Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
  • C07K16/40—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
  • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
  • C07K2317/52—Constant or Fc region; Isotype

Definitions

• TECHNICAL FIELD This invention relates to optimized proteins, particularly antibody Fc moieties, and methods for producing biopharmaceuticals of such enhanced antibodies and Fc fusion proteins with enhanced productivity, and to a method of producing and purifying proteins Biomolecule is completely homogeneous with respect to the C-terminal lysine.
• Biomolecules such as proteins, polynucleotides, polysaccharides and the like are increasingly gaining commercial importance as drugs, as diagnostics, as additives in foods, detergents and the like, as research reagents and for many other applications.
• the need for such biomolecules can be determined - e.g. in the case of proteins - usually no longer satisfy by isolating the molecules from natural sources but requires the use of biotechnological production methods.
• the biotechnological production of proteins typically begins with the isolation of the DNA encoding the desired protein and its cloning into a suitable expression vector. After transfection of the recombinant expression vector into suitable prokaryotic or eukaryotic expression cells and subsequent selection of transfected, recombinant cells, the latter are cultured in fermenters and the desired protein is expressed. Subsequently, the harvest of the cells or of the culture supernatant and the workup and purification of the protein contained therein takes place. In the case of biopharmaceuticals, such as proteins used as drugs, eg therapeutic antibodies, the product yield is crucial. In addition, the separation of impurities is important. Here, process- and product-dependent impurities can be distinguished from each other.
• the process-dependent contaminants include components of the host cells, such as proteins and nucleic acids, or stem from cell culture (such as media components) as well as work-up (such as salts or detached chromatography ligands).
• product-dependent impurities occur. These are molecular variants of the product with different properties. These include, for example, shortened forms such as precursors and hydrolytic degradation products, enzymatic cleavage of C-terminal amino acid residues of proteins, but also modified forms, for example, by deamination, different Glykosyl michsmuster or incorrectly linked disulfide bridges.
• the product-dependent variants include polymers and aggregates. Contaminants are any other materials of a chemical, biochemical or microbiological nature that are not directly related to the manufacturing process. Other contaminants include viruses that may undesirably occur in cell cultures.
• CIEX Cation Ion Exchange Chromatography
• Isoelectric Focusing Isoelectric Focusing
• clEF Capillary Isoelectric Focusing
• LCMS Liquid Chromatography Mass Spectrometry
• the starting point for the evaluation of the production batch is the physico-chemical product properties, the purity, the homogeneity and the efficacy and safety of the product.
• Electrophoretic (IEF) or chromatographic (IEC, SEC, RP) separation methods and mass spectroscopic methods (MS, ESI, MALDI) are used to evaluate product purity and product heterogeneity.
• the control of product purity ensures sufficient depletion of impurities and the removal of fission products and aggregated protein molecules resulting from enzymatic, mechanical or chemical processes in the manufacturing process.
• the evaluation of the product homogeneity is primarily based on the deviations in the glycosylation pattern and the charge heterogeneity.
• the efficacy of a product describes its biological activity, which in the case of antibodies is composed of properties such as the antigen-binding capacity, the induction of effector functions, serum half-life and others. Factors determining product safety include sterility and bacterial endotoxin load on the product lot. Due to the large number of control values, which must be ensured or respected in a generated production batch for its release, a reduction of the control values, z. B. by eliminating the batch influencing parameter, desirable.
• the present invention surprisingly achieves this object by a method for the production of proteins which allows an increased yield by removing already at the DNA level the C-terminal coding codon (for example lysine) and subsequently inserting a stop codon.
• This method enables an increase in the protein titer, in particular of antibodies having a C-terminal lysine heavy chain deletion.
• the present invention describes recombinant DNA constructs of proteins, in particular of antibody molecules such as IgGI, IgG2, IgG3, IgG4 and Fc fusion constructs which have a deletion of the C-terminal lysine. Due to the modification of the expression construct and the deletion of the C-terminal Lys codon, only molecules with a homogeneous C-terminus of the heavy chain are produced.
• Mammalian cell fusion proteins for the production of new biopharmaceutical drugs often have molecules that exhibit heterogeneity at the C-terminus of the heavy chain.
• the purified end product has with respect to the C-terminus of the heavy chain, three different species: 1) complete chains with C-terminal lysine according to the DNA sequence (Lys 2) or 2) partial chain (Lys 1) and 3) deletion of the C-terminal lysine on both Chains (Lys 0).
• the proportions of the two species are unpredictable. Thus, differences may occur depending on the cell, fermentation conditions and manufacturing batch. It is unclear whether the antibody structure has any influence on this intracellular enzymatic cleavage of lysine.
• Fermentation conditions and thus different metabolic processes in the cell have a significant influence. Furthermore, it is still unknown at what point in the production of the product in the cell (co-translational, post-translational), at which location and by which enzyme the cleavage of the lysine takes place. Possible batch fluctuations can thus not be prevented and counter-control is thus not specifically possible.
• the codon for lysine in the expression construct for the heavy chain of antibodies has already been deleted at the DNA level at the 3 ' end.
• the heavy chain C-terminus is highly conserved, and the C-terminus lysine is always present in both human and mouse antibodies, for example. Because of this, lysine is expected to be essential for expression, folding or secretion.
• lysine is expected to be essential for expression, folding or secretion.
• the product titer is increased by at least 10%, preferably at least 20% and particularly preferably by at least 50%.
• the main advantage of the current state of the art is that using these constructs only the variant of the C-terminus without lysine for the heavy chain can occur. This eliminates the possibility of batch fluctuations and the proportion of product characterization work.
• Particularly surprising in the present invention is that the constructs without C-terminal lysine lead to increased product titers, which is particularly advantageous for a high yield.
• the present invention is preferably applicable to processes for producing recombinant antibodies and / or Fc fusion proteins.
• the present invention is applicable to other molecules having C-terminal amino acid deletions. Examples include EPO and tPA, where C-terminal arginine deletions occur.
• the invention relates to the improved production and purification of optimized proteins, the constituent of which is, inter alia, the immunoglobulin domain C H 3.
• An often observed effect of these proteins is the cleavage of the C-terminal lysine. This usually incomplete processing of the heavy chain leads to product heterogeneity.
• the corresponding codon of the C-terminal lysine of the heavy antibody chain was deleted by means of recombinant DNA technology. This deletion in the optimized Surprisingly, antibody does not lead to a disadvantage in the expression or intracellular protein processing but rather to an increased product titer compared to the wild type.
• the optimized antibodies prove to be advantageous in purification by a better elution behavior due to the reduced charge heterogeneity and they are characterized by an improved homogeneity.
• the present invention does not result from the prior art.
• product heterogeneity needs to be analyzed for each production lot before it can be released.
• For the qualitative and quantitative determination of the heterogeneity of lysine residues at the C-terminus of the heavy chain laborious and costly analysis methods must be used.
• FIGURE 1 SCHEMATICARY REPRESENTATION OF THE RECOMBINANT
• VECTORS The vectors shown here are used to express the monoclonal antibodies of the IgGI and IgG4 isotype in CHO-DG44 cells.
• P / E is a combination of CMV enhancer and hamster Ub / S27a promoter
• CMV is a combination of CMV enhancer and promoter
• P is just a promoter element
• T is a termination signal for transcription needed for polyadenylation of the transcribed mRNA.
• the position and direction of transcription initiation within each transcription unit is indicated by an arrow.
• the amplifiable selectable marker dlhydrofolate reductase is abbreviated "dhfr.”
• the selection marker neomycin phosphotransferase is labeled “npt” and the neomycin phosphotransferase mutant produced by point mutation F240I contains “npt F240I”.
• "IgG1 HC” encodes the heavy chain of the IgGI isotype wild-type F19 antibody and IgG1-Lys heavy chain antibody of this antibody with a C-terminal lysine deletion.
• IgG4 HC identifies the IgG4 wild-type heavy chain gene and "IgG4-Lys” again, the heavy chain of the IgG4 with a C-terminal lysine deletion.
• LC encodes the IgGI or IgG4 antibody light chain.
• the cell culture supernatants are removed and the IgGI titers determined by ELISA and the SEAP activity.
• the IgGI titer is corrected for transfection efficiency.
• the figure shows the average of 10 parallel pools with comparable product quantities for both variants.
• FIGURE 3 EXPRESSION OF IGG1 WILD TYPE AND IGG1 LYSININE
• the concentration of IgGI antibody produced in the cell culture supernatant is determined by ELISA and the specific productivity per cell and day is calculated.
• the bars represent the means of specific productivity (dotted bars) and titer (striped bars) all pools in the test from each 3 - 4 cultivation passages in 75cm 2 cell culture bottles.
• FIGURE 4 EXPRESSION OF IGG1 WILD TYPE AND IGG1 LYSENSION DELUTION MUTANT IN STABLE AMPLIFIED
• MTX methotrexate
• the concentration of IgGI antibody produced in the cell culture supernatant is determined by ELISA and the specific productivity per cell and day is calculated.
• the bars represent, on the one hand, the mean values of the specific productivity (dotted bars) and the titer (striped bars) of each individual pool in the test from 6 cultivation passages each in 75 cm 2 cell culture bottles. On the other hand, the mean value (MW) from all pool data is given.
• Figure 4A shows the data from the cell pools transfected with the IgGI wild type
• Figure 4B shows the data from the cell pools transfected with the IgG1 lysine deletion variant.
• the latter produce on average 86% more antibodies with 120% higher specific productivity than the cell pools transfected with the IgGI wild type.
• FIGURE 5 INFLUENCE OF C-TERMINAL LYSINE DELETION ON
• FIGURE 6 EXPRESSION OF IGG4 WILD TYPE AND IGG4 LYSINE
• DHFR-mediated gene amplification is subsequently performed by addition of 100 nM methotrexate (MTX) to the culture medium
• MTX methotrexate
• concentration of IgG4 antibody produced in the cell culture supernatant is determined by ELISA and the specific productivity per cell and day is calculated.
• the bars represent, on the one hand, the mean values of the specific productivity (dotted bars) and the titer (striped bars) of each individual pool in the test from 6 cultivation passages each in 75 cm 2 cell culture bottles.
• the mean value (MW) from all pool data is given.
• Figure 6A shows the data from the cell pools transfected with the IgG4 wild-type
• Figure 6B shows the data from the cell pools transfected with the IgG4-lysine deletion variant. The latter produce on average 63% more antibodies with 70% higher specific productivity than the cell pools transfected with the IgG4 wild-type.
• FIGURE 7 EXPRESSION OF IGG4 WILD TYPE AND IGG4 LYSINE
• a stepwise DHFR-mediated gene amplification is performed.
• 100 nM methotrexate (MTX) is added to the culture medium.
• MTX methotrexate
• a second round of gene amplification is carried out by adding 400 nM MTX to the culture medium.
• successfully amplified cell pools are obtained for the lgG4 wild-type 4 and for the lgG4-lysine deletion variant 6.
• the concentration of IgG4 antibody produced in the cell culture supernatant is determined by ELISA and the specific productivity per cell and day is calculated.
• the bars represent, on the one hand, the mean values of the specific productivity (dotted bars) and the titer (striped bars) of each individual pool in the test from 4 cultivation passages each in 75 cm 2 cell culture bottles.
• the mean value (MW) from all pool data is given.
• Figure 7A shows the data from the cell pools transfected with the IgG4 wild-type
• Figure 7B shows the data from the cell pools transfected with the IgG4-lysine deletion variant. The latter produce on average 53% more Antibodies at 66% higher specific productivity than the cell pools transfected with the IgG4 wildtype.
• FIGURE 8 QUANTIFICATION OF PRODUCT REPRODUCTION BY PROTEIN A HPLC
• the determined values for the product yield of IgGI and IgG4 are independent of the lysine deletion over 90%.
• the monomer content of the isotypes and the corresponding lysine deletion variants is in the range of 89.23 to 97.93%. Both the yield and the monomer content are higher for the IgGI-Lys than for the WT-variant.
• FIGURE 9 ISOELECTRIC FOCUSING (IEF) OF ISOTYPES
• IGG1 and IGG4 The antibodies were incubated in vitro with carboxypeptidase B to cleave existing C-terminal lysine.
• FIGURE 10 DETECTION OF C-TERMINAL LYSINE BY LC-MS
• the dark gray bars represent the heavy chain (HC) portions without lysine.
• FIGURE 11 SEPARATION OF THE ANTIBODIES BY WCX Separation of IgGI-WT (A) and IgGI-Lysine (B) by means of a weak cationic exchange (WCX).
• the enzymatic lysine cleavage by carboxypeptidase B shows a reduction of the basic peaks 1 and 2 in the WT IgGI.
• the overlay (C) of IgGI WT without CpB (upper line) and IgGI WT + CpB (lower line) shows the reduction of the basic peak areas a total of 9.8%.
• the overlay (D) of IgGI-Lys without CpB (upper line) and IgGI-Lys + CpB (lower line) shows no reduction of the basic peak area (below 1%).
• FIGURE 12 QUANTIFICATION OF THE C-TE RM I NAL E LYSINE MEDIUM
• titer is an indication of the product concentration in a defined volume, eg ng / mL, mg / mL, mg / L, g / L.
• specific productivity is meant the amount of protein produced by the cell in pg per cell per day, calculated by the formula pg / ((Ct-Co) t / In (Ct-Co)), where Co
• Yield describes the percentage recovery of the respective product variants after separation by means of chromatography on a matrix, for example a protein A matrix.
• Product concentration of proteins encoded by a selected nucleotide sequence can be determined by ELISA, but can also be determined by other methods such as e.g. by protein A HPLC, Western blot, radioimmunoassay, immunoprecipitation, detection of the biological activity of the protein, immunostaining of the protein with subsequent FACS analysis or fluorescence microscopy, direct detection of a fluorescent protein by FACS analysis or by spectrophotometry.
• the "gene of interest” contained in the expression vector of the invention comprises a nucleotide sequence of any length encoding a product of interest
• the gene product or “product of interest” is typically a protein, polypeptide, peptide or fragment or derivative thereof. It can also be RNA or antisense RNA.
• the gene of interest may be in full length, in truncated form, as a fusion gene or a labeled gene. It may be genomic DNA or preferably cDNA or corresponding fragments or fusions.
• the gene of interest may be the native gene sequence, mutated or otherwise modified. Such modifications include codon optimizations for adaptation to a particular host cell and humanization.
• the gene of interest may encode a secreted, cytoplasmic, nuclear localized, membrane bound or cell surface bound polypeptide.
• the term "nucleic acid,”"nucleotidesequence,” or “nucleic acid sequence” refers to an oligonucleotide, nucleotides, polynucleotides and fragments thereof, and DNA or RNA of genomic or synthetic origin which may be in single or double stranded and represent the coding or noncoding strand of a gene
• standard techniques such as site-specific mutagenesis or PCR-mediated mutagenesis, can be used.
• Encoding means the property or ability of a specific sequence of nucleotides in a nucleic acid, such as a gene in a chromosome or an mRNA, as a template for the synthesis of other polymers and macromolecules such as rRNA, tRNA, mRNA, other RNAs.
• a gene encodes a protein when transcription and subsequent translation of the mRNA produce the desired protein in a cell or other biological system
• both the coding strand the nucleotide sequence of which is identical with the mRNA sequence and is normally also indicated in sequence databases, eg EMBL or GenBank, as well as the noncoding strand of a gene or cDNA serving as template for the transcription can be designated as coding for a product or protein
• Nucleic acid encoding a protein also includes nuk linolenic acids, which have a different nucleotide sequence sequence due to the degenerate genetic code, but result in the same amino acid sequence of the protein. Nucleic acid sequences encoding proteins may also contain introns.
• cDNA refers to deoxyribonucleic acids prepared by reverse transcription and synthesis of the second strand of DNA from a mRNA or other RNA produced by a gene, which, when present as a double-stranded DNA molecule, contains both a coding DNA as well as a non-coding strand.
• Biopharmaceutically significant proteins / polypeptides include e.g. Antibodies or immunoglobulins, enzymes, cytokines, lymphokines, adhesion molecules, receptors and their derivatives or fragments are, however, not limited to these. In general, all polypeptides that act as agonists or antagonists and / or find therapeutic or diagnostic use are important. Other proteins of interest are, for example, proteins / polypeptides which are used for altering the properties of host cells in the context of so-called "cell engineering", such as anti-apoptotic proteins, chaperones, metabolic enzymes, glycosylation enzymes and their derivatives or fragments, but are not limited to these.
• cell engineering such as anti-apoptotic proteins, chaperones, metabolic enzymes, glycosylation enzymes and their derivatives or fragments, but are not limited to these.
• polypeptides is used for amino acid sequences or proteins and refers to polymers of amino acids of any length
• Expression also includes proteins that are posttranslational in response to, for example, glycosylation, phosphorylation, acetylation or
• Protein processing can be modified.
• the structure of the polypeptide may be e.g. by substitutions, deletions or insertion of amino acids, fusion with other proteins, while retaining its biological activity.
• the polypeptides can multimerize and homo- and
• immunoglobulins There are several classes of immunoglobulins: IgA, IgD, IgE, IgG 1 IgM, IgYJgW.
• immunoglobulin and antibodies are used synonymously.
• therapeutic antibodies are monoclonal, polyclonal, multispecific and single chain antibodies or immunoglobulins and fragments thereof, such as Fab, Fab ', F (ab') 2, Fc and Fc 'fragments, light (L) and heavy (H) immunoglobulin chains and their constant, variable or hypervariable regions, as well as Fv and Fd fragments.
• the antibodies may be of human or non-human origin. Humanized and chimeric antibodies are also considered.
• fragment antigen-binding Fab
• Protease such as papain
• Other antibody fragments are also generated from conventional antibodies or by DNA cloning. Other antibody fragments are
• F (ab ') 2 fragments which can be prepared by proteolytic digestion with pepsin.
• the variable region of the heavy and light chain are often linked together by means of a short peptide fragment of about 10 to 30 amino acids, particularly preferably 15 amino acids. In this way, a single polypeptide chain is formed in which VH and VL are linked by a peptide linker.
• Such antibody fragments are also referred to as a single-chain Fv fragment (scFv). Examples of scFv antibodies are known and described.
• scFv derivatives In recent years, various strategies have been developed to produce multimeric scFv derivatives. The intention is the generation of recombinant antibodies with improved pharmacokinetic properties and enhanced binding avidity. To achieve multimerization of the scFv fragments, these are prepared as fusion proteins with multimerization domains.
• the CH3 region of an IgG or coiled coil structures may function as multimerization domains, such as the leucine zipper domains, while in other strategies, the interaction between the VH and VL regions of the scFv fragment may become multimerization
• diabody refers to a divalent homodimeric scFv derivative.
• the shortening of the peptide linker in the scFv molecule to 5-10 amino acids results in the formation of homodimers by superposition of VHA / L chains.
• the diabodies can additionally be stabilized by introduced disulfide bridges. Examples of diabodies can be found in the literature.
• minibody refers to a divalent, homodimeric scFv derivative which consists of a fusion protein which contains the CH3 region of an immunoglobulin, preferably IgG, particularly preferably IgGI, as a dimerization region which links the scFv fragments via a hinge Region, also of IgG, and a linker region
• thabody refers to a trivalent homotrimeric scFv derivative. The direct fusion of VH-VL without the use of a linker sequence leads to the formation of trimers.
• fragments designated by the skilled person as mini-antibodies which have a bi-, tri- or tetravalent structure, are likewise derivatives of scFv fragments.
• the multimerization is achieved via di-, tri- or tetrameric "coiled-coil" structures.
• the production of the expression vector according to the invention can in principle be carried out by conventional methods familiar to the person skilled in the art.
• a vector eg suitable promoters, enhancers, termination and polyadenylation signals, Antibiotic resistance genes, selection markers, origins of replication and splice signals.
• Conventional cloning vectors can be used for the preparation, for example plasmids, bacteriophages, phagemids, cosmids or viral vectors such as baculovirus, retroviruses, adenoviruses, adeno-associated viruses and herpes simplex virus, but also artificial or artificial or mini-chromosomes.
• the eukaryotic expression vectors also typically contain prokaryotic sequences, such as origin of replication, and antibiotic resistance genes, which allow multiplication and selection of the vector in bacteria.
• prokaryotic sequences such as origin of replication, and antibiotic resistance genes, which allow multiplication and selection of the vector in bacteria.
• a variety of eukaryotic expression vectors containing multiple cloning sites for introducing a polynucleotide sequence are known and some are commercially available from various companies such as Stratagene, La JoIIa, CA, USA; Invitrogen, Carlsbad, CA, USA; Promega, Madison, WI, USA or BD Biosciences Clontech, Paolo Alto, CA, USA.
• the expression of the genes can take place within an expression vector of one or more transcription units.
• a region which contains one or more genes to be transcribed is defined as a "transcription unit.”
• the genes within a transcription unit are functionally linked together in such a way that all genes within such a unit are under the transcriptional control of the same promoter or promoter / enhancer.
• IRES elements or introns can be used to functionally link genes within a transcription unit.
• the expression vector may contain a single transcriptional unit for expression of the gene or genes of interest and, for example, selection marker genes. Alternatively, these genes can also be arranged in two or more transcription units. Different combinations of the genes within a transcription unit are possible. In another embodiment of the present invention, more than one expression vector consisting of one, two or more transcription units may be introduced into a host cell by co-transfection or in sequential transfections in any order. Any combination of regulatory elements and genes on each vector can be chosen as long as sufficient expression of the transcription units is ensured. If necessary, additional regulatory elements and genes, such as additional genes of interest or selection markers, can be positioned on the expression vectors.
• eukaryotic host cells preferably mammalian cells, and especially rodent cells such as e.g. Mouse, rat and hamster cell lines.
• rodent cells such as e.g. Mouse, rat and hamster cell lines.
• preferred host cells are hamster cells, such as BHK21, BHK TK ", CHO, CHO-K1, CHO-DUKX, CHO-DUKX B1, and CHO-DG44 cells or derivatives / descendants of these cell lines.
• CHO-DG44 particularly preferred are CHO-DG44, CHO DUKX, CHO-K1 and BHK21 cells, in particular CHO-DG44 and CHO-DUKX cells, likewise suitable are mouse myeloma cells, preferably NSO and Sp2 / 0 cells and derivatives / derivatives of these cell lines, but also derivatives and derivatives of these cells, others Mammalian cells, including but not limited to human, mouse, rat, monkey, rodent, or eukaryotic cells, including, but not limited to, yeast, insect, avian, and plant cells, may also be used as host cells for the production of biopharmaceutical proteins ,
• Transfection of the eukaryotic host cells with a polynucleotide or an expression vector according to the invention is carried out by customary methods. Suitable transfection methods are e.g. liposome-mediated transfection, calcium phosphate co-precipitation, electroporation, polycation (e.g., DEAE-dextran) -mediated transfection, protoplast fusion, microinjection, and viral infections.
• a stable transfection is performed wherein the constructs are integrated into either the genome of the host cell or an artificial chromosome / minichromosome or are stably episomally contained in the host cell.
• any sequence or gene introduced into a host cell will be referred to as a "heterologous sequence” or “heterologous gene” with respect to the host cell. Even if the sequence to be introduced or the gene to be introduced is identical to an endogenous sequence or an endogenous gene of the host cell.
• a hamster actin gene that is introduced into a hamster host cell is by definition a heterologous gene.
• mAbs monoclonal antibodies
• the transfection of suitable host cells can in principle be carried out in two different ways.
• Such mAbs are composed of several subunits, the heavy and light chains.
• Genes encoding these subunits can be housed in independent or multicistronic transcription units on a single plasmid, with which the host cell is then transfected. This is supposed to be the stoichiomehsche Ensure representation of genes after integration into the genome of the host cell.
• independent transcription units it must be ensured here that the mRNAs which code for the various proteins have the same stability, transcription and translation efficiency.
• the expression of the genes takes place within a multicistronic transcription unit by a single promoter and only one transcript is formed.
• IRES elements By using IRES elements, a fairly efficient internal translation initiation of the genes in the second and subsequent cistrons is enabled. Nevertheless, the expression rates for these cistrons are lower than those of the first cistron, whose translation initiation through a so-called cap-dependent pre-initiation complex is much more efficient than the IRES-dependent translation initiation additional intercistronic elements are introduced, which, in conjunction with the IRES elements, ensure uniform expression rates.
• Another possibility which is preferred according to the invention for simultaneously producing a plurality of heterologous proteins is co-transfection, in which the genes are integrated separately into different expression vectors.
• This has the advantage that certain ratios of the genes and gene products can be adjusted to each other, whereby differences in the mRNA stability and in the transcription and translation efficiency can be compensated.
• the expression vectors are more stable and easier to handle in both cloning and transfection.
• the host cells are additionally transfected, preferably co-transfected, with one or more vectors having genes which code for one or more other proteins of interest.
• the other vectors used for co-transfection code for the one or more other proteins of interest under the control of the same Promoter, preferably under the control of the same promoter / enhancer combination and for at least one selection marker, for example, the dihydrofolate reductase.
• the host cells are cotransfected with at least two eukaryotic expression vectors, at least one of the two vectors containing at least one gene encoding at least protein of interest, and the other vector containing one or more nucleic acids according to the invention in any combination , Position and orientation, and optionally also for at least one gene (of interest encoded, and these nucleic acids according to the invention their transcription or expression-enhancing effect on the genes of interest, which are located on the other co-transfected vector, via co-integration mediate with the other vector.
• the host cells are preferably established under serum-free conditions, adapted and cultivated, if appropriate in media which are free from animal proteins / peptides.
• media which are free from animal proteins / peptides.
• Examples of commercially available media are Ham 's F12 (Sigma, Deisenhofen, DE), RPMI-1640 (Sigma), Dulbecco 's Modified Eagle 's Medium (DMEM; Sigma), Minimal Essential Medium (MEM; Sigma), Iscove 's Modified Dulbecco's medium (IMDM; Sigma), CD-CHO (Invitrogen, Carlsbad, CA, USA), CHO-S-SFMII (Invitrogen), serum-free CHO medium (Sigma), and protein-free CHO medium (Sigma) ,
• DMEM Dulbecco 's Modified Eagle 's Medium
• MEM Minimal Essential Medium
• IMDM Iscove 's Modified Dulbecco's medium
• CD-CHO Invitrogen
• serum-free media are preferred according to the invention, it is also possible to use media which have been cultivated with a suitable amount for cultivating the host cells Serum were added.
• media which have been cultivated with a suitable amount for cultivating the host cells Serum were added.
• one or more suitable selection agents are added to the medium.
• selection agent refers to a substance which impairs the growth or survival of host cells having a deficiency for the respective selection marker gene.
• G418 preferably geneticin (G418) is used as a medium supplement for the selection of heterologous host cells which are a wild-type or, preferably, wild-type If the host cells are to be transfected with several expression vectors, eg if several genes of interest are to be introduced separately into the host cell, they usually have different selection marker genes.
• selection marker gene is a gene that allows for the specific selection of cells that receive this gene by adding a suitable selection agent to the culture medium.
• an antibiotic resistance gene can be used as a positive selection marker Can be grown and thus selected in the presence of the corresponding antibiotic, but nontransfected cells can not grow or survive under these selection conditions, there are positive, negative and bifunctional selection markers, positive selection markers allow the selection and thus enrichment of transformed cells Mediating resistance to the selection agent or compensating for a metabolic or catabolic defect of the host cell, in contrast, cells that have received the gene for the selection marker may be targeted by negative selection markers en, be selectively eliminated.
• selection markers used in this invention including the amplifiable Selection marker includes genetically engineered mutants and variants, fragments, functional equivalents, derivatives, homologs and fusions with other proteins or peptides as long as the selection marker retains its selective properties.
• Such derivatives have considerable homology in the amino acid sequence in the regions or domains to which the selective property is attributed.
• the literature describes a variety of selection marker genes, including bifunctional (positive / negative) markers.
• selection markers commonly used in eukaryotic cells include the genes for aminoglycoside phosphotransferase (APH), hygromycin phosphotransferase (HYG), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase, asparagine synthetase and genes conferring resistance to neomycin (G418), puromycin, histidinol D, bleomycin, phleomycin and zeocin.
• APH aminoglycoside phosphotransferase
• HAG hygromycin phosphotransferase
• DHFR dihydrofolate reductase
• TK thymidine kinase
• glutamine synthetase glutamine synthetase
• asparagine synthetase genes conferring resistance to neomycin (G418), puromycin, histidino
• the cells according to the invention can optionally also be subjected to one or more gene amplification steps in which they are cultured in the presence of a selection agent which leads to an amplification of an amplifiable selection marker gene.
• the prerequisite is that the host cells are additionally transfected with a gene which codes for an amplifiable selection marker. It is conceivable that the gene which codes for an amplifiable selection marker is present on one of the expression vectors according to the invention or is introduced into the host cell with the aid of another vector.
• the amplifiable selection marker gene usually encodes an enzyme required for the growth of eukaryotic cells under certain culture conditions.
• the amplifiable selection marker gene may encode dihydrofolate reductase (DHFR).
• DHFR dihydrofolate reductase
• the gene is amplified when culturing a host cell transfected therewith in the presence of the selection agent methotrexate (MTX).
• MTX methotrexate
• the DHFR marker is particularly well suited for selection and subsequent amplification when using DHFR-negative basic cells such as CHO-DG44 or CHO-DUKX, since these cells do not express endogenous DHFR and thus do not grow in purine-free medium. Therefore, here the DHFR gene can be used as a dominant selection marker and the transformed cells are selected in hypoxanthine / thymidine-free medium.
• amplifiable selection marker genes which can be used according to the invention are, for example, glutamine synthetase, methallothionein, adenosine deaminase, AMP deaminase, UMP synthase, xanthine-guanine phosphoribosyltransferase and thymdilate synthetase.
• the rate of expression may be generally determined either based on the amount of corresponding mRNA present in the host cell or on the amount of gene product produced encoded by the gene of interest.
• the amount of mRNA generated by transcription of a selected nucleotide sequence can be determined, for example, by Northern blot hybridization, ribonuclease RNA protection, in situ hybridization of cellular RNA, or by PCR methods (e.g., quantitative PCR). Proteins encoded by a selected nucleotide sequence may also be prepared by various methods, such as e.g.
• titre or increase in productivity is meant increasing the expression, synthesis or secretion of a heterologous gene introduced into a host cell Sequence, for example, a gene encoding a therapeutic protein, as compared to a suitable control, for example, mutant protein versus wild-type protein called.
• a titer or productivity increase is when a cell of the invention is cultured by a method of the invention described herein, and when that cell has at least an increase in specific productivity or titer of 10%.
• a titer or productivity increase is also present when a cell according to the invention is cultured by a method according to the invention described here, and when this cell has at least one increase in specific productivity or titer of 20%, 50% and 75%, respectively ,
• a titer or increase in productivity is in particular also present if a cell according to the invention is cultured by a method according to the invention described here, and if this cell has at least an increase in specific productivity or titer of 10-500%, preferably 20-300%, more preferably 50-200%.
• a titer or productivity increase can be achieved both by using one of the expression vectors according to the invention and by using one of the methods according to the invention.
• the corresponding methods can be combined with a FACS-based selection of recombinant host cells containing as further selection marker, for example, one (or more) fluorescent protein (s) (eg GFP) or a cell surface marker.
• s fluorescent protein
• Other methods for achieving increased expression although a combination of different methods is possible, for example, based on the use of c / s-active elements for manipulating the chromatin structure (eg LCR, UCOE, EASE, insulators, S / MARs, STAR elements ), Use of (artificial) transcription factors, treatment of cells with natural or synthetic agents to upregulate endogenous or heterologous gene expression, improve the stability (half-life) of the mRNA or protein, improve mRNA translation initiation, increase gene dose by using episomal plasmids (based on the use of viral sequences as the origin of replication, eg of SV40, polyoma, adenovirus, EBV or BPV), use of amplification-promoting
• the selected high producing cells are preferably cultured in a serum-free culture medium and preferably in suspension culture under conditions which allow expression of the gene of interest.
• the protein / product of interest is preferably recovered as a secreted gene product from the cell culture medium.
• the gene product can also be isolated from cell lysates.
• standard purification steps are performed. For this one often first removes cells and cell debris from the culture medium or lysate.
• the desired gene product may then be released from contaminating soluble proteins, polypeptides and nucleic acids, e.g. by fractionation on immunoaffinity and ion exchange columns, ethanol precipitation, reverse phase HPLC or chromatography on Sephadex, silica or cation exchange resins such as DEAE.
• Methods which result in the purification of a heterologous protein expressed by recombinant host cells are known to the person skilled in the art and are described in the literature.
• the present invention relates to a method for increasing the titer of a
• Proteins of interest of a cell characterized in that a. in a nucleic acid sequence encoding the protein of interest, at least the codon deleted for the C-terminal
• Amino acid encoded b. the cell is transfected with a vector containing the altered nucleic acid from a) and c. the cell is cultured under conditions that allow production of the protein of interest.
• the present invention relates to a method for increasing the titer of an antibody of a cell, characterized in that in a nucleic acid sequence which codes for the heavy chain of the antibody, at least the codon which codes for the C-terminal amino acid lysine, the cell deleted is transfected with a vector containing the altered nucleic acid and the cell is cultured under conditions that allow production of the antibody of interest.
• the present invention preferably relates to a method for increasing the specific productivity of a protein of interest of a cell, characterized in that in a nucleic acid sequence coding for the protein of
• Amino acid is coded, the cell is transfected with a vector containing the altered nucleic acid, and the cell is cultured under conditions that allows production of the protein of interest.
• the present invention relates to a method for increasing the specific productivity of an antibody of a cell, characterized in that in a nucleic acid sequence which codes for the heavy chain of the antibody, at least the codon is deleted, that for the C-terminal amino acid Lysine is transfected, the cell is transfected with a first vector containing the altered nucleic acid, the cell is co-transfected with a second vector containing the light chain of an antibody, and the cell is cultured under conditions that require production of the antibody allowed.
• the modified heavy chain and the light chain or subunits of a heteromeric protein are introduced in successive transfections in any order.
• the present invention relates to a method for increasing the specific productivity of an antibody or any heteromeric protein of interest of a cell, characterized in that in a nucleic acid sequence which codes for the heavy chain of the antibody, at least the codon is deleted, which codes for the C-terminal amino acid lysine, the cell is transfected with a vector which contains both the altered nucleic acid for the heavy chain of an antibody and the light chain of an antibody, and the cell is cultured under conditions involving production of the antibody Antibody allowed.
• the vector with which the cell is transfected is a bi- or multicistronic vector.
• the vector with which the cell is transfected is a vector which contains the heavy and light antibody chain as separate transcription units,
• an IgGI molecule is expressed and secreted despite the deletion of the C-terminal lysine in CHO cells and the amounts of product are comparable to the cells transfected by IgGI wild-type (FIG. 2).
• cells expressing the lysine deletion variant of the IgGI on average achieve even 27% higher titers or 32% higher specific productivities than cells expressing the IgGI wild type (FIG. 3).
• This production advantage of the lysine deletion variant is still present even if a DHFR-based gene amplification is induced in these cell pools by addition of 100 nM MTX.
• the titre and / or the specific productivity is increased by 10-500%, preferably 20-300%, particularly preferably 50-200% with respect to the comparison value of the protein without the deletion of the C-terminal amino acid .
• the titre and / or the specific productivity is increased by at least 10%, preferably by at least 20%, further preferably by at least 50%, and particularly preferably by at least 75% with respect to the reference value of the protein without the deletion of the C-terminal amino acid.
• the specific productivity is at least 5 pg / cell / day.
• the present invention furthermore relates to a method for generating an expression vector for the increased production of a protein of interest, characterized in that in the nucleic acid sequence which codes for the protein of interest, at least the codon coding for the C-terminal amino acid is deleted, and the thus modified nucleic acid sequence is introduced into an expression vector.
• the present invention further relates to a method for producing a cell with increased titer and / or increased specific productivity of a
• Proteins of interest characterized in that a cell according to a treated according to the invention and then a single cell cloning is carried out, for example via dilution cloning or FACS based Einzellzellablage.
• the present invention furthermore relates to a method for producing a protein of interest in a cell, characterized in that a group of cells is treated according to a method according to the invention, these cells are selected in the presence of at least one selection pressure, optionally a single cell cloning is carried out and the protein of Interest is derived from the cells or the culture supernatant.
• a specific embodiment of the method according to the invention for producing at least one protein of interest is characterized in that the cells used for the preparation are additionally subjected to a gene amplification step after the selection step by means of selection means.
• a specific embodiment of all said processes according to the invention is characterized in that the C-terminal amino acid is lysine (Lys) or arginine (Arg), preferably Lys.
• Another specific embodiment of all said methods according to the invention is characterized in that the protein of interest is an antibody, an Fc fusion protein, EPO or tPA.
• a preferred embodiment of all said methods according to the invention is characterized in that the protein of interest is a heavy chain of an antibody and the C-terminal amino acid is lysine (Lys).
• a specific embodiment of all said methods according to the invention is characterized in that the heavy chain of the antibody is of the IgGI, IgG2, IgG3 or IgG4 type, preferably of the IgGI, IgG4 or IgG2 type.
• the protein of interest is a monoclonal, polyclonal, mammalian, mouse, chimeric, humanized, primate or human antibody or an antibody fragment or derivative of a heavy chain of an immunoglobulin antibody or a Fab, F (ab ') 2, Fc, Fc-Fc fusion protein, Fv, single chain Fv, single domain Fv, tetravalent single chain Fv, disulfide-linked Fv, domain-deleted antibody, a minibody, diabody, or a fusion polypeptide of one of said fragments with another peptide or polypeptide or is an Fc-peptide fusion protein, an Fc-toxin fusion protein or a
• Another specific embodiment of all said processes according to the invention is characterized in that the cell is cultured in suspension culture.
• a special embodiment of all said methods according to the invention is characterized in that the cell is cultured serum-free.
• a further specific embodiment of all said processes according to the invention is characterized in that the cell is cultured in chemically defined medium.
• a preferred embodiment of all said processes according to the invention is characterized in that the cell is cultured in protein-free medium.
• a preferred embodiment of all said methods according to the invention is characterized in that the cell is a eukaryotic cell, for example from yeast, plants, worms, insects, birds, fish, reptiles or mammals.
• a further preferred embodiment of all said methods according to the invention is characterized in that the cell is a mammalian cell.
• a particularly preferred embodiment of all said methods according to the invention is characterized in that the cell is a CHO cell.
• a further specific embodiment of the abovementioned process according to the invention is characterized in that the CHO cell is selected from the group: CHO wild type, CHO K1, CHO DG44, CHO DUKX-B11 and CHO Pro-5. Particularly preferred is a CHO DG44 cell.
• the invention further relates to an expression vector with increased expression of a gene of interest generatable by one of the aforementioned methods of the invention.
• the invention further relates to a cell generatable according to one of the aforementioned methods of the invention.
• the invention further relates to a method of producing and purifying a protein of interest, characterized in that at least one C-terminal amino acid of the corresponding gene of interest is deleted and the resulting protein of interest has a reduced heterogeneity compared to the wild-type protein without deletion.
• a specific embodiment of the method according to the invention is characterized in that the C-terminal amino acid is lysine (Lys) or arginine (Arg), preferably Lys.
• Another specific embodiment of the method according to the invention is characterized in that the protein of interest is an antibody, an Fc fusion protein, EPO or tPA.
• a preferred embodiment of the method according to the invention is characterized in that the protein of interest is a heavy chain of an antibody and the C-terminal amino acid lysine (Lys).
• a further preferred embodiment of the method according to the invention is characterized in that the heavy chain of the antibody is of the IgGI, IgG2, IgG3 or IgG4 type, preferably of the IgGI, IgG2 or IgG4 type.
• a special embodiment of the method according to the invention is characterized in that cells are cultivated in suspension culture for the production.
• Another specific embodiment of the method according to the invention is characterized in that cells are serum-free for the production be cultivated.
• a further specific embodiment of all said processes according to the invention is characterized in that the cell is cultured in chemically defined medium.
• a preferred embodiment of all said processes according to the invention is characterized in that the cell is cultured in protein-free medium.
• a preferred embodiment of the method according to the invention is characterized in that the cells are mammalian cells.
• a further preferred embodiment of the method according to the invention is characterized in that the cells are CHO cells, preferably CHO DG44 cells.
• a particularly preferred embodiment of the method according to the invention is characterized in that in the purification of the protein of interest, a lower salt concentration is used in comparison to the purification of a wild-type protein without deletion.
• the invention further relates to a method for producing an antibody, characterized in that in a nucleic acid which codes for the heavy chain of an antibody, at least the codon which codes for the C-terminal amino acid lysine, the cell is transfected with a vector containing the nucleic acid thus altered, and the cell is cultured under conditions permitting expression of the antibody.
• immunoglobulin G immunoglobulin G
• Lys Lys in mAb: monoclonal antibody
• NPT neomycin phosphotransferase
• SEAP secreted alkaline phosphatase
• the cells CHO-DG44 / dhfr " ⁇ are permanently stored as suspension cells in serum-free CHO-S-SFMII medium supplemented with hypoxanthine and thymidine (HT) (Invitrogen GmbH, Düsseldorf, DE) in cell culture flasks at 37 ° C. in a humid atmosphere and 5%.
• HT hypoxanthine and thymidine
• the cell counts and the viability are determined with a Cedex (Innovatis) and the cells are then seeded in a concentration of 1-3 x 10 5 / mL and passaged every 2-3 days.
• a Cedex Innovatis
• Lipofectamine Plus reagent For each transfection mixture, a total of 1.0-0.1 ⁇ g of plasmid DNA, 4 ⁇ L of Lipofectamine and 6 ⁇ L of Plus reagent are mixed according to the manufacturer's instructions and in a volume of 200 ⁇ L to 6 ⁇ 10 5 cells in 0 , 8 ml HT-supplemented CHO-S-SFMII medium. After incubation for 3 hours at 37 ° C.
• CHO-S-SFMII medium 2 ml of HT-supplemented CHO-S-SFMII medium are added. After a cultivation time of 48 hours, the transfection batches are either harvested (transient transfection) or subjected to selection. Since one expression vector contains one DHFR and the other an NPT selection marker, the cotransfected cells are transferred to CHO-S-SFMII medium without hypoxanthine and thymidine supplement for DHFR- and NPT-based selection 2 days after transfection and added to the medium also added G418 (Invitrogen) in a concentration of 400 ug / mL.
• G418 Invitrogen
• DHFR-based gene amplification of the integrated heterologous genes is achieved by addition of the selection agent MTX (Sigma, Deisenhofen, DE) in a concentration of 5-2000 nM to an HT-free CHO-S-SFMII medium.
• MTX Sigma, Deisenhofen, DE
• eukaryotic expression vectors are used which are based on the pAD-CMV vector and mediate the expression of a heterologous gene via the combination CMV enhancer / hamster ubiquitin / S27a promoter (WO 97/15664) or CMV enhancer / CMV promoter. While the base vector pBID contains the dhfr minigene which serves as an amplifiable selection marker, in the pBIN vector the dhfr minigene is replaced by an NPT gene.
• the NPT selection marker including SV40 early promoter and TK polyadenylation signal, was isolated from the commercial plasmid pBK-CMV (Stratagene, La JoIIa, CA) as a 1640 bp Bsu36I fragment. After a replenishment reaction of the fragment ends by Klenow DNA polymerase, the fragment was ligated with the 3750 bp Bsu36l / Stul fragment of the vector pBID, which was also treated with Klenow DNA polymerase. In both vectors, the expression of the heterologous gene is controlled by the combination CMV enhancer / hamster ubiquitin / S27a promoter.
• the vector pBIN ⁇ a is a derivative of the vector pBIN and contains a modified NPT gene. It is the NPT variant F240I (Phe240lle), whose cloning is described in WO2004 / 050884.
• F240I He240lle
• a derivative of the vector pBID the expression of the heterologous gene is under the control of the CMV enhancer / promoter combination.
• Supernatants from stably transfected CHO-DG44 cells are determined by ELISA according to standard protocols, using on the one hand a goat anti human IgG Fc fragment (Dianova, Hamburg, DE) and on the other hand an AP-conjugated goat anti human kappa light chain antibody (Sigma) becomes. As a standard purified antibody of the same isotype as the expressed antibodies.
• Productivities (pg / cell / day) are calculated using the formula pg / ((Ct-Co) t / In (Ct-Co)), where Co and Ct indicate the cell number at sowing or harvesting and t the cultivation time.
• the SEAP titer in culture supernatants of transiently transfected CHO-DG44 cells is quantified using the SEAP Reporter Gene Assay according to the protocol specifications of the manufacturer (Roche Diagnostics GmbH, Mannheim, DE).
• the heavy chain of the monoclonal humanized F19 antibody (IgGI / kappa) is isolated as a 1.5 kb Nael / HindIII fragment from the plasmid pG1 D105F19HC (NAGENESEQ: AAZ32786) and inserted into the EcoRI (filled in with Klenow DNA polymerase) and HindIII-digested vector pBID cloned resulting in the vector pBID / F19HC (Fig.1).
• the light chain is expressed as a 1.3 kb HindIII / EcoRI fragment from the plasmid pKN100F19LC (NAGENESEQ: AAZ32784) and cloned into the corresponding cleavage sites of the vector pBIN, resulting in the vector pBIN / F19LC ( Figure 1).
• the deletion of the C-terminal lysine on the heavy chain of the F19 antibody is carried out by means of PCR using the mutagenic primer F19HC-Lys rev gacgtctaga tcaacccgga gacagggaga ggc (SEQ ID NO: 1) with complementary sequence to the gene sequence corresponding to the last amino acids of the encoded heavy chain in the C-terminal region.
• the codon of C-terminal lysine is replaced by a stop codon.
• an Xbal restriction cleavage site follows, which is used for later cloning.
• This mutagenic primer is used in combination with the primer F19 heavy4 atctgcaacg tgaatcacaa gc (SEQ ID NO: 2), which has complementarity to a more upstream sequence in the heavy chain constant region.
• the template used for PCR mutagenesis is the vector pBID / F19HC.
• the resulting 757 bp PCR product is digested with BmgBI (an endogenous site downstream of primer position F19 heavy4) and XbaI and the 547 bp restriction fragment used to replace the corresponding sequence region in the vector pBID / F19HC. This results in the vector pBID / IgG1-Lys, which codes for a heavy chain of the F19 antibody with deleted C-terminal amino acid lysine (Fig.
• control plasmids pBID / F19HC and pBIN / F19LC which encode the monoclonal antibody F19 in its wild-type configuration, that is including the C-terminal lysine on the heavy chain
• pBID / IgG1-Lys and pBIN / F19LC encoding an F19 antibody whose heavy chain has a C-terminal lysine deletion
• the IgGI molecule is expressed and secreted and the amounts of product are comparable to the cells transfected by IgGI wild-type (FIG. 2).
• stably transfected cells For stable transfection of CHO-DG44 cells, co-transfection is carried out with the same plasmid combinations as described above, producing 10 pools per combination. As a negative control, two mock-transfected pools are carried, ie treated the same, but without DNA addition in the transfection mixture. The selection of stably transfected cells is carried out two days after transfection in HT-free medium with the addition of 400 ⁇ g / mL G418. After selection, the IgGI titer and the specific productivity of the cell pools are determined over a period of 3-4 passages (passenger rhythm 2-2-3 days).
• the heavy chain is cloned as a 2.2 kb BamHI / SmaI fragment into the EcoRI (filled-in interface by treatment with Klenow DNA polymerase) and BamHII-digested plasmid pBIDa
• the plasmid pBIDa / IgG4 HC results (FIG. 1).
• the light chain is cloned as a 1.1 kb BamHI / EcoRI fragment into the BamHI / EcoRI sites of the plasmid pBINa, resulting in the plasmid pBIN8a / IgG4 LC (FIG . 1 ).
• the deletion of the C-terminal lysine on the IgG4 antibody heavy chain is carried out by PCR using the mutagenic primer IgG4HC-Lys revgacgtctaga tcaacccaga gacagggaga ggct (SEQ ID NO: 3) with complementary sequence sequence corresponding to the last amino acids of the heavy chain encoded in the C-terminal region.
• the codon of C-terminal lysine is replaced by a stop codon.
• an Xbal restriction cleavage site follows, which is used for later cloning.
• This mutagenic primer is used in combination with the primer HC for ⁇ ccctgacctagagcccaccc (SEQ ID NO: 4), which has complementarity to a more upstream sequence in the heavy chain constant region.
• the vector pBIDa / IgG4 HC serves as template for the PCR mutagenesis.
• the resulting 1013 bp PCR product is digested with BmgBI (an endogenous cleavage site downstream of primer position HC for ⁇ ) and XbaI, and the 644 bp restriction fragment used to replace the corresponding sequence region in vector pBIDa / IgG4 HC.
• BmgBI an endogenous cleavage site downstream of primer position HC for ⁇
• XbaI 644 bp restriction fragment used to replace the corresponding sequence region in vector pBIDa / IgG4 HC.
• This results in the vector pBIDa / IgG4-Lys which codes for
• control plasmids pBIDa / IgG4 HC and pBIN8a / IgG4 LC which encode for the monoclonal IgG4 antibody in its wild-type configuration, that is, including the C-terminal lysine on the heavy chain
• the IgG4 molecule is even produced slightly better than the IgG4 wild type (FIG. 5).
• C-terminal lysine ions become Fc fusion proteins (bivalent or bispecific) in which biomolecules such as cytokines, soluble receptors, etc. are part of an Fc fusion protein (examples: alefacept, LFA-3-Fc, etanercept TNFR-Fc ), performed.
• transient transfections it is first tested whether the deletion of the C-terminal amino acid has an influence on expression and secretion. Thereafter, stable transfections are performed and the specific productivities and titres of cell pools expressing mutated proteins or wild-type proteins are compared.
• the work-up is identical.
• Protein A affinity chromatography (MabSelect, GE) is according to the manufacturer's instructions.
• the quantification of the product yield after Protein A chromatography is carried out by means of Protein A HPLC.
• the yields of both variants of the isotype IgGI are over 90% independent of the lysine codon deletion ( Figure 8).
• the lysine deletion has no negative influence on the affinity chromatography or the product yield.
• the product heterogeneity with respect to the C-terminal lysine is qualitatively determined in isoelectric focusing (IEF) as well as quantitatively by weak cationic exchange (WCX) (see Figs. 9 and 11).
• the antibodies are incubated with carboxypeptidase B.
• carboxypeptidase B At 37 ° C., 10 ⁇ g carboxypeptidase B are incubated in 100 ⁇ L and an antibody concentration of 1 mg / ml for 2 h.
• Figure 9 shows a reduction in the number of bands for the WT antibody (IgGI) after enzymatic cleavage with carboxypeptidase B (CpB).
• Cation exchange chromatography (ProPac WCX-10/4 x 250 mm) was performed at a flow rate of 1 mL / min and a 5-10% gradient over 40 min (buffer A 2OmM MES buffer pH 6.7; buffer B: 20 mM, 1M NaCl pH6.7).
• the pillar is loaded with 40 ⁇ g each antibody.
• the WT and the -Lys variant are analyzed respectively with and without enzymatic CpB treatment.
• the states Lys1 and Lys2 are characterized by the basic peaks 1 and 2. Their product content is -10%.
• the elution profile or overlay of the variant with Lysindeletion has a very low heterogeneity in the basic range. The product content is less than 1% (Fig.11).
• EXAMPLE 5 PURIFICATION OF IGG4 WT AND IGG4-LYS
• the work-up is identical to the IgGL.
• the protein A affinity chromatography (MabSelect, GE) is carried out according to the manufacturer's instructions.
• the quantification of the product yield after Protein A chromatography is carried out by means of Protein A HPLC.
• the yields of both variants of the isotype IgG4 are also over 90% independent of the lysine codon deletion ( Figure 8).
• the product heterogeneity with respect to the C-terminal lysine is quantitatively determined by LC-MS (see FIGS. 10 and 12). To determine the C-terminal lysine distribution, the antibody samples are first reduced with DTT.
• the reduced light chain and the reduced heavy chain are separated via HPSEC and analyzed in subsequent (in-line) ESI-TOF-MS.
• the distribution of the C-terminal lysine is based on the peak areas for the HC 1 -446 and HC 1 -447, respectively.
• mass shift by lysine is shown as a function of glycosylation (GO, G1, G2) ( Figure 12).
• the calculated product content of antibody molecules (IgG4 WT) with C-terminal lysines in the heavy chain is approximately 20% ( Figure 10).
• EXAMPLE 6 THERMAL STABILITY
• the determination of the thermal stability by means of intrinsic fluorescence shows no influence of the C-terminal lysine (IgGI WT and -Lys T m 69 ° C, or IgG4 WT and -Lys 64 ° C).
• the excitation wavelength is 295 nm.
• the respective emission spectrum is measured in 1 ° C increments over a range of 25 ° C to 85 ° C.
• the emission spectra are recorded over a wavelength range of 300 nm to 450 nm.
• the protein concentrations are 0.1 mg / mL in PBS buffer.
• the investigation shows that the C-terminal lysine of the heavy antibody chain has no influence on the thermal stability of the antibody molecule.

Landscapes

• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Health & Medical Sciences (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• Life Sciences & Earth Sciences (AREA)
• Genetics & Genomics (AREA)
• Medicinal Chemistry (AREA)
• Molecular Biology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Immunology (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Peptides Or Proteins (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Priority Applications (4)

Applications Claiming Priority (2)

Publications (1)

Family

ID=39107125

Family Applications (1)

Country Status (6)

Cited By (46)

Families Citing this family (46)

Citations (1)

Family Cites Families (5)

• 2007
  • 2007-08-29 EP EP07115227A patent/EP2031064A1/de not_active Ceased
• 2008
  • 2008-08-28 KR KR1020107004046A patent/KR20100046219A/ko not_active Withdrawn
  • 2008-08-28 EP EP08803328A patent/EP2195431A1/de not_active Ceased
  • 2008-08-28 JP JP2010522371A patent/JP2010536396A/ja active Pending
  • 2008-08-28 WO PCT/EP2008/061310 patent/WO2009027471A1/de not_active Ceased
  • 2008-08-28 CA CA2696809A patent/CA2696809A1/en not_active Abandoned
  • 2008-08-28 US US12/675,218 patent/US20100297697A1/en not_active Abandoned

Patent Citations (1)

Non-Patent Citations (4)

Also Published As

Similar Documents

Legal Events