WO2009065080A1 - Compositions and method for manipulating pim-1 activity in circulatory system cells - Google Patents
Compositions and method for manipulating pim-1 activity in circulatory system cells Download PDFInfo
- Publication number
- WO2009065080A1 WO2009065080A1 PCT/US2008/083693 US2008083693W WO2009065080A1 WO 2009065080 A1 WO2009065080 A1 WO 2009065080A1 US 2008083693 W US2008083693 W US 2008083693W WO 2009065080 A1 WO2009065080 A1 WO 2009065080A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- pim
- cell
- cardiac
- tissue
- heart
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/45—Transferases (2)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/11—Protein-serine/threonine kinases (2.7.11)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/12—Dual-specificity kinases (2.7.12)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
- A61K2035/124—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells the cells being hematopoietic, bone marrow derived or blood cells
Definitions
- This invention was produced in part using funds from the Federal government under one or more of the following grants 5R01HL067245, 1R01HL091102, 1P01HL085577, and IPOl AG023071, all from the National Institutes of Health. Accordingly, the Federal government has certain rights in this invention.
- compositions comprising nucleic acids encoding the serine/threonine kinase PIM-I (and related PIM enzymes), and medical uses and methods relating to alteration of PIM availability or availability in cardiac or vascular system cells or tissues; including inducing or enhancing differentiation, implantation, survival, and function of stem cells, progenitor cells, or adult cells in a cardiac or vascular tissue or environment.
- compositions comprising nucleic acids encoding PIM, and methods for enhancing the regenerative potential of stem cells and progenitor cells in a vascular or cardiac environment.
- Intracellular molecular signaling networks communicate via kinases that phosphorylate target substrates to regulate critical aspects of growth and survival.
- PIM-I a proto-oncogenic serine/threonine kinase
- PIM-I is up-regulated in prostate cancer. The gene is highly expressed in the liver and spleen during fetal hematopoiesis and primarily in B-lymphoid and myeloid cell lines.
- PIM-I exists in two isoforms with molecular weights of 34 and 44kDa. The 34kDa isoform is cytosolic and nuclear localized, while the 44kDa isoform was recently found to be membrane bound.
- PIM-I may be a relatively promiscuous kinase based upon minimal target substrate recognition sequence requirements and capacity for autophosphorylation. Two additional family members, PIM-2 and PIM-3, may exhibit functional redundancy with PIM-I .
- PIM-I expression is mediated by cytokines and growth factors including LIF, GM-CSF, EGF, and most interleukins, consistent with a role for PIM-I in proliferation and survival of hematopoeitic cells.
- cytokines and growth factors including LIF, GM-CSF, EGF, and most interleukins, consistent with a role for PIM-I in proliferation and survival of hematopoeitic cells.
- PIM-I mediates proliferative actions through phosphorylation of multiple target substrates, resulting in cell cycle transition, as well as protective effects via phosphorylation of multiple targets.
- Induction of PIM-I expression has been linked to AKT (a serine/threonine kinase) in hematopoeitic cells.
- AKT a serine/threonine kinase
- compositions such as pharmaceutical compositions, comprising nucleic acids encoding a serine/threonine kinase PIM, and methods for making and using them; including methods for inducing cardiac or vascular cellular proliferation, and protecting cardiac or vascular cells from hypoxia and cellular apoptosis.
- the compositions and methods of the invention are used to express PIM-I (e.g., by upregulating PIM kinase expression and/or activity) to protect cardiomyocytes from hypertrophy and inhibit myocardial apoptosis induced by infarction, reducing infarct size.
- compositions and methods of the invention are used to express PIM to induce cardiac or vascular cellular dedifferentiation and re-expression of stem cell markers; and in one aspect, to overexpress PIM to enhance the regenerative potential of stem cells, including stem cell ability to engraft in the heart after a myocardial infarction (post-MI).
- post-MI myocardial infarction
- One aspect of the disclosure relates to a method, comprising identifying a patient in need of enhanced PIM activity in a vascular system tissue, and enhancing levels of PIM in vascular system tissue of the patient to alter a functional characteristic of cells in that tissue.
- the patient has experienced cardiac injury and the enhanced PIM levels facilitate cardiac regeneration to repair that injury.
- the enhancing step may advantageously comprise enhancing endogenous production of PIM in the vascular system tissue.
- it may comprise administering to the patient an exogenous PIM.
- the exogenous PIM may comprise PIM-I, for example, or another material sharing that same function, and may comprise a PIM enzyme in association with a cellular delivery moiety, such as a translocation domain that is attached to the PIM enzyme.
- the enhancing step comprises administering cells to the patient that produce enhanced levels of PIM.
- the administered cells may be stem cells or vascular system progenitor cells.
- the administered cells comprise a PIM-encoding polynucleotide operatively linked to a non-PIM promoter.
- the enhancing step comprises administering cells to vascular tissue of the patient, and expressing enhanced levels of PIM from the administered cells.
- a different embodiment comprises PIM-delivering or enhancing material for treatment of vascular system disease or injury.
- This material can be, for example, a PIM enzyme linked to a cellular delivery agent, or a cell for introduction into a human or animal, wherein the cell has been altered to permit enhanced production of PIM.
- the cell is a progenitor cell or a stem cell, and the alteration comprises a PIM-encoding polynucleotide under control of a non-PIM promoter.
- the promoter may be a cardiac-specific promoter, an inducible promoter, an endogenous promoter, an exogenous promoter, or a constituitive promoter.
- the PIM-enhancer may be an inducer of endogenous PIM expression.
- Yet another embodiment is use of a PIM-delivering or enhancing material in the preparation of a medicament for treating vascular system disease or injury.
- Still another embodiment is a composition, comprising a vascular system cell or a cell that is differentiatable into a vascular system cell, where the cell comprises a PIM-encoding polynucleotide sequence operably linked to a non-PIM promoter.
- the cell may be, for example, a stem cell or cardiac progenitor cell.
- stem cells include mesenchymal stem cells, cardiac stem cells, adipose-derived stem cells, embryonic stem cells, and hematopoietic stem cells.
- the promoter is an inducible promoter or a cardiac-specific promoter.
- Yet another embodiment is a method for treating cardiac disease or injury, comprising enhancing levels of PIM within diseased or injured cardiac tissue.
- the cardiac disease or injury may include ischemic injury, hypoxic injury, myocardial infarction, traumatic cardiac injury, cardiac hypertrophy, overpressure injury, congestive heart failure, apoptosis-inducing injury or disease, bacterial infection, viral infection, and conditions that create an enhanced risk of any of the foregoing.
- the expression construct or expression vehicle comprises or consists of a vector, a plasmid, a recombinant virus or an artificial chromosome;
- the pharmaceutical composition of (c), wherein the expression construct or expression vehicle comprises or consists of a recombinant adeno-associated viral vector; an adenovirus vector, a retroviral vector; or a lentiviral vector;
- HAV human immunodeficiency virus
- Still other embodiments include uses of a pharmaceutical compound of the invention, a liposome of the invention, or a nanoparticle of the invention, for the manufacture of a medicament for:
- a cardiac or vascular cell, tissue or organ is or is contained in: a heart cell (a myocyte), a heart tissue or a heart or other organ;
- the cell is a stem cell, an adult stem cell, a hematopoietic stem cell, an adipose-derived stem cell, a mesenchymal stem cell, a c-kit + stem cell, a human stem cell, an autologous or allogeneic stem cell, an embryonic cell, a tissue- specific resident stem cell, an allogeneic or autologous cell, a progenitor cell, a placental and/or cord blood cell, a Sca-1+ cell, or a CD34+ cell; or
- the PIM-I encoding nucleic acid comprises or consists of a human PIM-I encoding nucleic acid, or a human PIM-I encoding message (mRNA), or a human PIM-I gene, or a human PIM-I gene locus;
- the cell is a human cell, a stem cell, an adult stem cell, a hematopoietic stem cell, an adipose-derived stem cell, a mesenchymal stem cell, a c- kit + stem cell, a human stem cell, an autologous or allogeneic stem cell, an embryonic cell, a tissue-specific resident stem cell, an allogeneic or autologous cell, a progenitor cell, a placental and/or cord blood cell, a Sca-1+ cell, or a CD34+ cell;
- the expression construct or expression vehicle comprises or consists of a recombinant adeno-associated viral vector; an adenovirus vector, a retroviral vector; or a lentiviral vector; (i) the method of any of (h), wherein the expression construct or expression vehicle comprises or consists of an immunodeficiency virus derived vector;
- the immunodeficiency virus derived vector comprises or consists of a human immunodeficiency virus (HIV) derived vector
- the human immunodeficiency virus (HIV) derived vector comprises or consists of a human immunodeficiency virus- 1 (HIV-I) derived vector;
- the compound that induces or upregulates PIM-I nucleic acid or a PIM-I kinase activity in a cardiac or vascular cell, tissue or organ comprises: an interleukin, a cytokine and/or a paracrine factor involved in survival and/or proliferative signaling; an up-regulator of AKT serine/threonine kinase; insulin-like growth factor- 1 (IGF-I); insulin; leukemia inhibitory factor (LIF); granulocyte-macrophage colony- stimulating factor (GM-CSF); or epidermal growth factor (EGF);
- an interleukin a cytokine and/or a paracrine factor involved in survival and/or proliferative signaling
- an up-regulator of AKT serine/threonine kinase insulin-like growth factor- 1 (IGF-I); insulin; leukemia inhibitory factor (LIF); granulocyte-macrophage colony- stimulating factor
- Still other aspects include methods for treating, preventing or ameliorating a disease or condition comprising administering to an individual in need thereof a pharmaceutical compound of the invention, a liposome of the invention, or a nanoparticle of the invention, or any combination thereof, wherein the treatment, prevention and/or amelioration of the disease or condition comprises:
- the cell is a stem cell, an adult stem cell, a hematopoietic stem cell, an adipose-derived stem cell, a mesenchymal stem cell, a c-kit + stem cell, a human stem cell, an autologous or allogeneic stem cell, an embryonic cell, a tissue- specific resident stem cell, an allogeneic or autologous cell, a progenitor cell, a placental and/or cord blood cell, a Sca-1+ cell, or a CD34+ cell.
- Figure 1 illustrates immunoblots demonstrating that cardioprotective stimuli induces Pim-1 expression, as described in detail in Example 2, below.
- Figure 2 illustrates confocal micrographs showing that cardiomyopathic stimuli induce
- Pim-1 expression in surviving myocardium a widefield view is shown in the micrographs of the upper row, with selected regions is shown in higher magnification to reveal cellular detail is shown in the micrographs of the lower row, as described in detail in Example 2, below.
- Figure 3 graphically illustrates data showing that Pim-1 preserves hemodynamic function in ischemia-reperfusion injury, as described in detail in Example 2, below.
- Figure 4 illustrates immunoblots demonstrating Pim-1 expression is highest in postnatal hearts and decreases with age, as described in detail in Example 2, below.
- Figure 5 illustrates immunoblots demonstrating Pim-1 expression in cardiomyocytes from recombinant adenoviral vectors, as described in detail in Example 2, below.
- Figures 6 and 7 show how Pim-1 inhibits apoptosis in cardiomyocytes:
- Figure 6 graphically summarizes that non-infected cells (NI) or GFP-expressing cells show comparable TUNEL labeling following doxorubicin treatment, whereas Pimwt expressing cells show significant reductions of TUNEL positive nuclei (p ⁇ 0.05);
- Figure 7 illustrates a micrograph demonstrating that cells expressing the DN construct show enhanced TUNEL labeling; while Figure 6 shows quantitative results, the Figure 7 panels illustrate representative fields of infected cardiomyocytes showing GFP fluorescence (green) overlay with actin filaments revealed by phalloidin (red) in GFP only, GFP-Pim-wt and GFP-Pim-DN samples, as described in detail in Example 2, below.
- Figures 8 A and 8B illustrate that nuclear accumulation of Akt induces expression of Pim-1 kinase in the myocardium: Immunoblot (Figure 8A) and confocal microscopy (Figure 8B) of sections from 6 month old normal (NTG) and transgenic mice expressing cardiac-specific nuclear-targeted Akt; a separated grayscale images in scans correspond to pim-1, actin, and nuclei that correspond to the overlay colors of green, red, and blue respectively, as described in detail in Example 2, below.
- Figure 9 illustrates that nuclear accumulation of Akt induces Pim-1 expression:
- Figure 9(A) illustrates a confocal microscopy of cultured cardiomyocytes infected with adenoviruses expressing nuclear-targeted ⁇ -galactosidase (B-gal), Akt wild-type (Akt wt), or nuclear targeted Akt (Akt-nuc) detected with myc-tag antibody (Tag);
- Figure 9(B) illustrates an immunoblot blot showing increased Pim-1 expression in cardiomyocyte cells infected with adenovirus encoding nuclear-targeted Akt (Akt-nuc), as described in detail in Example 2, below.
- Figure 10 illustrates an immunoblot blot showing expression of dominant negative Pim-1 prompts Akt accumulation in cardiomyocytes; immunoblot shows infection of neonatal rat cardiomyocytes with adenoviruses expressing Pim-1 in either wild type (wt) or dominant- negative (DN) forms, as described in detail in Example 2, below.
- wt wild type
- DN dominant- negative
- Figure 11 illustrates data characterizing founder lines and protein expression in Pim-1 transgenic mice:
- Figure 11 left panel illustrates a PCR of genomic DNA samples from Pim-1 transgenic mice, and
- Figure 11 right panel illustrates an immunoblot of cardiac lysates, as described in detail in Example 2, below.
- Figure 12 graphically illustrates data showing that inactivation of Pim-1 in the myocardium increases apoptosis and fibrosis:
- Figure 12a and Figure 12b graphically illustrate echocardio graphic measurement of posterior (12a) and anterior (12b) wall dimension (PWD and AWD respectively) in NTG and Pim-DN animals at two week intervals;
- Figure 12c graphically illustrates heart weight to body weight ratios in NTG and Pim-DN animals at 10 and 22 weeks of age;
- Figure 12d graphically illustrates histogram data representing counts of TUNEL positive myocytes per mm 2 in 17-22 week old NTG and Pim-DN transgenics, as described in detail in Example 3, below.
- Figure 13 shows individual cell surface area measurements from uninfected control, EGFP, and Pim-wt infected neonatal rat cardiomyocyte cultures treated and untreated with endothelin-1, as described in detail in Example 3, below.
- Figure 14 graphically illustrates data showing Pim-wt transgenic animals are resistant to pressure overload induced hypertrophy:
- Figures 14a to 14f illustrate line graphs representing weekly echo-cardiographic assessment of NTG and Pim-wt sham and TAC banded hearts for anterior wall dimension (AWD 14d, 14a), posterior wall dimension (PWD 14d, 14b), end diastolic dimension (EDD, 14c), end-systolic dimension (ESD, 14d), percent fractional shortening (FS, 14e), and ejection fraction (EF, 14f), as described in detail in Example 3, below.
- ATD 14d, 14a anterior wall dimension
- PWD 14d, 14b posterior wall dimension
- ESD end diastolic dimension
- ESD end-systolic dimension
- FS percent fractional shortening
- EF ejection fraction
- Figure 15 graphically illustrates data showing that Pim-1 enhances cardiac function:
- Figure 15a, Figure 15b and Figure Ic show in vivo hemodynamic assessment of NTG and Pim- wt hearts 4 and 10 weeks after sham or TAC operation, as described in detail in Example 3, below.
- Figure 16 graphically illustrates data demonstrating that Pim-1 protects against infarction injury:
- Figure 16a graphically illustrates a histogram representing infarct size 7 days post-MI as a percent of left-ventricular free wall in Pim-KO hearts;
- Figure 16b graphically illustrates data showing the number of TUNEL positive myocytes per mm 2 7 days post-MI in Pim-KO hearts;
- Figure 16c graphically illustrates in vivo hemodynamic measurements of NTG and Pim-KO mice 5 days following MI;
- Figure 16e graphically illustrates immunoblot quantitation of survival protein levels 7 days post-infarction in Pim-KO and NTG control hearts;
- Figure 16f graphically illustrates infarct size measurements 10 days post-infarction;
- Figure 16g graphically illustrates the number of TUNEL-labeled CM/m2 in LV 10 days after MI, as described in detail in Example 3, below.
- Figure 17 illustrates data showing increased proliferative rate of Pim-1 engineered CSCs:
- Figure 17A illustrates a cell growth assessment using trypan blue assay of control, CGW, and CGW-Pim-wt transduced CPCs;
- Figure 17B illustrates an MTT assay on control, CGW, CGW- Pirn- wt transduced CPCs;
- Figure 17C illustrates the proliferation rate of Pim-1 expressing CPCs treated with or without lOuM of Quercetagentin, a specific Pim-1 activity inhibitor, as described in detail in Example 4, below.
- Figure 18 graphically illustrates data showing that intra-myocardial injection of Pim-1 expressing CPCs improves cardiac function:
- Figures 18A-C graphically illustrate electrocardiographic assessment of AWD ( Figure 18A), EF ( Figure 18B), and FS ( Figure 18C), in sham ( ⁇ ), PBS injected (•), CGW (A), and CGW-Pim-WT ( ⁇ ) cardiac progenitor cells;
- Figure 18 D-F graphically illustrates in vivo hemodynamic measurements of left ventricular developed pressure (LVDP) (Figure 18D), left ventricular end diastolic pressure (LVEDP) ( Figure 18E), and dP/dT maximum and minimum (Figure 18F) were used to assess cardiac function 12 weeks post-intramyocardial injection of PBS, eGFP, and Pim-1 expressing CPCs, as described in detail in Example 4, below.
- LVDP left ventricular developed pressure
- LVEDP left ventricular end diastolic pressure
- Figure 18F dP/d
- Figure 19 graphically illustrates data showing that CGW-Pim-wt CPCs form myocytes and vasculature in infarcted heart tissue reducing infarction area; and shows a quantitation of infarction area 12 weeks post CPC injection, as described in detail in Example 4, below.
- Figure 20 graphically illustrates that long term cardiac functional recovery is afforded by
- Figure 20A-C illustrates electrocardiographic assessment of FS ( Figure 20A), EF ( Figure 20B), and AWD ( Figure 20C), in sham ( ⁇ ), PBS injected (•), CGW (A), and CGW-Pim-WT ( ⁇ ) cardiac progenitor cells 32 weeks post CPC transplantation, as described in detail in Example 4, below.
- Figure 21 illustrates an exemplary lenti viral constructs of the invention, as described in detail in Example 4, below.
- the present disclosure includes the discovery of new roles for PIM-I, its isoforms, and other PIM enzymes having equivalent or overlapping targets and substrates. Specifically, these enzymes have a role in cardiac and other circulatory system protection, survival, repair, regeneration, and recovery, and in the implantation, differentiation, function, and survival of stem cells, progenitor cells, or differentiated cells introduced into circulatory system tissues. These discoveries form the basis for new cardiac therapies, including repair of damaged heart tissue and implantation, expansion, and survival of implanted stem cells or progenitor cells that differentiate into functional heart tissue. Prior to this invention, enhancement of PIM activity was not known to have any prophylactic or therapeutic utility in heart tissue, heart cells, or in other circulatory system cells or tissues.
- PIM serine or threonine kinase
- PIM-I serine/threonine kinase
- PIM-2 PIM-2
- PIM-3 PIM-3
- PIM-I serine/threonine kinase
- PIM-I is known to exist in two isoforms
- references to PIM and PIM-I herein are intended to encompass both isoforms, unless otherwise specified.
- certain cells, constructs, polynucleotides, techniques, uses, and methods are described in connection with one particular PIM, such as PIM-I, such descriptions are exemplary, and should be taken as also including the other PIM enzymes having similar activity.
- PIM activity and "PIM kinase activity” refer to the enzymatic or physiological activity of the PIM enzymes, e.g., the activity of a PIM-I, and encompasses use of other materials having similar activity.
- the discoveries set forth herein relate to altering characteristics of living cells by enhancing a particular kinase activity in the cells.
- enzyme variants exist or can be readily constructed, having conservative amino acid substitutions, cross-linking, cross-species domain substitutions, truncations, and the like, while preserving a physiologically-effective level of enzymatic activity (in this case, kinase activity for the PIM-I target).
- vascular system is used herein to refer to the blood vessels and the heart, and all the tissues and cells of which they are comprised, including cardiac smooth muscle, cardiomyocytes, cardiomyoblasts, vascular wall , endothelium, vascular smooth muscle, vascular connective tissue, and other known cells and tissues of the vascular system.
- stem cell is used broadly to include totipotent, pluripotent, and multipotent cells that can differentiate into vascular system cells, including cardiac cells.
- Progenitor cells overlaps somewhat with multipotent stem cells, and includes cells that are at least partially differentiated but that are multipotent or unipotent, in that they have the ability to differentiate into at least one type of vascular system cells.
- treat and “treatment” are used broadly, to include both prophylactic and therapeutic treatments.
- disease or injury of circulatory system tissues those terms are used broadly to include fully developed disease or injury, as well as incipient or threatened disease or injury.
- a patient at risk of or beginning to develop a particular condition is considered to have that condition "treated” when methods as disclosed herein are used to reduce the risk of development or progression of that condition, as well as when an already-developed condition is reversed, inhibited, cured, or ameliorated, and when the rate of development of a condition is halted or slowed.
- compositions such as pharmaceutical compositions, comprising nucleic acids encoding a PIM serine/threonine kinase, such as PIM-I, and methods for making and using them; including methods for inducing cardiac or vascular cellular proliferation, and protecting cardiac or vascular cells from hypoxia and cellular apoptosis.
- compositions and methods of the invention are used to express PIM-I to protect cardiomyocytes from hypertrophy and inhibit myocardial apoptosis induced by infarction, reducing infarct size.
- the compositions and methods of the invention are used to express PIM- 1 to induce cardiac or vascular cellular dedifferentiation and re-expression of stem cell markers; and in one aspect, to overexpress PIM-I to enhance the regenerative potential of stem cells, including stem cell ability to engraft in the heart after a myocardial infarction (post-MI).
- the compositions and methods of the invention are used to express PIM-I to increase BcI-XL expression to induce cardioprotective anti-apoptotic signaling, thus increasing myocardial survival signaling.
- compositions such as pharmaceutical compositions, comprising nucleic acids encoding the serine/threonine kinase PIM-I and methods for preventing or inhibiting cell or tissue damage, e.g., cardiomyocyte cell death or inhibiting an ischemic or reperfusion related injury; including preventing or inhibiting the irreversible cellular and tissue damage and cell death caused by ischemia, e.g., ischemia subsequent to reperfusion (which can exacerbates ischemic damage by activating inflammatory response and oxidative stress).
- the disclosure further provides compositions, such as pharmaceutical compositions, comprising nucleic acids encoding a serine/threonine kinase PIM and methods for regulating cardiac or vascular cellular proliferation and survival.
- the care provider may wish to perform a patient selection step. This may include, for example, assessing whether a patient is in need of one or more of the various treatments, or identifying a patient in need of such treatment. Two significant categories of need warrant some discussion.
- identification can take place by recognizing an inchoate disease or injury that would otherwise progress, for example, injury or other factors that have or will initiate apoptosis, or conditions or factors that enhance the risk of developing a particular condition. Identification and treatment of those individuals may be desirable to prevent development of a disease or injury or to slow its development.
- Prophylactic treatment is desirable, when high risk of ischemic injury can be identified. However, in many cases, the patient will be treated after the injury has occurred. Treatment should be commenced as soon as is practicable after the injury.
- PIM-activity enhancement can be used to treat a number of other conditions and to create desired physiological effects, by treating a subject to enhance PIM activity in vascular, cardiac, or other circulatory system cells or tissues.
- These include prevention, reduction, or reversal of cardiac hypertrophy, including but not limited to maladaptive hypertrophic remodeling; promoting cardiac cell survival and inhibiting apoptosis of those cells; enhancing cardiac contractility; improving cardiac ejection fraction; enhancing vascular growth and repair; and promoting differentiation of stem cells and progenitor cells toward cardiac or vascular tissue.
- the methods contemplated herein include, but are not limited to, inhibition of cardiac apoptosis; inhibition of cardiac fibrosis; inhibition of cardiac remodeling; inhibition of cardiac hypertrophy; preservation or reduced loss of ejection fraction in damaged hearts; enhanced preservation of contractile function; decrease in cardiac necrosis; reduction in lesion size following ischemic injury; and increasing cardiac cellularity and decreasing myocyte volume. All of these methods can be practiced prophylactically (to prevent or reduce a particular condition that would otherwise be likely to occur) and therapeutically (to treat a condition that is already in existence, including treatment to slow progression of a condition).
- conditions that may lead to treatment by enhancement of PIM activity include (but are not limited to) congenital heart conditions; ischemic injury of any kind to heart tissue; damage from infarction; cardiac reperfusion injury; traumatic cardiac injury; congestive heart failure injury; and injury relating to cardiac infection with a pathogen, including viral, bacterial, and parasitic pathogens.
- methods of treating the individual can include a step of increasing the level of PIM activity in a target tissue, such as vascular tissue or cardiac tissue. This step can be practiced in the various ways disclosed herein.
- those include administering factors or drugs to the patient, systemically or locally, that upregulate endogenous PIM expression; administering PIM protein, preferably in combination with a delivery modality, such as a linked transduction domain, a liposome, an antibody, or the like; administering PIM- encoding polynucleotide to the patient, including naked DNA administration, administration of the polynucleotide in a viral vector, liposome, or other delivery modality; electroporation of cells of a subject to deliver DNA; and administering an autologous cell to the subject (e.g., into the heart) that has been altered to enhance PIM expression, including cardiomyocytes, cardiac progenitor cells, cardiac stem cells, mesenchymal stem cells, hematopoietic stem cells, adipose- derived stem cells, and the like.
- a delivery modality such as a linked transduction domain, a liposome, an antibody, or the like
- the number of cells can be any amount effective to enhance cardiac function or structure or treat a target condition.
- Exemplary, non-limiting amounts include 10 5 to 10 10 cells, more typically 10 6 to 10 9 cells.
- Exemplary, non-limiting amounts of PIM protein administered to an adult human heart can be, for example, from about 10 ⁇ 4 g to about 10 "10 g, calculated as the pure PIM protein.
- Exemplary, non-limiting amounts of DNA include about 0.05 to 500 ug/kg, or 0.5 to 50 ug/kg body weight, and in the case of viral particles, formulated at a titer of about at least 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , or 10 17 physical particles per milliliter.
- the PIM-I encoding nucleic acid is administered in about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or 150 or more microliter ( ⁇ l) injections. Doses and dosage regimens can be determined by conventional range-finding techniques known to those of ordinary skill in the art.
- about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 or 10 17 viral (e.g., lentiviral) particles are delivered to the individual (e.g., a human patient) in one or multiple doses.
- an intracardiac single administration (e.g., a single dose) comprises from about 0.1 ⁇ l to 1.0 ⁇ l, 10 ⁇ l or to about 100 ⁇ l of a pharmaceutical composition of the invention.
- dosage ranges from about 0.5 ng or 1.0 ng to about 10 ⁇ g, 100 ⁇ g to 1000 ⁇ g of PIM-I expressing nucleic acid is administered (either the amount in an expression construct, or as in one embodiment, naked DNA is injected).
- nucleic acid constructs comprising a PIM-encoding sequence, e.g., a PIM-I expressing message or a PIM-I gene.
- PIM- expressing nucleic acids used to practice this invention include PIM-I genomic sequences, or fragments thereof, including coding or non-coding sequences, e.g., including introns, 5' or 3' non-coding sequences, and the like. Also encompassed are PIM-encoding mRNA sequences.
- the PIM-I expressing, or PIM-I inducing or upregulating, composition is a nucleic acid, including a vector, recombinant virus, and the like; and a recombinant PIM-I is expressed in a cell in vitro, ex vivo and/or in vivo.
- a PIM-I expressing nucleic acid encodes a human PIM-I, such as
- a PIM-I expressing nucleic acid encodes a human PIM-I kinase 44 kDa isoform, see e.g., Genbank accession no. AAY87461 (see also, e.g., Xie (2006) Oncogene
- a PIM-I expressing nucleic acid comprises a human PIM-I kinase message (mRNA), see e.g., Genbank accession no. NM_002648 (see also, e.g., Zhang (2007) MoI. Cancer Res. 5 (9), 909-922), SEQ ID NO:3.
- mRNA human PIM-I kinase message
- PIM-2 SEQ ID NO:4
- PIM-3 SEQ ID NO:5
- nucleic acids of this invention are operatively linked to a transcriptional regulatory sequence, e.g., a promoter and/or an enhancer, e.g., cardiac-specific, promoters to drive (e.g., regulate) expression of Pirn- 1.
- a transcriptional regulatory sequence e.g., a promoter and/or an enhancer, e.g., cardiac-specific, promoters to drive (e.g., regulate) expression of Pirn- 1.
- Promoters and enhancers used to practice this invention can be of any type and/or origin, an in one embodiment promoters specific to the species receiving the Pim-1 construct are used; e.g., humans can receive human promoters, mice receive murine promoters, etc.
- promoters from heterologous species can be used; e.g., mammals or vertebrates receiving promoters that originate from other mammals or vertebrates, or viral or synthetic promoters active in the appropriate specie and/or cell type also can be used.
- These promoters can comprise, for example, a ⁇ -myosin heavy chain promoter; a cardiac troponin-T promoter; a MLC-2v promoter; and any other promoter that drives expression in cardiac tissue but does not drive significant expression in other tissues.
- promoters and enhancers active in primordial cells or stem cells e.g., myocardial stem cells, can be operatively linked to drive expression of Pim-1.
- this disclosure provides constructs or expression vehicles, e.g., expression cassettes, vectors, viruses (e.g., lentiviral expression vectors, e.g., see SEQ ID NO:4), and the like, comprising a PIM- encoding sequence, e.g., a PIM-1 encoding message or a PIM-Ia gene, for use as ex vivo or in vitro gene therapy vehicles, or for expression of PIM-1 in heart tissue, a cardiac or vascular cell, tissue or organ to practice the methods of this invention, and for research, drug discovery or transplantation.
- constructs or expression vehicles e.g., expression cassettes, vectors, viruses (e.g., lentiviral expression vectors, e.g., see SEQ ID NO:4), and the like, comprising a PIM- encoding sequence, e.g., a PIM-1 encoding message or a PIM-Ia gene, for use as ex vivo or in vitro gene therapy vehicles, or for
- an expression vehicle used to practice the invention can comprise a promoter operably linked to a nucleic acid encoding a PIM protein (or functional subsequence thereof).
- the invention provides expression cassettes comprising nucleic acid encoding a PIM-1 protein operably linked to a transcriptional regulatory element, e.g., a promoter.
- an expression vehicle used to practice the invention is designed to deliver a PIM-1 encoding sequence, e.g., a PIM-1 gene or any functional portion thereof to a cardiac tissue or cell of an individual.
- Expression vehicles, e.g., vectors, used to practice the invention can be non-viral or viral vectors or combinations thereof.
- the invention can use any viral vector or viral delivery system known in the art, e.g., adenoviral vectors, adeno-associated viral (AAV) vectors, herpes viral vectors (e.g., herpes simplex virus (HSV)-based vectors), retroviral vectors, lentiviral vectors and baculoviral vectors.
- adenoviral vectors e.g., adeno-associated viral (AAV) vectors
- herpes viral vectors e.g., herpes simplex virus (HSV)-based vectors
- retroviral vectors e.g., lentiviral vectors and
- an expression vehicle e.g., a vector or a virus
- a retroviral e.g., a lentiviral, vector capable of delivering the nucleotide sequence encoding full-length human PIM-I in vitro, ex vivo and/or in vivo.
- An exemplary lentiviral expression vector backbone (no "payload” included, e.g., no PIM-I sequence included) that can be used to practice this invention is set forth in SEQ ID NO:4.
- a lentiviral vector used to practice this invention is a "minimal" lentiviral production system lacking one or more viral accessory (or auxiliary) gene.
- Exemplary lentiviral vectors for use in the invention can have enhanced safety profiles in that they are replication defective and self-inactivating (SIN) lentiviral vectors.
- Lentiviral vectors and production systems that can be used to practice this invention include e.g., those described in U.S. Patent Nos.
- non-integrating lentiviral vectors can be employed in the practice of the invention.
- non-integrating lentiviral vectors and production systems that can be employed in the practice of the invention include those described in USPN 6,808,923.
- the expression vehicle can be designed from any vehicle known in the art, e.g., a recombinant adeno-associated viral vector as described, e.g., in U.S. Pat. App. Pub. No. 20020194630, Manning, et al.; or a lentiviral gene therapy vector, e.g., as described by e.g., Dull, et al. (1998) J. Virol. 72:8463-8471 ; or a viral vector particle, e.g., a modified retrovirus having a modified proviral RNA genome, as described, e.g., in U.S. Pat. App. Pub. No.
- adeno-associated viral vector as described e.g., in USPN 6,943,153, describing recombinant adeno-associated viral vectors for use in the eye; or a retroviral or a lentiviral vector as described in USPNs 7,198,950; 7,160,727; 7,122,181 (describing using a retrovirus to inhibit intraocular neovascularization in an individual having an age-related macular degeneration); or 6,555,107.
- Any viral vector can be used to practice this invention, and the concept of using viral vectors for gene therapy is well known; see e.g., Verma and Somia (1997) Nature 389:239-242; and Coffin et al ("Retroviruses” 1997 Cold Spring Harbour Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 758-763) having a detailed list of retroviruses.
- Any lentiviruses belonging to the retrovirus family can be used for infecting both dividing and non-dividing cells with a PIM-I -encoding nucleic acid, see e.g., Lewis et al (1992) EMBO J. 3053-3058.
- Viruses from lentivirus groups from “primate” and/or “non-primate” can be used; e.g., any primate lentivirus can be used, including the human immunodeficiency virus (HIV), the causative agent of human acquired immunodeficiency syndrome (AIDS), and the simian immunodeficiency virus (SIV); or a non-primate lentiviral group member, e.g., including "slow viruses” such as a visna/maedi virus (VMV), as well as the related caprine arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV) and/or a feline immunodeficiency virus (FIV) or a bovine immunodeficiency virus (BIV).
- VMV visna/maedi virus
- CAEV caprine arthritis-encephalitis virus
- EIAV equine infectious anemia virus
- FV feline immunodeficiency virus
- BIV bo
- lentiviral vectors used to practice this invention are pseudotyped lentiviral vectors.
- pseudotyping used to practice this invention incorporates in at least a part of, or substituting a part of, or replacing all of, an env gene of a viral genome with a heterologous env gene, for example an env gene from another virus.
- the lentiviral vector of the invention is pseudotyped with VSV-G.
- the lentiviral vector of the invention is pseudotyped with Rabies-G.
- Lentiviral vectors used to practice this invention may be codon optimized for enhanced safety purposes. Different cells differ in their usage of particular codons.
- This codon bias corresponds to a bias in the relative abundance of particular tRNAs in the cell type.
- Codon usage tables are known in the art for mammalian cells, as well as for a variety of other organisms. Codon optimization has a number of other advantages. By virtue of alterations in their sequences, the nucleotide sequences encoding the packaging components of the viral particles required for assembly of viral particles in the producer cells/packaging cells have RNA instability sequences (INS) eliminated from them. At the same time, the amino acid sequence coding sequence for the packaging components is retained so that the viral components encoded by the sequences remain the same, or at least sufficiently similar that the function of the packaging components is not compromised. Codon optimization also overcomes the Rev/RRE requirement for export, rendering optimized sequences Rev independent.
- INS RNA instability sequences
- Codon optimization also reduces homologous recombination between different constructs within the vector system (for example between the regions of overlap in the gag-pol and env open reading frames). The overall effect of codon optimization is therefore a notable increase in viral titer and improved safety.
- the strategy for codon optimized gag-pol sequences can be used in relation to any retrovirus.
- Vectors, recombinant viruses, and other expression systems used to practice this invention can comprise any nucleic acid which can infect, transfect, transiently or permanently transduce a cell.
- a vector used to practice this invention can be a naked nucleic acid, or a nucleic acid complexed with protein or lipid.
- a vector used to practice this invention comprises viral or bacterial nucleic acids and/or proteins, and/or membranes (e.g., a cell membrane, a viral lipid envelope, etc.).
- expression systems used to practice this invention comprise replicons (e.g., RNA replicons, bacteriophages) to which fragments of DNA may be attached and become replicated.
- expression systems used to practice this invention include, but are not limited to RNA, autonomous self-replicating circular or linear DNA or RNA (e.g., plasmids, viruses, and the like, see, e.g., U.S. Patent No. 5,217,879), and include both the expression and non-expression plasmids.
- a recombinant microorganism or cell culture used to practice this invention can comprise "expression vector" including both (or either) extra-chromosomal circular and/or linear nucleic acid (DNA or RNA) that has been incorporated into the host chromosome(s).
- expression vector including both (or either) extra-chromosomal circular and/or linear nucleic acid (DNA or RNA) that has been incorporated into the host chromosome(s).
- DNA or RNA linear nucleic acid
- the vector may either be stably replicated by the cells during mitosis as an autonomous structure, or is incorporated within the host's genome.
- an expression system used to practice this invention can comprise any plasmid, which are commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. Plasmids that can be used to practice this invention are well known in the art.
- a vector used to make or practice the invention can be chosen from any number of suitable vectors known to those skilled in the art, including cosmids, YACs (Yeast Artificial Chromosomes), megaYACS, BACs (Bacterial Artificial Chromosomes), PACs (Pl Artificial Chromosome), MACs (Mammalian Artificial Chromosomes), a whole chromosome, or a small whole genome.
- the vector also can be in the form of a plasmid, a viral particle, or a phage.
- vectors include chromosomal, non-chromosomal and synthetic DNA sequences, derivatives of SV40; bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
- cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by, e.g., Sambrook.
- Bacterial vectors which can be used include commercially available plasmids comprising genetic elements of known cloning vectors.
- compositions including pharmaceutical compositions, and methods for expressing PIM; e.g., for expressing PIM-I or another functionally-equivalent kinase to protect cardiomyocytes from hypertrophy and to inhibit myocardial apoptosis induced by infarction, and to reduce infarct size.
- PIM e.g., for expressing PIM-I or another functionally-equivalent kinase to protect cardiomyocytes from hypertrophy and to inhibit myocardial apoptosis induced by infarction, and to reduce infarct size.
- compositions of the invention are used to express PIM-I to induce cardiac or vascular cellular dedifferentiation and re-expression of stem cell markers; and in one aspect, to overexpress PIM-I to enhance the regenerative potential of stem cells, including stem cell ability to engraft in the heart after a myocardial infarction (post- Mi).
- the PIM-I expressing, or PIM-I inducing or upregulating, composition is a nucleic acid, including a vector, recombinant virus, and the like; and a recombinant PIM-I is expressed in a cell in vitro, ex vivo and/or in vivo.
- compounds that induce or upregulate PIM nucleic acid or a PIM kinase activity in the heart or a cardiac or vascular cell, tissue or organ are administered.
- compounds that can be administered in practicing use of the pharmaceutical compositions and methods of this invention can comprise: an interleukin, a cytokine and/or a paracrine factor involved in survival and/or proliferative signaling; an up-regulator of AKT serine/threonine kinase; insulin-like growth factor- 1 (IGF-I); insulin; leukemia inhibitory factor (LIF); granulocyte-macrophage colony-stimulating factor (GM-CSF); or epidermal growth factor (EGF).
- IGF-I insulin-like growth factor- 1
- LIF leukemia inhibitory factor
- GM-CSF granulocyte-macrophage colony-stimulating factor
- EGF epidermal growth factor
- Okadaic acid and SV40 small T antigen inhibit or block negative regulation of PIM-I by protein phosphatase 2A, and can thus be used to increase PIM-I levels. See Maj, et al, Oncogene 26(
- the PIM-expressing, or PIM-inducing or upregulating, compositions of the invention are formulated with a pharmaceutically acceptable carrier.
- the pharmaceutical compositions of the invention can be administered parenterally, topically, orally or by local administration, such as by aerosol or transdermally.
- the pharmaceutical compositions can be formulated in any way and can be administered in a variety of unit dosage forms depending upon the condition or disease and the degree of illness, the general medical condition of each patient, the resulting preferred method of administration and the like. Details on techniques for formulation and administration are well described in the scientific and patent literature, see, e.g., the latest edition of Remington's Pharmaceutical Sciences, Maack Publishing Co, Easton PA ("Remington's").
- Therapeutic agents of the invention can be administered alone or as a component of a pharmaceutical formulation (composition).
- the compounds may be formulated for administration in any convenient way for use in human or veterinary medicine.
- Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.
- Formulations of the PIM-expressing, or inducing or upregulating, compositions of the invention include those suitable for systemic administration, direct local vascular or cardiac administration, or alternatively oral/ nasal, topical, parenteral, rectal, and/or intravaginal administration.
- the formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy.
- the amount of active ingredient which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration.
- the amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect.
- compositions of this invention may comprise one or more diluents, emulsifiers, preservatives, buffers, excipients, etc. and may be provided in such forms as liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled release formulations, tablets, pills, gels, on patches, in implants, etc.
- compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in appropriate and suitable dosages. Such carriers enable the pharmaceuticals to be formulated in unit dosage forms as tablets, pills, powder, dragees, capsules, liquids, lozenges, gels, syrups, slurries, suspensions, etc., suitable for ingestion by the patient.
- Pharmaceutical preparations for oral use can be formulated as a solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable additional compounds, if desired, to obtain tablets or dragee cores.
- Suitable solid excipients are carbohydrate or protein fillers include, e.g., sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxy-methylcellulose; and gums including arabic and tragacanth; and proteins, e.g., gelatin and collagen.
- Disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
- Dragee cores are provided with suitable coatings such as concentrated sugar solutions, which may also contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
- Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound (i.e., dosage).
- Pharmaceutical preparations of the invention can also be used orally using, e.g., push- fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating such as glycerol or sorbitol.
- Push-fit capsules can contain active agents mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers.
- the active agents can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers.
- Aqueous suspensions can contain an active agent (e.g., a chimeric polypeptide or peptidomimetic of the invention) in admixture with excipients suitable for the manufacture of aqueous suspensions.
- excipients include a suspending agent, such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing or wetting agents such as a naturally occurring phosphatide (e.g., lecithin), a condensation product of an alkylene oxide with a fatty acid (e.g., polyoxyethylene stearate), a condensation product of ethylene oxide with a long chain aliphatic alcohol (e.g., heptadecaethylene oxycetanol), a condensation product of ethylene oxide with a partial ester derived from a fatty acid and a hexitol (e.g., polyoxyethylene
- the aqueous suspension can also contain one or more preservatives such as ethyl or n-propyl p- hydroxybenzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose, aspartame or saccharin.
- preservatives such as ethyl or n-propyl p- hydroxybenzoate
- coloring agents such as a coloring agent
- flavoring agents such as aqueous suspension
- sweetening agents such as sucrose, aspartame or saccharin.
- Formulations can be adjusted for osmolarity.
- Oil-based pharmaceuticals can be used to deliver PIM-I expressing, or PIM-I inducing or upregulating, compositions of the invention.
- Oil-based suspensions can be formulated by suspending an active agent in a vegetable oil, such as arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin; or a mixture of these. See e.g., U.S. Patent No. 5,716,928 describing using essential oils or essential oil components for increasing bioavailability and reducing inter- and intra-individual variability of orally administered hydrophobic pharmaceutical compounds (see also U.S. Patent No. 5,858,401).
- the oil suspensions can contain a thickening agent, such as beeswax, hard paraffin or cetyl alcohol.
- Sweetening agents can be added to provide a palatable oral preparation, such as glycerol, sorbitol or sucrose.
- These formulations can be preserved by the addition of an antioxidant such as ascorbic acid.
- an injectable oil vehicle see Minto (1997) J. Pharmacol. Exp. Ther. 281 :93-102.
- the pharmaceutical formulations of the invention can also be in the form of oil-in- water emulsions.
- the oily phase can be a vegetable oil or a mineral oil, described above, or a mixture of these.
- Suitable emulsifying agents include naturally-occurring gums, such as gum acacia and gum tragacanth, naturally occurring phosphatides, such as soybean lecithin, esters or partial esters derived from fatty acids and hexitol anhydrides, such as sorbitan mono-oleate, and condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan mono-oleate.
- the emulsion can also contain sweetening agents and flavoring agents, as in the formulation of syrups and elixirs. Such formulations can also contain a demulcent, a preservative, or a coloring agent.
- the pharmaceutical compounds can also be administered by in intranasal, intraocular and intravaginal routes including suppositories, insufflation, powders and aerosol formulations (for examples of steroid inhalants, see Rohatagi (1995) J. Clin. Pharmacol. 35:1187-1193; Tjwa (1995) Ann. Allergy Asthma Immunol. 75:107-111).
- Suppositories formulations can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at body temperatures and will therefore melt in the body to release the drug.
- a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at body temperatures and will therefore melt in the body to release the drug.
- Such materials are cocoa butter and polyethylene glycols.
- the pharmaceutical compounds can be delivered by transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.
- the pharmaceutical compounds can also be delivered as microspheres for slow release in the body.
- microspheres can be administered via intradermal injection of drug which slowly release subcutaneously; see Rao (1995) J. Biomater Sci. Polym. Ed. 7:623-645; as biodegradable and injectable gel formulations, see, e.g., Gao (1995) Pharm. Res. 12:857-863 (1995); or, as microspheres for oral administration, see, e.g., Eyles (1997) J. Pharm. Pharmacol. 49:669-674.
- the pharmaceutical compounds can be parenterally administered, such as by intravenous (IV) administration or administration into a body cavity or lumen of the heart.
- IV intravenous
- catheters that temporarily block flow of blood from the heart while incubating the stem cells or a viral construct in heart tissue can be used, as well as recirculation systems of well-known type that isolate the circulation in all or a part of the heart to increase the dwell time of an introduced agent (e.g., stem cell, construct, naked DNA, PIM protein, viral or other vector) in the heart.
- agents e.g., stem cell, construct, naked DNA, PIM protein, viral or other vector
- These formulations can comprise a solution of active agent dissolved in a pharmaceutically acceptable carrier.
- Acceptable vehicles and solvents that can be employed are water and Ringer's solution, an isotonic sodium chloride.
- sterile fixed oils can be employed as a solvent or suspending medium.
- any bland fixed oil can be employed including synthetic mono- or diglycerides.
- fatty acids such as oleic acid can likewise be used in the preparation of injectables. These solutions are sterile and generally free of undesirable matter.
- These formulations may be sterilized by conventional, well known sterilization techniques.
- the formulations may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents, e.g., sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like.
- concentration of active agent in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight, and the like, in accordance with the particular mode of administration selected and the patient's needs.
- the formulation can be a sterile injectable preparation, such as a sterile injectable aqueous or oleaginous suspension.
- This suspension can be formulated using those suitable dispersing or wetting agents and suspending agents.
- the sterile injectable preparation can also be a suspension in a nontoxic parenterally- acceptable diluent or solvent, such as a solution of 1,3-butanediol.
- the administration can be by bolus or continuous infusion (e.g., substantially uninterrupted introduction into a blood vessel for a specified period of time).
- the pharmaceutical compounds and formulations of the invention can be lyophilized.
- the invention provides a stable lyophilized formulation comprising a composition of the invention, which can be made by lyophilizing a solution comprising a pharmaceutical of the invention and a bulking agent, e.g., mannitol, trehalose, raffinose, and sucrose or mixtures thereof.
- a process for preparing a stable lyophilized formulation can include lyophilizing a solution about 2.5 mg/mL protein, about 15 mg/mL sucrose, about 19 mg/niL NaCl, and a sodium citrate buffer having a pH greater than 5.5 but less than 6.5. See, e.g., U.S. patent app. no. 20040028670.
- compositions and formulations of the invention can be delivered by the use of liposomes (see also discussion, below).
- liposomes particularly where the liposome surface carries ligands specific for target cells, or are otherwise preferentially directed to a specific organ, one can focus the delivery of the active agent into target cells of the heart or other part of the circulatory system in vivo. See, e.g., U.S. Patent Nos. 6,063,400; 6,007,839; Al-Muhammed (1996) J. Microencapsul. 13:293-306; Chonn (1995) Curr. Opin. Biotechnol. 6:698-708; Ostro (1989) Am. J. Hosp. Pharm. 46:1576-1587.
- compositions of the invention can be administered for prophylactic and/or therapeutic treatments.
- compositions are administered to a subject already suffering from a condition, infection or disease in an amount sufficient to cure, alleviate or partially arrest the clinical manifestations of the condition, infection or disease and its complications (a "therapeutically effective amount").
- pharmaceutical compositions of the invention are administered in an amount sufficient to treat, prevent and/or ameliorate the deleterious effects on the heart of a myocardial infarction (post- MI); to protect cardiomyocytes from hypertrophy and to inhibit myocardial apoptosis induced by infarction, and to reduce infarct size.
- the pharmaceutical compositions of the invention are used to express PIM-I to induce cellular dedifferentiation and re-expression of stem cell markers; and in one aspect, to overexpress PIM-I to enhance the regenerative potential of stem cells, including stem cell ability to engraft in the heart post-MI.
- the amount of pharmaceutical composition adequate to accomplish this is defined as a
- the dosage schedule and amounts effective for this use i.e., the “dosing regimen” will depend upon a variety of factors, including the stage of the disease or condition, the severity of the disease or condition, the general state of the patient's health, the patient's physical status, age and the like. In calculating the dosage regimen for a patient, the mode of administration also is taken into consideration.
- the dosage regimen also takes into consideration pharmacokinetics parameters well known in the art, i.e., the active agents' rate of absorption, bioavailability, metabolism, clearance, and the like (see, e.g., Hidalgo-Aragones (1996) J. Steroid Biochem. MoI. Biol. 58:611-617; Groning (1996) Pharmazie 51 :337-341; Fotherby (1996) Contraception 54:59-69; Johnson (1995) J. Pharm. Sci. 84:1144-1146; Rohatagi (1995) Pharmazie 50:610-613; Brophy (1983) Eur. J. Clin. Pharmacol. 24:103-108; the latest Remington's, supra).
- pharmacokinetics parameters well known in the art, i.e., the active agents' rate of absorption, bioavailability, metabolism, clearance, and the like (see, e.g., Hidalgo-Aragones (1996) J. Steroid Biochem. MoI. Biol. 58:
- formulations can be given depending on the dosage and frequency as required and tolerated by the patient.
- the formulations should provide a sufficient quantity of active agent to effectively treat, prevent or ameliorate a conditions, diseases or symptoms as described herein.
- Methods for preparing parenterally or non- parenterally administrable formulations are known or apparent to those skilled in the art and are described in more detail in such publications as Remington's.
- the methods of the invention can further comprise co-administration with other drugs or pharmaceuticals, e.g., compositions for treating heart attacks, congestive heart failure and related symptoms or conditions.
- the methods and/or compositions and formulations of the invention can be co-formulated with and/or co-administered with antibiotics (e.g., antibacterial or bacteriostatic peptides or proteins), particularly those effective against gram negative bacteria, fluids, cytokines, immunoregulatory agents, anti-inflammatory agents, complement activating agents, such as peptides or proteins comprising collagen-like domains or fibrinogen-like domains (e.g., a ficolin), carbohydrate-binding domains, and the like and combinations thereof.
- antibiotics e.g., antibacterial or bacteriostatic peptides or proteins
- cytokines cytokines
- immunoregulatory agents e.g., anti-inflammatory agents
- complement activating agents such as peptides or proteins comprising collagen-like domains or fibrin
- the invention also provides nanoparticles and liposomal membranes comprising the PIM-I -expressing compounds of this invention which target specific molecules, including biologic molecules, such as polypeptide, including cardiac or vascular or stem cell surface polypeptides, including heart cell (e.g., myocyte) cell surface polypeptides.
- biologic molecules such as polypeptide, including cardiac or vascular or stem cell surface polypeptides, including heart cell (e.g., myocyte) cell surface polypeptides.
- the invention provides nanoparticles and liposomal membranes targeting diseased and/or injured heart cells, or stem cells, such as any pluripotent cell.
- the invention provides nanoparticles and liposomal membranes comprising (in addition to comprising compounds of this invention) molecules, e.g., peptides or antibodies, that selectively target diseased and/or injured heart cells, or stem cells.
- the invention provides nanoparticles and liposomal membranes using interleukin receptors and/or other receptors to target receptors on cells, e.g., diseased and/or injured heart cells, or stem cells. See, e.g., U.S. patent application publication no. 20060239968.
- the compositions of the invention are specifically targeted to stem cells or heart cells, such as myocytes.
- the invention also provides nanocells to allow the sequential delivery of two different therapeutic agents with different modes of action or different pharmacokinetics, at least one of which comprises a composition of this invention.
- a nanocell is formed by encapsulating a nanocore with a first agent inside a lipid vesicle containing a second agent; see, e.g., Sengupta, et al., U.S. Pat. Pub. No. 20050266067.
- the agent in the outer lipid compartment is released first and may exert its effect before the agent in the nanocore is released.
- the nanocell delivery system may be formulated in any pharmaceutical composition for delivery to patients suffering from any disease or condition as described herein, e.g., such as congestive heart failure or heart attack (myocardial infarction).
- myocardial infarction an antibody and/or angiogenic agent can be contained in the outer lipid vesicle of the nanocell, and a composition of this invention is loaded into the nanocore. This arrangement allows the antibody and/or angiogenic agent to be released first and delivered to the injured tissue.
- the invention also provides multilayered liposomes comprising compounds of this invention, e.g., for transdermal absorption, e.g., as described in Park, et al., U.S. Pat. Pub. No.
- the multilayered liposomes can be prepared using a mixture of oil-phase components comprising squalane, sterols, ceramides, neutral lipids or oils, fatty acids and lecithins, to about 200 to 5000 nm in particle size, to entrap a composition of this invention.
- a multilayered liposome of the invention may further include an antiseptic, an antioxidant, a stabilizer, a thickener, and the like to improve stability. Synthetic and natural antiseptics can be used, e.g., in an amount of 0.01% to 20%.
- Antioxidants can be used, e.g., BHT, erysorbate, tocopherol, astaxanthin, vegetable fiavonoid, and derivatives thereof, or a plant-derived antioxidizing substance.
- a stabilizer can be used to stabilize liposome structure, e.g., polyols and sugars.
- Exemplary polyols include butylene glycol, polyethylene glycol, propylene glycol, dipropylene glycol and ethyl carbitol; examples of sugars are trehalose, sucrose, mannitol, sorbitol and chitosan, or a monosaccharide or an oligosaccharide, or a high molecular weight starch.
- a thickener can be used for improving the dispersion stability of constructed liposomes in water, e.g., a natural thickener or an acrylamide, or a synthetic polymeric thickener.
- exemplary thickeners include natural polymers, such as acacia gum, xanthan gum, gellan gum, locust bean gum and starch, cellulose derivatives, such as hydroxy ethylcellulose, hydroxypropyl cellulose and carboxymethyl cellulose, synthetic polymers, such as polyacrylic acid, poly-acrylamide or polyvinylpyrollidone and polyvinylalcohol, and copolymers thereof or cross-linked materials.
- Liposomes can be made using any method, e.g., as described in Park, et al., U.S. Pat.
- Pub. No. 20070042031 including method of producing a liposome by encapsulating a therapeutic product comprising providing an aqueous solution in a first reservoir; providing an organic lipid solution in a second reservoir, wherein one of the aqueous solution and the organic lipid solution includes a therapeutic product; mixing the aqueous solution with said organic lipid solution in a first mixing region to produce a liposome solution, wherein the organic lipid solution mixes with said aqueous solution so as to substantially instantaneously produce a liposome encapsulating the therapeutic product; and immediately thereafter mixing the liposome solution with a buffer solution to produce a diluted liposome solution.
- the invention also provides nanoparticles comprising compounds of this invention to deliver a composition of the invention as a drug-containing nanoparticles (e.g., a secondary nanoparticle), as described, e.g., in U.S. Pat. Pub. No. 20070077286.
- the invention provides nanoparticles comprising a fat-soluble drug of this invention or a fat- solubilized water-soluble drug to act with a bivalent or trivalent metal salt.
- the PIM-I expressing nucleic acid compositions of the invention can be delivered for ex vivo or in vivo gene therapy to deliver a PIM-I encoding nucleic acid.
- PIM-I expressing nucleic acid compositions of the invention including non-reproducing viral constructs expressing high levels of the human PIM-I protein, are delivered ex vivo or for in vivo gene therapy.
- the PIM-I expressing nucleic acid compositions of the invention can be delivered to and expressed in a variety of cardiac or vascular cells to induce cellular proliferation, and/or to protect cardiac or vascular cells from hypoxia and cellular apoptosis.
- PIM-I so expressed can protect cardiomyocytes from hypertrophy and inhibit cell death induced by myocardial infarction (e.g. heart attack), reducing the amount of muscle affected.
- PIM-I overexpression by practicing the composition and methods of this invention in cardiac or vascular cells, e.g., in heart cells, results in cellular reversion; the cardiac or vascular cells become stem cell like; complete with re-expression of stem cell markers (such as cardiac stem cell markers).
- overexpression of PIM-I enhances the regenerative potential of stem cells and their ability to repair a damaged or injured organ (e.g., an injured heart after a heart attack).
- the invention provides compositions and methods for overexpressing PIM-I using a controlled system using cultured stem cells prior to reintroduction in the adult human to enhance their ability to repair the organ following injury.
- the invention provides use of PIM-I for a clinical therapy for repair of a number of tissues damaged by low oxygen or other means through use of a conditional control element that allows control of PIM-I expression.
- PIM-I expressing nucleic acid delivery vehicles e.g., expression constructs, such as vectors or recombinant viruses
- expression constructs such as vectors or recombinant viruses
- expression constructs such as vectors or recombinant viruses
- vectors used to practice this invention are bicistronic.
- a MND (or, myeloproliferative sarcoma virus LTR-negative control region deleted) promoter is used to drive Pim-1 expression.
- a reporter is also used, e.g., an enhanced green florescent protein (eGFP) reporter, which can be driven off a viral internal ribosomal entry site (vIRES).
- eGFP enhanced green florescent protein
- vIRES viral internal ribosomal entry site
- all constructs are third generation self-inactivating (SIN) lentiviral vectors and incorporate several elements to ensure long-term expression of the transgene.
- a MND promoter allows for high expression of the transgene, while the LTR allows for long-term expression after repeated passage.
- the vectors also include (IFN)- ⁇ - scaffold attachment region (SAR) element; SAR elements have been shown to be important in keeping the vector transcriptionally active by inhibiting methylation and protecting the transgene from being silenced.
- PIM-I expressing nucleic acid delivery vehicles e.g., expression constructs, such as vectors or recombinant viruses
- expression constructs such as vectors or recombinant viruses
- blood, fat, or marrow-derived stem cells can also be used.
- PIM-I expression can be activated through addition of the drug to culture media. After a number of days in culture, the expression of PIM-I can be then turned off through removal of the drug; and, in one aspect, the increased number of cells produced in culture are reintroduced into the damaged area contributing to an enhanced repair process.
- the invention can incorporate use of any non- viral delivery or non- viral vector systems are known in the art, e.g., including lipid mediated transfection, liposomes, immunoliposomes, lipofectin, cationic facial amphiphiles (CFAs) and combinations thereof.
- non- viral delivery or non- viral vector systems are known in the art, e.g., including lipid mediated transfection, liposomes, immunoliposomes, lipofectin, cationic facial amphiphiles (CFAs) and combinations thereof.
- expression vehicles e.g., vectors or recombinant viruses, used to practice the invention are injected directly into the heart muscle.
- the PIM-I encoding nucleic acid is administered to the individual by direct injection.
- the invention provides sterile injectable formulations comprising expression vehicles, e.g., vectors or recombinant viruses, used to practice the invention.
- target cells e.g., myocytes or stem cells
- One particular embodiment of the invention is the ex vivo modification of stem cells of any origin or any pluripotent cell to enhance PIM-I expression, followed by administration of the stem cells to a human or other mammalian host, or to any vertebrate.
- the stem cells may be directly or locally administered, for example, into cardiac tissue in the same manner as in existing stem cell therapy for cardiac injury or insufficiency. Alternatively, systemic administration is also contemplated.
- the stem cells may be autologous stem cells or heterologous stem cells. They may be derived from embryonic sources or from infant or adult organisms.
- the enhancement of PIM-I expression may for example be the result of upregulation of the expression of existing chromosomal PIM-I -encoding sequence in the stem cells, or may be the result of insertion of an exogenous polynucleotide operably encoding PIM- 1.
- a PIM-I -encoding insert in such stem cells may advantageously be under inducible expression control.
- a "suicide sequence" of known type of known type
- one or more "suicide sequences” are also administered, either separately or in conjunction with a nucleic acid construct of this invention, e.g., incorporated within the same nucleic acid construct (such as a vector, recombinant virus, and the like. See, e.g., Marktel S, et al., Immunologic potential of donor lymphocytes expressing a suicide gene for early immune reconstitution after hematopoietic T-cell-depleted stem cell transplantation. Blood 101 : 1290-1298(2003).
- Suicide sequences used to practice this invention can be of known type, e.g., sequences to induce apoptosis or otherwise cause cell death, e.g., in one aspect, to induce apoptosis or otherwise cause cell death upon administration of an exogenous trigger compound or exposure to another type of trigger, including but not limited to light or other electromagnetic radiation exposure.
- a PIM-I encoding nucleic acid-comprising expression construct or vehicle of the invention is formulated at an effective amount of ranging from about 0.05 to 500 ug/kg, or 0.5 to 50 ug/kg body weight, and can be administered in a single dose or in divided doses.
- the amount of a PIM-I encoding nucleic acid of the invention, or other the active ingredient (e.g., a PIM-I inducing or upregulating agent) actually administered ought to be determined in light of various relevant factors including the condition to be treated, the age and weight of the individual patient, and the severity of the patient's symptom; and, therefore, the above dose should not be intended to limit the scope of the invention in any way.
- a PIM-I encoding nucleic acid-comprising expression construct or vehicle of the invention is formulated at a titer of about at least 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , or 10 17 physical particles per milliliter.
- the PIM-I encoding nucleic acid is administered in about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or 150 or more microliter ( ⁇ l) injections. Doses and dosage regimens can be determined by conventional range- finding techniques known to those of ordinary skill in the art.
- an intracardiac single administration (e.g., a single dose) comprises from about 0.1 ⁇ l to 1.0 ⁇ l, 10 ⁇ l or to about 100 ⁇ l of a pharmaceutical composition of the invention.
- dosage ranges from about 0.5 ng or 1.0 ng to about 10 ⁇ g, 100 ⁇ g to 1000 ⁇ g of PIM-I expressing nucleic acid is administered (either the amount in an expression construct, or as in one embodiment, naked DNA is injected). Any necessary variations in dosages and routes of administration can be determined by the ordinarily skilled artisan using routine techniques known in the art.
- a PIM-I expressing nucleic acid is delivered in vivo directly to a heart using a viral stock in the form of an injectable preparation containing pharmaceutically acceptable carrier such as saline.
- the final titer of the vector in the injectable preparation can be in the range of between about 10 8 to 10 14 , or between about 10 10 to 10 12 , viral particles; these ranges can be effective for gene transfer.
- PIM-I expressing nucleic acids (e.g., vector, transgene) constructs are delivered to the myocardium by direct intracoronary injection, e.g., using a standard percutaneous catheter based methods under fluoroscopic guidance.
- PIM-I expressing nucleic acids (e.g., vector, transgene) constructs are delivered to organs and tissues, e.g., the heart, directly into both coronary and/or peripheral arteries, e.g., using a lipid- mediated gene transfer.
- the amount of the PIM-I expressing nucleic acid (e.g., vector, transgene) injected can be in the range of between about 10 8 to 10 14 , or between about 10 10 to 10 12 , viral particles.
- the injection can be made deeply (such as 1 cm within the arterial lumen) into the lumen of the coronary arteries, and can be made in both coronary arteries, as the growth of collateral blood vessels is highly variable within individual patients.
- the invention combines a therapeutic PIM-I nucleic acid with a genetic "sensor" that recognizes and responds to the oxygen deprivation that follows the reduced blood flow, or ischemia, from coronary artery disease and heart attack. As soon as the oxygen declines, the sensor turns on the therapeutic gene, thereby protecting the heart.
- the aspect of this invention is useful for any condition in which circulatory system tissues are susceptible to loss of blood supply, including stroke, shock, trauma and sepsis.
- PIM proteins can also be delivered directly to the affected cardiac or other circulatory tissues. Because PIM acts intracellularly, it is preferred to utilize a delivery strategy to facilitate intracellular delivery of PIM.
- PIM in a vehicle that in taken up by or that fuses with a target cell.
- PIM can be encapsulated within a liposome or other vesicle, as described in more detail above in connection with polynucleotide delivery to cells.
- the PIM may be linked to a transduction domain, such as TAT protein.
- PIM enzyme can be operably linked to a transduction moiety, such as a synthetic or non-synthetic peptide transduction domain (PTD), Cell penetrating peptide (CPP), a cationic polymer, an antibody, a cholesterol or cholesterol derivative, a Vitamin E compound, a tocol, a tocotrienol, a tocopherol, glucose, receptor ligand or the like, to further facilitate the uptake of the PIM by cells.
- PTD synthetic or non-synthetic peptide transduction domain
- CPP Cell penetrating peptide
- a cationic polymer an antibody, a cholesterol or cholesterol derivative, a Vitamin E compound, a tocol, a tocotrienol, a tocopherol, glucose, receptor ligand or the like, to further facilitate the uptake of the PIM by cells.
- a number of protein transduction domains/peptides are known in the art and facilitate uptake of heterologous molecules linked to the transduction domains (e.g., cargo molecules). Such peptide transduction domains (PTD 's) facilitate uptake through a process referred to as macropinocytosis. Macropinocytosis is a nonselective form of endocytosis that all cells perform. Exemplary peptide transduction domains (PTD 's) are derived from the Drosophila homeoprotein antennapedia transcription protein (AntHD) (Joliot et al., New Biol. 3:1121-34,
- the peptide transduction domain increases uptake of the bioniolecule to which it is fused in a receptor independent fashion, is capable of transducing a wide range of cell types, and exhibits minimal or no toxicity (Nagahara et al., Nat. Med. 4:1449-52, 1998).
- Peptide transduction domains have been shown to facilitate uptake of DNA (Abu-Amer, supra), antisense oligonucleotides (Astriab-Fisher et al., Pharm. Res, 19:744-54, 2002), small molecules (Polyakov et al., Bioconjug. Chem. 11 :762- 71, 2000) and even inorganic 40 nanometer iron particles (Dodd et al., J. Immunol. Methods
- Fusion proteins with such trans-cellular delivery proteins can be readily constructed using known molecular biology techniques.
- any of the polynucleotides encoding PIM molecules can be linked to the foregoing domains to facilitate transduction of those polynucleotides into target cells, in vivo or in vitro.
- kits comprising compositions of this invention and methods of the invention, including PIM-expressing, or PIM-inducing or upregulating compositions and/or nucleic acids of the invention, including vectors, recombinant viruses and the like, transfecting agents, transducing agents, cardiac or vascular cells and/or cell lines, instructions (regarding the methods of the invention), or any combination thereof.
- kits, cells, vectors and the like are provided herein.
- compositions of the invention comprising nucleic acids encoding the serine/threonine kinase PIM-I, and the methods of this invention, are effective for inducing cellular proliferation, and protecting cells from hypoxia and cellular apoptosis; and to express PIM-I kinase to protect cardiomyocytes from hypertrophy and/or inhibit myocardial apoptosis induced by infarction, reducing infarct size; and to express PIM-I to induce cellular dedifferentiation and re-expression of stem cell markers; and to overexpress PIM-I to enhance the regenerative potential of stem cells, including stem cell ability to engraft in the heart after a myocardial infarction (post-MI).
- post-MI myocardial infarction
- PIM-I expressed in the mouse myocardium is developmentally regulated.
- PIM-I exhibits cardioprotective effects in vivo.
- PIM-I positive border zone cardiomyocytes are negative for "terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling" (TUNEL) labeling and exhibit increased BcI-XL expression indicative of cardioprotective anti- apoptotic signaling, demonstrating a role for PIM-I in myocardial survival signaling, also demonstrating the compositions and methods of the invention can be effective in myocardial survival signaling by expressing and/or upregulating PIM-I kinase expression and/or activity.
- TUNEL terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling
- GFP-tagged cDNAs for wild-type 34kDa PIM-I (PIM-wt) or a kinase dead (K67M) mutant (PIM-DN) as previously described 10 were used to generate recombinant adenoviruses used for infection of neonatal rat cardiomyocyte cultures.
- Immunoblotting of lysates from cultures expressing GFP-PIM- wt or GFP-PIM-DN accumulate 64kDa GFP-PIM-I fusion proteins recognized by either GFP or PIM-I antibodies.
- Cardiomyocytes overexpressing GFP-PIM-wt exhibit a statistically significant decrease in TUNEL labeling compared to EGFP infected controls.
- GFP-PIM-DN overexpression induced a 30.8% increase in apoptotic cardiomyocytes (*p ⁇ 0.05).
- Cultured cardiomyocytes were protected from apoptotic challenge with doxorubicin or deoxyglucose by GFP-PIM-wt overexpression (**p ⁇ 0.01 for both groups), whereas GFP-PIM-DN overexpression exacerbated apoptotic effects (**p ⁇ 0.01, and *p ⁇ 0.05 respectively).
- GFP-PIM-DN induced a 3.6-fold increase in caspase3 cleavage and an 80% increase in cleaved poly (ADP-ribose) polymerase (PARP).
- PARP cleaved poly (ADP-ribose) polymerase
- GFP-PIM-wt produced significant increases in bcl-XL and bcl-2 expression (2.2- fold and 25.4-fold, respectively) when compared to control (*p ⁇ 0.01).
- GFP-PIM-wt also increased phosphorylation of Bad at the serine 112 residue (Sl 12) by 16.7-fold versus uninfected control while levels of total Bad remained unchanged (*p ⁇ 0.01).
- PIM-I is induced by cardioprotective stimuli.
- compositions and methods of the invention can be used to increase the expression of PIM-I to provide a cardioprotective effect, e.g., after a myocardial infarction.
- PIM-I immunoreactivity was not induced by phenylephrine, endothelin-1, forskolin, or estradiol (Fig. 4A).
- IGF-I induction of PIM- 1 expression is AKT-dependent.
- PIM-I expression in response to IGF-I treatment is significantly reduced in the presence of the PD kinase inhibitor wortmannin or inactivated AKT (AKT-DN) by 4.0-fold and 9.1 -fold respectively (**p ⁇ 0.001).
- a role for nuclear accumulation of AKT resulting following IGF stimulation 11 was confirmed, as overexpression of nuclear-targeted AKT 12 increased PIM-I expression in cultured cardiomyocytes by 2.1 -fold compared to uninfected controls (*p ⁇ 0.05).
- overexpression of wildtype AKT (AKT- wt) decreased expression of PIM-I 1.4-fold versus uninfected control (*p ⁇ 0.05).
- PIM-I and AKT exhibit feedback relationships.
- AKT expression and phosphorylation increase in response to overexpression of GFP-PIM-DN in cultured cardiomyocytes (Fig. 6A). Comparable findings of increased phospho-AKT 473 were observed with confocal microscopy of immunolabeled myocardial sections from 2-month old PIM-KO mice. Increased phospho-AKT 7 and total AKT in immunoblots of whole heart lysates from PIM-KO mice correlated with the immunostaining, demonstrating that regulation of Akt expression and activity depends, in part, upon PIM-I levels. Discussion
- compositions and methods of the invention can be used to increase the expression of PIM-I to provide a cardioprotective effect (a myocardium protective effect), e.g., after a myocardial infarction.
- a cardioprotective effect e.g., after a myocardial infarction.
- Molecular regulation of cardioprotection endures as a highly significant research avenue for therapeutic interventional strategies in the treatment of myocardial injury and heart failure.
- this invention's discovery of a central role for PIM-I in cardioprotection as demonstrated by the data presented herein, a new facet of signaling has been uncovered with profound implications for regulation of cardiomyocyte survival and AKT-mediated effects.
- PIM-I functions as a defense against apoptotic stimuli induced during ischemia/reperfusion injury
- PIM-I has not previously been studied in the myocardial context studies. In non-cardiac cells is has been demonstrated that PIM-I as a critical regulator of proliferation and cell survival signaling, e.g., as reviewed in ref ' (see below). Using the compositions and methods of this invention, PIM-I functions as a defense against apoptotic stimuli induced during ischemia/reperfusion injury resulting from myocardial infarction, pressure-overload induced hypertrophy, and heart failure. Although PIM-I level is developmentally down-regulated, expression reappears in cardiomyocytes following cardiac injury by pressure-overload induced by TAC banding and myocardial infarction.
- PIM-I is one of several protoncogenes participating in the "immediate early response" gene profile expressed following cardiac injury 13 including c- fos, c-myc 14 , Raf and Ras. PIM-I has been shown to cooperate with c-myc in activation of c- Myb dependent cellular proliferation in other tissues 15 ⁇ 17 suggesting synergistic effects between oncogenes may help preserve the myocardium in reaction to injury.
- PIM-I potentiates intracellular anti-apoptotic signaling
- PIM-I serves as the downstream effector of AKT induced p53 inhibition, since induction of mdm.2 expression, phosphorylation, and p53 degradation is mediated by PIM-I I7 and AKT protects against doxorubicin induced apoptosis through a p53 -dependent mechanism .
- PIM-I inactivation may also increase apoptotic activity through increasing generation of reactive- oxygen species and mitochondrial pore permeability, as has been found in other cellular contexts 18 .
- IGF-I mediates myocardial survival signaling 40"42 and stem cell proliferation 43 although we were unable to find prior published demonstration of PIM- 1 induction by IGF.
- Results indicate that IGF-I induced PIM-I expression is AKT dependent and that nuclear-targeted AKT expression induces significant increases in PIM-I expression in vitro and in vivo.
- inactivation or ablation of PIM-I expression induced AKT expression and activation but increased AKT activation is unable to enhance recovery or reduce apoptosis following ischemia/reperfusion injury in PIM-I null animals.
- Neonatal Rat Cardiomyocyte Cultures infections and treatments Neonatal rat cardiomyocyte cultures were prepared as described previously . Cells to be subjected to treatments were placed in media with 2% serum overnight and then treated with the appropriate agent and harvested or fixed after the pre-described timepoint. Cardiomyocytes were infected with adenovirus for two hours, washed in PBS and then re-fed Ml 99 with 2% FBS and 50 ⁇ g/ml pen/strep, and 100 ⁇ M glutamine.
- Pellets were resuspended in 1.5 mL of 0.57M STEAKMTM, homogenized in tight fitting pestle and centrifuged at 1000xg for 10 minutes at 4° C. Supernatant was collected for cytosolic fraction. Pellets were re-suspended in 750 ⁇ l of 0.57M STEAKMTM with 0.5% TRITON-XTM and centrifuged at 1000xg for 10 minutes at 4 0 C. Supernatant was collected for membrane fraction.
- Pellets were re-suspended in 300 ⁇ l of 2.3M STEAKMTM (2.3M sucrose, 25mM KCL, 5% MgCl 2 , ImM DTT, 0.5mM PMSF, 500 ⁇ l of protease inhibitor and 50 ⁇ l of phosphatase inhibitor). 2 volumes of 0.57M STEAKMTM was added and the pellets were gently mixed. A layer of 2.7M STEAKMTM (2.7M sucrose, 25mM KCL, 5% MgCl 2 , ImM DTT,
- 0.5mM PMSF, 500 ⁇ l of protease inhibitor and 50 ⁇ l of phosphatase inhibitor was made at the bottom of an ultracentrifuge tube followed by a 2.4M STEAKMTM (2.4M sucrose, 25mM KCL, 5% MgCl 2 , 1 mM DTT, 0.5 mM PMSF, 500 ⁇ l of protease inhibitor and 50 ⁇ l of phosphatase inhibitor).
- the homogenate layer was added.
- the 3 layers were centrifuged at 112,000xg for lhour at 4° C.
- White interface between 2.7 and 2.4M STEAKMTM was collected for nuclear fraction. 5 volumes of 0.57 STEAKMTM was added and the pellets were centrifuged at 2000xg for 20 minutes at 4° C. The pellet was re-suspended in sample buffer containing phosphatase inhibitors and protease inhibitors.
- Infected cardiomyocytes were harvested 24 hours after infection in SDS denaturing sample buffer, sonicated and boiled for 10 minutes, and quantitated using the Bradford assay.
- Mouse whole heart lysates were generated from flash frozen hearts pulverized in a mortar and pestle then resuspended in SDS denaturing sample buffer, sonicated, boiled for 10 minutes and quantitated using Bradford assay. Approximately 50 ⁇ g of each sample was loaded on a 4-15% gradient Bis-Acrylamide Tris Glycine gel and transferred to PVDF.
- Blots were blocked in 3% BSA for lhour, and probed with primary antibodies (PIM-I (Cell Signaling Technology), c-jun (Cell Signaling Technology), HISTONE3TM (Cell Signaling Technology), GFP (Molecular Probes), bcl-2 (Santa Cruz), bcl-XL (Cell Signaling Technology), PHOSPHO- BADSl 12TM (Biosource) AKT (Cell Signaling Technology), GAPDH (Research Diagnostics Inc.), PHOSPHO-AKTS473TM (Cell Signaling Technology), total PARP (Biosource), cleaved PARP (Biosource), and cleaved caspase3 (Cell Signaling Technologies)) diluted in blocking solution overnight at 4°C.
- PIM-I Cell Signaling Technology
- c-jun Cell Signaling Technology
- HISTONE3TM Cell Signaling Technology
- GFP Molecular Probes
- bcl-2 Santa Cruz
- bcl-XL Cell Signaling Technology
- Blots were washed in TBS-0.5%Tween three times and probed with fluorescent or alkaline phosphatase conjugated secondary antibodies diluted 1 :5000 in blocking solution for lhour at room temperature followed by three washes in TBS-0.5%T ween. Blots were scanned using a TYPHOON 9410 IMAGERTM (GE Healthcare) and quantitated using IMAGEQUANT 5.2TM software (GE Healthcare). All quantitation is based on standardization to loading controls.
- Adenoviral constructs AKT-nuc and AKT wildtype adenoviruses were prepared as described previously, see reference 12 .
- PIM- wt and PIM-DN adenoviruses were prepared by subcloning of the Nhel/Smal fragments from pEGFP-Nl PIM-I and pEGFP-NlPIM-DNTM plasmids described previously 10 , into the pDC315ioTM (Microbix) adenoviral shuttle vector.
- Sequence verified shuttle vectors were cotransfected with the genomic pBHGlox ⁇ El,3Cre into 293 iqTM cells (Microbix) to generate the adenovirus. Purified plaques were isolated and expanded for use in experiments. Immunohistochemistry. Hearts were fixed and embedded and cardiomyocytes fixed and permeabilized as described previously 12 . Staining of cultured neonatal rat cardiomyocytes was performed with antibodies described above diluted 1 : 25 in PBS containing 10% horse serum overnight at 4°C. Slides were washed in PBS and probed with fluorescent conjugated secondary antibodies (1 :100) for one hour at room temperature, and Texas Red phalloidin (1 :50 Molecular Probes) to identify actin filaments.
- Doxorubicin and deoxyglucose induction of apoptosis were infected with GFP, PIM-wt, and PIM-DN viruses as described earlier. Twenty-four hours after infection, cells were treated with l ⁇ M Doxorubicin or ImM deoxyglucose for 16 hours then labeled for TUNEL using the IN SITU CELL DEATH DETECTION KITTM, TMR red (Roche Applied Science) per manufacturer instructions. Number of infected TUNEL positive cells was counted for each treatment on a Nikon DIAPHOT 420TM fluorescent scope.
- PIM-I protein kinase is nuclear in Burkitt's lymphoma: nuclear localization is necessary for its biologic effects. Anticancer Res 23, 167-78 (2003). 18. Lilly, M., Sandholm, J., Cooper, J.J., Koskinen, PJ. & Kraft, A. The PIM-I serine kinase prolongs survival and inhibits apoptosis-related mitochondrial dysfunction in part through a bcl-2-dependent pathway. Oncogene 18, 4022-31 (1999).
- CT-I Cardiotrophin 1
- compositions of the invention comprising nucleic acids encoding the serine/threonine kinase PIM-I, and the methods of this invention, are effective for inducing cellular proliferation, and protecting cells from hypoxia and cellular apoptosis; and to express PIM-I kinase to protect cardiomyocytes from hypertrophy and/or inhibit myocardial apoptosis induced by infarction, reducing infarct size.
- PIM-I was originally identified as a proto-oncogene and subsequently found to be a highly conserved serine / threonine kinase. Unlike other serine / threonine kinases (e.g. Akt, MAPK, PKA or PKC), PIM-I phosphotransferase activity is not regulated by upstream kinases - it is active in nascent translated form. Thus, PIM-I activity is regulated by concerted control of gene transcription, mRNA translation, and protein degradation. The target phosphorylation consensus sequence for PIM-I is found in proteins mediating transcription, cell growth, proliferation, and survival.
- serine / threonine kinases e.g. Akt, MAPK, PKA or PKC
- PIM-I overexpression alone is not highly oncogenic, it does predispose cells to transformation upon exposure to mutagens. 8 ' 9
- PIM-I up- regulation enhances cell survival whereas loss of PIM-I increases apoptotic cell death.
- the protective effect of PIM-I is dependent upon kinase activity as borne out by experiments using a dominant negative kinase dead mutant construct.
- 10 ' 11 Occasional exceptions wherein PIM-I activity increases cell death seem to result from differences in the cellular backgrounds where PIM-I was studied. Increased PIM-I expression also associated with cellular differentiation 4 ' 12 ' 13 as well as proliferation. 14 ' 15
- Studies with myocardium demonstrate changes in PIM-I expression during postnatal development and aging that form the basis of studies for this invention.
- PIM-I expression is stimulated by a variety of hormones, cytokines and mitogens, many of which are associated with cardioprotective signaling. 16 ' 17 These multiple inductive stimuli lead to an accepted survival kinase in the myocardium: Akt/PKB.
- Akt/PKB Akt/PKB
- the connection of Akt-mediated effects to PIM-I mediated signaling has been overlooked.
- expression of PIM-I is increased by Akt activation and studies using LY294002 to block PI3-K activity were also inadvertently inhibiting PIM-I kinase activity as well. 5
- PIM-I is a downstream effector of many cytokines that operate through "Signal Transducers and Activators of Transcription" known by the STAT acronym. Both STAT3 or STAT5 bind directly to the PIM-I promoter and induce expression. PIM-I expression is inhibited by negative feedback loop regulatory control of the Jak/STAT pathway through interaction with Suppressors Of Cytokine Signaling (also known as SOCS). 1 PIM-I protein stability is also decreased through action of serine/threonine phosphatase PP2a.
- PIM-I is expressed in cardiomyocytes exposed to cardioprotective stimuli. Unlike Akt, PIM-I is constitutively active and regulated by protein production / degradation rates. Constitutive low level production of PIM-I is detectable in cardiomyocytes under basal conditions both in cultured cells as well as normal myocardium.
- Figure 1 illustrates immunoblots demonstrating that cardioprotective stimuli induces
- Pim-1 expression Cultured neonatal rat cardiomyocytes were treated with various factors to increase Pim-1 protein level as indicated above each lane including IGF-I, PMA, dexamethasone, and forskolin. Induction is evident in response to IGF-I , PMA and dexamethasone, whereas forskolin has no discernable effect. Similarly, other stimuli including phenylephrine, endothelin-1, or estradiol did not markedly increase Pim-1 protein expression in this time frame of exposure, which was two hours.
- PIM-1 is induced in cardiomyocytes in response to cardiomyopathic injury.
- Low level PIM-1 expression is markedly increased following cardiomyopathic challenge in hearts of mice subjected to either infarction by coronary occlusion or pressure overload resulting from transverse aortic constriction (TAC) at four days after procedures.
- TAC transverse aortic constriction
- PIM-1 is concentrated within the nuclei of selected cardiomyocytes in chronic heart failure from a genetically engineered mouse model (tropomodulin overexpressing transgenic 34 ).
- PIM-1 protein level is elevated relative to sham-operated control mice. The elevation of PIM-1 under these circumstances is presumably mediated by paracrine cytokine signaling within the challenged myocardium.
- FIG. 2 illustrates confocal micrographs showing that cardiomyopathic stimuli induce Pim-1 expression in surviving myocardium.
- Confocal micrographs show induction of Pim-1 protein expression relative to sham-operated controls (Sham) in response to acute myocardial injury induced four days after infarction in the border zone (MI) or near vasculature after pressure overload after four days (TAC).
- MI border zone
- TAC near vasculature after pressure overload after four days
- Both acute injury models show accumulation of Pim-1 in perinuclear areas
- a genetically engineered transgenic model of chronic dilated cardiomyopathy shows Pim-1 accumulation within select nuclei (TOT). Sections were labeled with antibody to Pim-1 (green), phalloidin to decorate actin filaments (red), and TOPRO dye for nuclei (blue).
- Widefield view upper row
- selected regions shown in higher magnification to reveal cellular detail lower row.
- FIG. 3 graphically illustrates data showing that Pirn- 1 preserves hemodynamic function in ischemia-reperfusion injury.
- Hearts harvested from mouse normal (FVB, green or upper line) as well as genetically engineered lines lacking Pim-1 (PIM-I ko, pink or lower line) or Pim-1, 2, and 3 (PIM 1,2,3 ko; blue or middle line) were subjected to ischemia reperfusion challenge and hemodynamic recovery of function was assessed as previously described.
- 32 Pirn knockout mouse lines show significant impairment (p ⁇ 0.01 for time points beyond one hour of reperfusion).
- PIM-1 expression is developmentally regulated in postnatal growth. Elevation of PIM-1 in postnatal development is consistent with our observation that PIM-1 promotes growth and proliferation of cardiomyocytes in the postnatal heart. In addition, we have also observed PIM- 1 expression in cardiac progenitor cells of adult hearts coincident with c-kit and Sca-1 stem cell markers. Correlation of PIM-1 expression in stem cell populations would be consistent with observations from hematopoeitic cell biology demonstrating PIM-1 plays a role in proliferation and survival. '
- FIG. 4 illustrates immunoblots demonstrating Pim-1 expression is highest in postnatal hearts and decreases with age. Immunoblot showing Pim-1 protein expression at the indicated weeks after birth: data including samples from less than one week, and 2, 3, 4, 5, 8, 12, 19 and 39 weeks of age. Actin is shown as a loading control to verify comparable protein sample concentration between lanes.
- PIM-1 is expressed by recombinant adenoviral vectors. Overexpression of PIM-1 or dominant-negative PIM-1 lacking kinase activity has been accomplished by creation of adenoviral vectors. We have engineered these constructs with GFP fluorescent tags to track their expression without the need for anti-PIM-1 antibodies, allowing to directly visualize exogenous protein expression. These constructs have been valuable for understanding the effects of PIM-1 accumulation in cardiomyocytes.
- Figure 5 illustrates immunoblots demonstrating Pim-1 expression in cardiomyocytes from recombinant adenoviral vectors.
- Cardiomyocytes were infected (or not infected, noting the "non- infected” control) with GFP-tagged constructs of Pim-1 in wild-type (GFP-Pimwt) or kinase-dead (GFP-PimDN) forms (and GFP only).
- GFP-Pimwt wild-type
- GFP-PimDN kinase-dead
- Apparent mobility of GFP-fusion constructs (-65 kDa) differs from native Pim-1 (approximately 33 kDa).
- GAPDH shown to demonstrate comparable loadings between lysates.
- PIM-1 overexpression protects against apoptotic challenge with doxorubicin.
- Overexpression of PIM-1 in cultured cardiomyocytes inhibits apoptosis resulting from exposure to doxorubicin as measured by TUNEL labeling.
- Neonatal rat cardiomyocyte cultures were infected with recombinant adenoviruses expressing GFP, PIM-1 wild-type (PIMwt), or PIM-1 dominant negative (DN) overnight prior to apoptotic stimulation with doxorubicin.
- non-infected cells (NI) or GFP-expressing cells show comparable TUNEL labeling following doxorubicin treatment, whereas PIMwt expressing cells show significant reductions of TUNEL positive nuclei (p ⁇ 0.05).
- Cells expressing the DN construct show enhanced TUNEL labeling.
- the mutant kinase-dead PIM-1 construct accumulates to lower protein levels than PIM-1 wild-type, yet significantly increases apoptosis compared to GFP-expressing control cells.
- Figures 6 and 7 show how Pim-1 inhibits apoptosis in cardiomyocytes.
- Neonatal rat cardiomyocyte cultures were infected with recombinant adenoviruses expressing GFP, Pim-1 wild-type (Pimwt), or Pim-1 dominant negative (DN) overnight prior to apoptotic stimulation with doxorubicin.
- NI non-infected cells
- GFP-expressing cells show comparable TUNEL labeling following doxorubicin treatment
- Pimwt expressing cells show significant reductions of TUNEL positive nuclei (p ⁇ 0.05).
- Figure 7 illustrates a micrograph demonstrating that cells expressing the DN construct show enhanced TUNEL labeling; while Figure 6 shows quantitative results, the Figure 7 panels illustrate representative fields of infected cardiomyocytes showing GFP fluorescence (green) overlay with actin filaments revealed by phalloidin (red) in GFP only, GFP-Pim-wt and GFP-Pim-DN samples.
- PIM-1 overexpression promotes anti-apoptotic signaling via cascades involving Bcl-2 family members as well as Mdm2. Overexpression of PIM-1 increases accumulation of Bcl-2 and BcI-XL family members, both of whom antagonize intrinsic apoptotic signaling by preserving mitochondrial integrity, as illustrated in Figure 8A.
- Additional signaling to promote survival induced by PIM-1 includes accumulation of Mdm2 and phosphorylation of Bad. Mdm2 antagonizes p53-dependent cell death 36 and Bad phosphorylation inhibits the pro-apoptotic action of this protein. 26 Thus, PIM-I impacts upon cell survival by promoting the anti-apoptotic action of Bcl-2 family members as well as enhancing Mdm2.
- PIM-I expression is induced by nuclear accumulation of activated Akt.
- Induction of PIM-I promoter activity by Akt kinase indicates that PIM-I expression lies downstream of Akt activation. 18 This observation has now been validated in both transgenic mouse hearts expressing nuclear-targeted Akt (as illustrated in Figure 8B) as well as cultured cardiomyocytes infected with an adenoviral vector expressing nuclear-targeted Akt.
- Figures 8 A and 8B illustrate that nuclear accumulation of Akt induces expression of Pirn- 1 kinase in the myocardium: Immunoblot (Figure 8A) and confocal microscopy (Figure 8B) of sections from 6 month old normal (NTG) and transgenic mice expressing cardiac-specific nuclear-targeted Akt. 38 Separated grayscale images in scans correspond to pim-1, actin, and nuclei that correspond to the overlay colors of green, red, and blue respectively. Nuclear accumulation of Akt promotes increased PIM-I expression detectable by both immunofluorescence as well as immunoblot analyses. The implications of this result are profound for survival signaling in the myocardium, since inhibition of Akt activation would also lead to reduction in PIM-I levels.
- Figure 9 illustrates that nuclear accumulation of Akt induces Pim-1 expression.
- Figure 9(A) illustrates a confocal microscopy of cultured cardiomyocytes infected with adenoviruses expressing nuclear-targeted ⁇ -galactosidase (B-gal), Akt wild-type (Akt wt), or nuclear targeted Akt (Akt-nuc) detected with myc-tag antibody (Tag).
- B-gal nuclear-targeted ⁇ -galactosidase
- Akt wt nuclear-targeted ⁇ -galactosidase
- Akt-nuc nuclear targeted Akt
- Figure 9(B) illustrates an immunoblot blot showing increased Pim-1 expression in cardiomyocyte cells infected with adenovirus encoding nuclear-targeted Akt (Akt-nuc). GAPDH is shown to show comparable loading between samples. Loss of PIM-I activity results in compensatory elevation of Akt. Previously documented overlaps between PIM-I and Akt in terms of functional effects and crosstalk warrant further investigation to determine the role of PIM-I kinase in myocardial biology. Experiments using adenoviruses expressing PIM-I in either wild-type or dominant negative forms demonstrate that loss of PIM-I signaling leads to elevation of Akt protein expression and activity.
- Figure 10 illustrates an immunoblot blot showing expression of dominant negative Pim-1 prompts Akt accumulation in cardiomyocytes.
- Immunoblot showing infection of neonatal rat cardiomyocytes with adenoviruses expressing Pim-1 in either wild type (wt) or dominant-negative (DN) forms.
- wt wild type
- DN dominant-negative
- Levels of phospho-Akt 473 as well as total Akt protein levels are elevated in lysates prepared from the cells expressing DN Pim-1.
- Two separate sets of experimental results are shown with controls of uninfected cells (NI), GFP-expressing cells (GFP), and GAPDH loading controls to standardize for variation in protein loading between samples.
- Figure 11 illustrates data characterizing founder lines and protein expression in Pim-1 transgenic mice.
- PIM-I a serine/threonine kinase with a role in cell survival, proliferation, differentiation, and tumorigenesis. J Vet Sci. 2001; 2: 167-179.
- Atrial natriuretic peptide promotes cardiomyocyte survival by cGMP-
- PHLPP a phosphatase that directly dephosphorylates Akt, promotes apoptosis, and suppresses tumor growth. MoI Cell. 2005; 18:13-24.
- Plank DM Plank DM
- Sussman MA Impaired intracellular Ca2+ dynamics in live cardiomyocytes revealed by rapid line scan confocal microscopy. Microsc Microanal. 2005; 11 : 235-43.
- ROS reactive oxygen species
- Pim-1 kinase exerts potent cardioprotective effects in the myocardium downstream of AKT, and that PIM-1 plays a role in cardiac hypertrophy.
- Cardiac-specific expression of Pim-1 (Pim-wt) or the dominant-negative mutant of Pim-1 (Pim- 0 DN) in transgenic mice together with adeno viral-mediated overexpression of these Pim-1 constructs was used to delineate the role of Pim-1 in hypertrophy.
- Transgenic overexpression of Pim-1 protects mice from pressure overload induced hypertrophy relative to wild-type controls as evidenced by improved hemodynamic function, decreased apoptosis, increases in anti- hypertrophic proteins, smaller myocyte size, and inhibition of hypertrophic signaling after 5 challenge.
- Pim-1 overexpression in neonatal rat cardiomyocyte cultures inhibits hypertrophy induced by endothelin-1.
- hearts of Pim-wt mice show enhanced incorporation of BrdU into myocytes as well as a hypercellular phenotype compared to wild-type controls after hypertrophic challenge.
- transgenic overexpression of Pim-DN leads to dilated cardiomyopathy characterized by increased apoptosis, fibrosis, and 0 severely depressed cardiac function.
- overexpression of Pim-DN leads to reduced contractility as evidenced by reduced Ca 2+ transient amplitude and decreased percent cell shortening in isolated myocytes.
- Pim- wt phosphorylates the transcription factor GATA-I and induces GATA-I luciferase reporter expression in C2C12 myoblasts, with increasing titration of Pim-DN inhibiting GATA-I activity.
- in- vitro kinase assays confirmed activity of our Pim-wt construct using whole heart lysates that were prepared from GFP-Pim-1-wt, GFP-Pim-1-DN transgenic mice and non-transgenic (NTG) mice.
- GFP- Pim-1 proteins (wt or KD) were immunoprecipitated from whole heart lysates and incubated in the presence of [ ⁇ -32P] ATP with GST-p21 as substrates. Samples were resolved on SDS- PAGE, and 32 P-labeled proteins were detected by autoradiography. Pim-wt overexpression phosphorylates p21 while this activity was abolished in the Pim-DN construct.
- Pim-1 inactivation increases cardiomyocyte apoptosis and fibrosis
- FIG. 12 Hearts from mice created with genetic deletion of Pim-1 (Pim-1 KO) exhibit increased apoptosis in myocytes relative to NTG (non-transgenic) controls but show no evidence of overt cardiomyopathic remodeling (12).
- Pim-DN overexpressing mice suffer from cardiomyopathy characterized by progressive wall thinning beginning at 3-4 months of age.
- Figure 12 compares the characteristics of the wild-type NTG mice with the mice lacking active PIM-1.
- Fig. 12a echocardiographic measurement of posterior wall dimension over time shows the PIM-DN mice have a progressive thinning. This is also seen in the anterior wall dimension in Figure 12b.
- Figure 12c the heartbody weight ratio at 10 and 22 weeks after birth is also significantly increased in the PIM-DN mice.
- Pim-DN overexpression induces cardiomyocyte apoptosis in vitro (12)
- assessment of apoptotic myocytes in the myocardium of Pim-DN animals was performed by TUNEL staining.
- Pim-DN animals exhibit a two-fold increase in apoptotic cardiomyocytes per mm 2 relative to age-matched controls (1.2/mm 2 and 2.4/mm 2 respectively, Figure 12d **p ⁇ 0.01) resulting in increased fibrosis and collagen deposits in the left ventricle.
- the amount of necrosis was quantified (**p ⁇ .01) and found to be significantly increased at basal levels in Pim-DN animals.
- Figure 12 graphically illustrates data showing that inactivation of Pirn- 1 in the myocardium increases apoptosis and fibrosis.
- Hearts of Pim-DN mice show progressive dilation from 17 weeks of age (*p ⁇ 0.05) with attendant depression of fractional shortening and ejection fraction (36.6% and 74.2% respectively) by 27 weeks of age (*p ⁇ 0.05, **p ⁇ 0.01) by echocardiographic analyses. Morphometric analysis performed on both NTG and Pim-DN hearts additionally confirmed that Pim-DN hearts were significantly dilated. In vivo hemodynamic assessments verified impaired hemodynamics with diminished ⁇ dP/dt, increased left-ventricular end diastolic pressure (LVEDP), and decreased left-ventricular developed pressure (LVDP). Mechanistically, Pim-DN myocytes displayed reduced Ca 2+ transient amplitude coupled with decreased percent cell shortening in respect to NTG myocytes.
- FIG. 13 shows individual cell surface area measurements from uninfected control, EGFP, and Pirn- wt infected neonatal rat cardiomyocyte cultures treated and untreated with endothelin-1.
- Pim-wt overexpression inhibits ET-I induced hypertrophy (*p ⁇ 0.05, **p ⁇ 0.01) as assessed by cell surface area measurements relative to the increase in cell size seen in control and EGFP infected myocytes treated with ET-I .
- Molecular profiling of the hypertrophic signature of untreated cultures shows that Pim-wt expression decreases mRNA levels for atrial natriuretic peptide (ANP) by 60.6% and B-type natriuretic peptide (BNP) by 39.8% while increasing ⁇ -skeletal actin levels 89% compared to EGFP infected controls.
- Pim-wt cultures exhibit a 2.5-fold increase in ANP levels and 10.2-fold decrease in ⁇ -myosin heavy chain levels versus ET-I treated EGFP controls.
- cultured cardiomyocytes overexpressing Pim-DN protein show diminished viability after the necessary time course to infect and treat with ET-I as evidenced by high levels of TUNEL positive cells.
- cardiomyocytes overexpressing Pim-DN protein begin to round up and detach from the plate, their morphology is drastically changed, thereby preventing an accurate assessment of cell size (12).
- the effect of Pim-DN on hypertrophy can be seen using the specific Pim-1 activity inhibitor quercetagetin.
- Pim-1 expressing NRCM cultures were treated for 1 hour with or without 1OnM quercetagetin prior to 48 hour incubation with ET- 1 and cell size assessment.
- Cells treated with quercetagetin and ET-I had significantly larger surface compared to ET-I stimulated cells where Pim-1 activity was not blunted by inhibitor.
- Figure 13 graphically illustrates data showing that Pim-1 overexpression protects cardiomyocytes from endothelin-1 induced hypertrophy.
- Pim-1 overexpression inhibits remodeling induced by pressure overload hypertrophy
- Pim-wt TAC fractional shortening
- FS fractional shortening
- ejection fraction after challenge
- myocardial function is maintained in Pim-wt hearts
- Figures 14e-14f **p ⁇ 0.01 vs. Pim-wt TAC
- FIG. 14e-14f shows marked decreases in both fractional shortening (FS) and ejection fraction after challenge
- myocardial function is maintained in Pim-wt hearts
- Pim-1 protein is modestly elevated in response to pressure overload during early hypertrophy and progression to heart failure. Endogenous levels of Pim-1 expression increase early during adaptive hypertrophy and decline shortly thereafter, while during late -phase hypertrophy (9 weeks post-TAC), Pim-1 appears localized to nuclei within vasculature.
- Figure 14 graphically illustrates data showing Pim-wt transgenic animals are resistant to pressure overload induced hypertrophy.
- Pim-wt hearts are resistant to TAC induced hypertrophy NTG mice exhibit significant increases in heart size and succumb at a significantly faster rate compared to Pim-wt transgenic mice following TAC challenge.
- Molecular mRNA markers of hypertrophy including ANP, BNP, ⁇ -skeletal actin ( ⁇ SKA), ⁇ -myosin heavy chain ( ⁇ -MHC) and c-fos are significantly increased in NTG TAC challenged hearts compared to shams.
- molecular hypertrophic markers are not significantly increased in hearts of Pim-wt mice subjected to TAC challenge, although Pim-wt hearts do express more c-fos mRNA under basal conditions.
- Pim-wt TAC banded hearts have significantly increased levels of anti-apoptotic proteins including Bcl-xl, Bcl-2, and increased phosphorylation of BAD relative to NTG counterparts.
- FIG. 15a-c illustrate an in vivo hemodynamic assessment of NTG and Pim-wt hearts 4 and 10 weeks (black and gray bars respectively) after sham or TAC operation (14 and 20 weeks of age respectively).
- Figure 15a shows ⁇ dP/dt measurements;
- Figure 15b shows left ventricular developed pressure (LVDP), and
- Figure 15c illustrates left ventricular end-diastolic pressure (LVEDP).
- Figure 15 graphically illustrates data showing that Pim-1 enhances cardiac function.
- Figure 15a-c In vivo hemodynamic assessment of NTG and Pim-wt hearts 4 and 10 weeks (black and gray bars respectively) after sham or TAC operation (14 and 20 weeks of age respectively). ⁇ dP/dt measurements ( Figure 15a), left ventricular developed pressure (LVDP, b), left ventricular end-diastolic pressure (LVEDP, Figure 15c).
- LVDP left ventricular developed pressure
- LVEDP left ventricular end-diastolic pressure
- Pim-wt hearts possess 67% more BrdU+ myocytes relative to NTG controls after TAC challenge.
- the majority of BrdU+ cells in Pim-wt hearts post-TAC are diploid, supporting the premise that increases in BrdU+ cells stemmed from new myocyte formation and not enhanced DNA synthesis in pre-existing cells.
- Pim-wt hearts also show increased levels of phosphorylated phospholamban (PLB) while Pim-DN animals show significant decreases in phospho-PLB compared to NTG control animals.
- Pim-1 increases myocardial cellularity
- the volume and cellularity of myocytes resulting from myocardial Pim-1 overexpression was assessed by quantitation of myocyte volume distribution. Results show Pim-wt hearts possess an increased percentage of small myocytes relative to NTG controls that is also reflected in decreased average myocyte size in these hearts, resulting in a hypercellular phenotype of approximately 33% more myocytes in Pim-wt compared to NTG. Additionally, isolated Pim- DN myocytes were 11% larger than NTG myocytes, indicating an inverse effect wherein impaired Pim-1 activity prompts formation of larger myocytes in the transgenic heart.
- Pim-1 contributes to Akt- mediated blunting of hypertrophic remodeling.
- Pim-1 is only upregulated in localized regions close to acute injury or damage and is not increased throughout the myocardium until initiation of transit to end stage failure.
- Pim-1 likely serves as a survival and protective response to blunt maladaptive hypertrophic remodeling in early phases of reactive signaling.
- Pim-1 elevation occurring in late stage decompensation probably represents a terminal effort to preserve function, although beneficial effects can be overridden by the sequelae of end stage failure.
- the differential expression of endogenous Pim-1 during transition from adaptive to maladaptive hypertrophy possibly represents a mechanism by which Pim-1 exerts cardioprotection.
- Pim-wt transgenic hearts exhibit persistent blunting of myocardial hypertrophy (see e.g., Figure 14) without increases in apoptosis, changes in hypertrophic signaling markers or deterioration of function (see e.g., Figure 15).
- Pim-wt transgenic hearts perform significantly better functionally than NTG counterparts at 14 and 20 weeks of age (see e.g., Figure 15).
- a potential basis for this remarkable resiliency to pressure overload is in part related to Pirn- 1 -mediated induction of sarco/endoplasmic reticulum Ca +2 ATP-ase 2a (SERC A2a) (12) and phospholamban (PLB) expression.
- SESC A2a sarco/endoplasmic reticulum Ca +2 ATP-ase 2a
- PLB phospholamban
- Pim-1 Overexpression of Pim-1 in the pathologically challenged myocardium results in numerous salutary effects including decreased apoptosis, increased expression of anti-apoptotic proteins, and decreased fibrosis and necrosis. Pim-1 also increases the percentage of small myocytes and an overall increase in the number of myocytes constituting the myocardium. Consequently, PIM-1 overexpression provides an increased capacity to withstand TAC challenge by virtue of increased cell numbers of small cells and decreased cell death.
- Pim-1 Genetic Ablation of Pim-1 increases infarction injury.
- Protective effects of Pim-1 were assessed following MI in Pim-KO animals.
- Left ventricular free wall infarct size is increased 22.7% in Pim-KO hearts compared to wild type controls.
- Fig. 5a Pim-KO mice possess a minor but significant increase in TUNEL positive myocytes in the left ventricle relative to wild type controls (Table S2, $p ⁇ 0.01), and this differential is exacerbated following MI up to a 4.0 fold increase in TUNEL positive myocytes relative to wild-type samples (Fig. 5b **p ⁇ 0.01).
- Hemodynamic performance is comparable between Pim-KO and wild type controls under normal conditions (Fig.
- Pim-KO mice were noted to possess decreased lymphocyte proliferation and hematopoetic cell differentiation 13"15 that could possibly decrease inflammatory responses following MI, but no significant differences were found in circulating c-kit+ cell number after MI or c-kit+/sca-l+ bone marrow cell number pre or post-MI (Fig. S5). Likewise, inflammatory cell recruitment following MI as indicated by CD45 staining is comparable between Pim-KO hearts versus controls (Fig. S5).
- Pim-KO hearts exhibit altered protective signaling.
- Pim-1 may be a relatively promiscuous kinase based upon minimal target substrate recognition sequence requirements 16 and capacity for autophosphorylation 17 , so molecular mechanisms responsible for Pim-1 -mediated cardioprotection were examined.
- Pim-1 -KO heart samples possess increases in phospho-AKT (90.72%), phospho- AKT S473 (2.76-fold), total AKT (2.10-fold), phospho-STAT3 Y705 (2.61 -fold), total STAT3 (68.6%) and Pim-2 (4.6-fold) relative to wild type samples.
- phospho-AKT 90.72%
- phospho- AKT S473 2.76-fold
- total AKT 2.10-fold
- phospho-STAT3 Y705 2.61 -fold
- total STAT3 68.6%
- Pim-2 4.6-fold
- Figure 16 graphically illustrates data demonstrating that Pim-1 protects against infarction injury.
- Figure 16a graphically illustrates a histogram representing infarct size 7 days post-MI as a percent of left- ventricular free wall in Pim-KO hearts (*p ⁇ 0.05 v NTG MI).
- Figure 16b graphically illustrates data showing the number of TUNEL positive myocytes per mm 2 7 days post-MI in Pim-KO hearts (**p ⁇ 0.01).
- Figure 16c graphically illustrates in vivo hemodynamic measurements of NTG and Pim-KO mice 5 days following MI (*p ⁇ 0.05).
- Left ventricular developed pressure (LVDP) left ventricular end-diastolic pressure (LVEDP), and ⁇ change in pressure over change in time.
- Figure 16e graphically illustrates Immunoblot quantitation of survival protein levels 7 days post-infarction in Pim-KO and NTG control hearts (*p ⁇ 0.05 vs. sham, #p ⁇ 0.01 vs. sham, $p ⁇ 0.01 vs. NTG MI).
- Figure 16g graphically illustrates the number of TUNEL-labeled CM/m2 in LV 10 days after MI. Materials and Methods
- Pim-wt and Pim-DN cDNA fragments (16) were subcloned into the ⁇ -MHC plasmid for transgenesis.
- Prior publications describe methods for TAC banding and echo (9), as well as HW:BW ratio determination and hemodynamics (12). Further details provided in the online supplement. All animal studies were approved by the Institutional Animal Use and Care Committee.
- GFP-Pim-1 proteins immunoprecipitated from heart Iy sates were used in an in vitro kinase assay with GST-p21 as substrate.
- C2C12 cells transfected with indicated plasmids and pGATA-Luc reporter construct were analyzed for GATA-dependent luciferase activity.
- Methods for immunofluorescence microscopy were done as described in reference 26, listed below, immunoblotting were done as described in reference 24, listed below, quantitative RT-PCR and TUNEL ("terminal deoxynucleotidyl transferase-mediated dUTP- biotin nick end labeling") staining were done as described in reference 9, listed below.
- Neonatal rat cardiomyocyte cultures were prepared as described previously (10).
- Adult myocyte isolation, volume calculations, cell shortening and Ca transient experiments performed as previously described in references 12, 22, 25, listed below.
- Pim-1 a serine/threonine kinase with a role in cell survival, proliferation, differentiation and tumorigenesis. J Vet Sci 2, 167-79.
- Pim-1 associates with protein complexes necessary for mitosis Chromosoma 111, 80-95.
- Pim-1 increases the proliferation of cardiac progenitor cells
- CGW-Pim-wt CPCs cardiac progenitor cells
- the number of viable cells was determined by trypan blue exclusion over a six day time course (Figure 17A).
- CGW-Pim-wt CPCs continued to expand significantly over that of CGW (p ⁇ .05) and non-treated (p ⁇ 001) CPCs.
- CGW-Pim-wt CPCs also exhibited an increased metabolic rate over CGW CPCs at one (p ⁇ .001) and three days (p ⁇ .001), as determined by MTT assay (Figure 17B).
- a specific Pim-1 activity inhibitor, Quercetagentin was used to confirm that the growth advantage acquired by CGW-Pim-wt CPCs was due to overexpression of Pim-1.
- the Pim-1 inhibitor significantly decreased the growth rate of CGW-Pim-wt CPCs at day two and three (p ⁇ .001) compared to untreated CGW-Pim-wt CPCs ( Figure 17C).
- Figure 17 illustrates data showing increased proliferative rate of Pim-1 engineered CSCs:
- Figure 17A illustrates a cell growth assessment using trypan blue assay of control, CGW, and CGW-Pim-wt transduced CPCs;
- mice were followed for 12 weeks post infarction.
- mice that received CGW-Pim-wt CPCs maintained EF and FS (Fig. 18B, C), and were statistically improved over CGW CPC injected mice.
- CGW CPCs failed to maintain cardiac function (FS and EF) and were not statistically different than those animals that received saline injections.
- echocardiography again indicated that CGW-Pim-wt CPC injected animals continued to maintain EF and FS, whereby animals that received control CPCs had a 2-fold and 1.6-fold decrease, respectively (Fig. 18B, C).
- Figure 18 graphically illustrates data showing that intra-myocardial injection of Pirn- 1 expressing CPCs improves cardiac function.
- Figure 18A-C graphically illustrates electrocardiographic assessment of AWD ( Figure 18A), EF ( Figure 18B), and FS ( Figure 18C), in sham ( ⁇ ), PBS injected (•), CGW (A), and CGW-Pim-WT ( ⁇ ) cardiac progenitor cells 12 weeks post CPC transplantation. Echocardiography measurements represent n>9 animals for each group.
- Figure 18 D-F graphically illustrates in vivo hemodynamic measurements of left ventricular developed pressure (LVDP) (18D), left ventricular end diastolic pressure (LVEDP) (18E), and dP/dT maximum and minimum (18F) were used to assess cardiac function 12 weeks post-intramyocardial injection of PBS, eGFP, and Pim-1 expressing CPCs (n> 5).
- ANOVA statistical tests were run for echocardiography and in- vivo hemodynamic measurements, using Tukey's post-hoc test. Results are represented as mean ⁇ SEM. Injection of Pim-1 modified CPCs results in a reduction of infarct size
- Figure 20 graphically illustrates that long term cardiac functional recovery is afforded by CGW-Pim-wt expressing CPCs 32 weeks after intra-myocardial injection:
- Figure 20A-C illustrates electrocardiographic assessment of FS (Figure 20A), EF ( Figure 20B), and AWD ( Figure 20C), in sham ( ⁇ ), PBS injected (•), CGW (A), and CGW-Pim-WT ( ⁇ ) cardiac progenitor cells 32 weeks post CPC transplantation. Echocardiography measurements represent an n>7 animals for each group.
- Vectors are bicistronic whereby the MND promoter drives Pim-1 expression and the reporter, enhanced green florescent protein (eGFP), is driven off a viral internal ribosomal entry site (vIRES). All constructs are third generation self-inactivating (SIN) lentiviral vectors and incorporate several elements to ensure long-term expression of the transgene.
- the MND (MND, myeloproliferative sarcoma virus LTR-negative control region deleted) promoter allows for high expression of the transgene, while the LTR allows for long-term expression after repeated passage.
- the vectors also include (IFN)- D -scaffold attachment region (SAR) element. The SAR element has been shown to be important in keeping the vector transcriptionally active by inhibiting methylation and protecting the transgene from being silenced.
- a bicistronic lentiviral vector was designed to deliver the human Pim-1 gene, CGW-Pim-wt, as well as a control vector, CGW (Fig. SlA).
- CGW a control vector
- Expression of the Pim-1 gene is controlled through a myeloproliferative sarcoma virus LTR-negative control region deleted (MND) promoter, while the eGFP reporter is driven off of a viral internal ribosomal entry site (vIRES).
- MND myeloproliferative sarcoma virus LTR-negative control region deleted
- vIRES viral internal ribosomal entry site
- Figure 21 illustrates an exemplary lentiviral constructs of the invention for e.g., gene expression in cardiac progenitor cells, e.g., gene expression in c-kit+ cardiac progenitor cells (CPCs).
- the figures illustrates a self-inactivating (SIN) lentiviral vectors, termed CGW (GFP control) and CGW-Pim-wt; they were designed such that the Pim-1 gene is driven off an MND promoter while the eGFP reporter is driven off an internal ribosomal entry site.
- CGW self-inactivating
- the following sequence is an exemplary lentiviral vector backbone for practicing the invention, e.g., to express PIM-1 in a cell, including a human cell, e.g., a stem cell or a cardiac or myocyte cell.
- the invention provides compositions and methods comprising use of PIM-expressing nucleic acids and PIM polypeptides.
- the Human PIM-I protein is used to practice the compositions and methods of this invention; an exemplary Human PIM-I protein that can be used is Genbank accession no. AAA36447 (see also, e.g., Domen (1987) Oncogene Res. 1
- a Human PIM-I protein isoform is used to practice the compositions and methods of this invention;
- an exemplary Human PIM-I protein isoform that can be used is the human pim-1 kinase 44 kDa isoform, see e.g., Genbank accession no. AAY87461 (see also, e.g., Xie (2006) Oncogene 25 (1), 70-78) (SEQ ID NO:6):
- a Human PIM-I message (mRNA) is used to practice the compositions and methods of this invention; an exemplary Human PIM-I message that can be used is Genbank accession no. NM_002648 (see also, e.g., Zhang (2007) MoL Cancer Res. 5 (9), 909-922) (SEQ ID NO:7): 1 cccgagagga gtcggtggca gcggcggcgg cgg cgggaccggc agcagcagca gcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcagcag
- a Human PIM-I gene is used to practice the compositions and methods of this invention; an exemplary Human PIM-I gene that can be used is (SEQ ID NO: 8):
- gagggagtcg tggctgggct cagcacgccg ccaccctgac ttcctcgcct ccgcctgcgt
- exemplary Human PIM-I polypeptides and message that can be used are:
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Developmental Biology & Embryology (AREA)
- Cell Biology (AREA)
- Virology (AREA)
- Epidemiology (AREA)
- Cardiology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Hematology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Hospice & Palliative Care (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP08850768.6A EP2209889B1 (en) | 2007-11-16 | 2008-11-14 | Compositions for manipulating pim-1 activity in cardiac cells |
| CA2705862A CA2705862C (en) | 2007-11-16 | 2008-11-14 | Compositions and method for manipulating pim-1 activity in circulatory system cells |
| JP2010534249A JP2011503207A (ja) | 2007-11-16 | 2008-11-14 | 循環系細胞におけるpim−1活性を操作するための組成物および方法 |
| US12/742,871 US8617534B2 (en) | 2007-11-16 | 2008-11-14 | Compositions and method for manipulating PIM-1 activity in circulatory system cells |
| US14/082,760 US20140234265A1 (en) | 2007-11-16 | 2013-11-18 | Compositions and method for manipulating pim-1 activity in circulatory system cells |
| US15/078,854 US20160324936A1 (en) | 2007-11-16 | 2016-03-23 | Compositions and method for manipulating pim-1 activity in circulatory system cells |
| US16/104,047 US20190060417A1 (en) | 2007-11-16 | 2018-08-16 | Compositions and method for manipulating pim-1 activity in circulatory system cells |
| US17/219,749 US20210322522A1 (en) | 2007-11-16 | 2021-03-31 | Compositions and method for manipulating pim-1 activity in circulatory system cells |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US98875307P | 2007-11-16 | 2007-11-16 | |
| US60/988,753 | 2007-11-16 | ||
| US9169808P | 2008-08-25 | 2008-08-25 | |
| US61/091,698 | 2008-08-25 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/742,871 A-371-Of-International US8617534B2 (en) | 2007-11-16 | 2008-11-14 | Compositions and method for manipulating PIM-1 activity in circulatory system cells |
| US14/082,760 Continuation US20140234265A1 (en) | 2007-11-16 | 2013-11-18 | Compositions and method for manipulating pim-1 activity in circulatory system cells |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2009065080A1 true WO2009065080A1 (en) | 2009-05-22 |
Family
ID=40639186
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2008/083693 Ceased WO2009065080A1 (en) | 2007-11-16 | 2008-11-14 | Compositions and method for manipulating pim-1 activity in circulatory system cells |
Country Status (5)
| Country | Link |
|---|---|
| US (5) | US8617534B2 (https=) |
| EP (1) | EP2209889B1 (https=) |
| JP (2) | JP2011503207A (https=) |
| CA (1) | CA2705862C (https=) |
| WO (1) | WO2009065080A1 (https=) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9200004B2 (en) | 2013-01-15 | 2015-12-01 | Incyte Holdings Corporation | Thiazolecarboxamides and pyridinecarboxamide compounds useful as Pim kinase inhibitors |
| EP2814513A4 (en) * | 2012-02-14 | 2016-01-13 | Univ California | SYSTEMIC ADMINISTRATION AND REGULATED EXPRESSION OF PARA RINGENES FOR CARDIOVASCULAR DISEASES AND OTHERS |
| US9278950B2 (en) | 2013-01-14 | 2016-03-08 | Incyte Corporation | Bicyclic aromatic carboxamide compounds useful as Pim kinase inhibitors |
| US9540347B2 (en) | 2015-05-29 | 2017-01-10 | Incyte Corporation | Pyridineamine compounds useful as Pim kinase inhibitors |
| US9556197B2 (en) | 2013-08-23 | 2017-01-31 | Incyte Corporation | Furo- and thieno-pyridine carboxamide compounds useful as pim kinase inhibitors |
| US9580418B2 (en) | 2014-07-14 | 2017-02-28 | Incyte Corporation | Bicyclic aromatic carboxamide compounds useful as Pim kinase inhibitors |
| US9822124B2 (en) | 2014-07-14 | 2017-11-21 | Incyte Corporation | Bicyclic heteroaromatic carboxamide compounds useful as Pim kinase inhibitors |
| US9862705B2 (en) | 2015-09-09 | 2018-01-09 | Incyte Corporation | Salts of a pim kinase inhibitor |
| US9920032B2 (en) | 2015-10-02 | 2018-03-20 | Incyte Corporation | Heterocyclic compounds useful as pim kinase inhibitors |
| US10596161B2 (en) | 2017-12-08 | 2020-03-24 | Incyte Corporation | Low dose combination therapy for treatment of myeloproliferative neoplasms |
| US20230282387A1 (en) * | 2020-09-04 | 2023-09-07 | Dexerials Corporation | Conductive layered product, optical device using same, and manufacturing method for conductive layered product |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA3067558A1 (en) | 2017-06-16 | 2018-12-20 | Avery Therapeutics, Inc. | Three dimensional tissue compositions and methods of use |
| CN108913655B (zh) * | 2018-07-16 | 2022-07-15 | 浙江大学 | 基于多能干细胞技术建立“人源性”心肌肥大模型的方法 |
| US20210386827A1 (en) * | 2018-10-15 | 2021-12-16 | Avery Therapeutics, Inc. | Cell-free compositions and methods for restoration or enhancement of tissue function |
| EP4103214B1 (en) | 2020-02-13 | 2026-04-29 | Tenaya Therapeutics, Inc. | Gene therapy vectors for treating heart disease |
Citations (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5217879A (en) | 1989-01-12 | 1993-06-08 | Washington University | Infectious Sindbis virus vectors |
| US5716928A (en) | 1995-06-07 | 1998-02-10 | Avmax, Inc. | Use of essential oils to increase bioavailability of oral pharmaceutical compounds |
| US5858401A (en) | 1996-01-22 | 1999-01-12 | Sidmak Laboratories, Inc. | Pharmaceutical composition for cyclosporines |
| US6007839A (en) | 1996-02-16 | 1999-12-28 | The Liposome Company, Inc. | Preparation of pharmaceutical compositions containing etherlipid-containing multiple lipid liposomes |
| US6063400A (en) | 1997-07-02 | 2000-05-16 | Sdg, Inc. | Targeted liposomal constructs for diagnostic and therapeutic uses |
| US6277633B1 (en) | 1997-05-13 | 2001-08-21 | The University Of North Carolina At Chapel Hill | Lentivirus-based gene transfer vectors |
| US6312683B1 (en) | 1997-12-22 | 2001-11-06 | Oxford Biomedica (Uk) Limited | Equine infectious anemia virus vectors |
| US6312682B1 (en) | 1996-10-17 | 2001-11-06 | Oxford Biomedica Plc | Retroviral vectors |
| US20020194630A1 (en) | 1999-03-15 | 2002-12-19 | Manning William C. | Use of recombinant gene delivery vectors for treating or preventing diseases of the eye |
| US20030003582A1 (en) | 2001-05-08 | 2003-01-02 | Tranzyme, Inc. | Trans-viral vector mediated gene transfer to the retina |
| US6555107B2 (en) | 1997-09-24 | 2003-04-29 | The Regents Of The University Of California | Lentiviral nucleic acids and uses thereof |
| US20040028670A1 (en) | 1997-04-28 | 2004-02-12 | Carlson Andrew David | Activated protein C formulations |
| US20040132190A1 (en) | 1995-02-28 | 2004-07-08 | The Regents Of The University Of California | Gene therapy for myocardial ischemia |
| US20050054092A1 (en) * | 2001-07-12 | 2005-03-10 | Chunhui Xu | Process for making transplantable cardiomyocytes from human embryonic stem cells |
| US6867348B1 (en) * | 1999-12-16 | 2005-03-15 | Xenogen Corporation | Methods and compositions for screening for angiogenesis modulating compounds |
| US6924123B2 (en) | 1996-10-29 | 2005-08-02 | Oxford Biomedica (Uk) Limited | Lentiviral LTR-deleted vector |
| US20050266067A1 (en) | 2004-03-02 | 2005-12-01 | Shiladitya Sengupta | Nanocell drug delivery system |
| US7122181B2 (en) | 2000-12-19 | 2006-10-17 | Research Development Foundation | Lentiviral vector-mediated gene transfer and uses thereof |
| US20060239968A1 (en) | 2002-08-30 | 2006-10-26 | Wadih Arap | Compositions and methods of use of targeting peptides for diagnosis and therapy of human cancer |
| WO2006125321A1 (en) * | 2005-05-27 | 2006-11-30 | The Hospital For Sick Children | Modulation of the integrin linked kinase signaling pathway to promote cardiac cell proliferation and self-renewal |
| EP0934422B1 (en) * | 1996-09-05 | 2006-12-06 | The Regents of the University of California | Gene therapy for congestive heart failure |
| US7160727B2 (en) | 2003-11-20 | 2007-01-09 | University Of Iowa Research Foundation | Methods for producing and using in vivo pseudotyped retroviruses using envelope glycoproteins from lymphocytic choriomeningitis virus (LCMV) |
| US20070042031A1 (en) | 2005-07-27 | 2007-02-22 | Protiva Biotherapeutics, Inc. | Systems and methods for manufacturing liposomes |
| US7198784B2 (en) | 1996-10-17 | 2007-04-03 | Oxford Biomedica (Uk) Limited | Retroviral vectors |
| US7198950B2 (en) | 2001-10-02 | 2007-04-03 | Institut Clayton De La Recherche | Methods and compositions relating to restricted expression lentiviral vectors and their applications |
| US20070077286A1 (en) | 2003-12-24 | 2007-04-05 | Tsutomu Ishihara | Drug-containing nanoparticle, process for producing the same and parenterally administered preparation from the nanoparticle |
| US20070082042A1 (en) | 2004-08-06 | 2007-04-12 | Deok-Hoon Park | Multiple-layered liposome and preparation method thereof |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5869037A (en) * | 1996-06-26 | 1999-02-09 | Cornell Research Foundation, Inc. | Adenoviral-mediated gene transfer to adipocytes |
| WO2002057413A2 (en) * | 2001-01-18 | 2002-07-25 | The Board Of Trustees Of The Leland Stanford Junior University | Peptides for activation and inhibition of delta pkc |
| EP1361896A2 (en) * | 2001-01-23 | 2003-11-19 | Boston Scientific Corporation | Localized myocardial injection method for treating ischemic myocardium |
| CA2505251A1 (en) * | 2002-11-05 | 2004-05-27 | Brigham And Women's Hospital, Inc. | Mesenchymal stem cells and methods of use thereof |
| CN100567502C (zh) * | 2003-04-03 | 2009-12-09 | 株式会社康福来 | 药学制剂 |
| JPWO2004113367A1 (ja) * | 2003-06-24 | 2007-04-12 | 学校法人慶應義塾 | アポトーシス抑制活性を有するペプチド |
| CN101087563A (zh) * | 2004-11-08 | 2007-12-12 | 约翰霍普金斯大学 | 活检钳 |
| WO2010135401A2 (en) | 2009-05-19 | 2010-11-25 | San Diego State University Foundation | Kinase-mediated cytoprotection and enhanced cellular engraftment and persistence |
-
2008
- 2008-11-14 WO PCT/US2008/083693 patent/WO2009065080A1/en not_active Ceased
- 2008-11-14 JP JP2010534249A patent/JP2011503207A/ja active Pending
- 2008-11-14 EP EP08850768.6A patent/EP2209889B1/en active Active
- 2008-11-14 CA CA2705862A patent/CA2705862C/en active Active
- 2008-11-14 US US12/742,871 patent/US8617534B2/en active Active
-
2013
- 2013-11-18 US US14/082,760 patent/US20140234265A1/en not_active Abandoned
-
2014
- 2014-07-30 JP JP2014154915A patent/JP5795670B2/ja not_active Expired - Fee Related
-
2016
- 2016-03-23 US US15/078,854 patent/US20160324936A1/en not_active Abandoned
-
2018
- 2018-08-16 US US16/104,047 patent/US20190060417A1/en not_active Abandoned
-
2021
- 2021-03-31 US US17/219,749 patent/US20210322522A1/en not_active Abandoned
Patent Citations (31)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5217879A (en) | 1989-01-12 | 1993-06-08 | Washington University | Infectious Sindbis virus vectors |
| US20040132190A1 (en) | 1995-02-28 | 2004-07-08 | The Regents Of The University Of California | Gene therapy for myocardial ischemia |
| US5716928A (en) | 1995-06-07 | 1998-02-10 | Avmax, Inc. | Use of essential oils to increase bioavailability of oral pharmaceutical compounds |
| US5858401A (en) | 1996-01-22 | 1999-01-12 | Sidmak Laboratories, Inc. | Pharmaceutical composition for cyclosporines |
| US6007839A (en) | 1996-02-16 | 1999-12-28 | The Liposome Company, Inc. | Preparation of pharmaceutical compositions containing etherlipid-containing multiple lipid liposomes |
| EP0934422B1 (en) * | 1996-09-05 | 2006-12-06 | The Regents of the University of California | Gene therapy for congestive heart failure |
| US6312682B1 (en) | 1996-10-17 | 2001-11-06 | Oxford Biomedica Plc | Retroviral vectors |
| US6669936B2 (en) | 1996-10-17 | 2003-12-30 | Oxford Biomedica (Uk) Limited | Retroviral vectors |
| US7198784B2 (en) | 1996-10-17 | 2007-04-03 | Oxford Biomedica (Uk) Limited | Retroviral vectors |
| US7056699B2 (en) | 1996-10-29 | 2006-06-06 | Oxford Biomedia (Uk) Limited | Lentiviral LTR-deleted vector |
| US6924123B2 (en) | 1996-10-29 | 2005-08-02 | Oxford Biomedica (Uk) Limited | Lentiviral LTR-deleted vector |
| US20040028670A1 (en) | 1997-04-28 | 2004-02-12 | Carlson Andrew David | Activated protein C formulations |
| US6521457B2 (en) | 1997-05-13 | 2003-02-18 | University Of North Carolina At Chapel Hill | Lentivirus-based gene transfer vectors |
| US6277633B1 (en) | 1997-05-13 | 2001-08-21 | The University Of North Carolina At Chapel Hill | Lentivirus-based gene transfer vectors |
| US6063400A (en) | 1997-07-02 | 2000-05-16 | Sdg, Inc. | Targeted liposomal constructs for diagnostic and therapeutic uses |
| US6555107B2 (en) | 1997-09-24 | 2003-04-29 | The Regents Of The University Of California | Lentiviral nucleic acids and uses thereof |
| US6312683B1 (en) | 1997-12-22 | 2001-11-06 | Oxford Biomedica (Uk) Limited | Equine infectious anemia virus vectors |
| US6943153B1 (en) | 1999-03-15 | 2005-09-13 | The Regents Of The University Of California | Use of recombinant gene delivery vectors for treating or preventing diseases of the eye |
| US20020194630A1 (en) | 1999-03-15 | 2002-12-19 | Manning William C. | Use of recombinant gene delivery vectors for treating or preventing diseases of the eye |
| US6867348B1 (en) * | 1999-12-16 | 2005-03-15 | Xenogen Corporation | Methods and compositions for screening for angiogenesis modulating compounds |
| US7122181B2 (en) | 2000-12-19 | 2006-10-17 | Research Development Foundation | Lentiviral vector-mediated gene transfer and uses thereof |
| US20030003582A1 (en) | 2001-05-08 | 2003-01-02 | Tranzyme, Inc. | Trans-viral vector mediated gene transfer to the retina |
| US20050054092A1 (en) * | 2001-07-12 | 2005-03-10 | Chunhui Xu | Process for making transplantable cardiomyocytes from human embryonic stem cells |
| US7198950B2 (en) | 2001-10-02 | 2007-04-03 | Institut Clayton De La Recherche | Methods and compositions relating to restricted expression lentiviral vectors and their applications |
| US20060239968A1 (en) | 2002-08-30 | 2006-10-26 | Wadih Arap | Compositions and methods of use of targeting peptides for diagnosis and therapy of human cancer |
| US7160727B2 (en) | 2003-11-20 | 2007-01-09 | University Of Iowa Research Foundation | Methods for producing and using in vivo pseudotyped retroviruses using envelope glycoproteins from lymphocytic choriomeningitis virus (LCMV) |
| US20070077286A1 (en) | 2003-12-24 | 2007-04-05 | Tsutomu Ishihara | Drug-containing nanoparticle, process for producing the same and parenterally administered preparation from the nanoparticle |
| US20050266067A1 (en) | 2004-03-02 | 2005-12-01 | Shiladitya Sengupta | Nanocell drug delivery system |
| US20070082042A1 (en) | 2004-08-06 | 2007-04-12 | Deok-Hoon Park | Multiple-layered liposome and preparation method thereof |
| WO2006125321A1 (en) * | 2005-05-27 | 2006-11-30 | The Hospital For Sick Children | Modulation of the integrin linked kinase signaling pathway to promote cardiac cell proliferation and self-renewal |
| US20070042031A1 (en) | 2005-07-27 | 2007-02-22 | Protiva Biotherapeutics, Inc. | Systems and methods for manufacturing liposomes |
Non-Patent Citations (40)
| Title |
|---|
| "Remington's Pharmaceutical Sciences", MAACK PUBLISHING CO |
| AI-MUHAMMED, J. MICROENCAPSUL., vol. 13, 1996, pages 293 - 306 |
| ASTRIAB-FISHER ET AL., PHARM. RES, vol. 19, 2002, pages 744 - 54 |
| BROPHY, EUR. J. CLIN. PHARMACOL., vol. 24, 1983, pages 103 - 108 |
| CHONN, CURR. OPIN. BIOTECHNOL., vol. 6, 1995, pages 698 - 708 |
| COFFIN ET AL.: "Retroviruses", 1997, COLD SPRING HARBOUR LABORATORY PRESS, pages: 758 - 763 |
| DODD ET AL., J. IMMUNOL. METHODS, vol. 256, 2001, pages 89 - 105 |
| DOMEN, ONCOGENE RES., vol. 1, no. 1, 1987, pages 103 - 112 |
| DULL ET AL., J. VIROL., vol. 72, 1998, pages 8463 - 8471 |
| ELLIOTT; O'HARE, CELL, vol. 88, 1997, pages 223 - 33 |
| EYLES, J. PHARM. PHARMACOL., vol. 49, 1997, pages 669 - 674 |
| FOTHERBY, CONTRACEPTION, vol. 54, 1996, pages 59 - 69 |
| FOX ET AL., GENES DEV., vol. 17, 2003, pages 1841 - 1854 |
| FRANKEL; PABO, CELL, vol. 55, 1988, pages 1189 - 1193 |
| GAO, PHARM. RES., vol. 12, 1995, pages 857 - 863 |
| GREEN; LOEWENSTEIN, CELL, vol. 55, 1988, pages 1179 - 1188 |
| GRONING, PHARMAZIE, vol. 51, 1996, pages 337 - 341 |
| HIDALGO-ARAGONES, J. STEROID BIOCHEM. MOL. BIOL., vol. 58, 1996, pages 611 - 617 |
| JOHNSON, J. PHARM. SCI., vol. 84, 1995, pages 1144 - 1146 |
| JOLIOT ET AL., NEW BIOL., vol. 3, 1991, pages 1121 - 34 |
| JOLIOT ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 1864 - 8 |
| JOSEPHSON ET AL., BIOCONJUG., CHEM., vol. 10, 1999, pages 186 - 91 |
| LE ROUX ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 9120 - 4 |
| LEWIN ET AL., NAT. BIOTECHNOL., vol. 18, 2000, pages 410 - 4 |
| LEWIS ET AL., EMBO J., 1992, pages 3053 - 3058 |
| MAJ ET AL., ONCOGENE, vol. 26, no. 35, 2007, pages 5145 - 53 |
| MARKTEL S ET AL.: "Immunologic potential of donor lymphocytes expressing a suicide gene for early immune reconstitution after hematopoietic T-cell-depleted stem cell transplantation", BLOOD, vol. 101, 2003, pages 1290 - 1298 |
| MINTO, J. PHARMACOL. EXP. THER, vol. 281, 1997, pages 93 - 102 |
| NAGAHARA ET AL., NAT. MED, vol. 4, 1998, pages 1449 - 52 |
| OSTRO, AM. J. HOSP. PHARM., vol. 46, 1989, pages 1576 - 1587 |
| POLYAKOV ET AL., BIOCONJUG. CHEM, vol. 11, 2000, pages 762 - 71 |
| RAO, J. BIOMATER SCI. POLYM. ED, vol. 7, 1995, pages 623 - 645 |
| ROHATAGI, J. CLIN. PHARMACOL., vol. 35, 1995, pages 1187 - 1193 |
| ROHATAGI, PHARMAZIE, vol. 50, 1995, pages 610 - 613 |
| See also references of EP2209889A4 * |
| TJWA, ANN. ALLERGY ASTHMA IMMUNOL., vol. 75, 1995, pages 107 - 111 |
| VERMA; SOMIA, NATURE, vol. 389, 1997, pages 239 - 242 |
| WUNDERBALDINGER ET AL., BIOCONJUG. CHEM., vol. 13, 2002, pages 264 - 8 |
| XIE, ONCOGENE, vol. 25, no. 1, 2006, pages 70 - 78 |
| ZHANG, MOL. CANCER RES., vol. 5, no. 9, 2007, pages 909 - 922 |
Cited By (32)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2814513A4 (en) * | 2012-02-14 | 2016-01-13 | Univ California | SYSTEMIC ADMINISTRATION AND REGULATED EXPRESSION OF PARA RINGENES FOR CARDIOVASCULAR DISEASES AND OTHERS |
| AU2013221615B2 (en) * | 2012-02-14 | 2018-02-22 | The Regents Of The University Of California | Systemic delivery and regulated expression of paracrine genes for cardiovascular diseases and other conditions |
| US10202618B2 (en) | 2012-02-14 | 2019-02-12 | The Regents Of The University Of California | Method of treating type I diabetes using an AAV vector encoding uracortin 2 |
| US10918738B2 (en) | 2012-02-14 | 2021-02-16 | The Regents Of The University Of California | Method of treating type I diabetes using an AAV vector encoding uracortin 2 |
| EP3311830A1 (en) * | 2012-02-14 | 2018-04-25 | The Regents of The University of California | Systemic delivery and regulated expression of paracrine genes for cardiovascular diseases and other conditions |
| US9676750B2 (en) | 2013-01-14 | 2017-06-13 | Incyte Corporation | Bicyclic aromatic carboxamide compounds useful as pim kinase inhibitors |
| US9278950B2 (en) | 2013-01-14 | 2016-03-08 | Incyte Corporation | Bicyclic aromatic carboxamide compounds useful as Pim kinase inhibitors |
| US10828290B2 (en) | 2013-01-15 | 2020-11-10 | Incyte Corporation | Thiazolecarboxamides and pyridinecarboxamide compounds useful as pim kinase inhibitors |
| US10517858B2 (en) | 2013-01-15 | 2019-12-31 | Incyte Holdings Corporation | Thiazolecarboxamides and pyridinecarboxamide compounds useful as PIM kinase inhibitors |
| US10265307B2 (en) | 2013-01-15 | 2019-04-23 | Incyte Corporation | Thiazolecarboxamides and pyridinecarboxamide compounds useful as Pim kinase inhibitors |
| US9849120B2 (en) | 2013-01-15 | 2017-12-26 | Incyte Holdings Corporation | Thiazolecarboxamides and pyridinecarboxamide compounds useful as Pim kinase inhibitors |
| US9550765B2 (en) | 2013-01-15 | 2017-01-24 | Incyte Holdings Corporation | Thiazolecarboxamides and pyridinecarboxamide compounds useful as Pim kinase inhibitors |
| US9200004B2 (en) | 2013-01-15 | 2015-12-01 | Incyte Holdings Corporation | Thiazolecarboxamides and pyridinecarboxamide compounds useful as Pim kinase inhibitors |
| US11229631B2 (en) | 2013-01-15 | 2022-01-25 | Incyte Corporation | Thiazolecarboxamides and pyridinecarboxamide compounds useful as Pim kinase inhibitors |
| US10000507B2 (en) | 2013-08-23 | 2018-06-19 | Incyte Corporation | Furo- and thieno-pyridine carboxamide compounds useful as pim kinase inhibitors |
| US9556197B2 (en) | 2013-08-23 | 2017-01-31 | Incyte Corporation | Furo- and thieno-pyridine carboxamide compounds useful as pim kinase inhibitors |
| US9580418B2 (en) | 2014-07-14 | 2017-02-28 | Incyte Corporation | Bicyclic aromatic carboxamide compounds useful as Pim kinase inhibitors |
| US9890162B2 (en) | 2014-07-14 | 2018-02-13 | Incyte Corporation | Bicyclic aromatic carboxamide compounds useful as pim kinase inhibitors |
| US9822124B2 (en) | 2014-07-14 | 2017-11-21 | Incyte Corporation | Bicyclic heteroaromatic carboxamide compounds useful as Pim kinase inhibitors |
| US9540347B2 (en) | 2015-05-29 | 2017-01-10 | Incyte Corporation | Pyridineamine compounds useful as Pim kinase inhibitors |
| US9802918B2 (en) | 2015-05-29 | 2017-10-31 | Incyte Corporation | Pyridineamine compounds useful as Pim kinase inhibitors |
| US10336728B2 (en) | 2015-09-09 | 2019-07-02 | Incyte Corporation | Salts of a Pim kinase inhibitor |
| US9862705B2 (en) | 2015-09-09 | 2018-01-09 | Incyte Corporation | Salts of a pim kinase inhibitor |
| US11066387B2 (en) | 2015-09-09 | 2021-07-20 | Incyte Corporation | Salts of a Pim kinase inhibitor |
| US11505540B2 (en) | 2015-09-09 | 2022-11-22 | Incyte Corporation | Salts of a Pim kinase inhibitor |
| US12043614B2 (en) | 2015-09-09 | 2024-07-23 | Incyte Corporation | Salts of a Pim kinase inhibitor |
| US10450296B2 (en) | 2015-10-02 | 2019-10-22 | Incyte Corporation | Heterocyclic compounds useful as Pim kinase inhibitors |
| US11053215B2 (en) | 2015-10-02 | 2021-07-06 | Incyte Corporation | Heterocyclic compounds useful as Pim kinase inhibitors |
| US9920032B2 (en) | 2015-10-02 | 2018-03-20 | Incyte Corporation | Heterocyclic compounds useful as pim kinase inhibitors |
| US10596161B2 (en) | 2017-12-08 | 2020-03-24 | Incyte Corporation | Low dose combination therapy for treatment of myeloproliferative neoplasms |
| US11278541B2 (en) | 2017-12-08 | 2022-03-22 | Incyte Corporation | Low dose combination therapy for treatment of myeloproliferative neoplasms |
| US20230282387A1 (en) * | 2020-09-04 | 2023-09-07 | Dexerials Corporation | Conductive layered product, optical device using same, and manufacturing method for conductive layered product |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2705862A1 (en) | 2009-05-22 |
| JP5795670B2 (ja) | 2015-10-14 |
| JP2011503207A (ja) | 2011-01-27 |
| JP2015007063A (ja) | 2015-01-15 |
| US20160324936A1 (en) | 2016-11-10 |
| US20100316701A1 (en) | 2010-12-16 |
| US20210322522A1 (en) | 2021-10-21 |
| EP2209889B1 (en) | 2016-07-20 |
| US20140234265A1 (en) | 2014-08-21 |
| US8617534B2 (en) | 2013-12-31 |
| EP2209889A4 (en) | 2012-09-05 |
| CA2705862C (en) | 2018-03-27 |
| EP2209889A1 (en) | 2010-07-28 |
| US20190060417A1 (en) | 2019-02-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210322522A1 (en) | Compositions and method for manipulating pim-1 activity in circulatory system cells | |
| US20190330595A1 (en) | Mammalian cells enriched with functional mitochondria | |
| Du et al. | Hypoxia-inducible factor 1 alpha (HIF-1α)/vascular endothelial growth factor (VEGF) pathway participates in angiogenesis of myocardial infarction in muscone-treated mice: preliminary study | |
| Tang et al. | Improved graft mesenchymal stem cell survival in ischemic heart with a hypoxia-regulated heme oxygenase-1 vector | |
| Korpela et al. | Gene therapy for ischaemic heart disease and heart failure | |
| Song et al. | Down-regulation of microRNA-320 suppresses cardiomyocyte apoptosis and protects against myocardial ischemia and reperfusion injury by targeting IGF-1 | |
| Yang et al. | Physiological functions of protein kinase B/Akt | |
| Choi et al. | IL-10-secreting human MSCs generated by TALEN gene editing ameliorate liver fibrosis through enhanced anti-fibrotic activity | |
| Stafford et al. | Signaling via the interleukin-10 receptor attenuates cardiac hypertrophy in mice during pressure overload, but not isoproterenol infusion | |
| KR101220516B1 (ko) | 항-mdm2를 발현하는 인간 성체줄기세포 및 그의 용도 | |
| Li et al. | Integrin β1 increases stem cell survival and cardiac function after myocardial infarction | |
| Pfister et al. | FLT3 activation improves post-myocardial infarction remodeling involving a cytoprotective effect on cardiomyocytes | |
| Zeng et al. | Paracrine action of HO‐1‐modified mesenchymal stem cells mediates cardiac protection and functional improvement | |
| Huang et al. | Cardiac-specific Traf2 overexpression enhances cardiac hypertrophy through activating AKT/GSK3β signaling | |
| Zeng et al. | ILK regulates MSCs survival and angiogenesis partially through AKT and mTOR signaling pathways | |
| AU4321299A (en) | Methods of altering cardiac cell phenotype | |
| Shahzad et al. | Transmyocardial revascularization induces mesenchymal stem cell engraftment in infarcted hearts | |
| KR20230010617A (ko) | 산화스트레스 저항성을 갖는 중간엽줄기세포, 이의 제조방법 및 용도 | |
| CN111705061B (zh) | 和心脏疾病相关的piRNA-P1与piRNA-P1反义核苷酸、应用和药物 | |
| de Muinck | Gene and cell therapy for heart failure | |
| EP3689896A1 (en) | Grk2 modulating mirnas | |
| WO2015153357A1 (en) | Compositions and methods for improving cardiac function | |
| US8496928B2 (en) | Method for preventing and treating cardiovascular diseases with BRCA1 | |
| Molina et al. | Right Ventricular Beneficial Effects of Intracoronary SERCA | |
| Yan et al. | Sphingosine kinase-1 protects transplanted mesenchymal stem cells and improves the performance of the infarcted heart. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08850768 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2705862 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010534249 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2008850768 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008850768 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12742871 Country of ref document: US |