WO2008143794A1 - Fusion molecules and il-15 variants - Google Patents

Fusion molecules and il-15 variants Download PDF

Info

Publication number
WO2008143794A1
WO2008143794A1 PCT/US2008/005918 US2008005918W WO2008143794A1 WO 2008143794 A1 WO2008143794 A1 WO 2008143794A1 US 2008005918 W US2008005918 W US 2008005918W WO 2008143794 A1 WO2008143794 A1 WO 2008143794A1
Authority
WO
WIPO (PCT)
Prior art keywords
fusion protein
cells
tcr
protein complex
soluble
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2008/005918
Other languages
English (en)
French (fr)
Inventor
Hing C. Wong
Peter Rhode
Xiaoyun Zhu
Kai-Ping Han
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Altor Bioscience LLC
Original Assignee
Altor Bioscience LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Altor Bioscience LLC filed Critical Altor Bioscience LLC
Priority to ES08743432.0T priority Critical patent/ES2518393T3/es
Priority to CN201810136797.6A priority patent/CN108948177B/zh
Priority to EP08743432.0A priority patent/EP2160401B1/en
Priority to CN200880024119.5A priority patent/CN101743249B/zh
Priority to DK08743432.0T priority patent/DK2160401T3/da
Priority to AU2008253720A priority patent/AU2008253720B2/en
Priority to JP2010507463A priority patent/JP5501222B2/ja
Priority to CA2690825A priority patent/CA2690825C/en
Publication of WO2008143794A1 publication Critical patent/WO2008143794A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • C07K14/5443IL-15
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177Receptors; Cell surface antigens; Cell surface determinants
    • A61K38/1774Immunoglobulin superfamily (e.g. CD2, CD4, CD8, ICAM molecules, B7 molecules, Fc-receptors, MHC-molecules)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177Receptors; Cell surface antigens; Cell surface determinants
    • A61K38/1793Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19Cytokines; Lymphokines; Interferons
    • A61K38/20Interleukins [IL]
    • A61K38/2086IL-13 to IL-16
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7155Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interleukins [IL]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K19/00Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56966Animal cells
    • G01N33/56977HLA or MHC typing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/31Fusion polypeptide fusions, other than Fc, for prolonged plasma life, e.g. albumin
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/33Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/70Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor
    • C07K2319/75Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor containing a fusion for activation of a cell surface receptor, e.g. thrombopoeitin, NPY and other peptide hormones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins

Definitions

  • T Cell Receptors are primary effectors of the immune system that have unique advantages as a platform for developing therapeutics. While antibody therapeutics are limited to recognition of pathogens in the blood and extracellular spaces or to protein targets on the cell surface, T cell receptors can recognize antigens displayed with MHC molecules on the surfaces of cells (including antigens derived from intracellular proteins). Depending on the subtype of T cells that recognize displayed antigen and become activated, T cell receptors and T cells harboring T cell receptors can participate in controlling various immune responses. For instance, T cells are involved in regulation of the humoral immune response through induction of differentiation of B cells into antibody producing cells. In addition, activated T cells act to initiate cell-mediated immune responses. Thus, T cell receptors can recognize additional targets not available to antibodies.
  • T-cells are a subgroup of cells which together with other immune cell types (polymorphonuclear, eosinophils, basophils, mast cells, B-, NK cells) constitute the cellular component of the immune system.
  • T-cells function in immune surveillance and in the elimination of foreign antigen.
  • pathological conditions there is compelling evidence that T-cells play a major role in the causation and propagation of disease. In these disorders, breakdown of T-cell immunological tolerance, either central or peripheral is a fundamental process in the causation of autoimmune disease.
  • the TCR is believed to play an important role in the development and function of the immune system.
  • the TCR has been reported to mediate cell killing, increase B cell proliferation, and impact the development and severity of various disorders including cancer, allergies, viral infections and autoimmune disorders.
  • IL- 15 a member of the four alpha-helix bundle family of lymphokines. IL-15 plays a multifaceted role in development and control of the immune system. More specifically, IL- 15 influences the function, development, survival, and proliferation of CD8+ T cells, NK cells, killer T cells, B cells, intestinal intraepithelial lymphocytes (IEL) and antigen-presenting cells (APC).
  • IL- 15 receptor consists of three polypeptides, the type-specific IL- 15R alpha ("IL-15R ⁇ ” or "IL- 15Ra”), the IL-2/IL-15Rbeta ("IL-2R ⁇ ” or "IL-15Rb”), and the common gamma chain (" ⁇ C,” or "gC” which is shared by multiple cytokine receptors).
  • IL- 15 signaling can occur through the heterotrimeric complex of IL-15R ⁇ , IL- 2R ⁇ and ⁇ C; through the heterodimeric complex of IL-2R ⁇ and ⁇ C.
  • a novel mechanism of IL- 15 action is that of transpresentation in which IL- 15 and IL-15R ⁇ are coordinately expressed by antigen-presenting cells (monocytes and dendritic cells), and IL-15 bound to IL-15R ⁇ is presented in trans to neighboring NK or CD8 T cells expressing only the IL- 15R ⁇ C receptor.
  • IL- 15 transpresentation now appears to be a dominant mechanism for IL- 15 action in vivo and appears to play a major role in tumor immunosurveillance (Waldmann, TA, 2006, Nature Rev. Immunol. 6:595-601).
  • Soluble IL-2R ⁇ subunits, inducing isoforms containing a deletion of exon3 and the so-called "sushi" domain at the N terminus, have been shown to bear most of the structural elements responsible for cytokine binding.
  • IL-2R ⁇ alone is a low affinity receptor for IL-2 (Kd 10 nM)
  • IL-15R ⁇ binds IL- 15 with high affinity (Kd _ 100 pM).
  • Kd 10 nM low affinity receptor for IL-2
  • IL-15R ⁇ binds IL- 15 with high affinity (Kd _ 100 pM).
  • soluble IL-2R ⁇ and IL- 15 are able to form stable heterodimeric complexes in solution and these complexes are capable of modulating (i.e. either stimulating or blocking) immune responses via the intermediate or high affinity IL-15R complex (Mortier et al. 2006. J Biol Chem 281: 1612-1619; Stoklasek et al. 2006. J Immunol 177: 6072-6080; Rubinstein et al. 2006. Proc Natl Acad Sci U S A 103: 9166-9171).
  • IL- 15-based approaches Given the known effects of IL- 15 on the immune system, a number of IL- 15- based approaches have been explored to manipulate the immune system for the hosts benefit. While IL- 15 administration has been employed to bolster immune responses or augment immune system reconstitution, blockade of IL- 15 activity can inhibit autoimmune and other undesirable immune responses (Waldmann, TA, 2006, Nature Rev. Immunol. 6:595-601). In fact, one of the limitations with systemic IL-15 treatment is the possible induction of autoimmune disease. Other limitations include the difficulty in produce this cytokine in standard mammalian cell expression systems as well as its very short half-life in vivo.
  • IL-15 immunostimulatory therapeutic form of IL-15 that displays a longer in vivo half-life, increased activity binding to immune cells, or enhanced bioactivity. Additionally there is a need for effective IL-15 antagonists. Ideally it would be desirable that such molecules be selectively targeted to the disease site to avoid unwanted systemic toxicities and provide a more effective therapeutic benefit.
  • the instant invention provides a number of IL- 15 variants and soluble fusion complexes that have therapeutic use and methods for making such proteins.
  • the instant invention provides methods for killing target cells using the soluble fusion complexes of the invention.
  • the IL- 15 variants and soluble complexes described herein have potential therapeutic utility.
  • the invention provides a soluble fusion protein complex comprising at least two soluble fusion proteins, wherein the first fusion protein comprises a first biologically active polypeptide covalently linked to interleukin-15 (IL- 15) or functional fragment thereof, and the second fusion protein comprises a second biologically active polypeptide covalently linked to soluble interleukin-15 receptor alpha (IL- 15Ra) polypeptide or functional fragment thereof, wherein IL- 15 domain of a first fusion protein binds to the soluble IL-15Ra domain of the second fusion protein to form a soluble fusion protein complex.
  • IL- 15 interleukin-15
  • IL- 15Ra soluble interleukin-15 receptor alpha
  • one of the first and second biologically active polypeptides comprises a first soluble T-cell receptor (TCR) or functional fragment thereof.
  • an other of the biologically active polypeptides comprises the first soluble TCR or functional fragment thereof, thereby creating a multivalent TCR fusion protein complex with increased binding activity.
  • the other biologically active polypeptide comprises a second soluble TCR or functional fragment thereof, different than the first soluble TCR.
  • the TCR is specific for recognition of a particular antigen.
  • the TCR is a heterodimer comprising a and b chain TCR.
  • the TCR comprises a single chain TCR polypeptide.
  • the single chain TCR comprises a TCR V- ⁇ chain covalently linked to a TCR V- ⁇ chain by a peptide linker sequence.
  • the single chain TCR further comprises a soluble TCR C ⁇ chain fragment covalently linked to a TCR V- ⁇ chain.
  • the single chain TCR further comprises a soluble TCR Ca chain fragment covalently linked to a TCR V- ⁇ chain.
  • one or both of the first and second biologically active polypeptides comprises an antibody or functional fragment thereof.
  • the antibody is specific for recognition of a particular antigen.
  • the antibody is a single-chain antibody or single-chain Fv.
  • the single-chain antibody comprises an immunoglobulin light chain variable domain covalently linked to immunoglobulin heavy chain variable domain by polypeptide linker sequence.
  • the first biologically active polypeptide is covalently linked to IL- 15 (or functional fragment thereof) by polypeptide linker sequence.
  • the second biologically active polypeptide is covalently linked to IL-15Ra polypeptide (or functional fragment thereof) by polypeptide linker sequence.
  • the antigen for the TCR domain comprises peptide antigen presented in an MHC or HLA molecule.
  • the peptide antigen is derived from a tumor associated polypeptide or virus encoded polypeptide.
  • the antigen for the antibody domain comprises a cell surface receptor or ligand.
  • the antigen comprises a CD antigen, cytokine or chemokine receptor or ligand, growth factor receptor or ligand, tissue factor, cell adhesion molecule, MHC/MHC-like molecules, FC receptor, Toll-like receptor, NK receptor, TCR, BCR, positive/negative co-stimulatory receptor or ligand, death receptor or ligand, tumor associated antigen, or virus encoded antigen.
  • the IL- 15Ra polypeptide comprises the extracellular domain of the IL- 15 receptor alpha capable for binding IL- 15.
  • the IL- 15Ra polypeptide comprise either the IL-15a sushi domain (Wei et al. Journal of Immunology, 2001 , 167: 277-282) or the IL-15a ⁇ E3 domain (Anderson et al. 1995. J. Biol. Chem. 270:29862- 29869, Dubois et al. 1999. J. Biol. Chem. 274:26978-26984).
  • the invention provides for an IL- 15 variant (also referred to herein as IL- 15 mutant) that has a different amino acid sequence that the native (or wild type) IL- 15 protein and that binds the IL- 15Ra polypeptide and functions as an IL- 15 agonist or antagonist.
  • IL- 15 variant also referred to herein as IL- 15 mutant
  • Embodiments of the invention provide an IL- 15 variant as a non- fusion protein or as a soluble fusion protein comprising a biologically active polypeptide described above, wherein the IL-15 variant is used in place of the IL-15 domain.
  • the invention features a nucleic acid sequence encoding the first fusion protein of any of the aspects or embodiments as described herein.
  • the invention features a nucleic acid sequence encoding the second fusion protein of any of the aspects or embodiments as described herein.
  • the invention features a nucleic acid sequence encoding the IL- 15 variant of any of the aspects or embodiments as described herein.
  • the nucleic acid sequence further comprises a promoter, translation initiation signal, and leader sequence operably linked to the sequence encoding the fusion protein or IL- 15 variant.
  • any of the nucleic acid sequences as described above are contained in a DNA vector.
  • the invention features a method for making a soluble fusion protein complex of the above-described aspects, the method comprising introducing into a first host cell a DNA vector of the above-described aspects and embodiments that encodes the first fusion protein, culturing the first host cell in media under conditions sufficient to express the first fusion protein in the cell or the media, purifying the first fusion protein from the host cells or media, introducing into a second host cell a DNA vector of the above- described aspects and embodiments encoding the second fusion protein, culturing the second host cell in media under conditions sufficient to express the second fusion protein in the cell or the media, and purifying the second fusion protein from the host cells or media, and mixing the first and second fusion protein under conditions sufficient to allow binding between IL- 15 domain of a first fusion protein and the soluble IL-15Ra domain of a second fusion protein to form the soluble fusion protein complex.
  • the invention features a method for making a soluble fusion protein complex of the above-described aspects, the method comprising introducing into a host cell a DNA vector of the above-described aspects and embodiments, encoding the first fusion protein and a DNA vector as described in the above-described aspects and embodiments, encoding the second fusion protein, culturing the host cell in media under conditions sufficient to express the fusion proteins in the cell or the media and allow association between IL-15 domain of a first fusion protein and the soluble IL-15Ra domain of a second fusion protein to form the soluble fusion protein complex, purifying the soluble fusion protein complex from the host cells or media.
  • the invention features a method for making a soluble fusion protein complex of the above-described aspects, the method comprising introducing into a host cell a DNA vector of claim 28 encoding the first and second fusion proteins, culturing the host cell in media under conditions sufficient to express the fusion proteins in the cell or the media and allow association between IL- 15 domain of a first fusion protein and the soluble IL- 15Ra domain of a second fusion protein to form the soluble fusion protein complex, purifying the soluble fusion protein complex from the host cells or media.
  • the invention features a method for making an IL- 15 variant of the above-described aspects, the method comprising introducing into a host cell a DNA vector of the above-described aspects and embodiments that encodes an IL-15 variant, culturing the host cell in media under conditions sufficient to express the IL-15 variant in the cell or the media, purifying the an IL- 15 variant from the host cells or media.
  • the invention features a method for killing a target cell, the method comprising contacting a plurality of cells with a soluble fusion protein complex or IL- 15 variant of any of the above-described aspects or embodiments, wherein the plurality of cells further comprises immune cells bearing the IL- 15R chains recognized by the IL- 15 domain of the above-described aspects and the target cells bearing an antigen recognized by at least one of the biologically active polypeptides of the above-described aspects, forming a specific binding complex (bridge) between the antigen on the target cells and the IL- 15R chains on the immune cells sufficient to bind and activate the immune cells, and killing the target cells by the bound activated immune cells.
  • a specific binding complex bridge
  • the target cells are tumor cells or virally infected cells.
  • the biologically active polypeptide comprises a TCR.
  • the antigen on the target cells comprises a tumor or virally encoded peptide antigen presented in an MHC or HLA molecule and recognized by the TCR.
  • the immune cells are T-cells, LAK cells or
  • the invention features a method for preventing or treating disease in a patient in which the diseased cells express a disease associated antigen, the method comprising administering to the patient a soluble fusion protein complex or IL- 15 variant of any of the above-described aspects or embodiments, comprising a biologically active polypeptide recognizing a disease-associated antigen forming a specific binding complex (bridge) between antigen-expressing diseased cells and IL-15R-expressing immune cells sufficient to localize the immune cells, and damaging or killing the disease cells sufficient to prevent or treat the disease in the patient.
  • a soluble fusion protein complex or IL- 15 variant of any of the above-described aspects or embodiments comprising a biologically active polypeptide recognizing a disease-associated antigen forming a specific binding complex (bridge) between antigen-expressing diseased cells and IL-15R-expressing immune cells sufficient to localize the immune cells, and damaging or killing the disease cells sufficient to prevent or treat the disease in the patient.
  • the invention features a method for preventing or treating disease in a patient in which the diseased cells express a disease associated antigen, the method comprising mixing immune cells bearing the IL-15R chains with a soluble fusion protein complex of claim 1 - 22 comprising a biologically active polypeptide recognizing a disease- associated antigen, administering to the patient the immune cell-fusion protein complex mixture, forming a specific binding complex (bridge) between antigen-expressing diseased cells and IL-15R-expressing immune cells sufficient to localize the immune cells; and damaging or killing the disease cells sufficient to prevent or treat the disease in the patient.
  • a specific binding complex bridge
  • the invention features a method for preventing or treating an disease in a patient in which the patient's cells express a disease associated antigen, the method comprising administering to the patient a soluble fusion protein complex or IL-15 variant of any of the above-described aspects or embodiments, comprising a biologically active polypeptide recognizing a disease-associated antigen on the patient's cells, localizing soluble fusion protein complex or IL-15 variant on the patient's cells wherein the IL- 15 domain of the soluble fusion protein complex or IL-15 variant binds immune cells bearing the IL-15R chains and suppressing the immune response of the immune cells.
  • the disease is cancer or viral infection.
  • the disease is an immune disorder, autoimmune disease or inflammatory disorder.
  • the disease associated antigen is a peptide/MHC complex.
  • the invention features a method of stimulating immune responses in a mammal comprising administering to the mammal an effective amount of the soluble fusion protein complex or IL- 15 variant of any of the above-desc ⁇ bed aspects and embodiments.
  • the invention features a method of suppressing immune responses in a mammal comprising administering to the mammal an effective amount of the soluble fusion protein complex or IL-15 variant of any of the above-desc ⁇ bed aspects and embodiments.
  • Figure 1(A & B) are schematic drawings
  • A) is a schematic depicting an example of a fusion protein complex containing single chain TCR polypeptides.
  • (B) is a schematic depicting representative fusion protein constructs comprising the fusion protein complex.
  • Figure 2 (A - C) consists of three panels.
  • A depicts a map of pNEF38- c264scTCR/huIL15 expression vector.
  • B shows the sequence of c264scTCR/huIL15 fusion gene and
  • C shows the sequence of c264scTCR/huIL15 fusion protein, including the leader sequence.
  • Figure 3 (A - C) consists of three panels.
  • A) depicts a map of pNEF38- c264scTCR-hinge-huIL15 expression vector.
  • B shows the sequence of c264scTCR- hinge-huIL15 fusion gene and
  • C shows the sequence of c264scTCR-hinge-huIL15 fusion protein, including the leader sequence.
  • Figures 4 (A - C) consists of three panels.
  • A depicts a map of pNEF38- c264scTCR/huIL15RaDE3 expression vector.
  • B shows the sequence of c264scTCR/huIL15R ⁇ E3 fusion gene and
  • C shows the sequence of c264scTCR/huIL15R ⁇ E3 fusion protein, including the leader sequence.
  • Figure 5 (A - C) consists of three panels.
  • A depicts a map of the pNEF38- c264scTCR/huIL15RaSushi expression vector.
  • B shows the sequence of c264scTCR/huIL15R ⁇ Sushi fusion gene and
  • C shows the sequence of c264scTCR/huIL15R ⁇ Sushi fusion protein, including the leader sequence.
  • Figure 6 (A - C) consists of three panels.
  • A depicts the pNEF38-c264scTCR- hinge-huIL15RaSushi expression vector.
  • B shows the sequence of c264scTCR-hinge- huIL15R ⁇ Sushi fusion gene and
  • C shows the sequence of c264scTCR-hinge- huIL15R ⁇ Sushi fusion protein, including the leader sequence.
  • Figure 7 is a map of pSun-c264scTCRIL15/c264scTCRIL15RaSushi expression vector.
  • Figure 8 is a map ofpSun-c264scTCRIL15/c264scTCRIL15RaDE3 expression vector.
  • Figures 9 set forth characterization of transfected cells expressing TCR/IL15R ⁇ fusion protein.
  • A is two graphs showing flow cytometric analysis of fusion protein expressing cells.
  • B is a graph showing TCR-based ELISA results for fusion protein production.
  • Figures 10 shows analysis of TCR/IL15 and TCR/IL15R ⁇ fusion proteins by reducing SDS PAGE.
  • A shows cell culture supernatants containing c264scTCR/huIL15 or c264scTCR/huIL15RaSushi.
  • B shows cell culture supernatants containing c264scTCR/huILl 5 or c264scTCR/huILl 5R ⁇ E3.
  • Figures 11 shows analysis of TCR/IL15, TCR/IL15Ra and fusion protein complexes by size exclusion chromatography.
  • A is a graph showing the SEC chromatography profile of c264scTCR/huILl 5.
  • B is a graph showing the SEC chromatography profile of c264scTCR/huILl 5R ⁇ Sushi.
  • C is a graph showing the SEC chromatography profile of c264scTCR/huIL15 + c264scTCR/huIL15R ⁇ Sushi fusion protein complex.
  • Figures 12 (A & B) is an analysis of TCR/IL15R ⁇ and fusion protein complexes by size exclusion chromatography.
  • (A) is a graph illustrating the SEC chromatography profile of c264scTCR/huIL15R ⁇ E3.
  • (B) is a graph illustrating the SEC chromatography profile of c264scTCR/huIL15 + c264scTCR/huIL15R ⁇ E3 fusion protein complex.
  • Figure 13 is a graph showing the binding of TCR/IL15, TCR/IL15R ⁇ and fusion protein complexes to peptide/MHC complexes displayed on cells, as determined by flow cytometry.
  • Figure 14 (A -D) consists of four panels.
  • A shows the sequence of mature human ILl 5 protein (SEQ ID NO: 1) and the blue underlined residues are substituted in the IL-15 variants as showed in Table 1.
  • B depicts the pNEF38-c264scTCR-hinge- huILl 5D8A and pNEF38-c264scTCR-hinge-huILl 5D8N expression vectors.
  • (C) shows the sequence of pNEF38-c264scTCR-hinge-huIL15D8A and pNEF38-c264scTCR-hinge- huIL15D8N genes and (D) shows the sequence of pNEF38-c264scTCR-hinge- huIL15D8A and pNEF38-c264scTCR-hinge-huIL15D8N fusion protein, including the leader sequence.
  • the blue underlined nucleotides were changed to generate the indicated IL- 15 variants.
  • Figure 15 is a graph showing flow cytometric analysis of IL- 15R-bearing CTLL2 cells stained with fusion proteins and complexes following by TCR-specific peptide/MHC reagent.
  • Figure 16 are graphs showing the binding of dimeric fusion proteins complexes of TCR/IL15R ⁇ Sushi and TCR/IL15, comprising native and variant forms of ILl 5, to cognate peptide/MHC complexes displayed on cells loaded with peptide, as determined by flow cytometry. Background binding of the dimeric fusion proteins complexes on cells with no loaded peptide is also shown (A) is a graph showing the binding of the dimeric complexes of TCR/IL15R ⁇ Sushi and TCR/IL15wt (native form), or TCR/IL15D8N or TCR/ILl 5D8A variants to cognate peptide/MHC complexes displayed on cells.
  • (B) is a graph showing the slight background binding of dimeric complexes of TCR/ILl 5 R ⁇ Sushi and TCR/ILl 5wt (native form) to the cells without loaded peptide. No background binding of dimeric complexes of TCR/ILl 5R ⁇ Sushi and TCR/ILl 5D8N or TCR/ILl 5D8A variants was seen to the cells with not loaded.
  • (C) is graph(showing flow cytometric analysis of IL-15R ⁇ C-bearing 32D ⁇ cells stained with dimeric complexes of TCR/ILl 5R ⁇ Sushi and TCR/ILl 5wt (native form), or
  • TCR/ILl 5N72D, TCR/IL15D8N or TCR/IL15D8A variants Enhanced IL-15R ⁇ C binding of the complex containing TCR/ILl 5N72D and decreased IL-15R ⁇ C binding of complexes containing TCR/ILl 5D8N or TCR/ILl 5D8A was observed.
  • Figure 17 are graphs showing binding activities of wide type, antagonist, and agonist TCR/ILl 5 fusion proteins to cognate peptide/MHC complexes and ILl 5R ⁇ as determined by ELISA.
  • A is analysis showing binding activity of fusion proteins to cognate peptide/MHC complexes.
  • B is analysis showing binding activity of fusion proteins to ILl 5R ⁇ .
  • Figure 18 is a graph showing fusion proteins and fusion protein complexes support growth of IL15R-bearing cells as determined by cell proliferation assay.
  • Figure 19 are graphs showing the ability of TCR/IL-15 fusion proteins comprising IL-15 variants to inhibit or enhance growth of ILl 5R-bearing cells, as determined by cell proliferation assay.
  • A is graph showing the activity of fusion proteins comprising IL-15 variants to inhibit the proliferation of high affinity ILl 5R ( ⁇ receptor complex) bearing CTLL-2 cells.
  • B is graph showing the activity of fusion proteins comprising IL-15 variants to inhibit or enhance the proliferation of low affinity ILl 5R ( ⁇ receptor complex) bearing 32D ⁇ cells.
  • C is graph showing the activity of fusion proteins comprising IL-15 variants to block TCR/IL15wt-stimulated proliferation of high affinity ILl 5R ( ⁇ receptor complex) bearing CTLL-2 cells.
  • Figure 20 depicts the effects of in vitro incubation of NK cells with dimeric fusion proteins complexes of TCR/IL15R ⁇ Sushi and TCR/IL15 on the survival of xenograft tumor-bearing nude mice.
  • Athymic nude mice were injected with human NSCLC A549- A2 cells to allow establishment of lung metastases.
  • NK cells isolated from spleens of allogenic donor mice were incubated in vitro with rhIL-2, MARTl scTCR-IL2, c264scTCR-IL2 or c264scTCR-IL15/c264scTCR-IL15R ⁇ and adoptively transferred into the tumor-bearing mice that had been pretreated with cyclophosphamide (CTX), as indicated in the figure legend.
  • CTX cyclophosphamide
  • Figure 21 sets forth Table 1 showing the amino acid replacements in the IL-15 variants and the affects of these changes on IL-15 activity.
  • Figures 22A-B set forth the amino acid seuqnece of IL-15(SEQ ID NO:1) and the nucleic acid sequence of IL-15 (SEQ ID NO:2), respectively.
  • the IL-15 stably binds to the extracellular domain of the IL-15R ⁇ and that the resulting complex is capable of modulating (i.e. either stimulating or blocking) immune responses via the intermediate or high affinity IL-15R complex (1-4).
  • single-chain TCR or antibody polypeptides can be fused to cytokines and other immune effector domains and that such bispecif ⁇ c fusion molecules retain functional activity of both fusion domains (5-8).
  • multivalent forms of the TCR provide enhanced binding to their ligands (9).
  • a cell includes a plurality of cells, including mixtures thereof.
  • a nucleic acid molecule includes a plurality of nucleic acid molecules.
  • compositions and methods include the recited elements, but do not exclude other elements.
  • Consisting essentially of, when used to define compositions and methods, shall mean excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like.
  • Consisting of shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions of this invention. Embodiments defined by each of these transition terms are within the scope of this invention.
  • an “antibody” is any immunoglobulin, including antibodies and fragments thereof, that binds a specific epitope.
  • the term encompasses polyclonal, monoclonal, chimeric and single-chain antibodies as well as bispecific antibodies.
  • the term "antigen” as used herein is meant any substance that causes the immune system to produce antibodies or specific cell-mediated immune responses against it.
  • a disease associated antigen is any substance that is associated with any disease.
  • biologically active polypeptide as used herein is meant to refer to an amino acid sequence such as a protein, polypeptide or peptide; a sugar or polysaccharide; a lipid or a glycolipid, glycoprotein, or lipoprotein that can produce the desired effects as discussed herein, including a TCR or antibody fusion protein complex with antigen binding activity.
  • cell as used herein is meant to include any prokaryotic, eukaryotic, primary cell or immortalized cell line, any group of such cells as in, a tissue or an organ.
  • the cells are of mammalian and particularly of human origin, and can be infected by one or more pathogens.
  • a "host cell” in accord with the invention can be a transfected, transformed, transduced or infected cell of any origin, including prokaryotic, eukaryotic, mammalian, avian, insect, plant or bacteria cells, or it can be a cell sof any origin that can be used to propagate a nucleic acid described herein.
  • conjugate molecule as it is used herein is meant to refer to a TCR or antibody molecule and an effector molecule usually a chemical or synthesized molecule covalently linked (i.e. fused) by chemical or other suitable method. If desired, the conjugate molecule can be fused at one or several sites through a peptide linker sequence or a carrier molecule. Alternatively, the peptide linker or carrier may be used to assist in construction of the conjugate molecule. Specifically preferred conjugate molecules are conjugate toxins or detectable labels.
  • effector molecule as used herein is meant to refer to an amino acid sequence such as a protein, polypeptide or peptide; a sugar or polysaccharide; a lipid or a glycolipid, glycoprotein, lipoprotein or chemical agent that can produce the desired effects as discussed herein, including an IL- 15 domain, IL- 15 variant or IL- 15 receptor such as IL-15R ⁇ , IL-2R ⁇ or ⁇ C, or functional fragments thereof.
  • fusion molecule and “fusion protein” are used interchangeably and are meant to refer to a biologically active polypeptide usually a TCR or antibody and an effector molecule usually a protein or peptide sequence covalently linked (i.e. fused) by recombinant, chemical or other suitable method. If desired, the fusion molecule can be fused at one or several sites through a peptide linker sequence. Alternatively, the peptide linker may be used to assist in construction of the fusion molecule. Specifically preferred fusion molecules are fusion proteins. Generally fusion molecule also can be comprised of conjugate molecules.
  • host cell is meant to refer to any prokaryotic or eukaryotic cell that contains either a cloning vector or an expression vector. This term also includes those prokaryotic or eukaryotic cells that have been genetically engineered to contain the cloned gene(s) in the chromosome or genome of the host cell.
  • immune response refers to the process whereby immune cells are stimulated and recruited from the blood to lymphoid as well as non-lymphoid tissues via a multifactorial process that involves distinct adhesive and activation steps.
  • Activation conditions cause the release of cytokines, growth factors, chemokines and other factors, upregulate expression of adhesion and other activation molecules on the immune cells, promote adhesion, morphological changes, and/or extravasation concurrent with chemotaxis through the tissues, increase cell proliferation and cytotoxic activity, stimulate antigen presentation and provide other phenotypic changes including generation of memory cell types.
  • Immune response if also meant to refer to the activity of immune cells to suppress or regulate inflammatory or cytotoxic activity of other immune cells.
  • polynucleotide and “nucleic acid molecule” are used interchangeably to refer to polymeric forms of nucleotides of any length.
  • the polynucleotides may contain deoxyribonucleotides, ribonucleotides, and/or their analogs. Nucleotides may have any three-dimensional structure, and may perform any function, known or unknown.
  • polynucleotide includes, for example, single-, double- stranded and triple helical molecules, a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA, ribozymes, antisense molecules, cDNA, recombinant polynucleotides, branched polynucleotides, aptamers, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers.
  • a nucleic acid molecule may also comprise modified nucleic acid molecules (e.g., comprising modified bases, sugars, and/or internucleotide linkers).
  • polypeptide is meant to refer to any polymer preferably consisting essentially of any of the 20 natural amino acids regardless of its size.
  • protein is often used in reference to relatively large proteins, and “peptide” is often used in reference to small polypeptides, use of these terms in the field often overlaps.
  • polypeptide refers generally to proteins, polypeptides, and peptides unless otherwise noted.
  • Peptides useful in accordance with the present invention in general will be generally between about 0.1 to 100 KD or greater up to about 1000 KD, preferably between about 0.1, 0.2, 0.5, 1 , 2, 5, 10, 20 ,30 and 50 KD as judged by standard molecule sizing techniques such as centrifugation or SDS-polyacrylamide gel electrophoresis.
  • the terms "prevent,” “preventing,” “prevention,” “prophylactic treatment” and the like are meant to refer to reducing the probability of developing a disorder or condition in a subject, who does not have, but is at risk of or susceptible to developing a disorder or condition.
  • single chain antibody is meant to refer to an antibody based on a single chain format.
  • Single chain antibodies can consist of the minimal binding subunit of antibodies.
  • Single-chain antibodies can combine only those antigen-binding regions of antibodies on a single stably-folded polypeptide chain. As such, single-chain antibodies are of considerably smaller size than classical immunoglobulins but retain the antigen- specific binding properties of antibodies.
  • Single chain antibodies may be linked to a wide range of ligands, for example effector molecules or drug conjugates.
  • soluble as used herein is meant that the fusion molecule and particularly a fusion protein that is not readily sedimented under low G-force centrifugation (e.g. less than about 30,000 revolutions per minute in a standard centrifuge) from an aqueous buffer, e.g., cell media. Further, the fusion molecule is soluble if it remains in aqueous solution at a temperature greater than about 5-37°C and at or near neutral pH in the presence of low or no concentration of an anionic or non-ionic detergent. Under these conditions, a soluble protein will often have a low sedimentation value e.g., less than about 10 to 50 svedberg units.
  • Aqueous solutions referenced herein typically have a buffering compound to establish pH, typically within a pH range of about 5-9, and an ionic strength range between about 2mM and 50OmM. Sometimes a protease inhibitor or mild non-ionic detergent is added. Additionally, a carrier protein may be added if desired such as bovine serum albumin (BSA) to a few mg/ml.
  • exemplary aqueous buffers include standard phosphate buffered saline, tris-buffered saline, or other well known buffers and cell media formulations.
  • the term "stimulate” or “stimulating” is meant to refer to increase, to amplify, to augment, to boost an immune response. Stimulation can be a positive alteration.
  • An exemplary increase can be e.g., by 5%, 10%, 25%, 50%, 75%, or even 90-100%.
  • Other exemplary increases include 2-fold, 5-fold, 10-fold, 20-fold, 40-fold, or even 100-fold
  • suppress or “suppressing” is meant to refer to decrease, to attenuate, to diminish, to arrest, or to stabilize an immune response. Suppression may be a negative alteration.
  • An exemplary decrease can be e.g., by 5%, 10%, 25%, 50%, 75%, or even 90- 100%. Exemplary decreases include 2-fold, 5-fold, 10-fold, 20-fold, 40- fold, or even 100-fold.
  • T-cell Receptor is meant to refer to polypeptides of a complex of integral membrane proteins that participates in the activation of T cells in response to the presentation of antigen. T cells recognize a peptide bound to the MHC product through the ⁇ . heterodimeric T cell receptor (TCR).
  • TCR T-cell Receptor
  • the TCR repertoire has extensive diversity created by the same gene rearrangement mechanisms used in antibody heavy and light chain genes [Tonegawa, S. (1988) Biosci. Rep. 8:3-26].
  • TCRs do not undergo somatic point mutations as do antibodies and, perhaps not coincidentally. TCRs also do not undergo the same extent of affinity maturation as antibodies. TCRs as they occur in nature appear to have affinities that range from 10 5 to 10 7 M. "1 whereas antibodies typically have affinities that range from 10 5 to 10 9 M "1 [Davis et al. (1998) Annu. Rev. Immunol. 16:523-544; Eisen et al.
  • TCR encompasses polyclonal, monoclonal, chimeric, humanized, heterodimeric and single- chain T-cell receptors or functional fragment thereof, including molecule comprising the TCR Va and V ⁇ domains.
  • TCR also encompasses T-cell receptors disclosed in for example, US Provisional Application Entitled “T CELL RECEPTOR FUSIONS AND CONJUGATES AND METHODS OF USE THEREOF", filed March 19, 2008 and US Patent Publication US 2003 01-44474A1.
  • vector is a nucleic acid molecule that is able to replicate autonomously in a host cell and can accept foreign DNA.
  • a vector carries its own origin of replication, one or more unique recognition sites for restriction endonucleases which can be used for the insertion of foreign DNA, and usually selectable markers such as genes coding for antibiotic resistance, and often recognition sequences (e.g. promoter) for the expression of the inserted DNA.
  • Common vectors include plasmid vectors and phage vectors.
  • TCR T-CeIl Receptors
  • T-cells are a subgroup of cells which together with other immune cell types (polymorphonuclear, eosinophils, basophils, mast cells, B-, NK cells), constitute the cellular component of the immune system.
  • T-cells function in immune surveillance and in the elimination of foreign antigen.
  • pathological conditions there is compelling evidence that T-cells play a major role in the causation and propagation of disease.
  • breakdown of T-cell immunological tolerance either central or peripheral is a fundamental process in the causation of autoimmune disease.
  • the TCR is composed of at least seven transmembrane proteins. The disulfide- linked (.alpha..
  • beta. heterodimer forms the monotypic antigen recognition unit, while the invariant chains of CD3, consisting of .epsilon., .gamma., .delta., and .zeta. and .eta. chains, are responsible for coupling the ligand binding to signaling pathways that result in T-cell activation and the elaboration of the cellular immune responses.
  • CD3 invariant chains of CD3, consisting of .epsilon., .gamma., .delta., and .zeta. and .eta. chains, are responsible for coupling the ligand binding to signaling pathways that result in T-cell activation and the elaboration of the cellular immune responses.
  • TCR chains Two structural features are common to all known subunits. Firstly, they are transmembrane proteins with a single transmembrane spanning domain— presumably alpha-helical. Secondly, all the TCR chains have the unusual feature of possessing a
  • the invariant chains have a single negative charge, conserved between the mouse and human, and the variant chains possess one (TCR-beta) or two (TCR-alpha) positive charges.
  • TCR-beta The transmembrane sequence of TCR-. alpha, is highly conserved in a number of species and thus phylogenetically may serve an important functional role.
  • the octapeptide sequence containing the hydrophilic amino acids arginine and lysine is identical between the species.
  • a T-cell response is modulated by antigen binding to a TCR.
  • TCR is a membrane bound heterodimer consisting of an ⁇ and ⁇ chain resembling an immunoglobin variable (V) and constant (C) region.
  • the TCR ⁇ chain includes a covalently linked V- ⁇ and C- ⁇ chain, whereas the ⁇ chain includes a V- ⁇ chain covalently linked to a C- ⁇ chain.
  • the V- ⁇ and V- ⁇ chains form a pocket or cleft that can bind a superantigen or antigen in the context of a major histocompatibility complex (MHC) (known in humans as an HLA complex).
  • MHC major histocompatibility complex
  • the soluble fusion protein and conjugate molecule complexes of the invention comprise at least two soluble fusion proteins, where the first fusion protein comprises a first biologically active polypeptide covalently linked to interleukin-15 (IL- 15) or functional fragment thereof; and the second fusion protein comprises a second biologically active polypeptide covalently linked to soluble interleukin-15 receptor alpha (IL- 15Ra) polypeptide or functional fragment thereof, and wherein IL- 15 domain of a first fusion protein binds to the soluble IL- 15Ra domain of the second fusion protein to form a soluble fusion protein complex.
  • IL- 15 interleukin-15
  • IL- 15Ra soluble interleukin-15 receptor alpha
  • one of the biologically active polypeptides comprises a first soluble TCR or fragment thereof.
  • the other or second biologically active polypeptide comprises the first soluble TCR or functional fragment thereof and thus creates a multivalent TCR fusion protein complex with increased binding activity for cognate ligands compared to the monovalent TCR.
  • the other biologically active polypeptide comprises a second soluble TCR or functional fragment thereof, different than the first soluble TCR.
  • TCRs are produced that have higher affinity, or increased binding affinity for cognate ligands as compared, for example, to the native TCR.
  • the soluble TCR of the invention as described herein has a higher avidity or affinity for its ligand, then it is useful as a specific probe for cell-surface bound antigen.
  • the TCR is specific for recognition of a particular antigen.
  • TCR is a heterodimer comprising an ⁇ chain (herein referred to as ⁇ , alpha or a chain) and a ⁇ chain (herein referred to as ⁇ , beta or b chain).
  • the TCR comprises a single chain TCR polypeptide.
  • the single chain TCR may comprise a TCR V- ⁇ chain covalently linked to a TCR V- ⁇ chain by a peptide linker sequence.
  • the single chain TCR may further comprise a soluble TCR C ⁇ chain fragment covalently linked to a TCR V- ⁇ chain.
  • the single chain TCR may further comprise a soluble TCR Ca chain fragment covalently linked to a TCR V- ⁇ chain.
  • one or both of the first and second biologically active polypeptides comprises an antibody or functional fragment thereof.
  • biologically active polypeptide or “effector molecule” is meant an amino acid sequence such as a protein, polypeptide or peptide; a sugar or polysaccharide; a lipid or a glycolipid, glycoprotein, or lipoprotein that can produce the desired effects as discussed herein. Effector molecules also include chemical agents. Also contemplated are effector molecule nucleic acids encoding a biologically active or effector protein, polypeptide, or peptide. Thus, suitable molecules include regulatory factors, enzymes, antibodies, or drugs as well as DNA, RNA, and oligonucleotides.
  • the biologically active polypeptides or effector molecule can be naturally-occurring or it can be synthesized from known components, e.g., by recombinant or chemical synthesis and can include heterologous components.
  • a biologically active polypeptides or effector molecule is generally between about 0.1 to 100 KD or greater up to about 1000 KD, preferably between about 0.1, 0.2, 0.5, 1 , 2, 5, 10, 20 ,30 and 50 KD as judged by standard molecule sizing techniques such as centrifugation or SDS-polyacrylamide gel electropheresis. Desired effects of the invention include, but are not limited to, for example, forming a TCR fusion protein complex with increased binding activity, killing a target cell, e.g.
  • an assay could be used, for example an assay that includes sequential steps of culturing cells to proliferate same, and contacting the cells with a TCR fusion complex of the invention and then evaluating whether the TCR fusion complex inhibits further development of the cells.
  • TCR fusion complexes of the invention can be produced that contain a single effector molecule, including such a peptide of known structure. Additionally, a wide variety of effector molecules can be produced in similar DNA vectors. That is, a library of different effector molecules can be linked to the TCR molecule for presentation of infected or diseased cells. Further, for therapeutic applications, rather than administration of an TCR molecule to a subject, a DNA expression vector coding for the TCR molecule linked to the effector peptide can be administered for in vivo expression of the TCR fusion complex. Such an approach avoids costly purification steps typically associated with preparation of recombinant proteins and avoids the complexities of antigen uptake and processing associated with conventional approaches.
  • components of the fusion proteins disclosed herein can be organized in nearly any fashion provided that the fusion protein has the function for which it was intended.
  • each component of the fusion protein can be spaced from another component by at least one suitable peptide linker sequence if desired.
  • the fusion proteins may include tags, e.g., to facilitate modification, identification and/or purification of the fusion protein. More specific fusion proteins are in the Examples described below.
  • the fusion complexes of the invention preferably also include a flexible linker sequence interposed between the IL- 15 or IL-15R ⁇ domains and the biologically active polypeptide.
  • the linker sequence should allow effective positioning of the biologically active polypeptide with respect to the IL- 15 or IL- 15R ⁇ domains to allow functional activity of both domains.
  • the linker sequence positions the TCR molecule binding groove so that the T cell receptor can recognize presenting MHC-peptide complexes and can deliver the effector molecule to a desired site.
  • Successful presentation of the effector molecule can modulate the activity of a cell either to induce or to inhibit T-cell proliferation, or to initiate or inhibit an immune response to a particular site, as determined by the assays disclosed below, including the in vitro assays that includes sequential steps of culturing T cells to proliferate same, and contacting the T cells with a TCR fusion complex of the invention and then evaluating whether the TCR fusion complex inhibits further development of the cells.
  • the soluble fusion protein complex has a linker wherein the first biologically active polypeptide is covalently linked to IL-15 (or functional fragment thereof) by polypeptide linker sequence.
  • the soluble fusion protein complex as described herein has a linker wherein the second biologically active polypeptide is covalently linked to IL- 15Ra polypeptide (or functional fragment thereof) by polypeptide linker sequence.
  • the linker sequence is preferably encoded by a nucleotide sequence resulting in a peptide that can effectively position the binding groove of the TCR molecule for recognition of a presenting antigen.
  • the phrase "effective positioning of the biologically active polypeptide with respect to the IL-15 or IL-15R ⁇ domains" is intended to mean the biologically active polypeptide linked to the IL-15 or IL-15R ⁇ domains is positioned so that the IL- 15 or IL-15R ⁇ domains are capable of interacting with each other to form a protein complex.
  • the IL- 15 or IL-15R ⁇ domains are effectively positioned to allow interactions with immune cells to initiate or inhibit an immune reaction, or to inhibit orstimulate cell development.
  • the linker sequence comprises from about 7 to 20 amino acids, more preferably from about 8 to 16 amino acids.
  • the linker sequence is preferably flexible so as not hold the biologically active polypeptide or effector molecule in a single undesired conformation.
  • the linker sequence can be used, e.g., to space the recognition site from the fused molecule.
  • the peptide linker sequence can be positioned between the biologically active polypeptide and the effector molecule, e.g., to chemically crosslink same and to provide molecular flexibility.
  • the linker is preferably predominantly comprises amino acids with small side chains, such as glycine, alanine and serine, to provide for flexibility.
  • the linker sequence comprises glycine, alanine or serine residues, particularly glycine and serine residues.
  • the linker sequence is suitably linked to the b chain of the TCR molecule, although the linker sequence also could be attached to the a chain of the TCR molecule.
  • linker sequence may be linked to both a and b chains of the TCR molecule. When such a beta peptide chain is expressed along with the a chain, the linked TCR-effector peptide should fold resulting in a functional TCR molecule as generally depicted in Figure 1.
  • linker sequence is ASGGGGSGGG (i.e., Ala Ser GIy GIy GIy GIy Ser GIy GIy GIy GIy), preferably linked to the first amino acid of the b domain of the TCR.
  • linker sequences could be used including any of a number of flexible linker designs that have been used successfully to join antibody variable regions together, see Whitlow, M. et al., (1991) Methods: A Companion to Methods in Enzymology 2:97-105.
  • the amino sequence of the linker should be capable of spanning suitable distance from the C-terminal residue of the TCR beta chain to the N-terminal residue of the effector molecule.
  • Suitable linker sequences can be readily identified empirically. Additionally, suitable size and sequences of linker sequences also can be determined by conventional computer modeling techniques based on the predicted size and shape of the TCR molecule.
  • preparation of the fusion protein complexes of the invention can be accomplished by procedures disclosed herein and by recognized recombinant DNA techniques involving, e.g., polymerase chain amplification reactions (PCR), preparation of plasmid DNA, cleavage of DNA with restriction enzymes, preparation of oligonucleotides, ligation of DNA, isolation of mRNA, introduction of the DNA into a suitable cell, transformation or transfection of a host, culturing of the host.
  • the fusion molecules can be isolated and purified using chaotropic agents and well known electrophoretic, centrifugation and chromatographic methods. See generally, Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed. (1989); and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York (1989) for disclosure relating to these methods.
  • biologically active polypeptides or effector molecules of the invention may include factors such as cytokines, chemokines, growth factors, protein toxins, immunoglobulin domains or other bioactive proteins such as enzymes. Also biologically active polypeptides may include conjugates to other compounds such as nonprotein toxins, cytotoxic agents, chemotherapeutic agents, detectable labels, radioactive materials and such. Cytokines of the invention are defined by any factor produced by cells that affect other cells and are responsible for any of a number of multiple effects of cellular immunity.
  • cytokines include but are not limited to the IL-2 family, interferon (IFN), IL-10, IL-I, IL- 17, TGF and TNF cytokine families, and to IL-I through IL-35, IFN- ⁇ , IFN- ⁇ , , IFN- ⁇ ,. TGF- ⁇ , TNF- ⁇ and TNF ⁇ .
  • the first fusion protein comprises a first biologically active polypeptide covalently linked to interleukin-15 (IL- 15) domain or a functional fragment thereof.
  • IL- 15 is a cytokine which affects T-cell activation and proliferation.
  • the first fusion protein comprises an interleukin- 15 (IL- 15) domain that is an IL- 15 variant (also referred to herein as IL- 15 mutant).
  • the IL- 15 variant preferably comprises a different amino acid sequence that the native (or wild type) IL- 15 protein.
  • the IL- 15 variant preferably binds the IL- 15Ra polypeptide and functions as an IL-15 agonist or antagonist.
  • IL- 15 variants with agonist activity have super agonist activity.
  • the IL- 15 variant can function as an IL- 15 agonist or antagonist independent of its association with IL- 15Ra.
  • IL-15 agonists are exemplified by comparable or increased biological activity compared to wild type IL-15.
  • IL- 15 antagonists are exemplified by decreased biological activity compared to wild type IL-15 or by the ability to inhibit IL-15-mediated responses.
  • the IL- 15 variant binds with increased or decreased activity to the IL-15R ⁇ C receptors.
  • the sequence of the IL- 15 variant has at least one amino acid change, e.g. substitution or deletion, compared to the native IL-2 sequence, such changes resulting in IL- 15 agonist or antagonist activity.
  • amino acid substitutions/deletions are in the domains of IL-15 that interact with IL-15R ⁇ and/or ⁇ C. More preferably, the amino acid substitutions/deletions do not affect binding to the IL-15Ra polypeptide or the ability to produce the IL-15 variant. Suitable amino acid substitutions/deletions to generate IL-15 variants can be identified based on putative or known IL-15 structures, comparisons of IL- 15 with homologous molecules such as IL-2 with known structure, through rational or random mutagenesis and functional assays, as provided herein, or other empirical methods.
  • IL-15 variants of the invention contain one or more than one amino acid substitutions/deletions at position 8, 61 , 65, 72, 92, 101, 108, or 1 1 1 of the mature human IL-15 sequence; particularly, D8N ("D8" refers to the amino acid and residue position in the native mature human IL-15 sequence and "N” refers to the substituted amino acid residue at that position in the IL-15 variant), D8A, D61 A, N65A, N72R or Q108A substitutions result in IL-15 variants with antagonist activity and N72D substitutions result in IL-15 variants with agonist activity.
  • D8N refers to the amino acid and residue position in the native mature human IL-15 sequence and "N" refers to the substituted amino acid residue at that position in the IL-15 variant
  • D8A, D61 A, N65A, N72R or Q108A substitutions result in IL-15 variants with antagonist activity
  • N72D substitutions result in IL-15 variants with agonist activity.
  • the IL-15 variant is a component of a fusion protein complex
  • the IL-15 variant is a non-fusion protein.
  • the non-fusion form of the IL-15 variant is a soluble cytokine that functions as an IL-15 agonist or antagonist.
  • the non-fusion IL- 15 variant forms a complex with IL- 15Ra whereas in other embodiment it acts independently of IL-15Ra.
  • Chemokines of the invention are defined as any chemical factor or molecule which when exposed to other cells are responsible for any of a number of multiple effects of cellular immunity. Suitable chemokines may include but are not limited to the CXC, CC, C, and CX 3 C chemokine families and to CCL-I through CCL- 28, CXC-I through CXC-17, XCL-I, XCL-2, CX3CL1, MIP-Ib, IL-8, MCP-I, and Rantes.
  • Growth factors include any molecules which when exposed to a particular cell induce proliferation and/or differentiation of the affected cell. Growth factors include proteins and chemical molecules, some of which include: GM-CSF, G-CSF, human growth factor and stem cell growth factor. Additional growth factors may also be suitable for uses described herein.
  • Toxins or cytotoxic agents include any substance which has a lethal effect or an inhibitory effect on growth when exposed to cells. More specifically, the effector molecule can be a cell toxin of, e.g., plant or bacterial origin such as, e.g., diphtheria toxin (DT), shiga toxin, abrin, cholera toxin, ricin, saporin, pseudomonas exotoxin (PE), pokeweed antiviral protein, or gelonin. Biologically active fragments of such toxins are well known in the art and include, e.g., DT A chain and ricin A chain. Additionally, the toxin can be an agent active at the cell surface such as, e.g., phospholipase enzymes (e.g., phospholipase C).
  • the effector molecule can be a chemotherapeutic drug such as, e.g., vindesine, vincristine, vinblastin, methotrexate, adriamycin, bleomycin, or cisplatin.
  • chemotherapeutic drug such as, e.g., vindesine, vincristine, vinblastin, methotrexate, adriamycin, bleomycin, or cisplatin.
  • the effector molecule can be a detectably-labeled molecule suitable for diagnostic or imaging studies.
  • labels include biotin or streptavidin/avidin, a detectable nanoparticles or crystal, an enzyme or catalytically active fragment thereof, a fluorescent label such as green fluorescent protein, FITC, phycoerythrin, cychome, texas red or quantum dots; a radionuclide e.g., iodine-131, yttrium-90, rhenium-188 or bismuth- 212; a phosphorescent or chemiluminescent molecules or a label detectable by PET, ultrasound or MRI such as Gd- or paramagnetic metal ion-based contrast agents.
  • a protein fusion or conjugate complex that includes a covalently linked IL- 15 and IL- 15Ra domains has several important uses.
  • the protein fusion or conjugate complex comprising a TCR can be employed to deliver the IL- 15/IL-l 5Ra complex ⁇ to certain cells capable of specifically binding the TCR.
  • the protein fusion or conjugate complex provide means of selectively damaging or killing cells comprising the ligand.
  • Examples of cells or tissue capable of being damaged or killed by the protein fusion or conjugate complexes comprising a TCR include tumors and virally or bacterially infected cells expressing one or more ligands capable of being specifically bound by the TCR. Cells or tissue susceptible to being damaged or killed can be readily assayed by the methods disclosed herein.
  • the IL- 15 and IL-15Ra polypeptides of the invention suitably correspond in amino acid sequence to naturally occurring IL- 15 and IL- 15Ra molecules, e.g. IL-15 and IL-15Ra molecules of a human, mouse or other rodent, or other mammal.
  • the protein fusion or conjugate complexes of the present invention polyvalent, e.g., to increase the valency of the sc- TCR.
  • interactions between the IL-15 and IL-15Ra domains of the fusion protein complex provide a means of generating polyvalent complexes.
  • the polyvalent fusion protein can made by covalently or non-covalently linking together between one and four proteins (the same or different) by using e.g., standard biotin- streptavidin labeling techniques, or by conjugation to suitable solid supports such as latex beads.
  • Chemically cross-linked proteins are also suitable polyvalent species.
  • the protein can be modified by including sequences encoding tag sequences that can be modified such as the biotinylation BirA tag or amino acid residues with chemically reactive side chains such as Cys or His.
  • tag sequences that can be modified such as the biotinylation BirA tag or amino acid residues with chemically reactive side chains such as Cys or His.
  • amino acid tags or chemically reactive amino acids may be positioned in a variety of positions in the fusion protein, preferably distal to the active site of the biologically active polypeptide or effector molecule.
  • the C-terminus of a soluble fusion protein can be covalently linked to a tag or other fused protein which includes such a reactive amino acid(s).
  • Suitable side chains can be included to chemically link two or more fusion proteins to a suitable dendrimer or other nanoparticle to give a multivalent molecule.
  • Dendrimers are synthetic chemical polymers that can have any one of a number of different functional groups of their surface (D. Tomalia, Aldrichimica Acta, 26:91 :101 (1993)).
  • Exemplary dendrimers for use in accordance with the present invention include e.g. E9 starburst polyamine dendrimer and E9 combust polyamine dendrimer, which can link cystine residues.
  • the invention further provides nucleic acid sequences and particularly DNA sequences that encode the present fusion proteins.
  • the DNA sequence is carried by a vector suited for extrachromosomal replication such as a phage, virus, plasmid, phagemid, cosmid, YAC, or episome.
  • a DNA vector that encodes a desired fusion protein can be used to facilitate preparative methods described herein and to obtain significant quantities of the fusion protein.
  • the DNA sequence can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence.
  • a variety of host- vector systems may be utilized to express the protein-coding sequence.
  • mammalian cell systems infected with virus e.g., vaccinia virus, adenovirus, etc.
  • insect cell systems infected with virus e.g., baculovirus
  • microorganisms such as yeast containing yeast vectors, or bacteria transformed with bacteriophage DNA, plasmid DNA or cosmid DNA.
  • any one of a number of suitable transcription and translation elements may be used. See generally Sambrook et al., supra and Ausubel et al. supra.
  • soluble fusion protein complex comprising introducing into a host cell a DNA vector as described herein encoding the first and second fusion proteins, culturing the host cell in media under conditions sufficient to express the fusion proteins in the cell or the media and allow association between IL-15 domain of a first fusion protein and the soluble IL-15Ra domain of a second fusion protein to form the soluble fusion protein complex, purifying the soluble fusion protein complex from the host cells or media.
  • a preferred DNA vector according to the invention comprises a nucleotide sequence linked by phosphodiester bonds comprising, in a 5' to 3' direction a first cloning site for introduction of a first nucleotide sequence encoding a TCR chain, operatively linked to a sequence encoding an effector molecule.
  • the fusion protein components encoded by the DNA vector can be provided in a cassette format.
  • cassette is meant that each component can be readily substituted for another component by standard recombinant methods.
  • a DNA vector configured in a cassette format is particularly desirable when the encoded fusion complex is to be used against pathogens that may have or have capacity to develop serotypes.
  • the sequence coding for the TCR molecule is linked to a sequence coding for the effector peptide by use of suitable ligases.
  • DNA coding for the presenting peptide can be obtained by isolating DNA from natural sources such as from a suitable cell line or by known synthetic methods, e.g. the phosphate triester method. See, e.g., Oligonucleotide Synthesis, IRL Press (MJ. Gait, ed., 1984). Synthetic oligonucleotides also may be prepared using commercially available automated oligonucleotide synthesizers.
  • the gene coding for the TCR molecule can be amplified by the polymerase chain reaction (PCR) or other means known in the art.
  • PCR polymerase chain reaction
  • Suitable PCR primers to amplify the TCR peptide gene may add restriction sites to the PCR product.
  • the PCR product preferably includes splice sites for the effector peptide and leader sequences necessary for proper expression and secretion of the TCR-effector fusion complex.
  • the PCR product also preferably includes a sequence coding for the linker sequence, or a restriction enzyme site for ligation of such a sequence.
  • the fusion proteins described herein are preferably produced by standard recombinant DNA techniques. For example, once a DNA molecule encoding the TCR protein is isolated, sequence can be ligated to another DNA molecule encoding the effector polypeptide.
  • the nucleotide sequence coding for a TCR molecule may be directly joined to a DNA sequence coding for the effector peptide or, more typically, a DNA sequence coding for the linker sequence as discussed herein may be interposed between the sequence coding for the TCR molecule and the sequence coding for the effector peptide and joined using suitable ligases.
  • the resultant hybrid DNA molecule can be expressed in a suitable host cell to produce the TCR fusion complex.
  • the DNA molecules are ligated to each other in a 5' to 3' orientation such that, after ligation, the translational frame of the encoded polypeptides is not altered (i.e., the DNA molecules are ligated to each other in-frame).
  • the resulting DNA molecules encode an in-frame fusion protein.
  • Other nucleotide sequences also can be included in the gene construct.
  • a promoter sequence which controls expression of the sequence coding for the TCR peptide fused to the effector peptide, or a leader sequence, which directs the TCR fusion complex to the cell surface or the culture medium, can be included in the construct or present in the expression vector into which the construct is inserted.
  • An immunoglobulin or CMV promoter is particularly preferred.
  • TCR-derived proteins may be modified by certain amino acid substitutions, additions, deletions, and post-translational modifications, without loss or reduction of biological activity.
  • conservative amino acid substitutions that is, substitution of one amino acid for another amino acid of similar size, charge, polarity and conformation, are unlikely to significantly alter protein function.
  • the 20 standard amino acids that are the constituents of proteins can be broadly categorized into four groups of conservative amino acids as follows: the nonpolar (hydrophobic) group includes alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan and valine; the polar (uncharged, neutral) group includes asparagine, cysteine, glutamine, glycine, serine, threonine and tyrosine; the positively charged (basic) group contains arginine, histidine and lysine; and the negatively charged (acidic) group contains aspartic acid and glutamic acid.
  • the nonpolar (hydrophobic) group includes alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan and valine
  • the polar (uncharged, neutral) group includes asparagine, cysteine, glutamine, glycine, serine, threonine and
  • Homology between nucleotide sequences can be determined by DNA hybridization analysis, wherein the stability of the double-stranded DNA hybrid is dependent on the extent of base pairing that occurs. Conditions of high temperature and/or low salt content reduce the stability of the hybrid, and can be varied to prevent annealing of sequences having less than a selected degree of homology. For instance, for sequences with about 55% G-C content, hybridization and wash conditions of 40- 5O.degree.
  • BLAST Basic Local Alignment Search Tool
  • ClustalW ClustalW programs.
  • BLAST is available on the world wide web at ncbi.nlm.nih.gov and a version of ClustalW is available at 2. ebi.ac.uk.
  • the components of the fusion protein can be organized in nearly any order provided each is capable of performing its intended function.
  • the TCR is situated at the C or N terminal end of the effector molecule.
  • Preferred effector molecules of the invention will have sizes conducive to the function for which those domains are intended.
  • the effector molecules of the invention can be made and fused to the TCR by a variety of methods including well-known chemical cross-linking methods. See e.g., Means, G.E. and Feeney, R.E. (1974) in Chemical Modification of Proteins, Holden-Day. See also, S. S. Wong (1991) in Chemistry of Protein Conjugation and Cross-Linking, CRC Press.
  • a fusion molecule or a conjugate molecule in accord with the invention can be organized in several ways.
  • the C-terminus of the TCR is operatively linked to the N-terminus of the effector molecule. That linkage can be achieved by recombinant methods if desired.
  • the N- terminus of the TCR is linked to the C-terminus of the effector molecule.
  • one or more additional effector molecules can be inserted into the TCR fusion or conjugate complexes as needed.
  • the TCR gene fusion construct described above can be incorporated into a suitable vector by known means such as by use of restriction enzymes to make cuts in the vector for insertion of the construct followed by ligation.
  • the vector containing the gene construct is then introduced into a suitable host for expression of the TCR fusion peptide. See, generally, Sambrook et al., supra. Selection of suitable vectors can be made empirically based on factors relating to the cloning protocol. For example, the vector should be compatible with, and have the proper replicon for the host that is being employed. Further the vector must be able to accommodate the DNA sequence coding for the TCR fusion complex that is to be expressed.
  • Suitable host cells include eukaryotic and prokaryotic cells, preferably those cells that can be easily transformed and exhibit rapid growth in culture medium.
  • Specifically preferred hosts cells include prokaryotes such as E. coli, Bacillus subtillus, etc. and eukaryotes such as animal cells and yeast strains, e.g., S. cerevisiae.
  • Mammalian cells are generally preferred, particularly J558, NSO, SP2-0 or CHO.
  • Other suitable hosts include, e.g., insect cells such as Sf9. Conventional culturing conditions are employed. See Sambrook, supra. Stable transformed or transfected cell lines can then be selected. Cells expressing a TCR fusion complex of the invention can be determined by known procedures.
  • expression of a TCR fusion complex linked to an immunoglobulin can be determined by an ELISA specific for the linked immunoglobulin and/or by immunoblotting.
  • Other methods for detecting expression of fusion proteins comprising TCRs linked to IL- 15 or IL- 15Ra domains are disclosed in the Examples.
  • a host cell can be used for preparative purposes to propagate nucleic acid encoding a desired fusion protein.
  • a host cell can include a prokaryotic or eukaryotic cell in which production of the fusion protein is specifically intended.
  • host cells specifically include yeast, fly, worm, plant, frog, mammalian cells and organs that are capable of propagating nucleic acid encoding the fusion.
  • mammalian cell lines which can be used include CHO dhfr- cells (Urlaub and Chasm, Proc. Natl. Acad. Sci. USA, 77:4216 (1980)), 293 cells (Graham et al, J Gen. Virol., 36:59 (1977)) or myeloma cells like SP2 or NSO (Galfre and Milstein, Meth. Enzymol., 73(B):3 (1981 )).
  • Host cells capable of propagating nucleic acid encoding a desired fusion protein encompass non-mammalian eukaryotic cells as well, including insect (e.g., Sp. frugiperd ⁇ ), yeast (e.g., S. cerevisiae, S. pombe, P. pastoris., K. lactis, H. polymorpha; as generally reviewed by Fleer, R., Current Opinion in Biotechnology, 3(5):486496 (1992)), fungal and plant cells. Also contemplated are certain prokaryotes such as E. coli and Bacillus.
  • Nucleic acid encoding a desired fusion protein can be introduced into a host cell by standard techniques for transfecting cells.
  • transfecting or “transfection” is intended to encompass all conventional techniques for introducing nucleic acid into host cells, including calcium phosphate co-precipitation, DEAE-dextran-mediated transfection, lipofection, electroporation, microinjection, viral transduction and/or integration. Suitable methods for transfecting host cells can be found in Sambrook et al. supra, and other laboratory textbooks.
  • promoters transcriptional initiation regulatory region
  • the selection of the appropriate promoter is dependent upon the proposed expression host. Promoters from heterologous sources may be used as long as they are functional in the chosen host.
  • Promoter selection is also dependent upon the desired efficiency and level of peptide or protein production.
  • Inducible promoters such as tac are often employed in order to dramatically increase the level of protein expression in E. coli. Overexpression of proteins may be harmful to the host cells. Consequently, host cell growth may be limited.
  • the use of inducible promoter systems allows the host cells to be cultivated to acceptable densities prior to induction of gene expression, thereby facilitating higher product yields.
  • signal sequences may be used according to the invention.
  • a signal sequence which is homologous to the TCR coding sequence may be used.
  • a signal sequence which has been selected or designed for efficient secretion and processing in the expression host may also be used.
  • suitable signal sequence/host cell pairs include the B. subtilis sacB signal sequence for secretion in B. subtilis, and the Saccharomyces cerevisiae .alpha. -mating factor or P. pastoris acid phosphatase phol signal sequences for P. pastoris secretion.
  • the signal sequence may be joined directly through the sequence encoding the signal peptidase cleavage site to the protein coding sequence, or through a short nucleotide bridge consisting of usually fewer than ten codons, where the bridge ensures correct reading frame of the downstream TCR sequence.
  • Elements for enhancing transcription and translation have been identified for eukaryotic protein expression systems. For example, positioning the cauliflower mosaic virus (CaMV) promoter 1000 bp on either side of a heterologous promoter may elevate transcriptional levels by 10- to 400-fold in plant cells.
  • the expression construct should also include the appropriate translational initiation sequences. Modification of the expression construct to include a Kozak consensus sequence for proper translational initiation may increase the level of translation by 10 fold.
  • a selective marker is often employed, which may be part of the expression construct or separate from it (e.g., carried by the expression vector), so that the marker may integrate at a site different from the gene of interest.
  • markers that confer resistance to antibiotics (e.g., bla confers resistance to ampicillin for E. coli host cells, nptll confers kanamycin resistance to a wide variety of prokaryotic and eukaryotic cells) or that permit the host to grow on minimal medium (e.g., HIS4 enables P. pastoris or His. sup.- S. cerevisiae to grow in the absence of histidine).
  • the selectable marker has its own transcriptional and translational initiation and termination regulatory regions to allow for independent expression of the marker. If antibiotic resistance is employed as a marker, the concentration of the antibiotic for selection will vary depending upon the antibiotic, generally ranging from 10 to 600 .mu.g of the antibiotic/mL of medium.
  • the expression construct is assembled by employing known recombinant DNA techniques (Sambrook et al., 1989; Ausubel et al., 1999). Restriction enzyme digestion and ligation are the basic steps employed to join two fragments of DNA. The ends of the DNA fragment may require modification prior to ligation, and this may be accomplished by filling in overhangs, deleting terminal portions of the fragment(s) with nucleases (e.g., ExoIII), site directed mutagenesis, or by adding new base pairs by PCR. Polylinkers and adaptors may be employed to facilitate joining of selected fragments.
  • the expression construct is typically assembled in stages employing rounds of restriction, ligation, and transformation of E. coli.
  • cloning vectors suitable for construction of the expression construct are known in the art (.lambda.ZAP and pBLUESCRIPT SK-I , Stratagene, LaJoIIa, Calif, pET, Novagen Inc., Madison, Wis. —cited in Ausubel et al., 1999) and the particular choice is not critical to the invention.
  • the selection of cloning vector will be influenced by the gene transfer system selected for introduction of the expression construct into the host cell. At the end of each stage, the resulting construct may be analyzed by restriction, DNA sequence, hybridization and PCR analyses.
  • the expression construct may be transformed into the host as the cloning vector construct, either linear or circular, or may be removed from the cloning vector and used as is or introduced onto a delivery vector.
  • the delivery vector facilitates the introduction and maintenance of the expression construct in the selected host cell type.
  • the expression construct is introduced into the host cells by any of a number of known gene transfer systems (e.g., natural competence, chemically mediated transformation, protoplast transformation, electroporation, biolistic transformation, transfection, or conjugation) (Ausubel et al., 1999; Sambrook et al., 1989).
  • the gene transfer system selected depends upon the host cells and vector systems used.
  • the expression construct can be introduced into S. cerevisiae cells by protoplast transformation or electroporation. Electroporation of S. cerevisiae is readily accomplished, and yields transformation efficiencies comparable to spheroplast transformation.
  • the present invention further provides a production process for isolating a fusion protein of interest.
  • a host cell e.g., a yeast, fungus, insect, bacterial or animal cell
  • a nucleic acid encoding the protein of the interest operatively linked to a regulatory sequence
  • the fusion protein of interest is isolated from harvested host cells or from the culture medium.
  • Standard protein purification techniques can be used to isolate the protein of interest from the medium or from the harvested cells.
  • the purification techniques can be used to express and purify a desired fusion protein on a large-scale (i.e. in at least milligram quantities) from a variety of implementations including roller bottles, spinner flasks, tissue culture plates, bioreactor, or a fermentor.
  • An expressed protein fusion complex can be isolated and purified by known methods. Typically the culture medium is centrifuged and then the supernatant is purified by affinity or immunoaffinity chromatography, e.g.
  • Protein-A or Protein-G affinity chromatography or an immunoaffinity protocol comprising use of monoclonal antibodies that bind the expressed fusion complex such as a linked TCR or immunoglobulin region thereof.
  • the fusion proteins of the present invention can be separated and purified by appropriate combination of known techniques.
  • methods utilizing solubility such as salt precipitation and solvent precipitation
  • methods utilizing the difference in molecular weight such as dialysis, ultra-filtration, gel-filtration, and SDS-polyacrylamide gel electrophoresis
  • methods utilizing a difference in electrical charge such as ion-exchange column chromatography
  • methods utilizing specific affinity such as affinity chromatograph
  • methods utilizing a difference in hydrophobicity such as reverse-phase high performance liquid chromatograph
  • methods utilizing a difference in isoelectric point such as isoelectric focusing electrophoresis, metal affinity columns such as Ni-NTA. See generally Sambrook et al. and Ausubel et al. supra for disclosure relating to these methods.
  • the fusion proteins of the present invention be substantially pure. That is, the fusion proteins have been isolated from cell substituents that naturally accompany it so that the fusion proteins are present preferably in at least 80% or 90% to 95% homogeneity (w/w). Fusion proteins having at least 98 to 99% homogeneity (w/w) are most preferred for many pharmaceutical, clinical and research applications.
  • the fusion protein should be substantially free of contaminants for therapeutic applications.
  • the soluble fusion proteins can be used therapeutically, or in performing in vitro or in vivo assays as disclosed herein. Substantial purity can be determined by a variety of standard techniques such as chromatography and gel electrophoresis.
  • Truncated TCR fusion complexes of the invention contain a TCR molecule that is sufficiently truncated so the TCR fusion complex can be secreted into culture medium after expression.
  • a truncated TCR fusion complex will not include regions rich in hydrophobic residues, typically the transmembrane and cytoplasmic domains of the TCR molecule.
  • a preferred truncated DRl TCR molecule of the invention preferably from about residues 199 to 237 of the b chain and from about residues 193 to 230 of the a chain of the TCR molecule are not included in the truncated TCR fusion complex.
  • the present TCR fusion and conjugate complexes are suitable for in vitro or in vivo use with a variety of cells that are infected or that may become infected by one or more diseases.
  • Therapeutics for preventing or treating disease in a patient in which the diseased cells express a disease associated antigen comprising administering to the patient a soluble fusion protein complex comprising a biologically active polypeptide recognizing a disease-associated antigen, forming a specific binding complex (bridge) between antigen-expressing diseased cells and IL-15R-expressing immune cells sufficient to localize the immune cells, and damaging or killing the disease cells sufficient to prevent or treat the disease in the patient.
  • a soluble fusion protein complex comprising a biologically active polypeptide recognizing a disease-associated antigen, forming a specific binding complex (bridge) between antigen-expressing diseased cells and IL-15R-expressing immune cells sufficient to localize the immune cells, and damaging or killing the disease cells sufficient to prevent or treat the disease in the patient.
  • a disease associated antigen comprising mixing immune cells bearing the IL-15R chains with a soluble fusion protein complex comprising a biologically active polypeptide recognizing a disease-associated antigen, for example a peptide/MHC complex, administering to the patient the immune cell-fusion protein complex mixture, forming a specific binding complex (bridge) between antigen-expressing diseased cells and IL-15R-expressing immune cells sufficient to localize the immune cells, and damaging or killing the disease cells sufficient to prevent or treat the disease in the patient.
  • a specific binding complex bridge
  • Also included in the invention are methods for killing a target cell the method comprising contacting a plurality of cells with a soluble fusion protein complex, where the plurality of cells further comprises immune cells bearing the IL-15R chains recognized by the IL-15 domain of claim 1 and the target cells bearing an antigen recognized by at least one of the biologically active polypeptides as described herein, forming a specific binding complex (bridge) between the antigen on the target cells and the IL- 15R chains on the immune cells sufficient to bind and activate the immune cells; and killing the target cells by the bound activated immune cells.
  • a specific binding complex bridge
  • Also included in the inventions are methods to increase in vivo half life of IL- 15 and/or enhance its ability to stability bind immune cells (e.g. increase cell surface residency time) through generation of a soluble fusion protein complex.
  • methods to increase in vivo half life of IL- 15 and/or enhance its ability to stability bind immune cells e.g. increase cell surface residency time
  • evaluation of the pharmacokinetic parameters and cell surface residency time of the fusion protein complex are conducted and compared to IL- 15, as described herein. Fusion protein complexes with an increased serum half life or cell surface residency time are preferable as based on their improved therapeutic utility..
  • neoplasia examples include, but are not limited to, neoplasia, including cancer, or viral infection.
  • neoplasia is meant any disease that is caused by or results in inappropriately high levels of cell division, inappropriately low levels of apoptosis, or both.
  • cancer is an example of a neoplasia.
  • cancers include, without limitation, leukemias (e.g., acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, acute myeloblastic leukemia, acute promyelocyte leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, chronic myelocytic leukemia, chronic lymphocytic leukemia), polycythemia vera, lymphoma (Hodgkin's disease, non-Hodgkin's disease), Waldenstrom's macroglobulinemia, heavy chain disease, and solid rumors such as sarcomas and carcinomas (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma,
  • Lymphoproliferative disorders are also considered to be proliferative diseases. Also included are methods of stimulating immune responses in a mammal comprising administering to the mammal an effective amount of the soluble fusion protein complex or IL- 15 variant as described herein. Also included are methods of suppressing immune responses in a mammal comprising administering to the mammal an effective amount of the soluble fusion protein complex or IL- 15 variant as described herein. In the case of immune suppression, a fusion protein complex or IL-15 variant comprising IL-15 antagonists or IL- 15 domains that lack the ability to bind the IL- 15 ⁇ c complex may be particularly advantageous.
  • a cultured cell can be infected by a pathogen of a single serotype.
  • the infected cell is then contacted by a specified fusion protein complex in vitro.
  • the fusion protein complex is configured so that the toxic domain is presented to the infected cell by the association of the TCR.
  • the cells are allowed to cause a desired effect for a time period of about up to about 2 to 24 hours, typically about 18 hours. After this time, the cells are washed in a suitable buffer or cell medium and then evaluated for viability.
  • cell viability can be readily measured and quantified by monitoring uptake of certain well-known dyes (e.g., trypan blue) or fluors.
  • Cells incubated with the fusion protein complex of the present invention can be assayed for viability by standard methods.
  • cell viability can be readily assayed by measuring DNA replication following or during incubation.
  • a preferred assay involves cell uptake of one or more detectably labeled nucleosides such as radiolabeled thymidine. The uptake can be conveniently measured by several conventional approaches including trichloroacetic acid (TCA) precipitation followed by scintillation counting.
  • TCA trichloroacetic acid
  • Other cell viability methods include well-known trypan blue exclusion techniques or WST-I -based proliferation assays.
  • TCR molecules of the fusion complexes of the invention suitably correspond in amino acid sequence to naturally occurring TCR molecules, e.g. TCR molecules of a human, mouse or other rodent, or other mammal.
  • one treatment method of the invention for inhibition of an autoimmune or inflammatory response would include a fusion protein complex which comprises a T cell receptor or antibody with binding specificity to a disease associated antigen.
  • a "truncated" soluble TCR complex is administered, i.e. the TCR complex does not contain a transmembrane portion.
  • the fusion protein complex also comprises an IL- 15 variants that functions as an IL-15 antagonist to suppress the unwanted immune response.
  • the TCR or antibody domain targets the fusion protein complex to the disease site where the IL- 15 antagonist suppresses the autoimmune or inflammatory response.
  • Such fusion protein complex may particularly useful for treatment of allergies, autoimmune diseases such as multiple sclerosis, insulin- dependent diabetes mellitus and rheumatoid arthritis or transplant rejection. Similar non- targeted approaches could be carried out using antagonist IL- 15 variants as non-fusion proteins.
  • Another treatment method of the invention for induction of an immune response provides for the administration of an effective amount of a protein fusion complexes of the invention in the presence of any costimulatory effector molecule such as a cytokine to thereby induce a desired immune response at the location of the presented antigen which binds the biologically active polypeptide.
  • Different therapies of the invention also may be used in combination as well as with other known therapeutic agents such as anti-inflammatory drugs to provide a more effective treatment of a disorder.
  • immunosuppressive protein fusion complexes or IL- 15 variants can be used in combination with anti-inflammatory agents such as corticosteroids and nonsteroidal drugs for the treatment of autoimmune disorders and allergies.
  • anti-inflammatory agents such as corticosteroids and nonsteroidal drugs for the treatment of autoimmune disorders and allergies.
  • Compounds of the invention will be especially useful to a human patient who has or is suspected of having a malignant disease, disorder or condition.
  • Compounds of the invention will be particularly useful in targeting particular tumor antigens in human patients.
  • Specific examples of diseases which may be treated in accordance with the invention include cancers, e.g. breast, prostate, etc, viral infections, e.g. HCV, HIV, etc. as well as other specific disorders of conditions mentioned herein.
  • the multiple and distinct covalently linked compounds of this invention can significantly enhance efficacy of the IL-15, e.g., by increasing targeting of IL- 15 to target antigen in subject individuals.
  • the conjugates of the invention present the IL-15 and the TCR to the subject cell essentially simultaneously, an effect that may not be readily achieved by administering the same compounds in a drug "cocktail" formulation without covalently linking the compounds.
  • the essentially simultaneous presentation to the subject cell of IL- 15 and TCR via a conjugate of the invention may enhance drug activity, e.g., by providing synergistic results and/or by enhancing production an immune response.
  • Diagnostic High affinity or multivalent TCR proteins specific for a particular pMHC ligand are useful in diagnosing animals, including humans believed to be suffering from a disease associated with the particular pMHC.
  • the fusion protein complexes of the present invention are useful for detecting essentially any antigen, including but not limited to, those associated with a neoplastic condition, an abnormal protein, an autoimmune disease or an infection or infestation with a bacterium, a fungus, a virus, a protozoan, a yeast, a nematode or other parasite.
  • a tumor or virally infected cell or tissue in a subject comprises: a) administering to the subject a soluble fusion protein complex of the invention comprising a soluble TCR under conditions that form a specific binding complex between the presented peptide antigen and the TCR; and b) detecting the specific binding complex as being indicative of a rumor or virally infected cell or tissue comprising the presented tumor or viral-associated peptide antigen.
  • the fusion protein complexes can also be used in the diagnosis of certain genetic disorders in which there is an abnormal protein produced.
  • Exemplary applications for fusion protein complexes are in the diagnosis and treatment of autoimmune diseases in which there is a known pMHC.
  • Type I diabetes is relatively well characterized with respect to the autoantigens which attract immune destruction.
  • Multiple sclerosis, celiac disease, inflammatory bowel disease, Crohn's disease and rheumatoid arthritis are additional candidate diseases for such application.
  • the fusion protein complexes of the present invention comprising IL- 15 variant polypeptides may be particularly useful in these applications.
  • a fusion protein complex comprising TCR molecules
  • interactions between the IL-15 variant domain and the IL-15Ra polypeptide generate multivalent TCR molecules with enhanced antigen binding activity, as disclosed herein.
  • the IL- 15 variant contains amino acid changes that potentially eliminate binding to cells bearing IL-15R ⁇ C receptors, thereby reducing non-specific or non-targeted binding to immune cells.
  • improved detection of TCR-specific antigens can be achieved with such fusion protein complexes.
  • fusion protein complexes of the invention can be further multimerized via peptide tags sequences or conjugation to detectable labels, as disclosed herein.
  • Administration of compounds of the invention may be made by a variety of suitable routes including oral, topical (including transdermal, buccal or sublingal), nasal and parenteral (including intraperitoneal, subcutaneous, intravenous, intradermal or intramuscular injection) with oral or parenteral being generally preferred. It also will be appreciated that the preferred method of administration and dosage amount may vary with, for example, the condition and age of the recipient.
  • Compounds of the invention may be used in therapy alone or in conjunction with other medicaments such those with recognized pharmacological activity to treat the desired indications.
  • Exemplary medicaments include recognized therapeutics such as surgery, radiation, chemotherapy and other forms of immunotherapy (e.g. vaccines, antibody based therapies).
  • the compounds of this invention can be administered before, during or after such therapies as needed.
  • one or more compounds of the invention may be administered alone, they also may be present as part of a pharmaceutical composition in mixture with conventional excipient, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for parenteral, oral or other desired administration and which do not deleteriously react with the active compounds and are not deleterious to the recipient thereof.
  • conventional excipient i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for parenteral, oral or other desired administration and which do not deleteriously react with the active compounds and are not deleterious to the recipient thereof.
  • compositions of the invention in general comprise one or more fusion protein complex or IL- 15 variant of the invention or DNA constructs coding for such compounds together with one or more acceptable carriers.
  • the carriers must be "acceptable” in the sense of being compatible with other ingredients of the formulation and not deleterious to the recipient thereof.
  • Suitable pharmaceutically acceptable carriers include but are not limited to water, salt solutions, alcohol, vegetable oils, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, perfume oil, fatty acid monoglycerides and diglycerides, petroethral fatty acid esters, hydroxymethyl-cellulose, polyvinylpyrrolidone, etc.
  • the pharmaceutical preparations can be sterilized and if desired mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously react with the active compounds.
  • auxiliary agents e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously react with the active compounds.
  • solutions preferably oily or aqueous solutions as well as suspensions, emulsions, or implants, including suppositories.
  • Ampules are convenient unit dosages.
  • enteral application particularly suitable are tablets, dragees or capsules having talc and/or carbohydrate carrier binder or the like, the carrier preferably being lactose and/or corn starch and/or potato starch.
  • a syrup, elixir or the like can be used wherein a sweetened vehicle is employed.
  • Sustained release compositions can be formulated including those wherein the active component is protected with differentially degradable coatings, e.g., by microencapsulation, multiple coatings, etc.
  • Therapeutic compounds of the invention also may be incorporated into liposomes.
  • the incorporation can be carried out according to known liposome preparation procedures, e.g. sonication and extrusion. Suitable conventional methods of liposome preparation are also disclosed in e.g. A.D. Bangham et al., J. MoI. Biol., 23:238-252 (1965); F. Olson et al., Biochim. Biophys. Acta, 557:9-23 (1979); F. Szoka et al., Proc. Nat. Acad. Sci., 75:4194-4198 (1978); S. Kim et al., Biochim. Biophys. Acta, 728:339- 348 (1983); and Mayer et al., Biochim. Biophys. Acta, 858:161-168 (1986).
  • the invention also provides methods for invoking an immune response in a mammal such as a human, including vaccinating a mammal such as a human against an infectious agent or a targeted disorder such as cancer.
  • These methods comprise administering to a mammal an effective amount of a DNA sequence that comprises a DNA vector that codes for a fusion protein complex or IL- 15 variant of the invention.
  • a DNA sequence that comprises a DNA vector that codes for a fusion protein complex or IL- 15 variant of the invention.
  • Preparation of expression vectors of fusion protein complexes and IL-15 variants is described above and in the Examples which follow. Methods for administration of plasmid DNA, uptake of that DNA by cells of the administered subject and expression of protein has been reported. See Ulmer, J. B., et al., Science (1993) 259: 1745-1749.
  • DNA vectors that encode fusion protein complexes and IL- 15 variantsof the invention are suitably administered to a mammal including a human preferably by intramuscle injection.
  • cDNA administered to skeletal muscle of a mammal with subsequent uptake of administered expression vector by the muscle cells and expression of protein encoded by the DNA has been described by Ulmer et al. and represents an exemplary protocol [Ulmer, J. B., et al., Science 259: 1745-1749].
  • the optimal dose for a given therapeutic application can be determined by conventional means.
  • fusion protein complexes and IL-15 variants of the invention and DNA constructs of the invention that encode such molecules will have significant use for veterinary applications, e.g., treatment of disorders of livestock such as cattle, sheep, etc. and pets such as dog and cats.
  • Example 1 Design of a fusion protein complex comprising scTCR/huIL15 and scTCR/huIL15R ⁇ fusion proteins.
  • the IL-15 stably binds to the extracellular domain of the IL-15R ⁇ and that the resulting complex is capable of modulating (i.e. either stimulating or blocking) immune responses via the intermediate or high affinity IL- 15R complex (1-4).
  • single-chain TCR or antibody polypeptides can be fused to cytokines and other immune effector domains and that such bispecific fusion molecules retain functional activity of both fusion domains (5-8).
  • a feature of the invention provides for a fusion protein complex comprising at least one fusion protein wherein a first TCR polypeptide is fused to IL- 15 and at least one fusion wherein a second TCR polypeptide is fused to the extracellular domain of IL-15R ⁇ , such that the two fusion proteins form a complex through binding interactions between the IL-15 and IL-15R ⁇ domains.
  • the TCR polypeptides can be the same or different and in either single- chain or heterodimeric format.
  • FIG. IA An example of a fusion protein complex containing single-chain TCR polypeptides is shown schematically in Figure IA.
  • the multivalent TCR domains provide increased binding avidity/affinity for their ligands.
  • Exemplary ligands include, but are not limited to, peptide/MHC complexes.
  • the IL- 15/IL-15R ⁇ domains provide immunomodulatory activity.
  • Representative fusion protein constructs comprising the fusion protein complex are schematically shown in Figure IB.
  • the TCR polypeptide is a single-chain TCR (264scTCR) comprised of TCR- Va and TCR-V ⁇ -C ⁇ domains linked by a peptide linker sequence ((G 4 S) 4 ).
  • the scTCR polypeptide is fused to either the IL- 15 or IL-15R ⁇ domains, directly or via a peptide linker sequence. Proceeding the scTCR polypeptide is a signal peptide (or leader peptide) sequence that permits soluble expression. The signal peptide is subsequently cleaved during protein transport to generate the mature fusion protein.
  • an antibody domain can substitute a TCR domain depicted in Figures IA and IB. Such an antibody can be in a single-chain or heteromultimeric format.
  • sequences can be human or non-human, for example, but not limited to mouse. These sequences can be employed for part or all of the fusion protein domains. In addition, the arrangement of the domains can vary so long as the fusion proteins remain soluble and functional.
  • Example 2 Construction of the c264scTCR/huIL15 gene fusion in an expression vector.
  • TCR genes for the p53 (aa264-272)-specific TCR were described previously (5-7).
  • human PBMC were isolated from 200 mL of blood of a donor (Lot#2238789, Community Blood Bank, Miami, FL) with HISTOPAGUE-1077 (Sigma).
  • the cells (1.5 xlO 7 ) were activated by 30 ng/ml of PMA (Sigma), 200 ng/ml of ionomycin, and 220 ng/ml of recombinant human IL2 in IMDM containing 10%FBS in a CO 2 incubator for 10 days.
  • the activated cells (1 x 10 7 per mL) were frozen at -70C for the further applications.
  • RNEASY PLUS MINI Qiagen
  • Human ILl 5 gene containing the coding region and a portion of 5' and 3' flanking regions was amplified from the total RNA with the front primer 5'-CACCTTGCCATAGCCAGCTCTTC-S ' and the back primer
  • the pNEF38-c264scTCR expression vector contains the gene fragment encoding an immunoglobulin light chain leader (or secretory signal) sequence linked to the p53 (aa264-272) peptide-specific soluble chimeric single-chain TCR protein (c264scTCR) (5).
  • the vector also contains 5' regulatory/enhancer regions, transcription regulatory and promoter regions, translational regulatory/initiation/termination sequences including a Kozak consensus sequence and poly- A termination region, and 3' regulatory regions with putative matrix attachment regulatory elements.
  • the vector also contains DNA sequences allowing selective growth in mammalian cells (SV40 promoter/neoR gene/poly- A) and bacteria (ori/amp gene).
  • c264scTCR/huILl 5 fusion gene comprising the following sequence: 3'- immunoglobulin light chain leader - 264 TCR V- ⁇ - peptide linker - 264 TCR V- ⁇ - human TCR C- ⁇ - human IL-15.
  • the resulting vector (pNEF38-c264scTCR/huIL15), shown in Figure 2A, was identified based on the diagnostic PCR and reconfirmed by DNA sequencing.
  • the sequences of the c264scTCR/huIL15 fusion gene and protein (including the leader sequence) are shown at Figure 2B and Figure 2C, respectively.
  • Example 3 Construction of the c264scTCR/huIL15 gene fusion containing a mutated human IgGl hinge region in an expression vector.
  • the 70 bp mutated human IgGl hinge PCR-cDNA product was separated by electrophoresis on a 1 % agarose gel and isolated.
  • the cDNA product was purified from agarose with a Qiaquick Gel Extraction Kit (Qiagen).
  • the mutated hinge region gene was digested with Hpal and MIuI and ligated into pNEF38- c264scTCR which had been digested with Hpal and MIuI.
  • the clone containing the mutated hinge region gene insert was identified based on the diagnostic PCR with the front primer
  • the huILl 5 gene was digested with MIuI and Xbal and ligated into pNEF38-c264scTCR containing mutated hinge gene which had been digested with MIuI and Xbal.
  • the clone containing the huILl 5 gene insert was identified based on the diagnostic PCR with the front primer
  • c264scTCR-hmt-huIL15 fusion gene comprising the following sequence: 3'- immunoglobulin light chain leader - 264 TCR V- ⁇ - peptide linker - 264 TCR V- ⁇ - human TCR C- ⁇ -mutated human IgGl hinge- human IL- 15.
  • the resulting vector (pNEF38-c264scTCR-hmt-huIL15), shown in Figure 3A, was identified based on the diagnostic PCR and reconfirmed by DNA sequencing.
  • the sequences of the c264scTCR-hmt-huIL15 fusion gene and protein (including the leader sequence) are shown at Figure 3B and Figure 3C, respectively.
  • Example 4 Construction of the c264scTCR/huIL15R ⁇ E3 gene fusion in an expression vector.
  • the total RNA of PBMC was prepared as described above. Human ILl 5R ⁇ gene containing coding region and a portion of 5' and 3' flanking regions was amplified from the total RNA of the PBMC with the front primer
  • the clone containing the correct human ILl 5 Ra extracellular domain gene insert was chosen based on diagnostic PCR and reconfirmed by DNA sequencing with the GenomeLab Dye Termination Cycle Sequencing with a Quick Start Kit according to the manufacturer's protocol.
  • the gene was determined to be human ILl 5 R ⁇ E3 extracellular domain gene.
  • the human ILl 5 R ⁇ E3 extracellular domain gene was removed from the shuttle vector by digestion with Hpal and MIuI and ligated into pNEF38-c264scTCR which had been digested with Hpal and MIuI.
  • c264scTCR/huILl 5R ⁇ fusion gene comprising the following sequence: 3 '- immunoglobulin light chain leader - 264 TCR V- ⁇ - peptide linker - 264 TCR V- ⁇ - human TCR C- ⁇ - ILl 5 R ⁇ E3 extracellular domain.
  • the resulting vector (pNEF38- c264scTCR/huIL15RaDE3), shown in Figure 4A, containing the correct ILl 5 R ⁇ E3 extracellular domain gene insert was identified based on the diagnostic PCR and reconfirmed by DNA sequencing.
  • the sequences of the c264scTCR/huIL15 R ⁇ E3 gene and protein are shown at Figure 4B and Figure 4C, respectively.
  • Example 5 Construction of c264scTCR/huIL15R ⁇ Sushi gene fusion in an expression vector.
  • RNA of PBMC was prepared as described above.
  • Human IL15R ⁇ Sushi gene was amplified from the 970 bp human ILl 5 Ra cDNA (see Example 3) with the front primer
  • c264scTCR/huIL15R ⁇ fusion gene comprising the following sequence: 3'- immunoglobulin light chain leader - 264 TCR V- ⁇ - peptide linker - 264 TCR V- ⁇ - human TCR C- ⁇ - human IL15R ⁇ Sushi.
  • the resulting vector, shown in Figure 5A, containing the correct human IL15R ⁇ Sushi gene insert was identified based on the diagnostic PCR and reconfirmed by DNA sequencing.
  • the sequences of the c264scTCR/huIL15 R ⁇ Sushi gene and protein are shown at Figure 5B and Figure 5C, respectively.
  • Example 6 Construction of c264scTCR/huIL15R ⁇ Sushi gene fusion containing a mutated human IgGl hinge region in an expression vector.
  • the huIL15R ⁇ Sushi gene was digested with MIuI and Xbal and ligated into pNEF38-c264scTCR containing mutated hinge gene which had been digested with MIuI and Xbal.
  • the clone containing the huIL15 gene insert was identified based on the diagnostic PCR with the front primer
  • c264scTCR-hmt-huILl 5RD Sushi fusion gene comprising the following sequence: 3'- immunoglobulin light chain leader - 264 TCR V- ⁇ - peptide linker - 264 TCR V- ⁇ - human TCR C- ⁇ -mutated human IgGl hinge- human IL15RDSushi.
  • the resulting vector (pNEF38-c264scTCR-hmt-huIL15RDSushi), shown in Figure 6A, was identified based on the diagnostic PCR and reconfirmed by DNA sequencing.
  • the sequences of the c264scTCR-hmt-huILl 5RD Sushi fusion gene and protein (including the leader sequence) are shown at Figure 6B and Figure 6C, respectively.
  • Example 7 Construction of the c264scTCR/huIL15R ⁇ Sushi and c264scTCR/huIL15 genes in a single expression vector.
  • the c264scTCR/huIL15R ⁇ Sushi gene was amplified from the template described in Example 5 by PfuUltra (Stratagene) with the front primer 5'- TGAGTGTCCGGAACCACCATGGAGACAGAC AC-3' and the back primer 5'- TTGTTGGCGGCCGCTTATCATCTAATGCATTTGAG-S' under the following condition: 94C, 1 min; 68C, 1 min; 72C, 2 min; x35 cycles; 72C, 10 min.
  • the PCR product of c264scTCR/huIL15R ⁇ Sushi gene was gel-purified, digested with BspEI and Notl and ligated into the pSUN34Rl expression vector which had been digested with BspEI and Notl.
  • the pSUN34Rl expression vector contains two sites for cloning genes- of-interest as well as 5' regulatory/enhancer regions, transcription regulatory and promoter regions, translational regulatory/initiation/termination sequences including a Kozak consensus sequence and poly-A termination region, and intron and 3' regions with regulatory elements.
  • This vector also contains DNA sequences allowing selective growth in mammalian cells (SV40 promoter/neoR gene/poly- A) and bacteria (ori/amp gene).
  • the vector containing the correct c264scTCR/ILl 5RD Sushi gene insert was identified based on the diagnostic PCR and reconfirmed by DNA sequencing.
  • the c264scTCR/huIL15 gene was amplified from the template described in Example 2 by PfuUltra (Stratagene) with the front primer
  • the resulting vector (pSun- c264scTCRILl 5/c264scTCRILl 5RaSushi), shown in Figure 7, containing the correct c264scTCR/huIL15 gene insert was identified based on the diagnostic PCR and reconfirmed by DNA sequencing.
  • This vector contains both c264scTCR/huIL15R ⁇ Sushi and c264scTCR/huIL15 genes.
  • Example 8 Construction of c264scTCR/huIL15R ⁇ E3 and c264scTCR/huIL15 genes in a single expression vector.
  • the c264scTCR/huIL15R ⁇ E3 fusion gene was amplified from the template described in Example 4 by PfuUltra (Stratagene) with the front primer 5'-TGAGTGTCCGGAACCACCATGGAGACAGACAC-S ' and the back primer 5 '-TTGTTGGCGGCCGCTTATCAAGTGGTGTCGCTG-S ' under the following condition: 94C, 1 min; 68C, 1 min; 72C, 2 min; x35 cycles; 72C, 10 min.
  • the PCR product of c264scTCR/huIL15R ⁇ E3 gene was gel-purified, digested with BspEI and Notl and ligated to the expression vector pSUN34Rl which had been digested with BspEI and Notl.
  • the vector containing the correct c264scTCR/huIL15R ⁇ E3 gene insert was identified based on the diagnostic PCR and reconfirmed by DNA sequencing.
  • the c264scTCR/huIL15 gene was amplified and cloned into the expression vector as described on Example 7.
  • the resulting vector (pSun- c264scTCRIL15/ c264scTCRIL15RaDE3), shown in Figure 8, containing the correct c264scTCR/huILl 5 gene insert was identified based on the diagnostic PCR and reconfirmed by DNA sequencing.
  • This vector contains both c264scTCR/huIL15R ⁇ E3 and c264scTCR/huIL15 genes.
  • Example 9 Generation of transfected host cell lines producing fusion proteins.
  • the expression vectors can be introduced into a variety of host cell lines by several different transformation, transfection or transduction methods.
  • CHO-Kl cells (5 x 10 4 ) were seeded in a 6-well plate and cultured overnight in a CO 2 incubator.
  • the cells were transfected with 5 ⁇ g of expression vector containing the TCR/IL15 and/or TCR/IL15R ⁇ fusion genes using 10 ⁇ L of Minis TransIT-LTl reagent (Mirus) according to the manufacturer's protocol.
  • the cells were selected with 4 mg/mL of G418 (Invitrogen) one day after the transfection.
  • the G418 resistant cells were expanded and TCR fusion protein expressing cells were enriched by 3-5 rounds of MACS selection as described below.
  • the cells were detached in 10 mM EDTA and washed once with IMDM containing 10%FBS.
  • Cells were resuspended (10 7 cells in 100 ⁇ L) and incubated with 5 ⁇ g of R-Phycoerythrin (PE) conjugated p53 (aa264-272)/HLA-A2 tetramer reagent for 15 min at 4C.
  • the cells were washed once and incubated with anti- PE antibody conjugated magnetic beads (Miltenyi Biotec) for 15 min at 4C.
  • the cells were loaded to a magnetic column (in a magnetic field) and the unbound cells were removed with wash buffer (PBS containing 0.5% BSA).
  • the column-bound cells were eluted with IMDM containing 10% FBS after the column had been removed from the magnetic field. This procedure allows enrichment of fusion protein-expressing cells based on the transient display of the soluble fusion protein on the cell surface during the production/secretion process. The cell surface association of the fusion proteins was monitored after each enrichment. Levels of cell surface-bound fusion proteins determined by flow cytometry were compared to levels of soluble fusion proteins present in the cell culture media as determined by ELISA. An example of the comparison is shown in Figure 9A and 9B.
  • CHO-Kl cells transfected with pNEF38- c264scTCR/huIL15R ⁇ Sushi were enriched by MACS for one to five times and were then seeded (1 x 10 6 cells/well) on a 6-well plate.
  • the level of soluble fusion protein secreted into the cell culture medium was also determined by TCR- specific ELISA with a capture antibody, anti -human TCR C ⁇ antibody (BFl), and a detection antibody, biotinylated anti-human TCR C ⁇ antibody (W4F) described previously (5), as shown in Figure 9B.
  • the results indicate that the magnetic bead-based enrichment process yielded transfectants that produced increased levels of soluble fusion protein.
  • the enriched transfected cells were then subcloned three times by the limiting dilution and production cell lines were screened based on the level of soluble fusion protein secreted into the culture media (determined by ELISA described above). Production cell lines were expanded and grown in IMDM + 10%FBS or serum- free media under conditions (i.e. flasks, spinners, fermenters, bags, bottles) suitable to generate the soluble fusion protein.
  • host cells were co-transfected with different expression vectors to generate transfectants capable of expressing multiple fusion proteins.
  • Transfectants expressing one fusion protein could also be re-transfected with a one or more expression vectors to generate transfectants expressing multiple fusion proteins.
  • Cells were also transfected with an expression vector containing more that one fusion protein genes, as exemplified in Examples 7 and 8, to generate a transfectant expressing multiple fusion proteins. The resulting cells could be used to produce the multi-component fusion protein complexes of the invention as soluble molecules in the cell culture medium.
  • Example 10 Purification of the TCR/IL15 and TCR/IL15R ⁇ fusion proteins or fusion protein complexes.
  • Soluble fusion proteins or fusion protein complexes of the invention can be purified from the host cells or cell culture media using a variety of methods, including by selective partitioning or solubility in solvents or by separation (i.e. via chromatography) based on charge, hydrophobicity, hydrophilicity, size, and/or selective or semi-selective binding to a ligand. Soluble fusion proteins or fusion protein complexes can be generated from insoluble materials through use of the appropriate protein folding conditions. In one example, c264scTCR/IL15 fusion protein was purified from cell culture media by affinity chromatography using a antibody (BFl) recognizing the human TCR-C ⁇ domain.
  • BFl antibody
  • a column containing BFl -conjugated Sepharose was first equilibrated with 2OmM Tris-HCl pH 8.0 (loading buffer) and then loaded at 2 ml/min with pH adjusted cell culture media containing c264scTCR/IL15 fusion protein. The column was then washed with 5 column volumes of the loading buffer to remove unbound proteins, and the c264scTCR/IL15 fusion protein was eluted with 4 column volumes of 0.5M Na-citrate, pH 4. After collection, the eluate was adjusted to pH 8.0 by 2M Tris-HCl pH 8.0. The purified protein was buffer exchanged into PBS and filtered using 0.22 ⁇ m filter.
  • the BFl column was stripped with 5OmM Glycine-HCl pH 3.0, and stored in 20% ethanol at 4C for further use.
  • the fusion protein could be further purified by ion exchange and/or size exclusion chromatography.
  • Cell culture supernatants containing c264scTCR/IL15, c264scTCR/ILl 5R ⁇ Sushi and c264scTCR/ILl 5R ⁇ E3 fusion proteins were purified by the above methods and samples of the purified fusion proteins were analyzed by electorphoresis on SDS polyacrylamide gels under reducing conditions and followed by staining with Coomassie brilliant blue. Examples of such gels are shown in Figure 10. The major protein bands correspond to the correct molecular weights expected based on fusion protein sequences.
  • Example 11 Generation of a fusion protein complex of the TCR/IL15 and TCR/IL15R ⁇ fusion proteins.
  • ILl 5 specifically binds to the extracellular ILl 5R ⁇ domain with high affinity (4).
  • a complex of fusion proteins bearing the IL- 15 and IL 15R ⁇ domains can be formed under a variety of conditions, including within the expression cell or extracellularly with unpurified or purified fusion proteins.
  • equal molar amounts of purified fusion proteins can be mixed under the appropriate conditions (i.e. 10 min at room temperature) to form a fusion protein complex.
  • Complex formation can be monitored in using a variety of techniques including direct binding assays, competitive binding assays, immunoprecipitation, surface plasma resonance, or analyses based on complex size, activity or other properties.
  • size exclusion chromatography can monitor the formation of complexes comprising c264scTCR/huIL15 and c264scTCR/huILl 5R ⁇ Sushi fusion proteins based on molecular weight.
  • c264scTCR/huIL15 0.5 mg/ml
  • the calculated molecular weight for c264scTCR/huIL15 is about 57 kD.
  • the estimated molecular weight is about 98 kD, suggesting that this fusion protein is likely a monomer.
  • Example 12 Fusion protein complex of the TCR/IL15 and TCR/IL15R ⁇ fusion proteins exhibits enhanced binding for peptide/MHC complexes.
  • the fusion protein complexes generated as described above were characterized for their ability to bind the TCR-specific antigen, p53 (aa264-272)/HLA-A2.1.
  • p53 aa264-272
  • HLA- A2.1 -positive T2 cells were loaded with p53 (aa264- 272) peptide at 26C overnight and then stored at 5 x 10 6 cells/mL in a liquid nitrogen. T2 cells that were not incubated with peptide serve as controls.
  • the p53 peptide-loaded or control T2 cells were thawed and resuspended in 1 mL of IMDM+10%FBS.
  • the cells (5 x lOVlOO ⁇ L) were then stained for 30 min at RT with 0.5 ⁇ g of following fusion proteins: c264scTCR/huIL15, c264scTCR/huIL15R ⁇ Sushi, c264scTCR/huIL15+ c264scTCR/huILl 5R ⁇ Sushi complex.
  • Cells were washed once with washing buffer (PBS containing 0.5%BSA and 0.05% sodium azide) and stained with 0.1 ⁇ g of biotinylated mouse monoclonal anti -human TCR C ⁇ antibody (BFl) in 100 ⁇ L of washing buffer for 30 min at RT.
  • washing buffer PBS containing 0.5%BSA and 0.05% sodium azide
  • each of the fusion proteins was capable of specifically staining p53 peptide-loaded cells.
  • the c264scTCR/huIL15+c264scTCR/huIL15R ⁇ Sushi fusion protein complex displayed enhanced specific binding via the multivalent c264scTCR domains to the p53 (aa264-272)/HLA-A2.1 complexes displayed on the T2 cells.
  • the dimeric fusion protein complex showed better staining of the p53 peptide-loaded T2 cells than the monomelic c264scTCR/huIL15 or c264scTCR/huIL15R ⁇ Sushi fusion proteins.
  • Example 13 Generation of huIL-15 mutant genes and construction of c264scTCR- hmt-huIL15 mutant gene expression vectors.
  • c264scTCR/huIL15+c264scTCR/huIL15R ⁇ Sushi polypeptides are able to form a complex through interactions of the IL- 15 and IL-15R ⁇ domains and the multivalent fusion protein complex has enhanced binding for peptide/MHC complexes.
  • Such a fusion protein complex has advantages as an antigen- specific or targeted research, diagnostic and therapeutic agent based on the enhanced binding activity.
  • the ability of the IL-15/IL-15R ⁇ domains of the fusion protein to bind cells expressing IL- 15 receptors is also an desirable feature as indicated herein.
  • the resulting mutations may create IL- 15 variants including antagonists or agonists.
  • the resulting IL-15 antagonists and agonists also may have utility as soluble cytokines (i.e., non-fusion proteins) or as a complex with IL-15R ⁇ domains, for research, diagnostic or therapeutic applications.
  • IL- 15 antagonists may be useful in suppressing unwanted immune responses whereas IL- 15 agonists may be used to stimulate immune responses in therapeutic strategies to treat various diseases.
  • IL- 15 variants were created where the potential binding sites of the mature human IL- 15 protein to IL-15R ⁇ c receptors, amino acids at positions 8, 61, 65, 72, and 108 (numbering based on mature native human IL-15 sequence), were each substituted or combined with two or more other substitutions.
  • the aspartic acid at position 8 was substituted with alanine or asparagine.
  • the aspartic acid at position 61 was substituted with alanine.
  • the asparagine at position 65 was substituted with alanine or aspartic acid.
  • the asparagine at position 72 was substituted with arginine or aspartic acid.
  • the glutamine at position 108 was substituted with alanine.
  • Both Asp at position 8 and GIn at position 108 were each substituted with an alanine.
  • Both Asp at position 8 and Asn at position 65 were each substituted with an asparagine or alanine.
  • Both Asp at position 8 and Asn at position 65 were each substituted with a serine or arginine.
  • the overlapping PCR was used.
  • pNEF38-c264scTCR/huIL15 vector was used as template to amplify two overlapping c-DNA fragments with the front primer for fragment 1
  • the fragments 1 and 2 PCR-cDNA products were separated by electrophoresis on a 1% agarose gel and isolated.
  • the cDNA product was purified from agarose with a Qiaquick Gel Extraction Kit (Qiagen).
  • the fragments 1 and 2 PCR-cDNA products were fused together with PfuUltra (Stratagene) under following PCR conditions: 94C, 1 min; 66C, 1.5 min; 72C 1.5 min; xlO cycles.
  • the overlapping PCR-cDNA fragment was amplified with the front primer 5 '-TGGTGGACGCGTAACTGGGTGAATG-S ' and with the back primer
  • the huILl 5 mutant gene was digested with MIuI and Xbal and ligated into pNEF38-c264scTCR-hmt which had been digested with MIuI and Xbal.
  • the clone containing the huILl 5 gene at position 8 with a substitution of alanine or asparagine was verified by DNA sequencing with GenomeLab Dye Termination Cycle Sequencing with a QUICK START KIT (Beckman Coulter) according to the manufacturer's protocol.
  • the pNEF38-c264scTCR expression vector is described above.
  • c264scTCR-hmt-huIL15D8A or c264scTCR-hmt-huIL15D8N fusion gene comprising the following sequence: 3'- immunoglobulin light chain leader - 264 TCR V- ⁇ - peptide linker - 264 TCR V- ⁇ - human TCR C- ⁇ -mutated human IgGl hinge- human ILl 5D8A or -human ILl 5D8N.
  • the resulting vector (pNEF38-c264scTCR-hmt-huILl 5D8A or pNEF38-c264scTCR- hmt-huIL15D8N), shown in Figure 14B, was confirmed by DNA sequencing.
  • the sequences of the pNEF38-c264scTCR-hmt-huIL15D8A or pNEF38-c264scTCR-hmt- huIL15D8N fusion gene and protein (including the leader sequence) are shown at Figure 14C and Figure 14D, respectively.
  • Other mutations were introduced in a similar fashion and expression vector constructed as described above.
  • the expression vectors were introduced into CHO.K1 cells to generated stable transfectants as described in Example 9.
  • TCR/IL15 fusion proteins and fusion protein complexes comprising IL- 15 variants was carried out using similar methods as described in Examples 10 and 11.
  • Generation of IL-15 variants as soluble cytokines can be carried out through a variety of methods known in the art, including production in prokaryotic and eukaryotic expression systems (see for example, WO9527722; Hsu et al. 2005 J. Immunol. 175:7226).
  • fusion protein TCR domain Functional binding of the fusion protein TCR domain was demonstrated based on the ELISA and cell staining methods using p53 (aa264-272)/HLA-A2.1 reagents described in Example 9 and the antigen presenting cell staining methods described in Example 12.
  • CTLL-2 cells which express the heterotrimeric IL-15R ( ⁇ c chains), were incubated with 0.5 ⁇ g of the individual fusion proteins: c264scTCR/huIL15, 264scTCR/huIL15R ⁇ Sushi, or c264scTCR/huIL15+ c264scTCR/huIL15R ⁇ Sushi complex for 30 min at RT.
  • Cells were washed once with washing buffer (PBS containing 0.5%BSA and 0.05% sodium azide) and stained with 0.5 ⁇ g of R-Phycoerythrin (PE) conjugated p53 (aa264-272)/HLA-A2 tetramer for 30 min at RT.
  • washing buffer PBS containing 0.5%BSA and 0.05% sodium azide
  • CTLL-2 cells are dependent upon cytokines for growth and can respond to recombinant human IL-15.
  • a cell-based WST-I proliferation assay using CTLL-2 cells was developed to assess the IL- 15 biological activity of fusion proteins and fusion protein complexes.
  • WST-I (Roche) is a reagent that can be converted into formazan by dehydrogenase enzymes found in metabolically active cells.
  • the quantity of formazan in the culture media measured by the amount of 440-450nm absorbance is directly proportional to the number of living cells in culture.
  • CTLL-2 cells (2 x 10 4 /200 ⁇ L) were incubated with the indicated concentrations of fusion proteins (0-28 ng/mL): c264scTCR/huILl 5, c264scTCR/huILl 5+ c264scTCR/huILl 5R ⁇ Sushi complex or c264scTCR/huIL15+ c264scTCR/huIL15R ⁇ E3 complex for 3 days in 96-well plates at 37C in a CO 2 incubator. Cells were incubated with 10 ⁇ L of WST-I for 4 hours before harvesting 100 ⁇ L of culture medium for 440-450 nm absorbance measurement with a microtiter plate reader.
  • c264scTCR/huIL15 fusion protein can support the proliferation of CTLL-2 cells at a concentration as low as 1.8 ng/mL ( ⁇ 31.25 pM), suggesting activation of CTLL-2 cells with c264scTCR/huIL15 fusion protein via the high affinity ILl 5 receptor.
  • fusion protein complexes also supported CTLL-2 cell proliferation but to a lesser degree suggesting that c264scTCR/huIL15 stimulatory activity was inhibited following complex formation with c264scTCR/huIL15R ⁇ Sushi or c264scTCR/huILl 5R ⁇ E3 (by one fold or four fold, respectively).
  • Example 15 Dimeric fusion protein complexes of the TCR/IL15R ⁇ Sushi and
  • TCR/IL15 variants exhibit TCR-specific binding to peptide/MHC complex but less binding to the IL-15R ⁇ c receptors.
  • the fusion protein complexes comprising IL-15 variants as described above were characterized for their ability to bind the TCR-specific antigen, p53 (aa264-272)/HLA- A2.1.
  • p53 aa264-272
  • HLA- A2.1 -positive T2 cells (2 x 10 6 /mL) were loaded with 20 ⁇ M p53 (aa264-272) peptide at 37C in the presence of Ix PLE (Altor Bioscience) for 2-3 hrs. T2 cells that were not incubated with peptide and 32D ⁇ cells expressing IL-2/15R ⁇ c serve as controls.
  • the p53 peptide- loaded T2 cells, control T2 cells, or 32D ⁇ cells (2 x 10 5 /100 ⁇ L) were then incubated for 30 min at 4C with 320 nM of following dimeric fusion protein complexes: 1) c264scTCR/huIL15+c264scTCR/huIL15R ⁇ Sushi, 2) c264scTCR/huIL15D8A+ c264scTCR/huIL15R ⁇ Sushi, and 3) c264scTCR/huIL15D8N+c264scTCR/huIL15R ⁇ Sushi.
  • the mutant c264scTCR/huIL15 fusion protein complexes showed less background staining on control T2 cells (Figure 17B) and IL-15R ⁇ c - positive 32D ⁇ cells ( Figure 17C) than the wide type c264scTCR/ILl 5 fusion protein complex.
  • these fusion protein complexes comprising IL- 15 variants (D8A and D8N) do not show binding activity to the IL-15R ⁇ c receptors present on the 32D ⁇ cells.
  • Similar studies of IL-15R ⁇ c receptor binding were carried out with other fusion proteins comprising IL- 15 variants and are summarized in Table 1. The results indicate that fusion proteins and fusion protein complexes of the invention comprising IL- 15 variants retain activity to recognize peptide/MHC complexes and exhibit decreased or increased binding activity for IL-15R ⁇ c receptors.
  • peptide/MHC and IL-15Ra binding activity was measured by ELISA analysis.
  • the 96- well microtiter plates were precoated with 20 nM BFl, an anti-TCR C ⁇ antibody, or 20 nM TCR/IL15R ⁇ Sushi in carbonated buffer pH 9.1 (sodium bicarbonate 35mM, Na 2 CO 3 , 17.5 mM, NaCl 50 mM) over 3 hours at 4C. Plates were washed with washing buffer (Imidazole 40 mM, NaCl 150 mM) for 4 times and blocked with 1%BSA-PBS for 10 minutes.
  • washing buffer Imidazole 40 mM, NaCl 150 mM
  • the indicated fusion proteins at a concentration of 0.03-4 nM were added to the plates and incubated at RT for 30 minutes. The plates were washed four times.
  • the BFl captured fusion proteins were incubated with 1 ⁇ g/mL of HRP-conjugated p53/HLA- A2.1 tetramer for 45 minutes at RT and the TCR/IL15RaSushi captured fusion proteins were incubated with 50 ng/mL of biotinylate mouse anti-human IL- 15 for 30 minutes at RT. After washing for 4 times, the plate incubated with biotinylate mouse anti-human IL- 15 was incubated with 0.25 ⁇ g/mL of HRP-streptavidin for 15 minutes.
  • the fusion proteins shared similar TCR-specific binding activity for p53/HLA-A2 tetramer and equivalent IL- 15 binding activity for ILl 5R ⁇ Sushi. Similar studies of IL-15R ⁇ binding were carried out with other fusion proteins comprising IL- 15 variants and are summarized in Table 1. The results indicate that fusion proteins and fusion protein complexes of the invention comprising IL- 15 variants retain activity to recognize peptide/MHC complexes and IL-15R ⁇ receptors.
  • fusion proteins comprising an IL- 15 antagonist or agonist may be a useful as a targeted agents for inhibiting or stimulating IL-15-mediated responses (i.e., T cell or NK cell activity) at the disease site.
  • IL-15-mediated responses i.e., T cell or NK cell activity
  • CTLL-2 cells expressing the high affinity IL- 15R ( ⁇ c chains) and with 32D ⁇ cells expressing the intermediate IL- 15R ( ⁇ c chains).
  • the cells(2 x 10 4 /200 ⁇ L) were incubated with 0.4-40 nM of the above described TCR/IL15 fusion proteins for 3 days in 96-well plates at 37C in a CO 2 incubator.
  • the c264scTCR/huIL15 fusion protein comprising the wild type IL-15 domain can support the proliferation of CTLL-2 and 32D ⁇ cells at a concentration as low as 40 pM or 1 nM respectively.
  • the fusion protein comprising an ILl 5 variant with an asparagine to aspartic acid substitution at position 72 with an amino acid was much more active that the fusion protein comprising the wild type IL-15 domain at supporting the proliferation of 32D ⁇ cell line, showing biological activity at a concentration as low as 80 pM (Figure 19B).
  • the fusion protein comprising IL-15 variant (huILl 5N72D) showed super agonist activity.
  • the fusion proteins comprising IL-15 variants with substitutions at position 8 (c264scTCR/huILl 5D8N or c264scTCR/huIL15D8A), position 65 (c264scTCR/huIL15N65A), position 108 (c264scTCR/huIL15Q108A), or a different substitution at position 72 (c264scTCR/huIL15N72R) were less active in supporting proliferation of both CTLL-2 and 32D ⁇ cells compared to c264scTCR/huIL15wt fusion protein (Figure 19A and Figure 19B).
  • IL-15 is trans-presented by ILl 5R ⁇ on a dend ⁇ tic cell surface to IL-15R ⁇ c receptors on memory T, NKT, or NK cell to support cell survival and stimulate immune responses.
  • An antagonist should block the trans-presentation of IL-15 by binding ILl 5R ⁇ .
  • IL-15 variants to be assessed include those with changes at position 8 to alanine, asparagine, serine, lysine, threonine, or tyrosine; position 61 to alanine, asparagine, serine, lysine, threonine, or tyrosine; position 65 to alanine, aspartic acid, or arginine; position 72 to alanine, aspartic acid, or arginine; and positions 92, 101, 108, or 111 to alanine or serine.
  • Example 17 Cell-cell conjugation and immune cell retargeting by the TCR/IL15 and TCR/IL15R ⁇ fusion proteins and fusion protein complexes.
  • T2 cells will be loaded with either p53 (aa264-272) peptide or control CMVpp65 (aa495-503) peptide and then labeled with dihydroethidium.
  • CTLL-2 cells will be labeled with calcein AM and the two labeled cell populations will be mixed and incubated in the presence or absence of the fusion proteins or fusion protein complexes.
  • the cells are anticipated to remain as two distinct populations as assessed by flow cytometry.
  • T2 cells are loaded with p53 (aa264-272) and incubated with the CTLL-2 cells in the presence of fusion proteins or complexes, the appearance of a double staining population of cells would be indicative of conjugation of T2 cells to CTLL-2 cells via the fusion proteins or fusion protein complexes.
  • fusion protein complexes can bridge IL- 15 receptor-bearing immune cells with peptide/MHC bearing target cells and direct immune cytotoxicity against the target cells.
  • T2 cells will be loaded with either p53 (aa264-272) peptide or control CMVpp65 (aa495-503) peptide and then labeled with calcein AM.
  • Immune effector cells bearing IL-15 receptors i.e. activated NK cells or T cells
  • Cytotoxicity will be assessed based on release of calcein from the T2 target cells into the culture media by standard methods. The specific release of calcein- AM will be measured or compared to the non-specific control of spontaneous released calcein- AM. In the absence of the fusion protein complex or when the T2 cells were loaded with control peptide, low levels of target cell cytotoxicity are expected. However, when the T2 cells are loaded with p53 (aa264-272) and incubated with the immune effector cells in the presence of fusion protein complex, specific lysis of the T2 cells would be an indication that the immune effector cells are retargeted against the p53 peptide-presenting cells via the fusion protein complex. Similar studies will be conducted with tumor cell lines presenting p53 (aa264-272)/HLA-A2.1 complexes as target cells.
  • Example 18 In vivo demonstration of anti-tumor effects of IL-15 variant agonists, TCR/IL15 fusion proteins and fusion protein complexes
  • an experimental xenograft tumor model will be used.
  • A375 human melanoma cells will be injected subcutaneously into the flank of nude mice and tumors will be allowed to establish for three days.
  • Tumor bearing mice will be injected intravenously with c264scTCR/huIL15+c264scTCR/huIL15R ⁇ Sushi complex or an IL-15 variant agonist (dose range - 0.1 to 2 mg/kg), or the dose volume equivalent of PBS daily for four or more days.
  • tumor size will measured and the tumor volumes will be calculated. All mice treated with PBS are expected to develop tumors. Suppression of tumor growth or complete tumor regression in some or all the mice treated with the fusion protein complex or IL- 15 variant agonist would be an indication of an antitumor effect of the treatment.
  • Alternative dosing schedules including multi-cycle dosing may also demonstrate the antitumor efficacy of the fusion protein or IL- 15 variant agonist.
  • Tumor cell lines lacking p53 (aa264-272)/HLA-A2.1 complexes (such as HT-29 or AsPC-I (5, 9)) can be used as controls for antigen specific recognition by the c264scTCR-domain of the fusion protein complex.
  • Alternative fusion protein complexes comprising other TCR domains (i.e. specific to CMVpp65 (aa495-503) peptide (9) could be used as non-tumor targeting controls.
  • immune cells bearing the IL- 15 receptor such as naive or activated (or memory) splenocytes, NK cell or T cells
  • splenocytes such as naive or activated (or memory) splenocytes, NK cell or T cells
  • c264scTCR/huIL15+c264scTCR7huIL15R ⁇ Sushi complex or an agonist IL-15 variant under conditions permitting binding to the cells.
  • the fusion protein complex or an agonist IL-15 variant will be used to activate the immune cells.
  • the IL-15 variant activated cells or fusion protein complex-coated cells will then be transferred into nude mice bearing A375 tumors.
  • Controls will include transfer of the untreated immune cells, the fusion protein complex alone and PBS. Tumor growth will be monitored and all mice treated with PBS are expected to develop tumors. Suppression of tumor growth or complete tumor regression in some or all the mice treated with the IL-15 variant activated cells or fusion protein complex-coated cells would be an indication of an antitumor effect of the treatment.
  • the IL- 15 variant or fusion protein complex and immune cells will be administered at the same time, or separately at the same or different times.
  • the immune cells may be autologous or allogeneic in relation with the tumor-bearing host. The number of cells transferred and dosing schedule will be varied to assess and optimize antitumor efficacy. As described above, other tumor lines or fusion protein complexes will be employed to determine the role of antigen targeting in any observed antitumor activity.
  • Example 19 In vitro treatment of immune cells with TCR/IL15:TCR/IL15R ⁇ fusion protein complexes followed by adoptive cell transfer provide improved survival in xenograft tumor animal model
  • the A549-A2 cell line represents a transfectant of the p53- positive A549 parental line carrying a vector expressing human HLA- A2.1 cDNA.
  • NK cells were isolated using a NK cell isolation kit from Miltenyi Biotech, Inc. according to the manufacturer's instruction. Briefly, a single cell suspension of splenocytes was prepared by homogenizing the spleens through a metal screen (60 mesh) in HBSS. Red blood cells were lysed in ACK red blood lysing buffer. Cells will be incubated with biotin-antibody cocktail (10 ⁇ L for 10 7 cells) for 10 min at 4-8C.
  • the number of leukocytes was determined and 30 ⁇ L of buffer (PBS pH 7.2, 0.5% BSA and 2 mM EDTA) and 20 ⁇ L of anti-biotin MicroBeads per 107 cells was added and the mixture was incubated at 4-8C for 15 min. The cells were washed in 2 mL buffer and centrifuge at 300xg for 10 min. The cells were resuspended in 500 ⁇ L of buffer for loading to the MACS column. The flow through was collected and the purity of the NK cells was determined using FACScan analysis.
  • buffer PBS pH 7.2, 0.5% BSA and 2 mM EDTA
  • NK cells (5 x 10 6 ) were cultured at 37C overnight in the presence or absence of c264scTCR/IL15: c264scTCR7IL15R ⁇ fusion protein complex, TCR-IL2 fusion protein or rhIL-2 in T25 flasks in 10 ml RPMI 1640 supplemented with 10% FBS.
  • c264scTCR/IL15 c264scTCR/IL15R ⁇ fusion protein complex
  • TCR-IL2 fusion protein was added at a concentration of 0.8 ⁇ g/mL and rhIL-2 was added at 0.2 ⁇ g/mL.
  • mice were injected i.v. via the tail vein with A549A2 tumor cells (5 x
  • mice 10 6 to establish pulmonary tumors.
  • CCTX cyclophosphamide
  • NK cells (1 x 10 6 /mouse) preincubated with different fusion proteins or rhIL-2 were injected i.v. on days 16 and 22, and mice receiving PBS served as controls.
  • a summary of the treatment schedule is a follows:
  • mice survival of tumor-bearing mice was monitored every day. Mice that became moribund were sacrificed and counted as dead. Mice surviving longer than 100 days post- tumor injection were considered as cured.
  • c264scTCR/IL15R ⁇ fusion protein complex treatment groups are 52, 67.5, 64.5, 85.5, and 80 days, respectively ( Figure 20).
  • c264scTCR/IL15 c264scTCR/IL15R ⁇ -activated NK cells resulted a longer median survival time than observed in tumor-bearing animals treated with chemotherapy alone or with NK cells activated by the non-targeted MARTscTCR-IL2 or rhIL-2.
  • the results from this pilot experiment indicate that activation and targeting mouse NK cells with c264scTCR/IL15: c264scTCR/ILl 5R ⁇ may provide enhanced antitumor activity.
  • Example 20 Enhanced binding of TCR/IL15:TCR/IL15R ⁇ fusion protein complexes to 1L-15R bearing immune cells as evidenced by an extended cell surface residency time
  • the cell surface residency time of the fusion protein complexes on the IL-15R-bearing cells may influence the ability of the fusion protein to target or bridge effector cells with the TCR-specific tumor cells.
  • binding of the scTCR/IL-15 fusion proteins, TCR/IL15:TCR/IL15R ⁇ fusion protein complexes and recombinant IL-15 to IL- 15R ⁇ C receptor-bearing CTLL-2 cells and IL-15R ⁇ C receptor-bearing CTLL-2 cells 32D ⁇ cells will be directly compared by flow cytometry.
  • c264scTCR/IL-15 c264scTCR/IL15: c264scTCR/IL15R ⁇ complex
  • recombinant IL-15 or soluble IL-15:IL-15Ra complex will be evaluated in the HLA-A2.1/Kb-transgenic mouse strain.
  • mice will be injected intravenous with molar equivalent amounts of c264scTCR/IL- 15 , c264scTCR/IL 15 : c264scTCR/IL15R ⁇ complex, recombinant IL-15 or soluble IL-15:IL-15Ra complex and blood will be collected at various time points from 5 minutes to two weeks post injection. Serum concentrations of the fusion proteins will be evaluated using ELISA formats, disclosed above. Concentrations of IL-15 were detected with a standard IL-15-specific ELISA.
  • autoimmune arthritis can be induced following administration of type II collagen (CII) in HLA-DR4-transgenic mice (Rosloniec et al. 1998. J Immunol. 160:2573-8). Additionally, Cll-specific T-cells involved in the pathology of this disease have been characterized. The TCR genes from these T-cells will be used to construct the appropriate expression vectors and host cell lines to generate CIIscTCR/IL15 comprising IL- 15 variant antagonists and CIIscTCR/IL15R ⁇ Sushi fusion proteins as described in previous examples.
  • CII type II collagen
  • the HLA-DR4-transgenic mice will be injected intravenously with CIIscTCR/IL15-antagonst+CIIscTCR/IL15R ⁇ Sushi complex or an IL-15 variant antagonist (dose range - 0.1 to 2 mg/kg), or the dose volume equivalent of PBS daily for four or more days.
  • CIIscTCR/IL15-antagonst+CIIscTCR/IL15R ⁇ Sushi complex or an IL-15 variant antagonist dose range - 0.1 to 2 mg/kg
  • the mouse paw joints will be evaluated and scored for the degree of inflammation on a scale of 0 to 4. All mice treated with PBS are expected to develop arthritis. Suppression of arthritis (e.g. decreased incidence or clinical score) in some or all the mice treated with the fusion protein complex or IL- 15 variant would be an indication of an immunosuppressive effect of the treatment.
  • Alternative dosing schedules including multi-cycle dosing may also demonstrate the immunosuppressive efficacy of the fusion protein or IL-15 variant.
  • Alternative fusion protein complexes comprising other TCR domains i.e. specific to p53 peptide

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Toxicology (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Hematology (AREA)
  • Plant Pathology (AREA)
  • Oncology (AREA)
  • Urology & Nephrology (AREA)
  • Communicable Diseases (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
PCT/US2008/005918 2007-05-11 2008-05-09 Fusion molecules and il-15 variants Ceased WO2008143794A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
ES08743432.0T ES2518393T3 (es) 2007-05-11 2008-05-09 Moléculas de fusión y variantes de IL-15
CN201810136797.6A CN108948177B (zh) 2007-05-11 2008-05-09 融合分子与il-15变异体
EP08743432.0A EP2160401B1 (en) 2007-05-11 2008-05-09 Fusion molecules and il-15 variants
CN200880024119.5A CN101743249B (zh) 2007-05-11 2008-05-09 融合分子与il‑15变异体
DK08743432.0T DK2160401T3 (da) 2007-05-11 2008-05-09 Fusionsmolekyler og il-15-varianter
AU2008253720A AU2008253720B2 (en) 2007-05-11 2008-05-09 Fusion molecules and IL-15 variants
JP2010507463A JP5501222B2 (ja) 2007-05-11 2008-05-09 融合分子及びil−15変異体
CA2690825A CA2690825C (en) 2007-05-11 2008-05-09 Fusion molecules and il-15 variants

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US92890007P 2007-05-11 2007-05-11
US60/928,900 2007-05-11

Publications (1)

Publication Number Publication Date
WO2008143794A1 true WO2008143794A1 (en) 2008-11-27

Family

ID=40122019

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/005918 Ceased WO2008143794A1 (en) 2007-05-11 2008-05-09 Fusion molecules and il-15 variants

Country Status (10)

Country Link
US (11) US8492118B2 (https=)
EP (4) EP3305805A1 (https=)
JP (3) JP5501222B2 (https=)
CN (3) CN101743249B (https=)
AU (1) AU2008253720B2 (https=)
CA (2) CA3028038C (https=)
DK (3) DK2769984T3 (https=)
ES (3) ES2642008T3 (https=)
PT (3) PT2388266E (https=)
WO (1) WO2008143794A1 (https=)

Cited By (74)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2258720A1 (en) * 2009-05-19 2010-12-08 Max Delbrück Centrum für Molekulare Medizin (MDC) Berlin-Buch; Multiple target T cell receptor
WO2012040323A2 (en) 2010-09-21 2012-03-29 Altor Bioscien Corporation Multimeric il-15 soluble fusion molecules and methods of making and using same
WO2014023315A1 (en) 2012-08-10 2014-02-13 Aarhus Universitet Multimerization through beta-strand swapping in ccp domains
US8940288B2 (en) 2005-05-17 2015-01-27 University Of Connecticut Method for treating cancer by administering IL-15 and IL-15Ralpha complexes
US9303080B2 (en) 2006-01-13 2016-04-05 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, National Institutes Of Health Codon optimized IL-15 and IL-15R-alpha genes for expression in mammalian cells
EP2911684A4 (en) * 2012-10-24 2016-08-10 Admune Therapeutics Llc IL-15R ALPHA FORMS, IL-15R ALPHA FORMS EXPRESSIVE CELLS, AND THERAPEUTIC USE OF IL-15R ALPHA AND IL-15 / IL-15R ALPHA COMPLEXES
WO2017046200A1 (en) * 2015-09-16 2017-03-23 INSERM (Institut National de la Santé et de la Recherche Médicale) Specific interleukin-15 (il-15) antagonist polypeptide and uses thereof for the treatment of inflammatory and auto-immune diseases
WO2017177063A1 (en) * 2016-04-06 2017-10-12 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of heterodimeric il-15 in adoptive cell transfer
JP2018500316A (ja) * 2014-12-19 2018-01-11 ジエンス ヘンルイ メデイシンカンパニー リミテッドJiangsu Hengrui Medicine Co.,Ltd. インターロイキン15タンパク複合体およびそれらの用途
US9931377B2 (en) 2007-06-27 2018-04-03 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Cell expressing complexes of IL-15 and IL-15Ralpha
EP3030575B1 (en) 2013-08-08 2018-07-11 Cytune Pharma Il-15 and il-15r-alpha sushi domain based modulokines
WO2018198091A1 (en) 2017-04-28 2018-11-01 Novartis Ag Antibody conjugates comprising toll-like receptor agonist and combination therapies
WO2018234879A1 (en) 2017-06-22 2018-12-27 Novartis Ag USE OF IL-1β BINDING ANTIBODIES IN THE TREATMENT OF CANCER
WO2018237173A1 (en) 2017-06-22 2018-12-27 Novartis Ag ANTIBODY MOLECULES DIRECTED AGAINST CD73 AND CORRESPONDING USES
WO2018237157A1 (en) 2017-06-22 2018-12-27 Novartis Ag CD73 BINDING ANTIBODY MOLECULES AND USES THEREOF
WO2019006007A1 (en) 2017-06-27 2019-01-03 Novartis Ag POSOLOGICAL REGIMES FOR ANTI-TIM3 ANTIBODIES AND USES THEREOF
KR20190016979A (ko) * 2016-05-27 2019-02-19 알토 바이오사이언스 코포레이션 Cd3 결합 도메인을 가지는 다량체 il-15 기반 분자의 구성 및 특성규명
WO2019099838A1 (en) 2017-11-16 2019-05-23 Novartis Ag Combination therapies
WO2019108900A1 (en) 2017-11-30 2019-06-06 Novartis Ag Bcma-targeting chimeric antigen receptor, and uses thereof
WO2019160956A1 (en) 2018-02-13 2019-08-22 Novartis Ag Chimeric antigen receptor therapy in combination with il-15r and il15
WO2019200229A1 (en) 2018-04-13 2019-10-17 Novartis Ag Dosage regimens for anti-pd-l1 antibodies and uses thereof
WO2019232244A2 (en) 2018-05-31 2019-12-05 Novartis Ag Antibody molecules to cd73 and uses thereof
WO2019229701A2 (en) 2018-06-01 2019-12-05 Novartis Ag Binding molecules against bcma and uses thereof
WO2019229658A1 (en) 2018-05-30 2019-12-05 Novartis Ag Entpd2 antibodies, combination therapies, and methods of using the antibodies and combination therapies
US10501543B2 (en) 2016-10-14 2019-12-10 Xencor, Inc. IL15/IL15Rα heterodimeric Fc-fusion proteins
WO2020012337A1 (en) 2018-07-10 2020-01-16 Novartis Ag 3-(5-amino-1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and their use in the treatment of i karos family zinc finger 2 (ikzf2)-dependent diseases
WO2020021465A1 (en) 2018-07-25 2020-01-30 Advanced Accelerator Applications (Italy) S.R.L. Method of treatment of neuroendocrine tumors
US10626155B2 (en) 2011-06-24 2020-04-21 Cytune Pharma IL-15 and IL-15R\alpha sushi domain based immunocytokines
WO2020128613A1 (en) 2018-12-21 2020-06-25 Novartis Ag Use of il-1beta binding antibodies
WO2020128972A1 (en) 2018-12-20 2020-06-25 Novartis Ag Dosing regimen and pharmaceutical combination comprising 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives
WO2020128637A1 (en) 2018-12-21 2020-06-25 Novartis Ag Use of il-1 binding antibodies in the treatment of a msi-h cancer
WO2020128636A1 (en) 2018-12-21 2020-06-25 Novartis Ag Use of il-1 beta antibodies in the treatment or prevention of myelodysplastic syndrome
WO2020128620A1 (en) 2018-12-21 2020-06-25 Novartis Ag Use of il-1beta binding antibodies
EP3529263A4 (en) * 2016-10-21 2020-07-08 Altor BioScience Corporation MULTIMERIC MOLECULES BASED ON IL-15
WO2020165833A1 (en) 2019-02-15 2020-08-20 Novartis Ag 3-(1-oxo-5-(piperidin-4-yl)isoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof
WO2020165834A1 (en) 2019-02-15 2020-08-20 Novartis Ag Substituted 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof
US10808022B2 (en) 2014-03-03 2020-10-20 Cytune Pharma IL-15/IL-15Ralpha based conjugates purification method
EP3430055B1 (en) * 2016-03-17 2020-10-28 Oslo Universitetssykehus HF Fusion proteins targeting tumour associated macrophages for treating cancer
WO2020234387A1 (en) 2019-05-20 2020-11-26 Cytune Pharma IL-2/IL-15Rßy AGONIST DOSING REGIMENS FOR TREATING CANCER OR INFECTIOUS DISEASES
EP3578570A4 (en) * 2016-12-29 2020-12-23 Timmune Biotech Inc. MULTIFUNCTIONAL PROTEIN
WO2021053559A1 (en) 2019-09-18 2021-03-25 Novartis Ag Entpd2 antibodies, combination therapies, and methods of using the antibodies and combination therapies
US10973917B2 (en) 2016-05-18 2021-04-13 Modernatx, Inc. MRNA combination therapy for the treatment of cancer
WO2021079195A1 (en) 2019-10-21 2021-04-29 Novartis Ag Tim-3 inhibitors and uses thereof
WO2021079188A1 (en) 2019-10-21 2021-04-29 Novartis Ag Combination therapies with venetoclax and tim-3 inhibitors
WO2021123902A1 (en) 2019-12-20 2021-06-24 Novartis Ag Combination of anti tim-3 antibody mbg453 and anti tgf-beta antibody nis793, with or without decitabine or the anti pd-1 antibody spartalizumab, for treating myelofibrosis and myelodysplastic syndrome
US11053299B2 (en) 2010-09-21 2021-07-06 Immunity Bio, Inc. Superkine
WO2021144657A1 (en) 2020-01-17 2021-07-22 Novartis Ag Combination comprising a tim-3 inhibitor and a hypomethylating agent for use in treating myelodysplastic syndrome or chronic myelomonocytic leukemia
US11084863B2 (en) 2017-06-30 2021-08-10 Xencor, Inc. Targeted heterodimeric Fc fusion proteins containing IL-15 IL-15alpha and antigen binding domains
US11173191B2 (en) 2014-06-30 2021-11-16 Altor BioScience, LLC. IL-15-based molecules and methods of use thereof
WO2021260528A1 (en) 2020-06-23 2021-12-30 Novartis Ag Dosing regimen comprising 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives
WO2022031440A1 (en) 2020-08-03 2022-02-10 Immunitybio, Inc. Drug-specific pharmacokinetic assay for il-15 superagonist
WO2022029573A1 (en) 2020-08-03 2022-02-10 Novartis Ag Heteroaryl substituted 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof
WO2022043557A1 (en) 2020-08-31 2022-03-03 Advanced Accelerator Applications International Sa Method of treating psma-expressing cancers
WO2022043558A1 (en) 2020-08-31 2022-03-03 Advanced Accelerator Applications International Sa Method of treating psma-expressing cancers
WO2022090203A1 (en) 2020-10-26 2022-05-05 Cytune Pharma IL-2/IL-15Rβү AGONIST FOR TREATING SQUAMOUS CELL CARCINOMA
WO2022090202A1 (en) 2020-10-26 2022-05-05 Cytune Pharma IL-2/IL-15RBβү AGONIST FOR TREATING NON-MELANOMA SKIN CANCER
WO2022097060A1 (en) 2020-11-06 2022-05-12 Novartis Ag Cd19 binding molecules and uses thereof
US11365231B2 (en) 2007-05-11 2022-06-21 Altor Bioscience, Llc Interleukin 15 (IL-15) variants
US11377477B2 (en) 2018-10-12 2022-07-05 Xencor, Inc. PD-1 targeted IL-15/IL-15RALPHA fc fusion proteins and uses in combination therapies thereof
WO2022147444A2 (en) 2020-12-30 2022-07-07 Alaunos Therapeutics, Inc. Recombinant vectors comprising polycistronic expression cassettes and methods of use thereof
US11401312B2 (en) 2013-04-19 2022-08-02 Cytune Pharma Cytokine derived treatment with reduced vascular leak syndrome
WO2022215011A1 (en) 2021-04-07 2022-10-13 Novartis Ag USES OF ANTI-TGFβ ANTIBODIES AND OTHER THERAPEUTIC AGENTS FOR THE TREATMENT OF PROLIFERATIVE DISEASES
US11505595B2 (en) 2018-04-18 2022-11-22 Xencor, Inc. TIM-3 targeted heterodimeric fusion proteins containing IL-15/IL-15RA Fc-fusion proteins and TIM-3 antigen binding domains
WO2022243846A1 (en) 2021-05-18 2022-11-24 Novartis Ag Combination therapies
US11524991B2 (en) 2018-04-18 2022-12-13 Xencor, Inc. PD-1 targeted heterodimeric fusion proteins containing IL-15/IL-15Ra Fc-fusion proteins and PD-1 antigen binding domains and uses thereof
WO2022268991A1 (en) 2021-06-23 2022-12-29 Cytune Pharma Interleukin 15 variants
WO2023017191A1 (en) 2021-08-13 2023-02-16 Cytune Pharma Il-2/il-15rbetagamma agonist combination with antibody-drug conjugates for treating cancer
US11618776B2 (en) 2018-12-20 2023-04-04 Xencor, Inc. Targeted heterodimeric Fc fusion proteins containing IL-15/IL-15RA and NKG2D antigen binding domains
WO2023214325A1 (en) 2022-05-05 2023-11-09 Novartis Ag Pyrazolopyrimidine derivatives and uses thereof as tet2 inhibitors
US11932675B2 (en) 2019-10-11 2024-03-19 Genentech, Inc. PD-1 targeted IL-15/IL-15Rα Fc fusion proteins with improved properties
WO2024215989A1 (en) 2023-04-14 2024-10-17 Sotio Biotech Inc. ENGINEERED IMMUNE CELLS FOR TREATING CANCER IN COMBINATION WITH IL-2/IL-15 RECEPTOR βγ AGONISTS
WO2024215987A1 (en) 2023-04-14 2024-10-17 Sotio Biotech Inc. IMMUNE CELLS FOR TREATING CANCER IN COMBINATION WITH IL-15/IL-15Rα CONJUGATES
US12239688B2 (en) 2018-04-18 2025-03-04 Xencor, Inc. IL-15/IL-15RA heterodimeric Fc fusion proteins and uses thereof
US12509495B2 (en) 2018-04-18 2025-12-30 Xencor, Inc. LAG-3 targeted heterodimeric fusion proteins containing IL-15/IL-15RA Fc-fusion proteins and LAG-3 antigen binding domains

Families Citing this family (76)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PL2251034T3 (pl) 2005-12-02 2018-07-31 Icahn School Of Medicine At Mount Sinai Chimeryczne wirusy prezentujące nienatywne białka powierzchniowe i zastosowania tych wirusów
DK2406289T3 (en) 2009-03-10 2017-05-01 Baylor Res Inst ANTIGEN PRESENTING CELL TARGETED ANTIVIRUS VACCINES
AU2010222942B2 (en) 2009-03-10 2013-01-10 Baylor Research Institute Anti-CD40 antibodies and uses thereof
ES2598005T3 (es) 2009-08-14 2017-01-24 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Uso de IL-15 para aumentar la salida del timo y para tratar la linfopenia
EP2547328B1 (en) * 2010-02-11 2017-06-07 Ecole Polytechnique Fédérale de Lausanne (EPFL) Ccr7 ligand delivery and co-delivery in immunotherapy
WO2013121296A1 (en) 2012-02-15 2013-08-22 Ecole Polytechnique Federale De Lausanne Erythrocyte-binding therapeutics
US9517257B2 (en) 2010-08-10 2016-12-13 Ecole Polytechnique Federale De Lausanne (Epfl) Erythrocyte-binding therapeutics
US9850296B2 (en) 2010-08-10 2017-12-26 Ecole Polytechnique Federale De Lausanne (Epfl) Erythrocyte-binding therapeutics
EP2603520A4 (en) 2010-08-10 2014-02-19 Ecole Polytech ERYTHROCYTE BINDING THERAPEUTICS
WO2018112219A1 (en) * 2016-12-14 2018-06-21 Nant Holdings Ip, Llc Superkine
WO2012054509A2 (en) 2010-10-22 2012-04-26 Dana-Farber Cancer Institute, Inc. Discovery of regulatory t cells programmed to suppress an immune response
US10548957B2 (en) 2012-09-28 2020-02-04 Dana-Farber Cancer Institute, Inc. Targeted expansion of Qa-1-peptide-specific regulatory CD8 T cells to ameliorate arthritis
EP2968525A4 (en) 2013-03-14 2016-10-26 Icahn School Med Mount Sinai MORBUS NEWCASTLE VIRUSES AND USES THEREOF
SG10202010429YA (en) * 2013-07-19 2020-11-27 Vib Vzw Targeting of cytokine antagonists
CN120939216A (zh) 2014-01-13 2025-11-14 贝勒研究院 抗hpv和hpv相关的疾病的新疫苗
SG11201606761RA (en) 2014-02-21 2016-09-29 Ecole Polytecnique Federale De Lausanne Epfl Epfl Tto Glycotargeting therapeutics
US10946079B2 (en) 2014-02-21 2021-03-16 Ecole Polytechnique Federale De Lausanne Glycotargeting therapeutics
US10046056B2 (en) 2014-02-21 2018-08-14 École Polytechnique Fédérale De Lausanne (Epfl) Glycotargeting therapeutics
US10953101B2 (en) 2014-02-21 2021-03-23 École Polytechnique Fédérale De Lausanne (Epfl) Glycotargeting therapeutics
EP3110443A4 (en) 2014-02-27 2017-11-15 Viralytics Limited Combination method for treatment of cancer
US10464982B2 (en) 2014-04-23 2019-11-05 Emory University Compositions of GM-CSF and interleukin fusions for immune modulation and uses related thereto
ES2811974T3 (es) 2014-07-29 2021-03-15 Novartis Ag Regímenes de aumento escalonado de la dosis del heterodímero de il-15 e il-15ralfa para tratar afecciones
US20170269076A1 (en) 2014-08-27 2017-09-21 Dana-Farber Cancer Institute, Inc. Intracellular osteopontin regulates the lineage commitment of lymphoid subsets
WO2016060996A2 (en) * 2014-10-14 2016-04-21 Armo Biosciences, Inc. Interleukin-15 compositions and uses thereof
EP3064507A1 (en) * 2015-03-06 2016-09-07 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Fusion proteins comprising a binding protein and an interleukin-15 polypeptide having a reduced affinity for IL15ra and therapeutic uses thereof
EP3307783B1 (en) 2015-06-10 2021-01-06 Emory University Compositions and conjugates comprising an interleukin and polypeptides that specifically bind tgf-beta
JP2018532729A (ja) * 2015-09-25 2018-11-08 アルター・バイオサイエンス・コーポレーション インターロイキン−15スーパーアゴニストは、移植片対腫瘍活性を大幅に増強する
WO2017059900A1 (en) * 2015-10-07 2017-04-13 Biontech Cell & Gene Therapies Gmbh Antigen receptors and uses thereof
WO2017165464A1 (en) * 2016-03-21 2017-09-28 Elstar Therapeutics, Inc. Multispecific and multifunctional molecules and uses thereof
CN109715196A (zh) 2016-06-13 2019-05-03 转矩医疗股份有限公司 用于促进免疫细胞功能的组合物和方法
WO2018013855A2 (en) 2016-07-14 2018-01-18 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Il-15/il-15 receptor alpha treatment regimens and use with therapeutic vaccines
CN108250301A (zh) * 2016-12-29 2018-07-06 天津天锐生物科技有限公司 一种多靶点嵌合抗原受体
WO2018134782A1 (en) 2017-01-20 2018-07-26 Novartis Ag Combination therapy for the treatment of cancer
WO2018134784A1 (en) 2017-01-20 2018-07-26 Novartis Ag Combination therapy for the treatment of cancer
US11629340B2 (en) 2017-03-03 2023-04-18 Obsidian Therapeutics, Inc. DHFR tunable protein regulation
KR102867975B1 (ko) 2017-03-06 2025-10-14 알토 바이오사이언스 엘엘씨 Il-12 및 il-18로의 il-15-기반 융합
WO2018166589A1 (en) * 2017-03-15 2018-09-20 Biontech Cell & Gene Therapies Gmbh Antigen receptors and uses thereof
JOP20190256A1 (ar) 2017-05-12 2019-10-28 Icahn School Med Mount Sinai فيروسات داء نيوكاسل واستخداماتها
WO2018229706A1 (en) 2017-06-16 2018-12-20 Novartis Ag Combination therapy for the treatment of cancer
WO2018232176A1 (en) 2017-06-16 2018-12-20 The University Of Chicago Compositions and methods for inducing immune tolerance
US20200121720A1 (en) 2017-06-20 2020-04-23 Nantkwest, Inc. Nk-92 cells and il-15 agonist combination therapy
JP2020533971A (ja) * 2017-08-28 2020-11-26 アルター・バイオサイエンス・コーポレーション Il−15をベースとするil−7及びil−21への融合物
CA3074826A1 (en) 2017-09-05 2019-03-14 Torque Therapeutics, Inc. Therapeutic protein compositions and methods of making and using the same
US10610585B2 (en) 2017-09-26 2020-04-07 Inserm (Institut National De La Sante Et De La Recherche Medicale) Methods and compositions for treating and preventing HIV
CA3086040A1 (en) 2017-12-19 2019-06-27 Blaze Bioscience, Inc. Tumor homing and cell penetrating peptide-immuno-oncology agent complexes and methods of use thereof
US12247060B2 (en) 2018-01-09 2025-03-11 Marengo Therapeutics, Inc. Calreticulin binding constructs and engineered T cells for the treatment of diseases
WO2019150310A1 (en) 2018-02-02 2019-08-08 Novartis Ag Combination of sting agonist and il-15/il15-ra for the treatment of cancer
CN112004547A (zh) 2018-02-26 2020-11-27 新索思股份有限公司 Il-15缀合物及其用途
AU2019228381B2 (en) 2018-02-28 2021-12-16 Pfizer Inc. IL-15 variants and uses thereof
CA3090407A1 (en) * 2018-03-01 2019-09-06 Glycotope Gmbh Fusion protein constructs comprising an anti-muc1 antibody and il-15
EP3765517A1 (en) 2018-03-14 2021-01-20 Elstar Therapeutics, Inc. Multifunctional molecules that bind to calreticulin and uses thereof
EP3790577A4 (en) 2018-05-09 2022-04-27 The University of Chicago COMPOSITIONS AND METHODS RELATED TO IMMUNTOLERANCE
CA3105448A1 (en) 2018-07-03 2020-01-09 Elstar Therapeutics, Inc. Anti-tcr antibody molecules and uses thereof
WO2020037215A1 (en) 2018-08-17 2020-02-20 Icahn School Of Medicine At Mount Sinai Recombinant newcastle disease viruses and uses thereof for the prevention of rsv disease or human metapneumovirus disease
WO2020097556A1 (en) * 2018-11-09 2020-05-14 Nektar Therapeutics Long-acting interleukin-15 receptor agonist in combination with another pharmacologically active agent
CN119039441A (zh) 2019-02-21 2024-11-29 马伦戈治疗公司 与nkp30结合的抗体分子及其用途
GB2599228B (en) 2019-02-21 2024-02-07 Marengo Therapeutics Inc Multifunctional molecules that bind to T cell related cancer cells and uses thereof
US20220289838A1 (en) * 2019-08-19 2022-09-15 Nantong Yichen Biopharma. Co. Ltd. Immunocytokine, Preparation for the Same, and Uses Thereof
WO2021050789A1 (en) 2019-09-10 2021-03-18 Obsidian Therapeutics, Inc. Ca2-il15 fusion proteins for tunable regulation
RU2753282C2 (ru) * 2019-09-19 2021-08-12 Закрытое Акционерное Общество "Биокад" ИММУНОЦИТОКИН, ВКЛЮЧАЮЩИЙ ГЕТЕРОДИМЕРНЫЙ БЕЛКОВЫЙ КОМПЛЕКС НА ОСНОВЕ IL-15/IL-15Rα, И ЕГО ПРИМЕНЕНИЕ
CN111690069B (zh) * 2019-11-13 2022-04-19 中国科学技术大学 一种IL-15/SuIL-15Rα-mFc-γ4复合体蛋白及其构造方法、应用
US20210188933A1 (en) * 2019-12-18 2021-06-24 Nantcell, Inc Methods of treating pancytopenia
AU2020416273A1 (en) 2020-01-03 2022-07-28 Marengo Therapeutics, Inc. Anti-TCR antibody molecules and uses thereof
US20210244821A1 (en) 2020-02-05 2021-08-12 Novartis Ag Cho cell expressed het il-15
TW202214290A (zh) 2020-04-22 2022-04-16 瑞士商諾華公司 異源二聚體人介白素-15(hetil-15)之藥物組成物及藥物產品
CN114057889B (zh) * 2020-07-30 2023-11-10 深圳市北科生物科技有限公司 二硫键稳定的IL15-IL15Rα复合物及其应用
KR20230118887A (ko) 2020-12-03 2023-08-14 센츄리 쎄라퓨틱스 인코포레이티드 유전자 조작 세포 및 이의 용도
US11661459B2 (en) 2020-12-03 2023-05-30 Century Therapeutics, Inc. Artificial cell death polypeptide for chimeric antigen receptor and uses thereof
CN116655771A (zh) * 2021-05-28 2023-08-29 苏州复融生物技术有限公司 一种新型白介素15突变体多肽的开发及其应用
EP4376870A4 (en) * 2021-07-28 2025-07-23 Anwita Biosciences Inc INTERLEUKIN-2 MUTEINS, FUSION PROTEINS, PHARMACEUTICAL COMPOSITIONS AND THERAPEUTIC APPLICATIONS
US20230151095A1 (en) 2021-11-12 2023-05-18 Xencor, Inc. Bispecific antibodies that bind to b7h3 and nkg2d
KR20240131446A (ko) 2022-01-22 2024-08-30 난트셀, 인크. Ctla4 및 il-15의 융합 분자
WO2024102636A1 (en) 2022-11-07 2024-05-16 Xencor, Inc. Bispecific antibodies that bind to b7h3 and mica/b
GB202315149D0 (en) 2023-10-03 2023-11-15 Celleron Therapeutics Ltd Combination therapy
WO2025085672A1 (en) 2023-10-17 2025-04-24 Xencor, Inc. Bispecific antibodies that bind to nkp46 and mica/b
US12605349B2 (en) 2024-09-05 2026-04-21 Orbus Therapeutics, Inc. Methods of treating grade 3 astrocytoma

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030180888A1 (en) * 2000-11-03 2003-09-25 Millennium Pharmaceuticals, Inc. CD2000 and CD2001 molecules, and uses thereof
US20040156826A1 (en) * 2002-09-27 2004-08-12 Fernando Dangond Treatment of patients with multiple sclerosis based on gene expression changes in central nervous system tissues
US20060263857A1 (en) * 2005-05-17 2006-11-23 University Of Connecticut Compositions and methods for immunomodulation in an organism

Family Cites Families (61)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS551222U (https=) 1978-06-15 1980-01-07
JPS5841623U (ja) 1981-09-17 1983-03-18 日産デイ−ゼル工業株式会社 リアエンジンバスにおけるエンジンル−ムの冷却及び房内熱風排出装置
JPS6152156U (https=) 1984-09-12 1986-04-08
JPS6251570U (https=) 1985-09-18 1987-03-31
JPS648039U (https=) 1987-06-29 1989-01-17
US5116964A (en) 1989-02-23 1992-05-26 Genentech, Inc. Hybrid immunoglobulins
US5314995A (en) 1990-01-22 1994-05-24 Oncogen Therapeutic interleukin-2-antibody based fusion proteins
US5288931A (en) 1991-12-06 1994-02-22 Genentech, Inc. Method for refolding insoluble, misfolded insulin-like growth factor-I into an active conformation
AU5098393A (en) 1992-08-14 1994-03-15 Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The Recombinant toxin with increased half-life
US5747654A (en) 1993-06-14 1998-05-05 The United States Of America As Represented By The Department Of Health And Human Services Recombinant disulfide-stabilized polypeptide fragments having binding specificity
AU680909B2 (en) * 1994-04-06 1997-08-14 Immunex Corporation Interleukin-15
WO1995027722A1 (en) 1994-04-06 1995-10-19 Immunex Corporation Interleukin-15
US5541087A (en) 1994-09-14 1996-07-30 Fuji Immunopharmaceuticals Corporation Expression and export technology of proteins as immunofusins
US5795966A (en) 1995-02-22 1998-08-18 Immunex Corp Antagonists of interleukin-15
US7008624B1 (en) * 1995-02-22 2006-03-07 Immunex Corporation Antagonists of interleukin-15
US6096871A (en) 1995-04-14 2000-08-01 Genentech, Inc. Polypeptides altered to contain an epitope from the Fc region of an IgG molecule for increased half-life
US5534592A (en) 1995-09-22 1996-07-09 The Goodyear Tire & Rubber Company High performance blend for tire treads
JP4046354B2 (ja) 1996-03-18 2008-02-13 ボード オブ リージェンツ,ザ ユニバーシティ オブ テキサス システム 増大した半減期を有する免疫グロブリン様ドメイン
WO1997041232A1 (en) * 1996-04-26 1997-11-06 Beth Israel Deaconess Medical Center Antagonists of interleukin-15
ATE229342T1 (de) 1997-02-21 2002-12-15 Vlaams Interuniv Inst Biotech Verwendung von interleukin-15
GB9912350D0 (en) 1999-05-26 1999-07-28 European Molecular Biology Lab Embl Modified cytokine
EP1284747A2 (en) * 2000-05-12 2003-02-26 Beth Israel Deaconess Medical Center, Inc. Compositions and methods for achieving immune suppression
AU7524601A (en) 2000-06-05 2001-12-17 Sunol Molecular Corp T cell receptor fusions and conjugates and methods of use thereof
EP1349873B1 (en) 2000-09-14 2009-04-01 Beth Israel Deaconess Medical Center, Inc. Modulation of il-2- and il-15-mediated t cell responses
FI117667B (fi) 2001-07-05 2007-01-15 Univ Zuerich Farmaseuttinen koostumus, joka soveltuu käytettäväksi ortopediassa ja hammaslääketieteessä
AU2003210060B2 (en) 2002-03-22 2010-02-25 Aprogen, Inc. Humanized antibody and process for preparing same
JP4892335B2 (ja) 2003-02-26 2012-03-07 ゲンマブ エー/エス インターロイキン15(il−15)に特異的なヒト抗体
DE10324708A1 (de) 2003-05-30 2004-12-16 Ltn Servotechnik Gmbh Schleifringelement und Verfahren zu dessen Herstellung
CN1233822C (zh) 2003-09-05 2005-12-28 中国科学技术大学 白细胞介素-15基因修饰的自然杀伤细胞株及其制备方法
KR101131297B1 (ko) 2003-11-10 2012-03-30 알토 바이오사이언스 코포레이션 가용성 티씨알 분자 및 이용 방법
ES2367027T3 (es) * 2004-02-27 2011-10-27 Inserm (Institut National De La Santé Et De La Recherche Medicale) Sitio de unión de la il-15 para il-15ralfa y mutantes específicos de il-15 que tienen actividad agonista/antagonista.
EP1586585A1 (de) 2004-04-14 2005-10-19 F. Hoffmann-La Roche Ag Expressionssystem zur Herstellung von IL-15/Fc-Fusionsproteinen und ihre Verwendung
CN100334112C (zh) 2004-10-15 2007-08-29 上海海欣生物技术有限公司 人白细胞介素15与Fc融合蛋白
EP1814580B1 (en) 2004-11-24 2016-08-10 Fred Hutchinson Cancer Research Center Methods of using il-21 for adoptive immunotherapy and identification of tumor antigens
WO2006063974A2 (en) * 2004-12-13 2006-06-22 Cytos Biotechnology Ag Il-15 antigen arrays and uses thereof
EP1777294A1 (en) * 2005-10-20 2007-04-25 Institut National De La Sante Et De La Recherche Medicale (Inserm) IL-15Ralpha sushi domain as a selective and potent enhancer of IL-15 action through IL-15Rbeta/gamma, and hyperagonist (IL15Ralpha sushi -IL15) fusion proteins
ES2352561T3 (es) 2006-06-30 2011-02-21 Conaris Research Institute Ag Dímeros de sgp 130fc mejorados.
US7965180B2 (en) 2006-09-28 2011-06-21 Semiconductor Energy Laboratory Co., Ltd. Wireless sensor device
SI2856876T1 (en) 2007-03-30 2018-04-30 Memorial Sloan-Kettering Cancer Center Constitutive expression of costimulatory ligands on adoptively transferred T lymphocytes
AU2013273643C1 (en) 2007-05-11 2016-08-11 Altor Bioscience Corporation Fusion molecules and il-15 variants
CN101743249B (zh) 2007-05-11 2017-08-08 阿尔托生物科学有限公司 融合分子与il‑15变异体
AU2008279550B2 (en) 2007-06-21 2012-08-09 Angelica Therapeutics, Inc. Modified toxins
NZ599338A (en) 2007-06-27 2013-11-29 Marinepolymer Tech Inc Complexes of il-15 and il-15ralpha and uses thereof
US20110070191A1 (en) * 2008-03-19 2011-03-24 Wong Hing C T cell receptor fusions and conjugates and methods of use there of
US11053299B2 (en) 2010-09-21 2021-07-06 Immunity Bio, Inc. Superkine
US8507222B2 (en) 2010-09-21 2013-08-13 Altor Bioscience Corporation Multimeric IL-15 soluble fusion molecules and methods of making and using same
EP2537933A1 (en) 2011-06-24 2012-12-26 Institut National de la Santé et de la Recherche Médicale (INSERM) An IL-15 and IL-15Ralpha sushi domain based immunocytokines
US20130302274A1 (en) 2011-11-25 2013-11-14 Roche Glycart Ag Combination therapy
US9682143B2 (en) 2012-08-14 2017-06-20 Ibc Pharmaceuticals, Inc. Combination therapy for inducing immune response to disease
WO2014028776A1 (en) 2012-08-15 2014-02-20 Zyngenia, Inc. Monovalent and multivalent multispecific complexes and uses thereof
US20150359853A1 (en) 2012-10-24 2015-12-17 Admune Therapeutics Llc Il-15r alpha forms, cells expressing il-15r alpha forms, and therapeutic uses of il-15r alpha and il-15/il-15r alpha complexes
US8977012B2 (en) 2012-10-31 2015-03-10 Google Inc. Image denoising system and method
PL3094351T3 (pl) 2014-01-15 2022-06-27 Kadmon Corporation, Llc Środki immunomodulujące
KR102762243B1 (ko) 2014-06-30 2025-02-05 알토 바이오사이언스 엘엘씨 Il-15-베이즈드 분자 및 이의 사용 방법
CN104672325A (zh) 2015-03-11 2015-06-03 福建农林大学 一种用新鲜螺旋藻制备藻蓝蛋白的方法
JP2018532729A (ja) 2015-09-25 2018-11-08 アルター・バイオサイエンス・コーポレーション インターロイキン−15スーパーアゴニストは、移植片対腫瘍活性を大幅に増強する
US10865230B2 (en) 2016-05-27 2020-12-15 Altor Bioscience, Llc Construction and characterization of multimeric IL-15-based molecules with CD3 binding domains
EP4613776A3 (en) 2016-10-21 2025-11-26 Altor BioScience Corporation Multimeric il-15-based molecules
KR102867975B1 (ko) * 2017-03-06 2025-10-14 알토 바이오사이언스 엘엘씨 Il-12 및 il-18로의 il-15-기반 융합
JP2020533971A (ja) * 2017-08-28 2020-11-26 アルター・バイオサイエンス・コーポレーション Il−15をベースとするil−7及びil−21への融合物
US11168138B2 (en) 2018-03-26 2021-11-09 Altor Bioscience, Llc Anti-PDL1, IL-15 and TGF-beta receptor combination molecules

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030180888A1 (en) * 2000-11-03 2003-09-25 Millennium Pharmaceuticals, Inc. CD2000 and CD2001 molecules, and uses thereof
US20040156826A1 (en) * 2002-09-27 2004-08-12 Fernando Dangond Treatment of patients with multiple sclerosis based on gene expression changes in central nervous system tissues
US20060263857A1 (en) * 2005-05-17 2006-11-23 University Of Connecticut Compositions and methods for immunomodulation in an organism

Non-Patent Citations (24)

* Cited by examiner, † Cited by third party
Title
"Fundamental Immunology", 1993, RSEN PRESS LTD.
A.D. BANGHAM ET AL., J. MOL. BIOL., vol. 23, 1965, pages 238 - 252
ANDERSON ET AL., J. BIOL. CHEM., vol. 270, 1995, pages 29862 - 29869
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1989, JOHN WILEY & SONS
D. TOMALIA, ALDRICHIMICA ACTA, vol. 26, 1993, pages 91 - 101
DAVIS ANN. REV. OF IMMUNOLOGY, vol. 3, 1985, pages 537
DUBOIS ET AL., J. BIOL. CHEM., vol. 274, 1999, pages 26978 - 26984
F. OLSON ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 557, 1979, pages 9 - 23
F. SZOKA ET AL., PROC. NAT. ACAD. SCI., vol. 75, 1978, pages 4194 - 4198
FLEER, R., CURRENT OPINION IN BIOTECHNOLOGY, vol. 3, no. 5, 1992, pages 486 - 496
GALFRE; MILSTEIN, METH. ENZYMOL., vol. 73, no. B, 1981, pages 3
GRAHAM ET AL., J GEN. VIROL., vol. 36, 1977, pages 59
MAYER ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 858, 1986, pages 161 - 168
MORTIER ET AL., J BIOL CHEM, vol. 281, 2006, pages 1612 - 1619
MOSQUERA, LUIS A. ET AL.: "Journal of Im- munology", vol. 174, 1 April 2005, AMERICAN ASSOCIATION OF IMMUNOLOGISTS, article "In Vitro and In Vivo Characterization of a Novel Antibody-Like Single-Chain TCR Human IgGI Fusion Protein", pages: 4381 - 4388
RUBINSTEIN ET AL., PROC NATL ACAD SCI USA, vol. 103, 2006, pages 9166 - 9171
S. KIM ET AL., BIOCHIM. BIOPHYS. ACTA, vol. 728, 1983, pages 339 - 348
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989
STOKLASEK ET AL., J IMMUNOL, vol. 177, 2006, pages 6072 - 6080
ULMER, J.B. ET AL., SCIENCE, vol. 259, 1993, pages 1745 - 1749
ULMER, J.B. ET AL., SCIENCE, vol. 259, pages 1745 - 1749
URLAUB; CHASM, PROC. NATL. ACAD. SCI. USA, vol. 77, 1980, pages 4216
WALDMANN, TA, NATURE REV. IMMUNOL., vol. 6, 2006, pages 595 - 601
WEI ET AL., JOURNAL OF IMMUNOLOGY, vol. 167, 2001, pages 277 - 282

Cited By (146)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9365630B2 (en) 2005-05-17 2016-06-14 University Of Connecticut Compositions and methods for Immunomodulation in an organism
US10464993B2 (en) 2005-05-17 2019-11-05 University Of Connecticut Compositions and methods for immunomodulation in an organism
US9969790B2 (en) 2005-05-17 2018-05-15 University Of Connecticut Compositions and methods for immunomodulation in an organism
US11008378B2 (en) 2005-05-17 2021-05-18 University Of Connecticut Compositions and methods for immunomodulation in an organism
US9932387B2 (en) 2005-05-17 2018-04-03 University Of Connecticut Compositions and methods for immunomodulation in an organism
US8940288B2 (en) 2005-05-17 2015-01-27 University Of Connecticut Method for treating cancer by administering IL-15 and IL-15Ralpha complexes
US9371368B2 (en) 2005-05-17 2016-06-21 University Of Connecticut Compositions and methods for immunomodulation in an organism
US11339198B2 (en) 2006-01-13 2022-05-24 The United States Of America, As Represented By, The Secretary, Department Of Health And Human Services Codon optimized IL-15 and IL-15R-alpha genes for expression in mammalian cells
US10428133B2 (en) 2006-01-13 2019-10-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Codon optimized IL-15 and IL-15R-alpha genes for expression in mammalian cells
US9303080B2 (en) 2006-01-13 2016-04-05 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, National Institutes Of Health Codon optimized IL-15 and IL-15R-alpha genes for expression in mammalian cells
US9725492B2 (en) 2006-01-13 2017-08-08 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Codon optimized IL-15 and IL-15R-alpha genes for expression in mammalian cells
US9790261B2 (en) 2006-01-13 2017-10-17 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Codon optimized IL-15 and IL-15R-alpha genes for expression in mammalian cells
US11673932B2 (en) 2007-05-11 2023-06-13 Altor BioScience, LLC. Fusion molecules and IL-15 variants
US11498950B1 (en) 2007-05-11 2022-11-15 Altor Bioscience, Llc Fusion molecules and IL-15 variants
US12168680B2 (en) 2007-05-11 2024-12-17 Altor Bioscience, Llc Fusion molecules and IL-15 variants
US11365231B2 (en) 2007-05-11 2022-06-21 Altor Bioscience, Llc Interleukin 15 (IL-15) variants
US9931377B2 (en) 2007-06-27 2018-04-03 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Cell expressing complexes of IL-15 and IL-15Ralpha
US10265382B2 (en) 2007-06-27 2019-04-23 Novartis Ag Complexes of IL-15 and IL-15Ralpha and uses thereof
US11110150B2 (en) 2007-06-27 2021-09-07 Novartis Ag Complexes of IL-15 and IL-15Ralpha and uses thereof
EP2258720A1 (en) * 2009-05-19 2010-12-08 Max Delbrück Centrum für Molekulare Medizin (MDC) Berlin-Buch; Multiple target T cell receptor
EP2258719A1 (en) * 2009-05-19 2010-12-08 Max-Delbrück-Centrum für Molekulare Medizin (MDC) Multiple target T cell receptor
US12371472B2 (en) 2010-09-21 2025-07-29 Altor Bioscience, Llc Multimeric IL-15 soluble fusion molecules and methods of making and using same
AU2011305476B2 (en) * 2010-09-21 2016-12-01 Altor Bioscience Corporation Multimeric IL-15 soluble fusion molecules and methods of making and using same
EP3327040A1 (en) 2010-09-21 2018-05-30 Altor BioScience Corporation Multimeric il-15 soluble fusion molecules and methods of making and using same
US11104716B2 (en) 2010-09-21 2021-08-31 Altor BioScience, LLC. Multimeric IL-15 soluble fusion molecules and methods of making and using same
EP3851459A1 (en) 2010-09-21 2021-07-21 Altor BioScience Corporation Multimeric il-15 soluble fusion molecules and methods of making and using same
KR20180126632A (ko) * 2010-09-21 2018-11-27 알토 바이오사이언스 코포레이션 다량체성 아이엘 15 용해성 융합 분자 및 그의 제조 및 사용 방법
US10150805B2 (en) 2010-09-21 2018-12-11 Altor Bioscience, Llc Multimeric IL-15 soluble fusion molecules and methods of making and using same
AU2017201056B2 (en) * 2010-09-21 2018-12-20 Altor Bioscience Corporation Multimeric il-15 soluble fusion molecules and methods of making and using same
US11053299B2 (en) 2010-09-21 2021-07-06 Immunity Bio, Inc. Superkine
US9428573B2 (en) 2010-09-21 2016-08-30 Altor Bioscience Corporation Multimeric IL-15 soluble fusion molecules and methods of making and using same
WO2012040323A2 (en) 2010-09-21 2012-03-29 Altor Bioscien Corporation Multimeric il-15 soluble fusion molecules and methods of making and using same
US11046747B2 (en) 2010-09-21 2021-06-29 Altor Bioscience Llc Multimeric IL-15 soluble fusion molecules and methods of making and using same
EP2619229A4 (en) * 2010-09-21 2014-03-26 Altor Bioscience Corp Multimeric il-15 soluble fusion molecules and methods of making and using same
US10899821B2 (en) 2010-09-21 2021-01-26 Altor Bioscience Llc Method of treating neoplasia with a multimeric IL-15 soluble fusion molecule
EP4385570A3 (en) * 2010-09-21 2024-09-11 Altor BioScience, LLC Multimeric il-15 soluble fusion molecules and methods of making and using same
EP2918607A1 (en) 2010-09-21 2015-09-16 Altor BioScience Corporation Multimeric il-15 soluble fusion molecules and methods of making and using same
KR102070098B1 (ko) * 2010-09-21 2020-01-28 알토 바이오사이언스 코포레이션 다량체성 아이엘 15 용해성 융합 분자 및 그의 제조 및 사용 방법
EP4385570A2 (en) 2010-09-21 2024-06-19 Altor BioScience, LLC Multimeric il-15 soluble fusion molecules and methods of making and using same
US10358478B2 (en) 2010-09-21 2019-07-23 Altor Bioscience Corporation Multimeric IL-15 soluble fusion molecules and methods of making and using same
US9255141B2 (en) 2010-09-21 2016-02-09 Hing C. Wong Multimeric IL-15 soluble fusion molecules and methods of treating neoplasia and HIV using same
US9328159B2 (en) 2010-09-21 2016-05-03 Altor Bioscience Corporation Multimeric IL-15 soluble fusion molecules and methods of using same
US11845783B2 (en) 2010-09-21 2023-12-19 Altor BioScience, LLC. Multimeric IL-15 soluble fusion molecules and methods of making and using same
US10626155B2 (en) 2011-06-24 2020-04-21 Cytune Pharma IL-15 and IL-15R\alpha sushi domain based immunocytokines
US11753454B2 (en) 2011-06-24 2023-09-12 Cytune Pharma IL-15 and IL-15R\alpha sushi domain based immunocytokines
US10899816B2 (en) 2011-06-24 2021-01-26 Inserm (Institut National De La Santé Et De La Recherche Medicale) IL-15 and IL-15Rα sushi domain based immunocytokines
WO2014023315A1 (en) 2012-08-10 2014-02-13 Aarhus Universitet Multimerization through beta-strand swapping in ccp domains
EP2911684A4 (en) * 2012-10-24 2016-08-10 Admune Therapeutics Llc IL-15R ALPHA FORMS, IL-15R ALPHA FORMS EXPRESSIVE CELLS, AND THERAPEUTIC USE OF IL-15R ALPHA AND IL-15 / IL-15R ALPHA COMPLEXES
US11401312B2 (en) 2013-04-19 2022-08-02 Cytune Pharma Cytokine derived treatment with reduced vascular leak syndrome
EP3030575B1 (en) 2013-08-08 2018-07-11 Cytune Pharma Il-15 and il-15r-alpha sushi domain based modulokines
EP3444271B1 (en) 2013-08-08 2021-10-06 Cytune Pharma Il-15 and il-15ralpha sushi domain based modulokines
US11273204B2 (en) 2013-08-08 2022-03-15 Cytune Pharma IL-15 and IL-15RAPLHA sushi domain based immunocytokines
US10808022B2 (en) 2014-03-03 2020-10-20 Cytune Pharma IL-15/IL-15Ralpha based conjugates purification method
US12060407B2 (en) 2014-03-03 2024-08-13 Cytune Pharma IL-15/IL-15Ralpha based conjugates purification method
US11173191B2 (en) 2014-06-30 2021-11-16 Altor BioScience, LLC. IL-15-based molecules and methods of use thereof
US12268732B2 (en) 2014-06-30 2025-04-08 Altor BioScience, LLC. IL-15-based molecules with anti-CD20 antibody and methods of use
US12268731B2 (en) 2014-06-30 2025-04-08 Altor Bioscience, Llc Compositions comprising IL-15N72D-based molecules and bacillus calmette-guerin (BCG)
US12186372B2 (en) 2014-06-30 2025-01-07 Altor Bioscience, Llc IL-15-based molecules and methods of treating a neoplasia
US11890323B2 (en) 2014-06-30 2024-02-06 Altor Bioscience, Llc Method of treating cancer with composition comprising IL-15-based molecules and BCG
US11471511B2 (en) 2014-06-30 2022-10-18 Altor Bioscience, Llc IL-15-based molecules and methods of use thereof
US12318432B2 (en) 2014-06-30 2025-06-03 Altor Bioscience, Llc BCG and IL-15 based molecules
US12097244B2 (en) 2014-06-30 2024-09-24 Altor BioScience, LLC. Methods of treating a neoplasia with IL-15-based molecules and CTLA-4 antibody
US11925676B2 (en) 2014-06-30 2024-03-12 Altor BioScience, LLC. Method for treating neoplasia with an anti-CD38 antibody and an IL-15:IL-15R complex
US11679144B2 (en) 2014-06-30 2023-06-20 Altor BioScience, LLC. IL-15-based molecules and methods of use thereof
US11992516B2 (en) 2014-06-30 2024-05-28 Altor BioScience, LLC. Compositions comprising IL-15-based molecules and immune checkpoint inhibitor antibodies
JP2018500316A (ja) * 2014-12-19 2018-01-11 ジエンス ヘンルイ メデイシンカンパニー リミテッドJiangsu Hengrui Medicine Co.,Ltd. インターロイキン15タンパク複合体およびそれらの用途
WO2017046200A1 (en) * 2015-09-16 2017-03-23 INSERM (Institut National de la Santé et de la Recherche Médicale) Specific interleukin-15 (il-15) antagonist polypeptide and uses thereof for the treatment of inflammatory and auto-immune diseases
US10858452B2 (en) 2015-09-16 2020-12-08 Insitut National de la Sante et de la Recherche Medicale (INSERM) Specific interleukin-15 (IL-15) antagonist polypeptide and uses thereof for the treatment of inflammatory and auto-immune diseases
EP3430055B1 (en) * 2016-03-17 2020-10-28 Oslo Universitetssykehus HF Fusion proteins targeting tumour associated macrophages for treating cancer
WO2017177063A1 (en) * 2016-04-06 2017-10-12 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of heterodimeric il-15 in adoptive cell transfer
US11660341B2 (en) 2016-05-18 2023-05-30 Modernatx, Inc. mRNA combination therapy for the treatment of cancer
US10973917B2 (en) 2016-05-18 2021-04-13 Modernatx, Inc. MRNA combination therapy for the treatment of cancer
AU2017271593B2 (en) * 2016-05-27 2021-04-22 Altor Bioscience Corporation Construction and characterization of multimeric IL-15-based molecules with CD3 binding domains
KR20190016979A (ko) * 2016-05-27 2019-02-19 알토 바이오사이언스 코포레이션 Cd3 결합 도메인을 가지는 다량체 il-15 기반 분자의 구성 및 특성규명
KR102463844B1 (ko) 2016-05-27 2022-11-08 알토 바이오사이언스 코포레이션 Cd3 결합 도메인을 가지는 다량체 il-15 기반 분자의 구성 및 특성규명
CN109496217B (zh) * 2016-05-27 2023-10-20 阿尔托生物科学有限公司 具有cd3结合域的基于多聚体il-15的分子的构造和表征
US10865230B2 (en) 2016-05-27 2020-12-15 Altor Bioscience, Llc Construction and characterization of multimeric IL-15-based molecules with CD3 binding domains
EP3464352A4 (en) * 2016-05-27 2019-10-23 Altor BioScience Corporation CONSTRUCTION AND CHARACTERIZATION OF MULTIMED IL-15 BASED MOLECULES WITH CD3 BINDING DOMAINS
CN109496217A (zh) * 2016-05-27 2019-03-19 阿尔托生物科学有限公司 具有cd3结合域的基于多聚体il-15的分子的构造和表征
US10550185B2 (en) 2016-10-14 2020-02-04 Xencor, Inc. Bispecific heterodimeric fusion proteins containing IL-15-IL-15Rα Fc-fusion proteins and PD-1 antibody fragments
US11584794B2 (en) 2016-10-14 2023-02-21 Xencor, Inc. Bispecific heterodimeric fusion proteins containing IL-15-IL-15Ralpha Fc-fusion proteins and immune checkpoint antibody fragments
US10501543B2 (en) 2016-10-14 2019-12-10 Xencor, Inc. IL15/IL15Rα heterodimeric Fc-fusion proteins
EP3529263A4 (en) * 2016-10-21 2020-07-08 Altor BioScience Corporation MULTIMERIC MOLECULES BASED ON IL-15
EP4613776A3 (en) * 2016-10-21 2025-11-26 Altor BioScience Corporation Multimeric il-15-based molecules
US11369679B2 (en) 2016-10-21 2022-06-28 Altor Bioscience, Llc Multimeric IL-15-based molecules
US11318201B2 (en) 2016-10-21 2022-05-03 Altor BioScience, LLC. Multimeric IL-15-based molecules
EP3578570A4 (en) * 2016-12-29 2020-12-23 Timmune Biotech Inc. MULTIFUNCTIONAL PROTEIN
US11530264B2 (en) 2016-12-29 2022-12-20 Shenzhen Beike Biotechnology Co., Ltd Multifunctional protein
WO2018198091A1 (en) 2017-04-28 2018-11-01 Novartis Ag Antibody conjugates comprising toll-like receptor agonist and combination therapies
WO2018237173A1 (en) 2017-06-22 2018-12-27 Novartis Ag ANTIBODY MOLECULES DIRECTED AGAINST CD73 AND CORRESPONDING USES
WO2018235056A1 (en) 2017-06-22 2018-12-27 Novartis Ag IL-1BETA BINDING ANTIBODIES FOR USE IN THE TREATMENT OF CANCER
WO2018234879A1 (en) 2017-06-22 2018-12-27 Novartis Ag USE OF IL-1β BINDING ANTIBODIES IN THE TREATMENT OF CANCER
WO2018237157A1 (en) 2017-06-22 2018-12-27 Novartis Ag CD73 BINDING ANTIBODY MOLECULES AND USES THEREOF
WO2019006007A1 (en) 2017-06-27 2019-01-03 Novartis Ag POSOLOGICAL REGIMES FOR ANTI-TIM3 ANTIBODIES AND USES THEREOF
US11084863B2 (en) 2017-06-30 2021-08-10 Xencor, Inc. Targeted heterodimeric Fc fusion proteins containing IL-15 IL-15alpha and antigen binding domains
US12139525B2 (en) 2017-06-30 2024-11-12 Xencor, Inc. Targeted heterodimeric Fc fusion proteins containing IL-15 IL-15alpha and antigen binding domains
WO2019099838A1 (en) 2017-11-16 2019-05-23 Novartis Ag Combination therapies
WO2019108900A1 (en) 2017-11-30 2019-06-06 Novartis Ag Bcma-targeting chimeric antigen receptor, and uses thereof
WO2019160956A1 (en) 2018-02-13 2019-08-22 Novartis Ag Chimeric antigen receptor therapy in combination with il-15r and il15
WO2019200229A1 (en) 2018-04-13 2019-10-17 Novartis Ag Dosage regimens for anti-pd-l1 antibodies and uses thereof
US11524991B2 (en) 2018-04-18 2022-12-13 Xencor, Inc. PD-1 targeted heterodimeric fusion proteins containing IL-15/IL-15Ra Fc-fusion proteins and PD-1 antigen binding domains and uses thereof
US12509495B2 (en) 2018-04-18 2025-12-30 Xencor, Inc. LAG-3 targeted heterodimeric fusion proteins containing IL-15/IL-15RA Fc-fusion proteins and LAG-3 antigen binding domains
US12239688B2 (en) 2018-04-18 2025-03-04 Xencor, Inc. IL-15/IL-15RA heterodimeric Fc fusion proteins and uses thereof
US11505595B2 (en) 2018-04-18 2022-11-22 Xencor, Inc. TIM-3 targeted heterodimeric fusion proteins containing IL-15/IL-15RA Fc-fusion proteins and TIM-3 antigen binding domains
WO2019229658A1 (en) 2018-05-30 2019-12-05 Novartis Ag Entpd2 antibodies, combination therapies, and methods of using the antibodies and combination therapies
WO2019232244A2 (en) 2018-05-31 2019-12-05 Novartis Ag Antibody molecules to cd73 and uses thereof
WO2019229701A2 (en) 2018-06-01 2019-12-05 Novartis Ag Binding molecules against bcma and uses thereof
WO2020012337A1 (en) 2018-07-10 2020-01-16 Novartis Ag 3-(5-amino-1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and their use in the treatment of i karos family zinc finger 2 (ikzf2)-dependent diseases
WO2020021465A1 (en) 2018-07-25 2020-01-30 Advanced Accelerator Applications (Italy) S.R.L. Method of treatment of neuroendocrine tumors
US11377477B2 (en) 2018-10-12 2022-07-05 Xencor, Inc. PD-1 targeted IL-15/IL-15RALPHA fc fusion proteins and uses in combination therapies thereof
WO2020128972A1 (en) 2018-12-20 2020-06-25 Novartis Ag Dosing regimen and pharmaceutical combination comprising 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives
US12448423B2 (en) 2018-12-20 2025-10-21 Xencor, Inc. Targeted heterodimeric Fc fusion proteins containing NKG2D antigen binding domains
US11618776B2 (en) 2018-12-20 2023-04-04 Xencor, Inc. Targeted heterodimeric Fc fusion proteins containing IL-15/IL-15RA and NKG2D antigen binding domains
WO2020128636A1 (en) 2018-12-21 2020-06-25 Novartis Ag Use of il-1 beta antibodies in the treatment or prevention of myelodysplastic syndrome
WO2020128637A1 (en) 2018-12-21 2020-06-25 Novartis Ag Use of il-1 binding antibodies in the treatment of a msi-h cancer
WO2020128613A1 (en) 2018-12-21 2020-06-25 Novartis Ag Use of il-1beta binding antibodies
WO2020128620A1 (en) 2018-12-21 2020-06-25 Novartis Ag Use of il-1beta binding antibodies
WO2020165833A1 (en) 2019-02-15 2020-08-20 Novartis Ag 3-(1-oxo-5-(piperidin-4-yl)isoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof
WO2020165834A1 (en) 2019-02-15 2020-08-20 Novartis Ag Substituted 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof
KR20220012296A (ko) 2019-05-20 2022-02-03 싸이튠 파마 암 또는 감염성 질환 치료를 위한 IL-2/IL-15Rβγ 작용제 투여 요법
WO2020234387A1 (en) 2019-05-20 2020-11-26 Cytune Pharma IL-2/IL-15Rßy AGONIST DOSING REGIMENS FOR TREATING CANCER OR INFECTIOUS DISEASES
WO2021053559A1 (en) 2019-09-18 2021-03-25 Novartis Ag Entpd2 antibodies, combination therapies, and methods of using the antibodies and combination therapies
US11932675B2 (en) 2019-10-11 2024-03-19 Genentech, Inc. PD-1 targeted IL-15/IL-15Rα Fc fusion proteins with improved properties
WO2021079188A1 (en) 2019-10-21 2021-04-29 Novartis Ag Combination therapies with venetoclax and tim-3 inhibitors
WO2021079195A1 (en) 2019-10-21 2021-04-29 Novartis Ag Tim-3 inhibitors and uses thereof
WO2021123996A1 (en) 2019-12-20 2021-06-24 Novartis Ag Uses of anti-tgf-beta antibodies and checkpoint inhibitors for the treatment of proliferative diseases
WO2021123902A1 (en) 2019-12-20 2021-06-24 Novartis Ag Combination of anti tim-3 antibody mbg453 and anti tgf-beta antibody nis793, with or without decitabine or the anti pd-1 antibody spartalizumab, for treating myelofibrosis and myelodysplastic syndrome
WO2021144657A1 (en) 2020-01-17 2021-07-22 Novartis Ag Combination comprising a tim-3 inhibitor and a hypomethylating agent for use in treating myelodysplastic syndrome or chronic myelomonocytic leukemia
WO2021260528A1 (en) 2020-06-23 2021-12-30 Novartis Ag Dosing regimen comprising 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives
WO2022029573A1 (en) 2020-08-03 2022-02-10 Novartis Ag Heteroaryl substituted 3-(1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof
WO2022031440A1 (en) 2020-08-03 2022-02-10 Immunitybio, Inc. Drug-specific pharmacokinetic assay for il-15 superagonist
WO2022043558A1 (en) 2020-08-31 2022-03-03 Advanced Accelerator Applications International Sa Method of treating psma-expressing cancers
WO2022043557A1 (en) 2020-08-31 2022-03-03 Advanced Accelerator Applications International Sa Method of treating psma-expressing cancers
KR20230096049A (ko) 2020-10-26 2023-06-29 싸이튠 파마 편평 세포 암종 치료용 IL-2/IL-15Rβγ 작용제
WO2022090203A1 (en) 2020-10-26 2022-05-05 Cytune Pharma IL-2/IL-15Rβү AGONIST FOR TREATING SQUAMOUS CELL CARCINOMA
KR20230096047A (ko) 2020-10-26 2023-06-29 싸이튠 파마 비흑색종 피부암 치료용 IL-2/IL-15Rβγ 작용제
WO2022090202A1 (en) 2020-10-26 2022-05-05 Cytune Pharma IL-2/IL-15RBβү AGONIST FOR TREATING NON-MELANOMA SKIN CANCER
WO2022097060A1 (en) 2020-11-06 2022-05-12 Novartis Ag Cd19 binding molecules and uses thereof
WO2022147444A2 (en) 2020-12-30 2022-07-07 Alaunos Therapeutics, Inc. Recombinant vectors comprising polycistronic expression cassettes and methods of use thereof
WO2022215011A1 (en) 2021-04-07 2022-10-13 Novartis Ag USES OF ANTI-TGFβ ANTIBODIES AND OTHER THERAPEUTIC AGENTS FOR THE TREATMENT OF PROLIFERATIVE DISEASES
WO2022243846A1 (en) 2021-05-18 2022-11-24 Novartis Ag Combination therapies
WO2022268991A1 (en) 2021-06-23 2022-12-29 Cytune Pharma Interleukin 15 variants
WO2023017191A1 (en) 2021-08-13 2023-02-16 Cytune Pharma Il-2/il-15rbetagamma agonist combination with antibody-drug conjugates for treating cancer
WO2023214325A1 (en) 2022-05-05 2023-11-09 Novartis Ag Pyrazolopyrimidine derivatives and uses thereof as tet2 inhibitors
WO2024215987A1 (en) 2023-04-14 2024-10-17 Sotio Biotech Inc. IMMUNE CELLS FOR TREATING CANCER IN COMBINATION WITH IL-15/IL-15Rα CONJUGATES
WO2024215989A1 (en) 2023-04-14 2024-10-17 Sotio Biotech Inc. ENGINEERED IMMUNE CELLS FOR TREATING CANCER IN COMBINATION WITH IL-2/IL-15 RECEPTOR βγ AGONISTS

Also Published As

Publication number Publication date
CA3028038A1 (en) 2008-11-27
JP6152156B2 (ja) 2017-06-21
JP5501222B2 (ja) 2014-05-21
US20230257437A1 (en) 2023-08-17
US12168680B2 (en) 2024-12-17
AU2008253720B2 (en) 2014-01-16
PT2160401E (pt) 2014-10-30
CA2690825A1 (en) 2008-11-27
US20200140513A1 (en) 2020-05-07
US8940289B2 (en) 2015-01-27
CN104109200A (zh) 2014-10-22
AU2008253720A1 (en) 2008-11-27
US20120230946A1 (en) 2012-09-13
US20100278774A1 (en) 2010-11-04
JP5841623B2 (ja) 2016-01-13
EP2160401B1 (en) 2014-09-24
CN101743249B (zh) 2017-08-08
US8163879B2 (en) 2012-04-24
EP2388266A2 (en) 2011-11-23
US20140219955A1 (en) 2014-08-07
US8492118B2 (en) 2013-07-23
US11498950B1 (en) 2022-11-15
DK2388266T3 (da) 2014-05-26
US20250066442A1 (en) 2025-02-27
ES2470772T3 (es) 2014-06-24
JP2014113159A (ja) 2014-06-26
CN108948177B (zh) 2022-04-22
EP2160401A1 (en) 2010-03-10
US11673932B2 (en) 2023-06-13
ES2642008T3 (es) 2017-11-14
PT2388266E (pt) 2014-06-23
JP2010527919A (ja) 2010-08-19
CA2690825C (en) 2019-02-12
EP2388266B1 (en) 2014-04-23
US9593152B2 (en) 2017-03-14
CN108948177A (zh) 2018-12-07
US20220281937A1 (en) 2022-09-08
EP3305805A1 (en) 2018-04-11
US20090324538A1 (en) 2009-12-31
US20150132257A1 (en) 2015-05-14
CN101743249A (zh) 2010-06-16
US11365231B2 (en) 2022-06-21
EP2769984A1 (en) 2014-08-27
DK2160401T3 (da) 2014-10-20
EP2769984B1 (en) 2017-08-30
EP2160401A4 (en) 2011-03-09
JP2016094419A (ja) 2016-05-26
DK2769984T3 (en) 2017-10-16
ES2518393T3 (es) 2014-11-05
CA3028038C (en) 2021-08-10
EP2388266A3 (en) 2012-06-13
US20160367635A1 (en) 2016-12-22
PT2769984T (pt) 2017-10-05
CN104109200B (zh) 2018-03-20
US9464127B2 (en) 2016-10-11
US10450359B2 (en) 2019-10-22

Similar Documents

Publication Publication Date Title
US12168680B2 (en) Fusion molecules and IL-15 variants
AU2013273643C1 (en) Fusion molecules and il-15 variants

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200880024119.5

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08743432

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2010507463

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2690825

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2126/MUMNP/2009

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2008253720

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2008253720

Country of ref document: AU

Date of ref document: 20080509

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2008743432

Country of ref document: EP