WO2008144453A1 - Methods of treating cognitive disorders by inhibition of gpr12 - Google Patents
Methods of treating cognitive disorders by inhibition of gpr12 Download PDFInfo
- Publication number
- WO2008144453A1 WO2008144453A1 PCT/US2008/063804 US2008063804W WO2008144453A1 WO 2008144453 A1 WO2008144453 A1 WO 2008144453A1 US 2008063804 W US2008063804 W US 2008063804W WO 2008144453 A1 WO2008144453 A1 WO 2008144453A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gprl2
- training
- term memory
- long term
- mammal
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
Definitions
- the present invention relates to methods of treating cognitive disorders by inhibition of the Gprl2 gene or gene products.
- transcription-independent memory which includes short term memory
- transcription-dependent memory which includes long term memory
- Gprl2 is an orphan GPCR. Analysis of Gprl2 expression by in situ hybridization revealed that Gprl2 is widely expressed in the mouse CNS, with highest levels of expression within hippocampus and thalamus. (Ignatov et al. 2003, J. Neurosci. 23:907-914). The endogenous ligand of Gprl2 is unknown. Phylogenetic analysis of Gprl2 revealed the orphan receptors Gpr3 and Gpr6 as closest homologous of Gprl2. The subgroup comprising the three orphan GPCRs is most closely related to the Mcr (melanocortin-like peptide) and Edg (endothelial differentiation) families of GPCRs.
- Sphlngosvlphosphorylcholine activates Gprl2 in heterologous expression systems. SPC promotes differentiation and maturation of cultured embryonic cortical neurons Id. However, the endogenous ligand of Gprl2 and its in vivo function in the adult CNS are unknown. Previous results showed that Gprl2 signals via a Ga, dependent mechanism. Id. The cAMP/PKA pathway regulates CREB activity and long-term memory in the mammalian brain (Abel et a!., 1997, Cell 88:615-626), (Bourtchouladze et al, 1998. Learn Mem.
- Gprl2 plays an important role in mediating the cellular events underlying memory formation in mammals.
- G ⁇ rI2-mediated mRNA trafficking within the hippocampus has been discovered to be important for contextual long-term memory formation in mammals.
- disruption or inhibition of hippocampal Gprl2 function enhances transcription dependent memory formation (such as long term memory formation) in mammals.
- the present application is directed to, inter alia, methods of treating long term memory defects or cognitive disorders by the inhibition of the Gprl2 gene or gene products.
- the invention provides methods for modulating cognitive function in a mammal.
- the invention is directed to a method comprising administering to a mammal an effective amount of a pharmaceutical agent which modulates Gprl2 activity in the mammal.
- the mammal is an adult mammal. In another embodiment the mammal is a human.
- the administering results in long term memory formation modulation.
- long term memory formation is enhanced.
- the methods further comprises detecting the modulation in the long term memory formation.
- the detecting of the modulation is the detection of modulation of a hippocampal -dependent cognithe task.
- the detecting of the modulation is the detection of modulation of an amygdala-dependent cognitive task.
- the detecting of the modulation is the detection of modulation of a hippocampal -dependent cognitive task and an amygdala-dependent cognitive task.
- the modulation of Gprl2 activity comprises modulation of Gprl2 protein expression in the mammal.
- the administering results in enhancement of cognitive function.
- the methods further comprise training the mammal under conditions sufficient to produce an improvement in performance of a particular cognitive task.
- a performance gain is achieved relative to the performance of the cognitive task achieved by training alone in the absence of the administering.
- training comprises multiple training sessions. In another embodiment the training comprises spaced training sessions. In another embodiment the pharmaceutical agent is administered before and/or during each training session.
- the pharmaceutical agent comprises one or more of an effective amount of a Gprl2 siRNA molecule, an effective amount of a biologically active Gprl2 antisense fragment and/or an effective amount of an antibody specific for the Gprl2 protein.
- Another method according to the present invention comprises the steps of: (a) introducing a pharmaceutical agent of interest into host cells expressing a Gprl2 protein; and (b) determining Gprl2 function, wherein a difference in the Gprl2 function determined in (b) compared to the Gprl2 function of host cells of (a) to which the pharmaceutical agent has not been administered identifies the pharmaceutical agent as one capable of modulating Gprl2 function.
- Another method according to the present invention comprises the steps of: (a) administering to a mammal a pharmaceutical agent which modulates Gprl2 function; (b) training the mammal of step (a) and a control mammal of the same species to which the pharmaceutical agent has not been administered under conditions sufficient to produce long term memory formation in the mammal; (c) assessing long term memory formation in the mammals trained in step (b); and (d) comparing long term memory formation in the mammals assessed in step (c), wherein a difference in long term memory formation assessed in the mammal administered the pharmaceutical agent relative to long term memory formation assessed in the control mammal identifies the pharmaceutical agent as one which is capable of modulating long term memory formation.
- the mammals are adult mammals.
- the mammals are humans.
- the long term memory formation is hippocampus-dependent long term memory formation.
- the long term memory formation is amygdala- dependent long term memory formation.
- the long term memory formation is hippocampus-dependent and amygdala-dependent long term memory formation.
- the modulation of Gpr 12 activity comprises modulation of Gprl 2 protein expression in the mammal.
- training comprises multiple training sessions. In another embodiment the training comprises spaced training sessions.
- the pharmaceutical agent is administered before and/or during each training sessi on.
- the pharmaceutical agent comprises one or more of an effective amount of a Gpr 12 siRNA molecule, an effective amount of a biologically active Gprl 2 antisense fragment and/or an effective amount of an antibody specific for the Gprl 2 protein.
- FIG. Ia is a bar graph showing the effect of number of trials on contextual memory formation. Mice were trained with increasing numbers of CS-US pairings and contextual memory assessed 4 days later.
- FIG. Ib is a bar graph showing the effect of the trace interval on temporal memory formation. Mice were trained in trace fear conditioning using increasingly long trace intervals and tone memory compared to delay conditioning.
- FIG. 2a is a table of the level of Gprl 2 mRNA expression within mouse CNS as measured by real-time PCR.
- FIG. 2b is a table of the level of Gprl2 mRNA expression within mouse CNS as measured by real-time PCR.
- FIG. 3 is a baar graph of the mRNA levels of Gprl2 24 hours after siRNA treatment in Neuro2A cells.
- FIG, 4a is a bar graph of the effect of Gprl2 siRNA in mouse hippocampus on contextual memory.
- FIG. 4b is a bar graph of the effect of Gprl2 siRNA in mouse amygdala on contextual memory.
- FIG. 5 is a bar graph of the effect of Gprl2 siRNA in mouse hippocampus on trace fear memory.
- FIG. 6 is a picture of Nissl stain of non-targeting (A) and Gprl2 siRNA (B) on infused hippocampus. Hippocampal slices of the dorsal and ventral of the cannula insertion site are shown.
- FIG. 7 is a bar graph of the hippocampal Gprl2 mRNA levels 2 and 3 days after Gprl2 si RNA treatment .
- FIG. 8a shows qPCR analysis of Gprl 2, Crebl, and Grinl mRNA levels in Gprl2-/-. Gprl2+/- mice and WT control littermates. Gprl2 mRNA was reduced to 51% of control in Gprl2+/- mice and nonop-detectable in homozygous KO mice. In contrast, Crebi and Grinl mRNA was not affected.
- FIG. 8b shows gross analysis of Gprl 2+/- and WT hippocampal morphology (Cresyl violet stain). No obvious abnormalities were observed in Gpr+A mice.
- FIG. lib shows exploration time during testing in Gprl 2 ⁇ '» mice and WT controls.
- FIG. 12b shows exploration time during testing.
- the present invention is related to the discovery that inhibition of Gprl2 can promote long term memory formation.
- Transcription-independent memory includes various "memory phases", such as short- term memory, intermediate-(or middle-) term memory and (in flies) anesthesia-resistant memory. In common to these forms is that pharmacological inhibitors of RNA transcription do not disrupt these memories. Transcription-dependent memory usually is referred to as long-term memory and inhibitors of RNA synthesis block its appearance.
- RNA transcription-independent form Memory formation of this specific, experimental experience can exist in two general forms: a transcription-independent form and a transcription-dependent form.
- the former includes various "memory phases," such as short-term memory, and intermediate-(or middle-) term memory.
- memory phases such as short-term memory, and intermediate-(or middle-) term memory.
- pharmacological inhibitors of RNA transcription do not disrupt these memories.
- the latter form usually is referred to as long-term memory and inhibitors of RNA synthesis block its appearance.
- Gprl2 plays an important role in mediating the cellular events underlying memory formation in mammals.
- Gprl2-mediated mRNA trafficking within the hippocampus has been discovered to be important for contextual long-term memory formation in mammals.
- hippocampal Gprl2 function enhances transcription dependent memory formation (such as long term memory formation) in mammals.
- the present direction is directed to methods of treating long term memory defects or cognitive disorders by the inhibition of the Gprl2 gene or gene products.
- animal includes mammals, as well as other animals, vertebrate and invertebrate (e.g., birds, fish, reptiles, insects (e.g., Drosophila species), Aplysia).
- vertebrate and invertebrate e.g., birds, fish, reptiles, insects (e.g., Drosophila species), Aplysia).
- mammals as well as other animals, vertebrate and invertebrate (e.g., birds, fish, reptiles, insects (e.g., Drosophila species), Aplysia).
- mammal and “mammalian” refer to any vertebrate animal, including monotremes, marsupials and placental, that suckle their young and either give birth to living young (eutharian or placental mammals) or are egg-laying (metatharian or nonplacental mammals).
- mammalian species include humans and other primates (e.g., monkeys, chimpanzees), rodents (e.g., rats, mice, guinea pigs) and ruminents (e.g., cows, pigs, horses).
- rodents e.g., rats, mice, guinea pigs
- ruminents e.g., cows, pigs, horses.
- the mammal is a human.
- a control animal or a "normal animal” is an animal that is of the same species as, and otherwise comparable to (e.g., similar age, sex), the animal that is trained under conditions sufficient to induce transcription-dependent memory formation in that animal.
- Gprl2 function is meant the biological activity of Gprl2.
- Biological activity is understood to mean biological function or action.
- Such compounds include interfering RNA (siRNA) specific for the Gprl2 gene, antisense nucleotides specific for the Gprl2 gene, antibodies specific for the Gprl2 protein and small molecules, including peptides.
- the Gprl2 gene and protein sequences of mouse and humans are presented in Table 1.
- long-term memory In various species, long-term memory (LTM) is defined by two main biologica! properties. First, formation of long-term memory requires synthesis of new proteins. Second, it involves cAMP-responsive transcription and is mediated through the cAMP-respo ⁇ se element binding protein (CREB) family transcription factors. "Cognitive disorders, defects or conditions” include age- associated memory impairment, neurodegenerative diseases (e.g., Alzheimer's disease.
- Parkinson's disease Huntington's disease (chorea), other senile dementia
- psychiatric diseases e.g., depression, schizophrenia, autism, attention deficit disorder
- trauma dependent loss of function e.g., cerebrovascular diseases (e.g., stroke, ischemia), brain tumor, head or brain injury
- genetic defects e.g., Rubinstein-Taybi syndrome, down syndrome, Angelman syndrome, neurofibromatosis, Coffin-Lowry syndrome, Rett syndrome, myotonic dystrophy, fragile X syndrome (e.g.. fragile X-I , fragile X-2), William's syndrome) and learning disabilities.
- Training can comprise one or multiple training sessions and is training appropriate to produce an improvement in performance of the cognitive task of interest. For example, if an improvement in language acquisition is desired, training would focus on language acquisition. If an improvement in ability to learn to play a musical instrument is desired, training would focus on learning to play the musical instrument. If an improvement in a particular motor skill is desired, training would focus on acquisition of the particular motor skill. The specific cognitive task of interest is matched with appropriate training.
- multiple training sessions is meant two or more training sessions.
- the Gprl2 inhibitor can be administered before, during or after one or more of the training sessions.
- the Gprl 2 inhibitor is administered before and during each training session.
- training is meant cognitive training.
- modulate is meant that the expression of the gene, or level of RNA molecule or equivalent RNA molecules encoding one or more proteins or protein subunits, or activity of one or more proteins or protein subunits is up regulated or down regulated, such that expression, level, or activity is greater than or less than that observed in the absence of the modulator.
- modulate can mean “inhibit,” but the use of the word “modulate” is not limited to this definition.
- inhibitor By “inhibit”, “down-regulate”, or “reduce”, it is meant that the expression of the gene, or level of RNA molecules or equivalent RNA molecules encoding one or more proteins or protein subunits, or activity of one or more proteins or protein subunits, is reduced below that observed in the absence of the nucleic acid molecules (e.g., siNA) of the invention.
- inhibition, down-regulation or reduction with an siNA molecule is below that level observed in the presence of an inactive or attenuated siRNA molecule.
- inhibition, down-regulation, or reduction with siNA molecules is below that level observed in the presence of, for example, an siNA molecule with scrambled sequence or with mismatches.
- inhibition, down-regulation or reduction with an siRNA molecule is meant that the expression level of the target RNA molecules or equivalent RNA molecules is reduced by at least 20%, 30%, 40%, 50%, 60% or 70% compared to the level in the absence of the siRNA molecules.
- enhancing or “enhancement” is meant the ability to potentiate, increase, improve or make greater or better, relative to normal, a biochemical or physiological action or effect.
- enhancing long term memory formation refers to the ability to potentiate or increase long term memory formation in an animal relative to the normal long term memory formation of the animal.
- Enhancing performance of a cognitive task refers to the ability to potentiate or improve performance of a specified cognitive task by an animal relative to the normal performance of the cognitive task by the animal.
- hippocampal-dependent cognitive task refers to a cognitive task associated with the hippocampal region of the brain.
- amygdala-dependent cognitive task refers to a cognitive task associated with the amygdala region of the brain.
- target gene or gene means, a nucleic acid that encodes an RNA, for example, nucleic acid sequences including, but not limited to, structural genes encoding a polypeptide.
- the target gene can be a gene derived from a cell or an endogenous gene.
- target nucleic acid is meant any nucleic acid sequence whose expression or activity is to be modulated.
- the target nucleic acid can be DNA or RNA.
- homologous sequence is meant, a nucleotide sequence that is shared by one or more polynucleotide sequences, such as genes, gene transcripts and/or non-coding polynucleotides.
- a homologous sequence can be a nucleotide sequence that is shared by two or more genes encoding related but different proteins, such as different members of a gene family, different protein epitopes, different protein isoforms or completely divergent genes, such as a cytokine and its corresponding receptors.
- a homologous sequence can be a nucleotide sequence that is shared by two or more non-coding polynucleotides, such as noncoding DNA or RNA, regulatory sequences, introns, and sites of transcriptional control or regulation. Homologous sequences can also include conserved sequence regions shared by more than one polynucleotide sequence. Homology does not need to be perfect homology (e.g., 100%), as partially homologous sequences are also contemplated by the instant invention (e.g., 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80% etc.).
- nucleotide sequence of one or more regions in a polynucleotide does not vary significantly between generations or from one biological system, subject, or organism to another biological system, subject, or organism.
- the polynucleotide can include both coding and non-coding DNA and RNA.
- sense region is meant a nucleotide sequence of a siNA molecule having complementarity to an antisense region of the siNA molecule.
- the sense region of a siNA molecule can comprise a nucleic acid sequence having homology with a target nucleic acid sequence.
- antisense region is meant a nucleotide sequence of a siNA molecule having complementarity to a target nucleic acid sequence.
- the antisense region of a siNA molecule can optionally comprise a nucleic acid sequence having complementarity to a sense region of the siNA molecule.
- nucleic acid can form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson- Crick or other non-traditional types.
- the binding free energy for a nucleic acid molecule with its complementary sequence is sufficient to allow the relevant function of the nucleic acid to proceed, e.g., RNAi activity. Determination of binding free energies for nucleic acid molecules is well known in the art (see, e.g., Turner et al., 1987, CSH Symp. Quant. Biol. LII pp. 123-133; Frier et al, 1986, Proc. Nat Acad. Sci.
- a percent complementarity indicates the percentage of contiguous residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, or 10 nucleotides out of a total of 10 nucleotides in the first oligonucleotide being based paired to a second nucleic acid sequence having 10 nucleotides represents 50%, 60%, 70%, 80%, 90%, and 100% complementary respectively).
- Perfectly complementary means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
- RNA is meant a molecule comprising at least one ribonucleotide residue.
- ribonucleotide is meant a nucleotide with a hydroxyl group at the T position of a ⁇ -D- ribofuranose moiety.
- the terms include double-stranded RNA, single-stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinant! y produced RNA, as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides.
- alterations can include addition of non-nucleotide material, such as to the end(s) of the siNA or internally, for example at one or more nucleotides of the RNA.
- Nucleotides in the RNA molecules of the instant invention can also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be referred to as analogs or analogs of naturally-occurring RNA.
- phosphorothioate refers to an internucleotide linkage in an
- RNA molecule wherein at least one linkage between two nucleotides comprises a sulfur atom.
- phosphorothioate refers to both phosphorothioate and phosphorodithioate internucleotide linkages.
- phosphonoacetate linkage refers to an internucleotide linkage in an RNA molecule wherein at least one linkage between two nucleotides comprises an acetyl or protected acetyl group. See for example Sheehan et al., 2003 Nucleic Acids Research 31,
- thiophosphono acetate linkage refers to an RNA molecule comprising at least one internucleotide linkage comprising an acetyl or protected acetyl group and a sulfur atom. See for example Sheehan et al., 2003 Nucleic Acids Research 31, 4109-4118 or U.S. Patent PublicationNo.2006/0247194
- treating is intended to mean an amelioration of a clinical symptom indicative of poor long term memory formation.
- Amelioration of the clinical symptom includes, for example, an increase or improvement in long term memory, an increased ability to perform a cognitive task as compared to pretreatment levels or to an individual without defects in long term memory formation.
- the term "preventing” is intended to mean a forestalling of a clinical symptom indicative of poor long term memory formation.
- therapeutic efficacy when used herein, refers to a therapeutic effect of a drug or candidate drug in treating defects in long term memory formation, in improving long term memory formation, in improving the ability to perform cognitive tasks. The therapeutic efficacy can be measured by monitoring the patients ability to perform cognitive tasks.
- RNA molecules The appropriate siRNA can be produced, for example, either synthetically or by expression in cells.
- the DNA sequences encoding the antisense strand of the siRNA molecule can be generated by PCR.
- the siRNA encoding DNA is cloned into a vector, such as a plasmid or viral vector, to facilitate transfer into mammals.
- siRNA molecules may be synthesized using chemical or enzymatic means.
- each sequence of a siNA molecule of the invention is independently about 18 to about 30 nucleotides in length, in specific embodiments about 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length.
- the siRNA molecules contain about 19-23 base pairs, and preferably about 21 base pairs. In another embodiment, the siRNA molecules contain about 24-28 base pairs, and preferably about 26 base pairs.
- Individual siRNA molecules may be in the form of single strands, as well as paired double strands ("sense” and "antisense") and may include secondary structure such as a hairpin loop. Individual siRNA molecules could also be delivered as precursor molecules, which are subsequently altered to give rise to active molecules. Examples of siRNA molecules in the form of single strands include a single stranded anti-sense siRNA against a non-transcribed region of a DNA sequence (e.g. a promoter region).
- siNA molecules of the invention comprising hairpin or circular structures are about 35 to about 55 (e.g., about 35, 40, 45, 50 or 55) nucleotides in length, or about 38 to about 44 (e.g., about 38, 39, 40, 41, 42, 43, or 44) nucleotides in length and comprising about 16 to about 22 (e.g., about 16, 17, 18, 19, 20, 21 or 22) base pairs.
- the siRNA molecules may comprise a nucleotide fragment which is the sense strand or the antisense strand of DNA sequence encoding for the native mouse or human Gprl2 protein sequences.
- the mouse or human Gprl2 protein sequence comprise those of Table 1, selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO, 4 or SEQ ID NO:6.
- the siRNA molecules of the invention may be a nucleotide fragment of the sense strand of the rriRNA sequences of the native mouse or human Gprl2 mRNAs as shown in Table 1, selected from the group consisting of SEQ ID NO;2, SEQ ID NO:3. SEQ ID NO:5.
- the siRNA molecules of the invention may be a sequence which is antisense to of the rriRNA sequences of the native mouse or human Gprl2 mRNAs as shown in Table 1, selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5..
- Table 1 selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5..
- the discussion that follows discusses the proposed mechanism of RNA interference mediated by short interfering RNA as is presently known, and is not meant to be limiting and is not an admission of prior art. Chemically-modified short interfering nucleic acids possess similar or improved capacity to mediate RNAi as do siRNA molecules and are expected to possess improved stability and activity in vivo. Therefore, this discussion is not meant to be limiting only to siRNA and can be applied to siNA as a whole.
- RNAi activity is meant to include RNAi activity measured in vitro and/or in vivo where the RNAi activity is a reflection of both the ability of the siNA to mediate RNAi and the stability of the siNAs of the invention.
- RNA interference refers to the process of sequence specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et ah, 1998, Nature, 391, 806). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing or RNA silencing and is also referred to as quelling in fungi.
- the process of post- transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes which is commonly shared by diverse flora and phyla (Fire et ai, 1999, Trends Genet., 15, 358). Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs
- dsRNAs derived from viral infection or the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA
- the presence of dsRNA in cells triggers the RNAi response though a mechanism that has yet to be fully characterized. This mechanism appears to be different from the interferon response that results from dsRNA-mediated activation of protein kinase PKR and 2',5'-oligoadenylate synthetase resulting in non-specific cleavage of mRNA by ribonuclease L.
- Dicer a ribonuclease III enzyme referred to as Dicer.
- Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Berstein et a!., 2001, Nature, 409. 363).
- Short interfering RNAs derived from Dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes.
- Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control (Hutvagner et ai, 2001 , Science, 293, 834).
- the RNAi response also features an endonuclease complex containing a siRNA, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence homologous to the siRNA. Cleavage of the target RNA takes place in the middle of the region complementary to the guide sequence of the siRNA duplex (Elbashir et al, 2001, Genes Dev., 15, 188).
- RISC RNA-induced silencing complex
- RNA interference can also involve small RNA (e.g., micro-RNA or mRNA) mediated gene silencing, presumably though cellular mechanisms that regulate chromatin structure and thereby prevent transcription of target gene sequences (see for example Allshire, 2002, Science, 297, 1818-1819; Volpe et al, 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297. 2232-2237).
- small RNA e.g., micro-RNA or mRNA
- RNAi has been studied in a variety of systems. Fire et al.. 1998, Nature, 391, 806, were the first to observe RNAi in C. elegans. Wianny and Goetz, 1999, Nature Cell Biol., 2, 70, describe RNAi mediated by dsRNA in mouse embryos. Hammond et al. , 2000, Nature, 404, 293, describe RNAi in Drosophila cells transfected with dsRNA. Elbashir et al., 2001, Nature, 411, 494, describe RNAi induced by introduction of duplexes of synthetic 21 -nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells.
- the invention features modified siNA molecules.
- modifications contemplated for the phosphate backbone include phosphate backbone modifications comprising one or more phosphorothioate, phosphorodithioate, phosphonates, including mcthylphosphonate, phosphotriester including alkylphosphotriesters, morpholino. amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and/or alkylsilyl, substitutions.
- modifications contemplated for the sugar moiety include 2'-alkyl pyrimidine, such as 2 ! -O-methyl, 2'-fluoro, amino, and deoxy modifications and the like (see, e.g., Amarzguioui et al., 2003, Nucleic Acds Res. 31 :589-595. U.S. Patent Publication No. 2007/0104688).
- modifications contemplated for the base groups include abasic sugars, 2-O-a ⁇ kyl modified pyrimidines, 4-thiouracil, 5-bromouracil, 5-iodouracil, and 5-(3- aminoallyl)-uracil and the like.
- Locked nucleic acids, or LNA's could also be incorporated. Many other modifications are known and can be used so long as the above criteria are satisfied. Examples of modifications are also disclosed in U.S. Pat. Nos. 5,684,143, 5,858,988 and 6,291,438 and in U.S. published patent application No. 2004/0203145 Al , each incorporated herein by reference. Other modifications are disclosed in Herdewijn (2000), Antisense Nucleic Acid Drug Dev. 10:297-310, Eckstein (2000) Antisense Nucleic Acid Drug Dev. 10:117-21, Rusckowski et al. (2000) Antisense Nucleic Acid Drug Dev. 10:333-345, Stein et al. (2001) Antisense Nucleic Acid Drug Dev. 11:317-25 and Vorobjev et al. (2001) Antisense Nucleic Acid Drug Dev. 11 :77-85, each incorporated herein by reference
- RNA may be produced enzymatically or by partial/total organic synthesis, and modified ribonucleotides can be introduced by in vitro enzymatic or organic synthesis.
- each strand is prepared chemically. Methods of synthesizing RNA molecules are known in the art. Antibodies
- Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies.
- antibody is used in the broadest sense and specifically covers, for example, single antiTM Gprl2 monoclonal antibodies (including antagonist, and neutralizing antibodies), anti- Gprl2 antibody compositions with polyepitopic specificity, single chain anti- Gprl2 antibodies, and fragments of anti- Gprl2 antibodies.
- monoclonal antibody refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present in minor amounts.
- Antibody fragments comprise a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody.
- antibody fragments include Fab, Fab', F(ab')? , and Fv fragments; diabodies; linear antibodies (Zapata et al, Protein Eng. 8(10): 1057-1062 [1995]); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
- An antibody that "specifically binds to” or is “specific for” a particular polypeptide or an epitope on a particular polypeptide is one that binds to that particular polypeptide or epitope on a particular polypeptide without substantially binding to any other polypeptide or polypeptide epitope.
- the anti- Gprl2 antibodies may comprise polyclonal antibodies. Methods of preparing polyclonal antibodies are known to the skilled artisan. Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections.
- the immunizing agent may include the G ⁇ rl2 polypeptide or a fusion protein thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized.
- immunogenic proteins include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyro globulin, and soybean trypsin inhibitor.
- adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A 5 synthetic trehalose dicorynomycolate).
- the immunization protocol may be selected by one skilled in the art without undue experimentation.
- the anti- Gprl2 antibodies may, alternatively, be monoclonal antibodies. Monoclonal antibodies may be prepared using hybridoma methods, such as those described by Kohler and Miistein, Nature, 256:495 (1975).
- a mouse, hamster, or other appropriate host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent.
- the lymphocytes may be immunized in vitro.
- various other gene disruption techniques can be used with the present invention. As non-limiting examples, homologous recombination, transgenic expression of dominant-negative gene constructs, transgenic expression of normal gene constructs and any other modification of amino acid sequence in the target gene can be used.
- Viral vectors may also be used as appropriate to deliver various such gene constructs to brain cells, and such constructs include several which act via the RNAi pathway (short hairpin RNA, double stranded RNA, etc).
- the Gprl2 inhibitor compound sample can be suitably formulated and introduced into the mammal by any means that allows for a sufficient portion of the sample to enter the cell.
- the inhibitor can be formulated in buffer solutions such as phosphate buffered saline solutions, liposomes, micellar structures, and capsids.
- Formulations of siRNA with cationic lipids can be used to facilitate transfection of the dsRNA into cells.
- cationic lipids such as lipofectin (U.S. Pat. No.
- Suitable lipids include Oligofectamine, Lipofectamine (Life Technologies), NC388 (Ribozyme Pharmaceuticals, Inc., Boulder, Colo.), or FuGene 6 (Roche) all of which can be used according to the manufacturer's instructions.
- the Gprl2 specific siNA molecules of the invention are formulated or complexed with polyethylenimine (e.g., linear or branched PEI) and/or polyethylenimine derivatives, including for example grafted PEIs such as galactose PEI, cholesterol PEI, antibody derivatized PEL and polyethylene glycol PEI (PEG-PEI) derivatives thereof (see for example Ogris et al, 2001, AAPA PharmSci, 3, 1-11; Furgeson et al, 2003, Bioconjugate Chem., 14, 840-847; Kunath et al, 2002, Pharmaceutical Research, 19, 810-817; Choi et al, 2001, Bull. Korean Chem.
- polyethylenimine e.g., linear or branched PEI
- polyethylenimine derivatives including for example grafted PEIs such as galactose PEI, cholesterol PEI, antibody derivatized PEL and polyethylene glycol PEI (P
- the method of introducing Gprl2 inhibitor molecules into the environment of the cell will depend on the type of cell and the make up of its environment.
- a lipid formulation such as in lipofectamine and the inhibitor can be added directly to the liquid environment of the cells.
- Lipid formulations can also be administered to animals such as by intravenous, intramuscular, or intraperitoneal injection, or orally or by inhalation or other methods as are known in the art.
- the formulation is suitable for administration into animals such as mammals and more specifically humans, the formulation is also pharmaceutically acceptable.
- Pharmaceutically acceptable formulations for administering oligonucleotides are known and can be used.
- the Gprl 2 inhibitor comprises a pharmacologically effective amount.
- a pharmacologically or therapeutically effective amount refers to that amount of a inhibitor effective to produce the intended pharmacological, therapeutic or preventive result.
- the phrases "pharmacologically effective amount” and “therapeutically effective amount” or simply “effective amount” refer to that amount of an inhibitor effective to produce the intended pharmacological, therapeutic or preventive result.
- a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount necessary to effect at least a 20% reduction in that parameter.
- Suitable amounts of inhibitor must be introduced and these amounts can be empirically determined using standard methods.
- effective concentrations of individual siRNA species in the environment of a cell will be about 50 nanomolar or less 10 nanomolar or less, or compositions in which concentrations of about 1 nanomolar or less can be used, In other embodiment, methods utilize a concentration of about 200 picomolar or less and even a concentration of about 50 picomolar or less can be used in many circumstances.
- a suitable dosage unit of siRNA will be in the range of about 0.001 to about
- the Gprl2 inhibitor can be administered, in one embodiment of the present invention, once daily.
- the formulation may also be dosed in dosage units containing two, three, four, five, six or more sub-doses administered at appropriate intervals throughout the day. In that case, in one embodiment, the inhibitor contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage unit.
- the dosage unit can also be compounded for a single dose over several days, e.g., using a conventional sustained release formulation which provides sustained and consistent release of the siRNA over a several day period. Sustained release formulations are well known in the art. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose. Regardless of the formulation, the pharmaceutical composition must contain inhibitor in a quantity sufficient to inhibit expression of the Gpr 12 gene in the animal.
- Data can be obtained from cell culture assays to formulate a suitable dosage range.
- the dosage of compositions of the invention lies within a range of circulating concentrations that include the ED 50 (as determined by known methods) with little or no toxicity.
- the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
- the therapeutically effective dose can be estimated initially from cell culture assays. Levels of inhibitor in plasma may be measured by standard methods, for example, by high performance liquid chromatography.
- the method can be carried out by addition of the siRNA compositions to any extracellular matrix in which cells can live provided that the siRNA composition is formulated so that a sufficient amount of the siRNA can enter the cell to exert its effect.
- the method is amenable for use with cells present in a liquid such as a liquid culture or cell growth media, in tissue explants, or in whole organisms, including animals, such as mammals and especially humans.
- DNA sequences encoding an antisense strand or a siRNA specific for a target sequence of a gene are introduced into mammalian cells for expression.
- DNA sequences encoding an antisense strand or a siRNA specific for a target sequence of a gene are introduced into mammalian cells for expression.
- siRNA-encoding DNA sequences specific to each targeted gene sequence can be introduced simultaneously into the cell.
- mammalian cells may be exposed to multiple siRNAs that target multiple sequences in the gene.
- the Gprl2 inhibitors of this invention can be administered by any means known in the art such as by parenteral routes, including intravenous, intramuscular, intraperitoneal, subcutaneous, transdermal, airway (aerosol), rectal, vaginal and topical (including buccal and sublingual) administration.
- the pharmaceutical compositions are administered by intravenous or intrapar enteral infusion or injection.
- the invention features the use of methods to deliver the nucleic acid molecules of the instant invention to the central nervous system and/or peripheral nervous system. Experiments have demonstrated the efficient in vivo uptake of nucleic acids by neurons. As an example of local administration of nucleic acids to nerve cells, Sommer etal, 1998, Antisense Nuc.
- Acid Drug Dev., 8, 75 describe a study in which a 15mer phosphorothioate antisense nucleic acid molecule to c-fos is administered to rats via microinjection into the brain.
- Epa et al, 2000, Antisense Nuc. Acid Drug Dev., 10, 469 describe an in vivo mouse study in which beta- cyclodextrin-adamantane-oligonucleotide conjugates were used to target the p75 neurotrophin receptor in neuronally differentiated PC 12 cells.
- DRG dorsal root ganglion
- Nucleic acid molecules of the invention are therefore amenable to delivery to and uptake by neural cells.
- nucleic acid molecules of the invention targeting the candidate gene is provided by a variety of different strategies.
- Traditional approaches to CNS delivery include, but are not limited to, intrathecal and intracerebro ventricular administration, implantation of catheters and pumps, direct injection or perfusion at the site of injury or lesion, injection into the brain arterial system, or by chemical or osmotic opening of the blood-brain barrier.
- Other approaches can include the use of various transport and carrier systems, for example though the use of conjugates and biodegradable polymers.
- gene therapy approaches for example as described in Kaplitt et a!., U.S. Pat. No. 6,180,613 and Davidson. WO 04/013280, can be used to express nucleic acid molecules in the CNS.
- introducing encompasses a variety of methods of introducing DNA into a cell, either in vitro or in vivo. Such methods include transformation, transduction, transfection. and infection.
- Vectors are useful and preferred agents for introducing DNA encoding the siRNA molecules into cells.
- the introducing may be accomplished using at least one vector. Possible vectors include plasmid vectors and viral vectors.
- Viral vectors include retroviral vectors, lentiviral vectors, or other vectors such as adenoviral vectors or adeno-associated vectors.
- siRNA molecules or DNA encoding siRNA molecules into cells or tissues may also be used in the present invention, including liposomes, chemical solvents, electroporation, viral vectors, pinocytosis, phagocytosis and other forms of spontaneous or induced cellular uptake of exogenous material, as well as other delivery systems known in the art.
- Suitable promoters include those promoters that promote expression of the interfering RNA molecules once operatively associated or linked with sequences encoding the RNA molecules. Such promoters include cellular promoters and viral promoters, as known in the art. In one embodiment, the promoter is an RNA Pol HI promoter, which preferably is located immediately upstream of the DNA sequences encoding the interfering RNA molecule. Various viral promoters may be used, including, but not limited to, the viral LTR, as well as adenovirus, SV40, and CMV promoters, as known in the art.
- the invention uses a mammalian U6 RNA Pol III promoter, and more preferably the human U ⁇ snRNA Pol III promoter, which has been used previously for expression of short, defined ribozyme transcripts in human cells (Bertrand et al. « 1997; Good et a!,, 1997).
- the U ⁇ Pol III promoter and its simple termination sequence were found to express siRNAs in cells.
- Appropriately selected interfering RNA or siRNA encoding sequences can be inserted into a transcriptional cassette, providing an optimal system for testing endogenous expression and function of the RNA molecules.
- Expression of the Gprl2 gene can be determined by any suitable method now known in the art or that is later developed, it can be appreciated that the method used to measure the expression of a target gene will depend upon the nature of the target gene.
- the term "expression" can refer to a protein or transcript derived from the gene.
- the expression of a target gene can be determined by measuring the amount of mRNA corresponding to the target gene or by measuring the amount of that protein. Protein can be measured in protein assays such as by staining or immunobiotting or, if the protein catalyzes a reaction that can be measured, by measuring reaction rates. All such methods are known in the art and can be used.
- RNA species expression can be measured by determining the amount of RNA corresponding to the gene product.
- the measurements can be made on cells, cell extracts, tissues, tissue extracts or any other suitable source material.
- the determination of whether the expression of the Gprl2 gene has been reduced can be by any suitable method that can reliably detect changes in gene expression.
- FIG. Ia shows the effect of number of trials on contextual memory formation. Mice were trained with increasing numbers of CS-US pairings and contextual memory assessed 4 days later. Training with Ix or 2x CS-US pairings induced sub-maximal memory.
- Example 2 Level of Gprl2 RNA in the hippocampus of mice after training
- a standardized contextual fear conditioning task originally developed for evaluation of memory in CREB knock-out mice was used.
- the mouse was placed into the conditioning chamber (Med Associates, Inc., VA) for 2 minutes before the onset of the unconditioned stimulus (US), a 0.5 mA foot shock of 2 seconds duration.
- US unconditioned stimulus
- the US was repeated two times with a 1 min inter-trial interval between shocks.
- Freezing was defined as the complete lack of movement in intervals of 5 seconds ((Fanselow and Bolles, 1979 J Comp Physiol Psychol 93, 736-744.); (Bourtchuladze et al, 1994 Cell 79, 59-68); (Bourtchouladze et al, 1998 Learn Mem 5, 365-374). Total testing time lasted 3 minutes. After each experimental subject, the experimental apparatus was thoroughly cleaned with 75% ethanol, water, dried, and ventilated. Each experiment was filmed. All experimenters were blind to the drug and training conditions.
- RNA preparations were performed using the QIAgen RNeasy kit (Qiagen) according to the manufacturer's specifications.
- cDNA was generated using TaqMan Reverse transcriptase kit (Applied Biosystems). The cDNA was analyzed using Affymetrix Gene chip analysis and the relative level of expression to naive mice was obtained. Expression changes at Ih after trace fear conditioning identified by Affymetrix-chip analysis were confirmed by Nimble-chip analysis (NimbleGen Systems, Madison, Wl, USA). Expression changes at Ih after contextual fear conditioning (5x training trials) identified by Affymetrix-chip analysis were confirmed by a second Affy-chip analysis and by qPCR, Table 2
- Table d Identification of G ⁇ rl2 as a memory regaiated gene in hippocampm. P vaSue and fcS value (Aff ⁇ metTM gene-chip analysis) and relative expression to naive ⁇ pPCR confirmation) are shows.
- Example 3 Screening for siRNAs targeting Gprl2 using Neuro 2
- a cell Expression profiling by real-time PCR revealed Gprl2 mRNA expression within mouse and human CNS with little expression in peripheral tissues (FIG. 2).
- Gprl2 is widely present in the mouse CNS (FIG. 2a), with highest expression levels in thalamus, brainstem, and cerebellum, areas of the brain involved in feeding and the integration of sensory information (thalamus), motor control (cerebellum), and autonomous function (brainstem). High levels of Gprl2 were also observed in hippocampus and neocortex, two brain areas critical to memory formation (Fanselow 2005 J Comp Physiol Psychol 93, 736-744).
- Gpr3 and Gpr ⁇ the closest homologous of Gprl2, were present in the CNS of both mouse and human (FIG. 2a/b).
- Gprl2 mRNA levels appear to be much higher in human CNS than those of Gpr3 and 6. This is in contrast to the situation in mouse, where Gpr6 expression is very prominent in hippocampus, thalamus and neocortex, In vivo grade siSTABLE siRNA (Dharmacon Inc., Lafayette, USA) was used for evaluation of Gprl2 function in the mouse CNS. siRNA's were chemically modified to enhance stability. A 21mer siSTABLE non-targeting si RNA was used as control
- siRNA2 reduced Gprl2 mRNA levels to 31% of vehicle control at 24h after treatment and was chosen for in vivo evaluation of Gprl2.
- siRNA2 reduced Gprl2 mRNA levels to 31% of vehicle control at 24h after treatment and was chosen for in vivo evaluation of Gprl2.
- siSTABLE siRNA for Gprl2-2 siRNA was obtained from Dharmacon (Lafayette, USA).
- siRNA's against Gprl2 were tested by bDNA assay (QuantiGene bDNA assay kit, Bayer) in vitro using Neuro 2a cells.
- siRNA was designed using a multi component rational design algorithm (Reynolds et ai, (2004), Nat Biotechnol 22, 326- 330) and controlled for specificity towards Gprl2 by BLAST search.
- Gprl2 siRNA2 sense strand GAGGCACGCCCAUCAGAUAUU; SEQ ID NO:7 Gprl 2 siRNA2 anti-sense strand UAUCUGAUGGGCGUGCCUCUU; SEQ ID NO:8 non-targeting siRNA sense strand UAGCGACUAAACACAUCAAUU; SEQ ID NO:9 non-targeting siRNA antisense strand UUG AUGUGUU U AGUCGCU AUU; SEQ ID NO: 10
- Example 4 In vivo delivery of synthetic Gprl 2 siRNA in mice Animals and Environment. Young-adult (10-12 weeks old) C57BL/6 male mice
- mice (Taconic, NY) were used. Upon arrival, mice were group-housed (5 mice) in standard laboratory cages and maintained on a 12:12 hours light-dark cycle. The experiments were always conducted during the light phase of the cycle. After surgery for cannulation, mice were single housed in individual cages and maintained so till the end of the experiment. With the exception of training and testing times, the mice had ad libitum access to food and water. Mice were maintained and bred under standard conditions, consistent with National Institutes of Health (NIH) guidelines and approved by the Institutional Animal Care and Use Committee.
- NASH National Institutes of Health
- siRNA was diluted to 0.5 ⁇ g per ⁇ l in 5% glucose and mixed with 6 equivalents of a 22kDa linear polyethyleneimine (Fermentas). After 10 min of incubation at room temperature, 2 ⁇ l were injected into each hippocampus through an infusion cannula that was connected to a micro-syringe by a polyethylene tube. The entire infusion procedure took -2 min, and animals were handled gently to minimize stress. A total of 3 infusions of siRNA were given over a period of 3 days (I ⁇ g siRNA per hippocampus per day). siRNA mediated knockdown of Gprl2 may cause damage to the hippocampal formation. The hippocampal morphology of siRNA treated brains was evaluated.
- siRNA injected animals were sacrificed one day after the behavioral experiments. Frozen brains were sliced into 15 ⁇ m sections and stained with Cresyl violet. Hippocampal morphology was evaluated on photographs of serial sections. For cannula verification, animals were injected with I ⁇ l of methyl blue dye and sacrificed immediately afterwards. Frozen brains were sliced into 15 ⁇ m sections. The position of the dye staining was determined microscopically and compared to (Franklin and Paxinos, 1997 The Mouse Brain in Stereotaxic Coordinates). Cannula verification was performed blind to the treatment of the subject.
- FIG. 6a There were no obvious differences in hippocampal morphology between non-targeting siRNA (FIG. 6a) and G ⁇ rl2 siRNA treated mice (FIG. 6b). Hence, Gprl2 siRNA did not cause any obvious changes in brain morphology. Damage to the pyramidal cell layer was restricted to the area of cannulation. Note that the damage visible in FIG. 6 (middle panel) is facilitated by the removal of the hippocampal cannula. It does not represent the actual surgery induced alterations in hippocampal morphology, which is considered to be minimal and does not affect behavioral performance of the experimental subjects.
- mice were treated with intra- hippocampal siRNA for 3 days and determined Gprl2 rriRNA levels at 2 and 3 days after the last siRNA infusion (FlG. 7).
- siRNA injected hippocampal tissue of 6 mice per group was pooled. 6 individual RNA preparations were performed using the QlAgen RNeasy kit (Qiagen) according to the manufacturer's specifications. cDNA was generated using TaqMan Reverse transcriptase kit (Applied Biosystems). 2 real-time PCR reactions per
- Example 5 Effect of siRNA mediated knockdown of Gpr 12 on Contextual and Trace Conditioning
- Freezing was defined as the complete lack of movement in intervals of 5 seconds ((Fanselow and Bolles, 1979 J Comp Physiol Psychol 93, 736-744.); (Bourtchuladze et al, 1994 Cell 79, 59-68); (Bourtchouladze et al., 1998 Learn Mem 5, 365-374). Total testing time lasted 3 minutes. After each experimental subject, the experimental apparatus was thoroughly cleaned with 75% ethanol, water, dried, and ventilated. Each experiment was filmed. All experimenters were blind to the drug and training conditions.
- Gprl2 is a negative regulator of memory formation in both the hippocampus and the amygdala, two temporal lobe structures that are critical to memory formation in mice as well as in humans.
- Gprl2 siRNA induced a 'gain of function' (that is, enhancement of memory formation). It is unlikely that this effect on behavioral plasticity is induced by side effects of Gprl2 siRNA.
- Gprl2 is a critical regulator of memory in hippocampus and amygdala.
- Gprl2 knockout mice Gprl2 knockout mice. Gprl2 knockout mice were licensed from Deltagen (San Carlos, CA 94070, U.S.A). Heterozygous Gprl2 KO mice (referred to as Gprl2+/- mice) in predominantly C57B1/6 background (five backcrosses into C57BI/6) and WT litterrnate controls were generated by breeding male Gprl2+/ ⁇ mice to C57B1/6 females (Taconic Farms, USA). The mice were genotyped by polymerase chain reaction. Male and female mice balanced by gender were used at an age of 3-6 month for behavioral analysis. Evaluation of Gprl2 and control mRNA levels in hippocampus of Gprl2t-/- mice.
- mice were observed for 10 minutes 24 hours after training.
- mice were observed for 10 minutes at 3 hours after training (Bourtchouladze, 2003).
- Animals were presented with two objects, one of which was used during training, and thus was 'familiar' and the other of which was novel (e.g., a small pyramid-shaped object).
- An object-memory index was determined as ((novel exploration - familiar exploration)' total exploration) * 100.
- the total time exploring during testing was also calculated.
- the apparatus and the objects were thoroughly cleaned with 90 % ethanol. dried and ventilated for a few minutes.
- Table 3 shows results demonstrating the identification of Gprl2 as a memory regulated gene in hippocampus. P value and delta 0og2 of relative expression) are shown for Affymetrix gene-chip analysis. Trace conditioning data were independently confirmed by Nimble-chip analysis. Context conditioning data were confirmed by repetition of Affyrnetrix-chip and by qPCR.
- Gprl2+/- mice Chronic inhibition of Gprl2 in heterozygous KO mice (Gprl2+/- mice), siRNA data indicates that long-term memory is facilitated by acute inhibition of Gprl2 in intact adult mice.
- Gprl2+/- mice were analyzed.
- Homozygous Gprl2 knockout mice have previously been analyzed. Homozygous knockout mice exhibit impaired locomotion, impaired motor-performance on the Rotarod, impaired motor function and learning (swimming) in the Morris Water Maze, hyperanalgesia, and they show signs of liver and kidney disease (patent application WO 2005/027628, Carlton, 2005). An additional study demonstrated that homozygous Gprl2 knockout mice develop dyslipidemia and obesity (Bjursell, 2006). Overall, these findings have shown that homozygous Gprl2 knockout mice have a variety of general and developmentally induced health problems. It is expected that cognitive function is impaired in these mutants because of general ill-health.
- Gprl2 alleles are inactivated in Gprl2-/- mice and these mice have no detectable expression of Gprl2 mRNA (0% of WT controls), expression of Crebl was slightly reduced while Grinl levels were normal (81 ⁇ 1% and 102 ⁇ 2% of control, respectively; FIG. 8a).
- Gprl 2 mRNA levels are thus distinct from homozygous knockout mice.
- mRNA of Crebl and Grinl was not affected in Gprl2+/ ⁇ mice (102 ⁇ 8% and 101 ⁇ 4%, respectively; FIG.8a).
- Gross histological analysis of Gprl 2+/- hippocampus by Cresyl violet stain did not reveal any obvious differences between heterozygous mutants and WT controls (FIG. 8b).
- Novel Object Recognition memory in heterozygous Gprl 2 knockout mice Object recognition is an ethologically relevant task for mice and rats, which does not result from negative reinforcement (foot shock). This task relies on the natural curiosity of rodents to explore novel objects in their environments more than familiar ones. Obviously, for an object to be "familiar,” the animal must have attended to it before and remembered that experience. Hence, animals with better memory will attend and explore a new object more than a familiar one. Recent neuroimaging studies in humans demonstrated that memory in object recognition involves the prefrontal cortex (Deibert, 1999), a structure that is strongly affected by aging (Hedden, 2004).
- lOmin of training were not sufficient to induce long- term object recognition memory.
- heterozygous Gprl2 mutant mice (harboring one functional Gprl2 allele) have no obvious deficits in motor activity and exploration.
- Analysis of long-term object recognition memory revealed the unanticipated finding that long-term memory consolidation is enhanced in heterozygous Gprl2 knockout mice.
- Short-term memory in contrast, was normal.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Molecular Biology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Animal Behavior & Ethology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Neurosurgery (AREA)
- Microbiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Neurology (AREA)
- General Chemical & Material Sciences (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Epidemiology (AREA)
- Hospice & Palliative Care (AREA)
- Psychiatry (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200880023965A CN101808647A (zh) | 2007-05-15 | 2008-05-15 | 通过抑制Gpr12治疗认知障碍的方法 |
| EP08755619.7A EP2162137B1 (en) | 2007-05-15 | 2008-05-15 | Methods of treating cognitive disorders by inhibition of gpr12 |
| MX2009012316A MX2009012316A (es) | 2007-05-15 | 2008-05-15 | Metodos de tratamiento de trastornos cognitivos mediante la inhibicion de gpr12. |
| JP2010508596A JP2010527375A (ja) | 2007-05-15 | 2008-05-15 | Gpr12の阻害による認知障害の治療方法 |
| AU2008254905A AU2008254905A1 (en) | 2007-05-15 | 2008-05-15 | Methods of treating cognitive disorders by inhibition of Gpr12 |
| BRPI0811625-3A2A BRPI0811625A2 (pt) | 2007-05-15 | 2008-05-15 | Métodos de tratamento de distúrbios cognitivos através da inibição da gpr12 |
| CA002684920A CA2684920A1 (en) | 2007-05-15 | 2008-05-15 | Methods of treating cognitive disorders by inhibition of gpr12 |
| IL202091A IL202091A0 (en) | 2007-05-15 | 2009-11-12 | Methods of treating cognitive disorders by inhibition of gpr12 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US93816307P | 2007-05-15 | 2007-05-15 | |
| US60/938,163 | 2007-05-15 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2008144453A1 true WO2008144453A1 (en) | 2008-11-27 |
| WO2008144453A9 WO2008144453A9 (en) | 2010-03-18 |
Family
ID=40122145
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2008/063804 Ceased WO2008144453A1 (en) | 2007-05-15 | 2008-05-15 | Methods of treating cognitive disorders by inhibition of gpr12 |
Country Status (11)
| Country | Link |
|---|---|
| US (2) | US7968524B2 (https=) |
| EP (1) | EP2162137B1 (https=) |
| JP (1) | JP2010527375A (https=) |
| KR (1) | KR20100029079A (https=) |
| CN (1) | CN101808647A (https=) |
| AU (1) | AU2008254905A1 (https=) |
| BR (1) | BRPI0811625A2 (https=) |
| CA (1) | CA2684920A1 (https=) |
| IL (1) | IL202091A0 (https=) |
| MX (1) | MX2009012316A (https=) |
| WO (1) | WO2008144453A1 (https=) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2545795T3 (es) | 2009-04-09 | 2015-09-15 | Cognition Therapeutics, Inc. | Inhibidores del deterioro cognitivo |
| CN102595884B (zh) | 2009-07-31 | 2014-12-03 | 考格尼申治疗股份有限公司 | 认知衰退的抑制剂 |
| WO2011106785A2 (en) * | 2010-02-26 | 2011-09-01 | Cognition Therapeutics, Inc. | Methods of identifying agents effective to treat cognitive decline and diseases associated therewith |
| BR112013019775A2 (pt) | 2011-02-02 | 2017-04-18 | Cognition Therapeutics Inc | composto, composição farmacêutica e método para tratar declínio cognitivo ou doença de alzheimer em um paciente |
| RU2692258C2 (ru) | 2014-01-31 | 2019-06-24 | Когнишн Терапьютикс, Инк. | Композиции изоиндолина и способы лечения нейродегенеративного заболевания |
| DK3634394T3 (da) | 2017-05-15 | 2026-03-02 | Cognition Therapeutics Inc | Sammensætninger til behandling af neurogenerative sygdomme |
| BR102022009685A2 (pt) * | 2022-05-18 | 2023-11-28 | Fundação Oswaldo Cruz | Método para triagem de fármacos ou substâncias com potencial neuroprotetor, kit para triagem de fármacos ou substâncias, e, uso de um painel de genes |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050266502A1 (en) * | 2004-04-20 | 2005-12-01 | Merchiers Pascal G | Methods, compositions and compound assays for inhibiting amyloid-beta protein production |
| US20060247252A1 (en) * | 2000-08-10 | 2006-11-02 | Tully Timothy P | Augmented cognitive training |
Family Cites Families (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100283601B1 (ko) * | 1993-02-19 | 2001-03-02 | 아만 히데아키 | 글리세롤 유도체, 디바이스 및 의약 조성물 |
| US5858988A (en) * | 1993-02-24 | 1999-01-12 | Wang; Jui H. | Poly-substituted-phenyl-oligoribo nucleotides having enhanced stability and membrane permeability and methods of use |
| US6291438B1 (en) * | 1993-02-24 | 2001-09-18 | Jui H. Wang | Antiviral anticancer poly-substituted phenyl derivatized oligoribonucleotides and methods for their use |
| US5877399A (en) * | 1994-01-27 | 1999-03-02 | Johns Hopkins University | Transgenic mice expressing APP-Swedish mutation develop progressive neurologic disease |
| ATE386131T1 (de) * | 1994-04-13 | 2008-03-15 | Univ Rockefeller | Aav-vermittelte überbringung von dna in zellen des nervensystems |
| US5684143A (en) * | 1996-02-21 | 1997-11-04 | Lynx Therapeutics, Inc. | Oligo-2'-fluoronucleotide N3'->P5' phosphoramidates |
| US6653086B1 (en) * | 1998-04-14 | 2003-11-25 | Arena Pharmaceuticals, Inc. | Endogenous constitutively activated G protein-coupled orphan receptors |
| WO2001048483A2 (en) * | 1999-12-10 | 2001-07-05 | Astrazeneca Ab | Method for screening of appetite control agents |
| US20060247194A1 (en) * | 2000-08-30 | 2006-11-02 | Sirna Therapeutics , Inc. | Rna interference mediated treatment of alzheimer's disease using short interfering nucleic acid (sina) |
| CA2429814C (en) * | 2000-12-01 | 2014-02-18 | Thomas Tuschl | Rna interference mediating small rna molecules |
| US6586524B2 (en) * | 2001-07-19 | 2003-07-01 | Expression Genetics, Inc. | Cellular targeting poly(ethylene glycol)-grafted polymeric gene carrier |
| US20040023384A1 (en) * | 2002-07-31 | 2004-02-05 | Isis Pharmaceuticals Inc. | Antisense modulation of G protein-coupled receptor 12 expression |
| US20050106731A1 (en) | 2002-08-05 | 2005-05-19 | Davidson Beverly L. | siRNA-mediated gene silencing with viral vectors |
| AU2003261449A1 (en) * | 2002-08-07 | 2004-02-25 | Compositions for rna interference and methods of use thereof | |
| WO2004038407A2 (en) * | 2002-10-24 | 2004-05-06 | Bayer Healthcare Ag | Diagnostics and therapeutics for diseases associated with human g-protein coupled receptor 12 (gpr12) |
| US7829694B2 (en) * | 2002-11-26 | 2010-11-09 | Medtronic, Inc. | Treatment of neurodegenerative disease through intracranial delivery of siRNA |
| US20070104688A1 (en) * | 2003-02-13 | 2007-05-10 | City Of Hope | Small interfering RNA mediated transcriptional gene silencing in mammalian cells |
| KR20060036466A (ko) * | 2003-09-19 | 2006-04-28 | 패러다임 테라퓨틱스 리미티드 | 수용체 |
-
2008
- 2008-05-15 CA CA002684920A patent/CA2684920A1/en not_active Abandoned
- 2008-05-15 US US12/121,731 patent/US7968524B2/en not_active Expired - Fee Related
- 2008-05-15 JP JP2010508596A patent/JP2010527375A/ja active Pending
- 2008-05-15 MX MX2009012316A patent/MX2009012316A/es unknown
- 2008-05-15 BR BRPI0811625-3A2A patent/BRPI0811625A2/pt not_active IP Right Cessation
- 2008-05-15 EP EP08755619.7A patent/EP2162137B1/en not_active Not-in-force
- 2008-05-15 WO PCT/US2008/063804 patent/WO2008144453A1/en not_active Ceased
- 2008-05-15 AU AU2008254905A patent/AU2008254905A1/en not_active Abandoned
- 2008-05-15 CN CN200880023965A patent/CN101808647A/zh active Pending
- 2008-05-15 KR KR1020097024747A patent/KR20100029079A/ko not_active Withdrawn
-
2009
- 2009-11-12 IL IL202091A patent/IL202091A0/en unknown
-
2011
- 2011-06-27 US US13/169,739 patent/US20110281936A1/en not_active Abandoned
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060247252A1 (en) * | 2000-08-10 | 2006-11-02 | Tully Timothy P | Augmented cognitive training |
| US20050266502A1 (en) * | 2004-04-20 | 2005-12-01 | Merchiers Pascal G | Methods, compositions and compound assays for inhibiting amyloid-beta protein production |
Non-Patent Citations (1)
| Title |
|---|
| See also references of EP2162137A4 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2684920A1 (en) | 2008-11-27 |
| MX2009012316A (es) | 2009-12-03 |
| EP2162137A1 (en) | 2010-03-17 |
| US20090022667A1 (en) | 2009-01-22 |
| KR20100029079A (ko) | 2010-03-15 |
| US20110281936A1 (en) | 2011-11-17 |
| CN101808647A (zh) | 2010-08-18 |
| WO2008144453A9 (en) | 2010-03-18 |
| US7968524B2 (en) | 2011-06-28 |
| AU2008254905A1 (en) | 2008-11-27 |
| EP2162137A4 (en) | 2011-06-08 |
| JP2010527375A (ja) | 2010-08-12 |
| BRPI0811625A2 (pt) | 2014-11-11 |
| EP2162137B1 (en) | 2016-11-23 |
| IL202091A0 (en) | 2010-06-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20090053140A1 (en) | METHODS OF IDENTIFYING GENES INVOLVED IN MEMORY FORMATION USING SMALL INTERFERING RNA(siRNA) | |
| TWI543763B (zh) | Hsp47表現之調節 | |
| US9932578B2 (en) | Double-stranded oligonucleotide molecules to P53 and methods of use thereof | |
| US20110281936A1 (en) | Methods of treating cognitive disorders by inhibition of gpr12 | |
| KR20080079264A (ko) | 고안압증/녹내장을 치료하기 위한 RHO 키나아제의RNAi-매개 억제 | |
| JP2011015695A (ja) | Nav1.8の短い干渉核酸阻害のための組成物および方法 | |
| JP2009533475A (ja) | 脾臓チロシンキナーゼ関連する炎症状態のrnaiを介した阻害 | |
| CN111566212A (zh) | miRNA分子,等同物,安塔够妙或其来源用于治疗和/或诊断与神经元缺陷相关的病症和/或疾病或用于神经元生成和/或再生 | |
| JP5473594B2 (ja) | ヒスタミン受容体H1関連状態のRNAi介在型阻害 | |
| US9926565B2 (en) | Aptamer-RNAi therapeutic compositions | |
| EP2895608B1 (en) | Double-stranded oligonucleotide molecules to p53 and methods of use thereof | |
| WO2018232191A1 (en) | Enhanced organogenesis through manipulation of lin28/let-7/dis3l2 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200880023965.5 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08755619 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2684920 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008254905 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010508596 Country of ref document: JP Ref document number: MX/A/2009/012316 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 20097024747 Country of ref document: KR Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2008254905 Country of ref document: AU Date of ref document: 20080515 Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2008755619 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008755619 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2313/MUMNP/2009 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: PI0811625 Country of ref document: BR Kind code of ref document: A2 Effective date: 20091113 |