de la proteine ikbalpha et moyens destines a la mise en oeuvre dudit procede

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5695946A (en) * 1991-02-14 1997-12-09 Vicam, Lp Assay method for detecting presence of bacteria
WO2006026712A2 (fr) * 2004-08-31 2006-03-09 Fox Chase Cancer Center Systeme double hybride de levure/bacterie et leurs procedes d'utilisation

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HUMPHREY ET AL.: "Human BRCA1 inhibits growth in yeast. Potential use in diagnostic testing", PROC. NATL. ACAD. SCI., vol. 94, May 1997 (1997-05-01), pages 5820 - 5825 *
SOELLICK ET AL.: "Development of an optimized interaction-mating protocol for large-scale yeast two-hybrid analyses", GENOME BIOLOGY, vol. 2, no. 12, 15 November 2001 (2001-11-15), pages 1 - 7 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102590528A (zh) * 2012-01-18 2012-07-18 厦门大学 一种蛋白相互作用的检测方法

Also Published As

Publication number Publication date
WO2009088991A3 (fr) 2009-12-30
WO2009088991A2 (fr) 2009-07-16

Similar Documents

Publication Publication Date Title
US7393318B2 (en) Methods and compositions for interaction trap assays
Walhout et al. High-throughput yeast two-hybrid assays for large-scale protein interaction mapping
US6132963A (en) Interaction trap systems for analysis of protein networks
EP1668114A2 (fr) Bibliotheques d'affichage de polypeptides et procede de fabrication et d'utilisation de celle-ci
JP2007523647A (ja) 細胞ディスプレイライブラリー
JP7419248B2 (ja) ペリプラズム空間中におけるタンパク質の酵母ディスプレイ
Vidal The reverse two-hybrid system
US7297491B2 (en) Methods and compositions for interaction trap assays
Lauer et al. Context-dependent neocentromere activity in synthetic yeast chromosome VIII
Zhang et al. [5] Yeast three-hybrid system to detect and analyze interactions between RNA and protein
EP2190989B1 (fr) Procédé de fabrication d'un peptide modifié
Chen et al. A surface display yeast two-hybrid screening system for high-throughput protein interactome mapping
Chen et al. A yEGFP‐based reporter system for high‐throughput yeast two‐hybrid assay by flow cytometry
WO2009088994A1 (fr) Système de criblage par double hybride en levure basé sur un affichage en surface
JP2022515545A (ja) 標的タンパク質への検出可能なタグのＣＲＩＳＰＲ／Ｃａｓ制御組み込みに基づく細胞の選択方法
WO2015163745A1 (fr) Souche de levure possédant un système à double rapporteur pour essai de migration à code-barres
Abedi et al. Transcriptional transactivation by selected short random peptides attached to lexA-GFP fusion proteins
Zhang et al. [27] Yeast three-hybrid system to detect and analyze RNA-protein interactions
Clarke et al. Novel mobilizable prokaryotic two-hybrid system vectors for high-throughput protein interaction mapping in Escherichia coli by bacterial conjugation
WO2000029565A1 (fr) Methodes de validation de polypeptides cibles se rapportant a des phenotypes cellulaires
Maeder et al. 4 A Guided Tour to PCR-based Genomic Manipulations of S. cerevisiae (PCR-targeting)
WO2023147073A1 (fr) Comptage numérique des événements de fusion cellulaire à l'aide de codes-barres d'adn
Kruse et al. Protein‐protein interaction screening with the Ras‐recruitment system
KR20150124383A (ko) 라이브러리-라이브러리 간 단백질-단백질 결합 동시 분석 방법
WO2007119165A2 (fr) Procédé de détection d'interactions entre protéines à l'intérieur du cytoplasme

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09700818

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09700818

Country of ref document: EP

Kind code of ref document: A1