WO2008116094A2 - Combined hairpin-antisense compositions and methods for modulating expression - Google Patents
Combined hairpin-antisense compositions and methods for modulating expression Download PDFInfo
- Publication number
- WO2008116094A2 WO2008116094A2 PCT/US2008/057704 US2008057704W WO2008116094A2 WO 2008116094 A2 WO2008116094 A2 WO 2008116094A2 US 2008057704 W US2008057704 W US 2008057704W WO 2008116094 A2 WO2008116094 A2 WO 2008116094A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- target
- sequence
- expression
- nucleotide
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8247—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3519—Fusion with another nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
Definitions
- Antisense suppression refers to the binding of an "antisense" strand of a nucleic acid to a gene or mRNA, thereby preventing expression of the gene or translation of the mRNA.
- an expression cassette is designed to express an RNA molecule complementary to all or part of an mRNA encoding a target. Over-expression of the antisense RNA molecule may result in reduced expression of the native gene.
- the polynucleotide for use in antisense suppression may correspond to all or part of the complement of the sequence encoding the target, all or part of the complement of the 5' and/or 3' untranslated region of the target transcript, and/or all or part of the complement of both the coding sequence and the untranslated regions of a transcript encoding the target, hi addition, the antisense polynucleotide may be fully complementary (i.e., 100% identical to the complement of the target sequence) or partially complementary (i.e., less than 100% identical to the complement of the target sequence) to the target sequence. Antisense suppression may be used to inhibit the expression of multiple proteins in the same cell or organism, as described, for example, in U.S. Pat. No. 5,952,657.
- portions of the antisense nucleotides may be used to disrupt the expression of the target gene.
- sequences of at least 50, 100, 200, 300, 500, or 550 nucleotides may be used.
- Methods for using antisense suppression to inhibit the expression of endogenous genes in plants are described, for example, in Liu et al (2002) Plant Physiol. 129:1732-1753 and U.S. Pat. Nos. 5,759,829 and 5,952,657.
- Efficiency of antisense suppression may be increased by including a poly-dT region in the expression cassette at a position 3' to the antisense sequence and 5' of the polyadenylation signal. See, U.S. Patent Publication No. 20020058815.
- RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al., 1998, Nature, 391, 806; Hamilton et al., 1999, Science, 286, 950-951).
- the corresponding process in plants is commonly referred to as post-transcriptional gene silencing or RNA silencing, and is also referred to as quelling in fungi.
- the process of post-transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire et al., 1999, Trends Genet, 15, 358).
- Such protection from foreign gene expression may have evolved in response to the expression of double-stranded RNAs (dsRNAs) derived from viral infection or from the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA.
- dsRNAs double-stranded RNAs
- the presence of dsRNA in cells triggers the RNAi response through a mechanism that has yet to be fully characterized. This mechanism appears to be different from the interferon response that results from dsRNA- mediated activation of protein kinase PKE. and 2', 5'-oligoadenylate synthetase resulting in non-specific cleavage of mRNA by ribonuclease L.
- dsRNAs short interfering RNAs
- dicer a ribonuclease III enzyme referred to as dicer.
- Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Hamilton et al., supra; Berstein et al., 2001, Nature, 409, 363).
- Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes (Hamilton et al., supra; Elbashir et al., 2001, Genes Dev., 15, 188).
- Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control (Hutvagner et al., 2001, Science, 293, 834).
- the RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex (Elbashir et al, 2001, Genes Dev., 15, 188).
- RISC RNA-induced silencing complex
- RNAi has been studied in a variety of systems. Fire et al., 1998, Nature, 391, 806, were the first to observe RNAi in C. elegans. Bahramian and Zarbl, 1999, Molecular and Cellular Biology, 19, 274-283 and Wianny and Goetz, 1999, Nature Cell Biol, 2, 70, describe RNAi mediated by dsRNA in mammalian systems. Hammond et al., 2000, Nature, 404, 293, describe RNAi in Drosophila cells transfected with dsRNA.
- Methods for using dsRNA interference to inhibit the expression of endogenous plant genes are described in Waterhouse et al. (1998) Proc. Natl. Acad. ScL USA 95:13959-13965, Liu et al. (2002) Plant Physiol. 129:1732-1753, and WO 99/59029, WO 99/53050, WO 99/61631, and WO 00/59035.
- RNAi methods relating to the inhibition of the expression of one or more targets obtained by hairpin RNA (hpRNA) interference or intron-containing hairpin RNA (ihpRNA) interference have been described. These methods are highly efficient at inhibiting the expression of endogenous genes. See, Waterhouse and Helliwell (2003) Nat. Rev. Genet. 5:29-38 and the references cited therein.
- hpRNA interference the expression cassette is designed to express an RNA molecule that hybridizes with itself to form a hairpin structure that comprises a single- stranded loop region and a base-paired stem.
- the base-paired stem region comprises a sense sequence corresponding to all or part of the endogenous messenger RNA encoding the gene whose expression is to be inhibited, and an antisense sequence that is fully or partially complementary to the sense sequence.
- the base-paired stem region of the molecule generally determines the specificity of the RNA interference.
- hpRNA molecules are highly efficient at inhibiting the expression of endogenous genes, and the RNA interference they induce is inherited by subsequent generations. See, for example, Chuang and Meyerowitz (2000) Proc. Natl. Acad. Sd. USA 97:5985- 5990; Stoutjesdijk et al. (2002) Plant Physiol. 129: 1723-1731 ; and Waterhouse and Helliwell (2003) Nat. Rev.
- the interfering molecules have the same general structure as for hpRNA, but the RNA molecule additionally comprises an intron that is capable of being spliced in the cell in which the ihpRNA is expressed.
- the use of an intron minimizes the size of the loop in the hairpin RNA molecule following splicing, which increases the efficiency of interference.
- Smith et al. show 100% suppression of endogenous gene expression using ihpRNA- mediated interference.
- Methods for using ihpRNA interference to inhibit the expression of genes are described, for example, in Smith et al. (2000) Nature 507:319-320; Wesley et al.
- Churikov et al., International PCT Publication No. WO 01/42443 describe certain methods for modifying genetic characteristics of an organism using certain dsRNAs.
- Cogoni et al., International PCT Publication No. WO 01/53475 describe certain methods for isolating a Neurospora- silencing gene and uses thereof.
- Reed et al., International PCT Publication No. WO 01/68836 describe certain methods for gene silencing in plants.
- Honer et al., International PCT Publication No. WO 01/70944 describe certain methods of drug screening using transgenic nematodes as Parkinson's disease models using certain dsRNAs. Deak et al., International PCT Publication No.
- WO 01/72774 describe certain Drosophila-de ⁇ ved gene products that may be related to RNAi in Drosophila.
- Arndt et al., International PCT Publication No. WO 01/92513 describe certain methods for mediating gene suppression by using factors that enhance RNAi.
- Tuschl et al., Intemational PCT Publication No. WO 02/44321 describe certain synthetic siRNA constructs.
- Pachuk et al, International PCT Publication No. WO 00/63364, and Satishchandran et al., International PCT Publication No. WO 01/04313, describe certain methods and compositions for inhibiting the function of certain polynucleotide sequences using certain dsRNAs.
- the first nucleotide sequence that modulates expression of a target modulates the expression of the target through the RNAi pathway. In an additional example embodiment, the first nucleotide sequence that modulates expression of a target modulates the expression of the target via antisense modulation of expression.
- a particular embodiment of the present invention provides a nucleotide construct, comprising: a nucleotide sequence that forms a stem and a loop; and a gene of interest operably linked to a promoter, wherein the stem comprises a second nucleotide sequence that modulates expression of a target; and wherein the loop comprises a first nucleotide sequence that may or may not modulate expression of a target.
- the gene of interest operably linked to a promoter is located in the loop.
- Another embodiment of the present invention provides a vector comprising the sequences encoding the nucleotide sequences, as previously described.
- An alternative embodiment provides a vector comprising a promoter operably linked to a sequence encoding a nucleotide sequence that forms a stem and a loop; wherein the loop comprises a first nucleotide sequence that modulates expression of a target; and wherein the stem comprises a second nucleotide sequence that modulates expression of a target.
- An example embodiment of the present invention provides a method of regulating the expression of a target, the method comprising: providing to a cell a sequence comprising a nucleotide sequence that forms a stem and a loop; wherein the loop comprises a first nucleotide sequence that modulates expression of the target; and wherein the stem comprises a second nucleotide sequence that modulates expression of the target; and culturing said cell.
- An example embodiment of the present invention provides a method of regulating the expression of a target, the method comprising providing to a cell a vector comprising a promoter operably linked to a sequence encoding a nucleotide sequence that forms a stem and a loop; wherein the loop comprises a first nucleotide sequence that modulates expression of the target; and wherein the stem comprises a second nucleotide sequence that modulates expression of the target; and expressing the nucleotide sequence from said vector in said cell.
- Another embodiment of the present invention provides a method of treating a condition in a subject comprising administering to the subject the previously described sequence comprising the nucleotide sequence that forms a stem and a loop.
- a particular embodiment comprises administering to the subject a vector comprising a promoter operably linked to a sequence encoding a nucleotide sequence that forms a stem and a loop.
- An example embodiment of the present invention provides a cell comprising the previously described nucleotide sequence that forms a stem and a loop.
- An alternative embodiment comprises providing a cell comprising a vector that includes a promoter operably linked to a sequence encoding a nucleotide sequence that forms a stem and a loop.
- An example embodiment of the present invention provides a method of making a construct for regulating a target, the method comprising: combining into a single nucleic sequence a first and second sequence capable of base pairing to form a stem-loop structure in the construct; and a third sequence, disposed between the first and second sequences; wherein said first and second sequences, when base paired, are capable of generating an siRNA; wherein said third sequence is of sufficient length to allow the first and second sequences to stably pair with each other; and wherein said third sequence comprises a sequence capable of modulating a target through antisense suppression.
- An example embodiment of the present invention provides a method of making a construct for regulating a target, the method comprising: combining into a single nucleic sequence a first and second sequence capable of base pairing to form a stem-loop structure in the construct; a third sequence, disposed between the first and second sequences; and a fourth sequence comprising a gene of interest operably linked to a promoter; wherein said first and second sequences, when base paired, are capable of generating an siRNA; wherein said third sequence is of sufficient length to allow the first and second sequences to stably pair with each other; and wherein said third sequence may or may not comprise a sequence capable of modulating a target through antisense suppression.
- Another embodiment of the invention provides a method of producing a plant with modified levels of endogenous component fatty acids.
- the method includes modulating the levels of a heterologous gene, such as a fatty acid synthesis or lipid metabolism gene.
- a heterologous gene such as a fatty acid synthesis or lipid metabolism gene.
- the present invention may further be utilized in combination with various gene silencing methodologies using RNAi and antisense technologies that are known in the art to provide increased modulation of gene expression tailored to one or more specific genes and/or genetic pathways.
- FIG. 1 is graphical representation of the constructs pPHAS-Fabl-AS, pPHAS- Fabl-HP, and pPHAS-Fabl-HPAS.
- FIG. 2 is graphical representation of the constructs pPHAS-Fad2-AS, pPHAS- Fad2-HP, pPHAS-Fad2-HPAS, and pPHAS-Fad2-HP-GUS.
- FIG. 3 is graphical representation of the constructs pPHAS-Fad3-AS, pPHAS- Fad3-HP, and pPHAS-Fad3-HPAS.
- FIG. 4 is a diagram showing how the construct pPHAS-Fabl-HPAS maybe processed in a cell to modulate expression of Fab 1.
- FIG. 5 is a schematic diagram of fatty acid production in Arabidopsis.
- FIG. 6 shows gas chromatograph traces indicating the levels of various fatty acids in seeds containing pPHAS-Fabl-HP and pPHAS-Fabl-HPAS as compared to the background strain.
- FIG. 7 is a graphical summary indicating the levels of various fatty acids in seeds containing pPHAS-Fab 1 -HP and pPHAS-Fab 1 -HPAS as compared to the background strain.
- FIG. 9 shows gas chromatograph traces indicating the levels of various fatty acids in seeds containing pPHAS-Fad2-HP and pPHAS-Fad2-HPAS as compared to the Fad2- MT mutant.
- FIG. 10 is a graphical summary indicating the levels of various fatty acids in seeds containing pPHAS-Fad2-AS, ⁇ PHAS-Fad2-HP, and pPHAS-Fad2-HPAS as compared to the Fad2-MT mutant and the background strain.
- FIG. 11 shows gas chromatograph traces indicating the levels of various fatty acids in seeds containing pPHAS-Fad2-HP-GUS as compared to the background strain.
- FIG. 12 shows a photograph containing wild type seeds (lighter seeds) and seeds expressing GUS from pPHAS-Fad2-HP-GUS (darker seeds).
- FIG. 13 shows gas chromatograph traces indicating the levels of various fatty acids in seeds containing pPHAS-Fad3-AS as compared to wild type.
- FIG. 14 shows gas chromatograph traces indicating the levels of various fatty acids in seeds containing pPHAS-Fad3-HP and pPHAS-Fad3-HPAS as compared to the Fad3-MT mutant.
- FIG. 15 is a graphical summary indicating the levels of various fatty acids in seeds containing pPHAS-Fad3-AS, pPHAS-Fad3-HP, and pPHAS-Fad3-HPAS as compared to the Fad3-MT mutant and the background strain.
- RNA inference RNA inference
- the modulating nucleotide sequence (mNS) molecules of the present invention may include a stem-loop structure, wherein the stem provides a substrate for dicer and may act to suppress a target through the RNAi pathway, and wherein the loop portion of the structure may comprise a first sequence that may act to suppress a gene through antisense suppression.
- the mNS molecules of the invention may be, in whole or in part, chemically modified and/or synthetically created. The use of chemically modified mNS may improve various properties of mNS molecules, for example, through increased resistance to nuclease degradation in vivo and/or improved cellular uptake.
- the chemically modified mNS molecules of the instant invention provide useful reagents and methods for a variety of therapeutic, diagnostic, agricultural, target validation, genomic discovery, genetic engineering, and pharmacogenomic applications, hi one particular embodiment, the mNS molecules of the present invention comprise a stem-loop (hairpin) structure, wherein the stem contains a double stranded nucleic acid (dsNA) sequence capable of being cleaved by dicer and releasing at least one small interfering nucleic acid (siNA) that is capable of suppressing an mRNA through the RNAi pathway.
- the loop of the mNS molecule contains at least one antisense nucleic acid (asNA).
- the siNA and the asNA of the hpNAas may target the same location in the same gene and/or mRNA. In a further example embodiment, the siNA and the asNA of the hpNAas may target a different location in the same gene and/or mRNA. The siNA and the asNA of the hpNAas may also target different genes and/or mRNAs.
- the stem portion of the hpNAas may contain more than one sequence capable of generating an siNA. If there is more than one siNA generated from the stem of the hpNAas, these siNAs may target the same site on the same mRNA. The siNAs may target different sites on the same mRNA. The siNAs may also target different mRNAs.
- the loop portion of the hpNAas may contain more than one asNA sequence. If there is more than one asNA in the loop of the hpNAas, these asNAs may target the same site on the same gene and/or mRNA. The asNAs may target different sites on the same gene and/or mRNA. The asNAs may also target different genes and/or mRNAs.
- the stem portion of the hpNAas may contain more then one sequence capable of generating an siNA and the loop portion of the hpNAas may contain more than one asNA sequence.
- These siNAs and asNAs may target the same site on the same mRNA, different sites on the same mRNA, different mRNAs, or any combination thereof.
- a single siNA and/or asNA from an hpNAas of the present invention may target more than one gene, nucleotide sequence, and/or protein. Because many genes may share some degree of sequence homology with each other, siNA and/or asNA molecules may be designed to target a class of genes (and associated receptor or ligand genes) or, alternatively, specific genes by selecting sequences that are either shared amongst different gene targets or alternatively that are unique for a specific gene target, hi one example embodiment, the siNA and/or asNA molecule may be designed to target conserved regions of, for example, an RNA sequence having homology between several genes so as to target several genes or gene families (e.g., different gene isoforms, splice variants, mutant genes etc.) with one siNA and/or asNA molecule, hi another example embodiment, the siNA and/or asNA molecule may be designed to target a sequence that is unique to a specific gene, nucleotide sequence, and/or protein due to the high degree
- the hpNAas molecules may contain one or more splice site(s). These splice sites may be operationally placed and oriented so as to allow the cleavage of the loop portion of the hpNAas from the stem portion of the hpHAas as though it were an intron. hpNAas containing such operationally oriented placed splices sites will hereinafter be referred to as "intron containing hpNAas" or "ihpNAas.”
- mNS may contain a gene of interest operably linked to a promoter.
- the mNS contains a hairpin or a loop
- particular embodiments of the present invention allow for the presence of the promoter and gene of interest within the loop.
- the asNA may be present or absent in the loop containing the promoter and gene of interest.
- the gene of interest may be any gene that a user wishes to express.
- the gene may be the same or related to the target of the mNS.
- the mNS could target a mutated form of a gene of interest while at the same time providing a normal or engineered copy as a replacement.
- the promoter and gene of interest may be placed near or within one or more sequence(s) that will promote integration into a genome. Examples of promoters useful in the present invention include, but are not limited to, viral, retroviral, mammalian, plant, bacterial, constitutive, regulatable, fungal, yeast, algal, and insect promoters.
- Plant promoters useful in the present invention include, for example, those identified in Arabidopsis, sunflower, cotton, rapeseed (including canola), maize, wheat, castor, palm, tobacco, peanut, sorghum, sugarcane, or soybean.
- Suitable promoters useful in the present invention include, for example, seed-specific promoters, inducible promoters, constitutive promoters, including but not limited to, 2S-storage protein, phaseolin, CaMV 35S, napin, cruciferin, ubiquitin, oleosin, cassava vein mosaic virus, prunin, legumin, and octopine synthase.
- RNA molecules can provide a powerful tool in overcoming potential limitations of in vivo stability and bioavailability inherent to native RNA molecules that are delivered exogenously.
- the use of chemically modified mNS or mNS-containing synthetic nucleotides may enable a lower dose of a particular mNS for a given therapeutic effect since these molecules tend to have a longer half-life in serum.
- certain chemical modifications may improve the bioavailability of nucleic acid molecules by targeting particular cells or tissues, and/or improving cellular uptake of the nucleic acid molecule.
- a chemically modified or synthetic nucleic acid molecule may be reduced as compared to a native nucleic acid molecule (e.g., when compared to an all RNA nucleic acid molecule), the overall activity of the modified or synthetic nucleic acid molecule may be greater than the native molecule due to improved stability and/or delivery of the molecule.
- chemically modified siNA may also minimize the possibility of activating interferon activity in humans.
- a mNS may comprise one or more modifications and/or synthetic bases.
- modifications and/or synthetic bases include, but are not limited to, 2'-amino, 2'-O-methyl, 2' - deoxy-2'-fluoro, 2'-deoxy, T- methoxyethyl, 4'-thio, 5-C-methyl, "universal base,” locked nucleic acid (LNA), morpholino, and "acyclic nucleotides” as well as nucleotides containing a 2'-0 or 4'-C methylene bridge, terminal glyceryl and/or inverted deoxy abasic residue incorporation, phosphorothioate internucleotide linkages, and nucleotides having a Northern conformation (e.g., Northern pseudorotation cycle, see for example Saenger, Principles of Nucleic Acid Structure, Springer-Verlag ed., 1984).
- the mNS may further comprise one or more deoxyribonucleotides and/or dideoxyribonucleotides.
- universal base refers to nucleotide base analogs that form base pairs with each of the natural DNA/RNA bases with little discrimination between them.
- Non-limiting examples of universal bases include C-phenyl, C-naphthyl and other aromatic derivatives, inosine, azole carboxamides, and nitroazole derivatives such as 3-nitropyrrole, 4-nitroindole, 5-nitroindole, and 6-nitroindole as known in the art (see for example Loakes, 2001, Nucleic Acids Research, 29, 2437-2447).
- acyclic nucleotide refers to any nucleotide having an acyclic ribose sugar, for example where any of the ribose carbons (Cl, C2, C3, C4, or C5), are independently or in combination absent from the nucleotide.
- Bases in a mNS can be modified by, for example, the addition of substituents at, or modification of one or more positions, for example, on the pyrimidines and purines.
- the addition of substituents may or may not saturate a double bond, for example, of the pyrimidines and purines.
- substituents include, but are not limited to, alkyl groups, nitro groups, halogens, and/or hydrogens.
- the alkyl groups may be of any length, preferably from one to six carbons.
- the alkyl groups may be saturated or unsaturated; and may be straight-chained, branched or cyclic.
- the halogens may be any of the halogens including, but not limited to, bromine, iodine, fluorine, and/or chlorine.
- Further modification of the bases may be accomplished by the interchanging and/or substitution of the atoms in the bases. Non-limiting examples include: interchanging the positions of a nitrogen atom and a carbon atom in the bases, substituting a nitrogen and/or a silicon atom for a carbon atom, substituting an oxygen atom for a sulfur atom, and/or substituting a nitrogen atom for an oxygen atom.
- Other modifications of the bases include, but are not limited to, the fusing of an additional ring to the bases, such as an additional five or six membered ring.
- the fused ring may carry various further groups.
- modified bases include, but are not limited to, 2,6- diaminopurine, 2-aminopurine, pseudoisocytosine, E-base, thiouracil, ribothymidine, dihydrouridine, pseudouridine, 4-thiouridine, 3-methylcytidine, 5-methylcytidine, N 6 - methyladenosine, N ⁇ -isopentenyladenosine, -methylguanosine, queuosine, wyosine, etheno-adenine, etheno-cytosine, 5-methylcytosine, bromothymine, azaadenine, azaguanine, 2 -fiuoro-uridine, and 2'-fluoro-cytidine.
- mNS may comprise modified and/or synthetic nucleotides as a percentage of the total number of nucleotides present in the mNS molecule.
- a mNS molecule of the invention may generally comprise modified and/or synthetic nucleotides from about 5 to about 100% of the nucleotide positions (e.g., 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% of the nucleotide positions).
- the actual percentage of modified nucleotides present in a given mNS molecule depends on the total number of nucleotides present in the mNS.
- mNS of the present invention comprises a molecular backbone attaching the various nucleotides in sequence.
- Example embodiments of mNS may have molecular backbones including, but not limited to, ribose, 2 -O-alkyl ribose, T- O-methyl ribose, 2 -O-allyl ribose, deoxyribose, 2-deoxyribose, morpholino, and/or peptide backbones.
- the backbone may comprise sugar and/or non-sugar units. These units may be joined together by any manner known in the art.
- the nucleotides may be joined by linking groups.
- a non-sugar backbone may comprise any non-sugar molecule to which bases may be attached.
- Non-sugar backbones are known in the art. Examples include, but are not limited to, morpholino and peptide nucleic acids (PNAs).
- PNAs peptide nucleic acids
- a morpholino backbone is made up of morpholino rings (tetrahydro-l,4-oxazine) and may be joined by non-ionic phosphorodiamidate groups. Modified morpholinos known in the art may be used in the present invention.
- PNAs include, but are not limited to, N-(2-aminoethyl)-glycine, cyclohexyl PNA, retro-inverso, phosphone, propinyl, and aminoproline-PNA.
- PNAs may be chemically synthesized by methods known in the art. Examples include, but are not limited to, modified Fmoc and/or tBoc peptide synthesis protocols. hi addition to the above-mentioned uniform antisense oligonucleotides, it is apparent to one of skill in the art that multiple types of backbone may be mixed in a single mNS molecule.
- a mNS may be combined with one or more carriers, adjuvants, and/or diluents to form a medicament or chemical treatment for a living organism.
- carriers, adjuvants, and/or diluents include, but are not limited to, water, saline, Ringer's solution, cholesterol and/or cholesterol derivatives, liposomes, lipofectin, lipofectamine, lipid anchored polyethylene glycol, block copolymer F108, and/or phosphatides, such as dioleooxyphosphatidylethanolamine, phophatidyl choline, phophatidylgylcerol, alpha-tocopherol, and/or cyclosporine.
- the mNS molecules may be mixed with one or more carriers, adjuvants, and/or diluents to form a dispersed composition or medicament which may be used to treat a disease, infection, or condition.
- a dispersed composition or medicament which may be used to treat a disease, infection, or condition.
- a dispersed composition may also be used to disrupt the proper expression of genes, nucleotide sequences and/or proteins involved in disease or infective processes, or in production of animal or plant products.
- the composition may be used to produce a plant with increased levels of a product of a fatty acid synthesis or lipid metabolism gene.
- the target may be, for example, a nucleic acid that may be an endogenous gene, an exogenous gene, a viral nucleic acid, or RNA, such as a mammalian gene, plant gene, viral gene, fungal gene, bacterial gene, plant viral gene, or mammalian viral gene.
- mammalian viruses include, but are not limited to, hepatitis C virus, human immunodeficiency virus, hepatitis B virus, herpes simplex virus, cytomegalovirus, human papilloma virus, respiratory syncytial virus, influenza virus, and severe acute respiratory syndrome virus (SARS).
- a mNS molecule of the invention comprises a sense region and an antisense region, wherein the sense region includes a terminal cap moiety at the 5'-end, the 3'-end, or both of the 5 1 and 3' ends.
- the cap moiety may be an inverted deoxy abasic moiety, an inverted deoxy thymidine moiety, or a thymidine moiety.
- One particular embodiment of the invention provides a vector comprising a nucleic acid sequence encoding at least one mNS molecule of the invention in a manner that allows expression of the nucleic acid molecule.
- the conjugate molecule attached to the chemically-modified siNA molecule is a poly ethylene glycol, human serum albumin, or a ligand for a cellular receptor that may mediate cellular uptake.
- Examples of specific conjugate molecules contemplated by the instant invention that can be attached to chemically-modified siNA molecules are described in Vargeese et al., U.S. Ser. No. 10/201,394.
- the type of conjugates used and the extent of conjugation of siNA molecules of the invention may be evaluated for improved pharmacokinetic profiles, bioavailability, and/or stability of siNA constructs, while at the same time maintaining the ability of the siNA to mediate RNAi activity.
- the method includes synthesizing a mNS molecule of the invention, which may be chemically-modified, wherein the mNS molecule comprises a sequence complementary to RNA of the gene and wherein the mNS molecule comprises a sequence substantially similar to the sequence of the target RNA.
- the mNS molecule can then be introduced into a cell under conditions suitable to modulate the expression of the genes in the cell.
- mNS molecules of the invention are used as reagents in ex vivo applications.
- mNS molecules can be introduced into tissue or cells that are transplanted into an organism or subject for therapeutic effect. The cells and/or tissue may be derived from an organism or subject that later receives the explant.
- the cells and/or tissue may be derived from another organism or subject prior to transplantation.
- the mNS molecules may be used to modulate the expression of one or more genes in the cells or tissue, such that the cells or tissue obtain a desired phenotype and are able to perform a function when transplanted in vivo.
- certain target cells from an organism or subject are extracted. These extracted cells are contacted with mNS molecules targeting a specific nucleotide sequence within the cells under conditions suitable for uptake of the mNS molecules by these cells (e.g. using delivery reagents such as cationic lipids, liposomes and the like, or using techniques such as electroporation to facilitate the delivery of mNS molecules into cells).
- the invention features a method of modulating the expression of more than one gene in an organism.
- the method includes synthesizing a mNS molecule of the invention, wherein the mNS molecule comprises a sequence complementary to RNA of the genes.
- the mNS molecule can then be introduced into the organism under conditions suitable to modulate the expression of the genes in the organism.
- the invention features a method for modulating the expression of a gene within a cell by synthesizing a mNS molecule of the invention, wherein the mNS molecule comprises a sequence having complementarity to RNA of the gene.
- the mNS molecule can then be introduced into a cell under conditions suitable to modulate the expression of the gene in the cell.
- the invention features a method for modulating the expression of more than one gene within a cell, which includes synthesizing mNS molecules of the invention, wherein the mNS molecule comprises a sequence having complementarity to RNA of the genes.
- the mNS molecule can then be contacted with a cell in vitro or in vivo under conditions suitable to modulate the expression of the genes in the cell,
- the invention includes a method of modulating the expression of a gene in an organism.
- a mNS molecule having complementarity to RNA of the gene can be synthesized and the mNS molecule can be introduced into the organism under conditions suitable to modulate the expression of the gene in the organism.
- Another embodiment features a method of modulating the expression of more than one gene in an organism by synthesizing mNS molecules that include a sequence having complementarity to RNA of the genes and introducing the mNS molecules into the organism under conditions suitable to modulate the expression of the genes in the organism.
- Another embodiment includes a method of modulating the expression of a gene in an organism by contacting the organism with the mNS molecule of the invention under conditions suitable to modulate the expression of the gene in the organism.
- Yet another alternative embodiment features a method of modulating the expression of more than one gene in an organism by contacting the organism with one or more mNS molecules of the invention under conditions suitable to modulate the expression of the genes in the organism.
- the mNS molecules of the invention may be designed to inhibit target gene expression through RNAi targeting of a variety of RNA molecules.
- the mNS molecules of the invention can be used to target various RNAs corresponding to a target gene.
- Non-limiting examples of such RNAs include messenger RNA (niRNA), alternate RNA splice variants of target gene(s), post-transcriptionally modified RNA of target gene(s), pre-mRNA of target gene(s), and/or RNA templates. If alternate splicing produces a family of transcripts that are distinguished by usage of appropriate exons, the instant invention may be used to inhibit gene expression through the appropriate exons to specifically inhibit or to distinguish among the functions of gene family members.
- a protein that contains an alternatively spliced transmembrane domain may be expressed in both membrane-bound and secreted forms.
- Use of the invention to target the exon containing the transmembrane domain may be used to determine the functional consequences of pharmaceutical targeting of membrane bound, as opposed to the secreted form of the protein.
- Non-limiting examples of applications of the invention relating to targeting these RNA molecules include therapeutic pharmaceutical applications, molecular and pharmaceutical discovery applications, modification of animal and plant products/molecules, molecular diagnostic and gene function applications, and gene mapping, for example, using single nucleotide polymorphism mapping with siNA molecules of the invention.
- Such applications may be implemented using known gene sequences or from partial sequences available from an expressed sequence tag (EST).
- the modification involves a fatty acid synthesis gene or a lipid metabolism gene in a plant.
- the mNS molecules of the invention can be used to target conserved sequences corresponding to a gene family or gene families.
- mNS molecules targeting multiple gene targets may provide increased biological effect or a modified effect (such as in the production of fatty acid synthesis in a plant or a seed).
- mNS molecules may be used to characterize pathways of gene function in a variety of applications.
- the present invention may be used to inhibit the activity of target gene(s) in a pathway to determine the function of uncharacterized gene(s) in gene function analysis, mRNA function analysis, or translational analysis.
- the invention may be used to determine potential target gene pathways involved in various diseases and conditions toward product, molecule, or pharmaceutical development.
- the invention maybe used to understand pathways of gene expression involved in, for example, development, such as prenatal development and postnatal development, and/or the progression and/or maintenance of cancer, infectious disease, autoimmunity, inflammation, endocrine disorders, renal disease, pulmonary disease, cardiovascular disease, birth defects, ageing, any other disease or condition related to gene expression.
- the invention may be used to modify expression of genes in plants or animals, or may be used to modify synthesis of animal or plant products, such as, for example, modification of fatty acid synthesis in plants and plant seeds.
- the invention features a method for validating a target gene.
- the method includes synthesizing a mNS molecule of the invention, which may be chemically modified and further include a sequence complementary to RNA of a target gene.
- the mNS molecule can then be introduced into a biological system under conditions suitable for modulating expression of the target gene in the biological system.
- the function of the gene can then be determined by assaying for any phenotypic change in the biological system.
- biological system is meant material, in a purified or unpurified form, from biological sources, including but not limited to human, animal, plant, insect, bacterial, viral or other sources, wherein the system comprises the components required for RNAi activity.
- biological system includes, for example, a cell, tissue, or organism, or extract thereof.
- biological system also includes reconstituted RNAi systems that may be used in an in vitro setting.
- phenotypic change is meant any detectable change to a cell that occurs in response to contact or treatment with a nucleic acid molecule of the invention (e.g., mNS).
- detectable changes include, but are not limited to, changes in shape, size, proliferation, motility, protein expression or RNA expression or other physical or chemical changes as may be assayed by methods known in the art.
- the detectable change may also include expression of reporter genes/molecules such as Green Florescent Protein (GFP) or various tags that are used to identify an expressed protein or any other cellular component that may be assayed.
- GFP Green Florescent Protein
- the invention features a kit containing a mNS molecule of the invention, which may be used to modulate the expression of a target in a cell, tissue, or organism.
- the invention features a kit containing more than one mNS molecule of the invention, which may be chemically-modified, that may be used to modulate the expression of more than one target gene in a cell, tissue, or organism.
- the invention features a kit containing a vector encoding a mNS molecule of the invention that may be used to modulate the expression of a gene in a biological system.
- the invention features a kit containing a vector encoding more than one mNS molecule of the invention that may be used to modulate the expression of more than one target gene in a biological system.
- Another embodiment of the invention features a cell containing one or more mNS molecules of the invention, hi one particular embodiment, there is provided a cell containing a vector encoding one or more mNS molecules of the invention.
- the cell containing a mNS molecule of the invention can be a mammalian cell or a plant cell.
- cells containing a mNS molecule can be from Arabidopsis, sunflower, cotton, rapeseed (including canola), maize, wheat, castor, palm, tobacco, peanut, sorghum, sugarcane, or soybean.
- the invention also includes mNS molecules that mediate RNAi in a cell or reconstituted system, wherein the mNS molecule comprises one or more chemical modifications described herein that modulate the polymerase activity of a cellular polymerase capable of generating additional endogenous siRNA molecules having sequence homology to the chemically-modified mNS molecule.
- the invention also includes a mNS molecule that mediates RNAi in a cell or reconstituted system, wherein the mNS molecule comprises one or more chemical modifications described herein that modulates the cellular uptake of the mNS molecule.
- the invention features mNS molecule that mediate expression of a target, wherein the mNS molecule comprises one or more chemical modifications described herein that increases the bioavailability of the mNS molecule, for example, by attaching polymeric conjugates such as polyethyleneglycol or equivalent conjugates that improve the pharmacokinetics of the mNS molecule, or by attaching conjugates that target specific tissue types or cell types in vivo.
- polymeric conjugates such as polyethyleneglycol or equivalent conjugates that improve the pharmacokinetics of the mNS molecule
- conjugates that target specific tissue types or cell types in vivo are described in Vargeese et al, U.S. Ser. No. 10/201,394.
- the invention features a method for generating mNS molecule of the invention with improved bioavailability, comprising (a) introducing a conjugate into the structure of a mNS molecule, and (b) assaying the mNS molecule of step (a) under conditions suitable for isolating mNS molecule having improved bioavailability.
- Such conjugates may include ligands for cellular receptors, such as peptides derived from naturally occurring protein ligands; protein localization sequences, including cellular ZIP code sequences; antibodies; nucleic acid aptamers; vitamins and other co-factors, such as folate and N-acetylgalactosamine; polymers, such as polyethyleneglycol (PEG); phospholipids; cholesterol; polyamines, such as spermine or spermidine; and others, hi another embodiment, polyethylene glycol (PEG) may be covalently attached to mNS molecule of the present invention.
- the attached PEG may be any molecular weight, preferably from about 2,000 to about 50,000 daltons (Da).
- kits having at least one of the reagents necessary to carry out the in vitro or in vivo introduction of RNA to test samples and/or subjects.
- suitable components of the kit can include a mNS molecule of the invention and a vehicle that promotes introduction of the mNS molecule into cells of interest as described herein (e.g., using lipids and other methods of transfection known in the art, see for example Beigelman et al, U.S. Pat. No. 6,395,713).
- the kit may be used for target validation, such as in determining gene function and/or activity, or in drug optimization, and in drug discovery (see for example Usman et al., U.S. Ser. No. 60/402,996).
- Such a kit may also include instructions to allow a user of the kit to practice the invention.
- RNA short interfering nucleic acid molecule
- short interfering oligonucleotide molecule or “chemically-modified short interfering nucleic acid molecule” as used herein refers to any nucleic acid molecule capable of inhibiting or down regulating gene expression or viral replication, for example by mediating RNA interference "RNAi” or gene silencing in a sequence-specific manner; see for example Bass, 2001 , Nature, 411, 428-429; Elbashir et al., 2001, Nature, 411, 494-498; and Kreutzer et al., International PCT Publication No. WO 00/44895; Zernicka-Goetz et al., International PCT Publication No.
- the siNA may be a double-stranded polynucleotide molecule comprising complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
- the siNA may be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, and wherein the antisense and sense strands are complementary (i.e. each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure, for example wherein the double stranded region is about 19 base pairs).
- the antisense strand comprises a nucleotide sequence that is complementary to the nucleotide sequence in a target nucleic acid molecule or a portion thereof, and the sense strand comprises a nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
- the siNA can be assembled from a single oligonucleotide, where the complementary sense and antisense regions of the siNA are linked by means of a nucleic acid based on non- nucleic acid-based linker(s).
- the siNA may be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof, and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
- the circular polynucleotide may be processed either in vivo or in vitro to generate an active siNA molecule capable of mediating RNAi.
- the siNA may also comprise a single stranded polynucleotide having nucleotide sequence complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof (e.g., where such siNA molecule does not require the presence within the siNA molecule of nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof).
- the single stranded polynucleotide may further comprise a terminal phosphate group, such as a 5'-phosphate (see, e.g., Martinez et al, 2002, Cell., 110, 563-574 and Schwarz et al, 2002, Molecular Cell, 10, 537-568), or 5',3'-diphosphate.
- the siNA molecule of the invention can include separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non-nucleotide linker molecules as are known in the art.
- the sense and antisense regions can be non-covalently linked by ionic interactions, hydrogen bonding, van der Waals interactions, hydrophobic interactions, and/or stacking interactions.
- the siNA molecules of the invention comprise a nucleotide sequence that is complementary to the nucleotide sequence of a target gene.
- the siNA molecule of the invention can interact with the nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene.
- the siNA molecules of the present invention need not be limited to those molecules containing only RNA, but may further encompass chemically-modified nucleotides and non- nucleotides.
- the short interfering nucleic acid molecules of the invention lack 2'-hydroxy (2'-OH) containing nucleotides.
- Particular embodiments include short interfering nucleic acids that do not require the presence of nucleotides having a 2'-hydroxy group for mediating RNAi and, as such, short interfering nucleic acid molecules of the invention optionally do not include any ribonucleotides (i.e., nucleotides having a 2'-OH group).
- siNA molecules that do not require the presence of ribonucleotides within the siNA molecule to support RNAi may, however, have one or more attached linker(s) or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2'-OH groups.
- siNA molecules may comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions.
- modified short interfering nucleic acid molecules of the invention may also be referred to as short interfering modified oligonucleotides "siMON.”
- siNA is equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, such as, for example, short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically-modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA).
- siRNA short interfering RNA
- dsRNA double-stranded RNA
- miRNA micro-RNA
- shRNA short hairpin RNA
- ptgsRNA post-transcriptional gene silencing RNA
- RNAi is equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.
- siNA molecules of the invention maybe used to epigenetically silence genes at both the post- transcriptional level and the pre-transcriptional level.
- epigenetic regulation of gene expression by siNA molecules of the invention may result from siNA mediated modification of chromatin structure to alter gene expression (see, for example, Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833- 1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232- 2237).
- asymmetric hairpin means a linear siNA molecule comprising an antisense region, a loop portion that may comprise nucleotides or non-nucleotides, and a sense region that comprises fewer nucleotides than the antisense region (to the extent that the sense region has enough complementary nucleotides to base pair with the antisense region and form a duplex with loop).
- an asymmetric hairpin siNA molecule of the invention may comprise an antisense region having a length sufficient to mediate RNAi in a cell or in vitro system ⁇ e.g.
- the asymmetric hairpin siNA molecule may also comprise a 5'- terminal phosphate group that may be chemically modified.
- the loop portion of the asymmetric hairpin siNA molecule may comprise nucleotides, non-nucleotides, linker molecules, or conjugate molecules as described herein.
- modulate means that the expression of the gene, or level of RNA molecule or equivalent RNA molecules encoding one or more proteins or protein subunits, or activity or level of one or more proteins or protein subunits, is up regulated or down regulated, such that expression, level, or activity is greater than or less than that observed in the absence of the modulator.
- modulate may mean “inhibit,” but is not limited to this definition.
- inhibitor means that the expression of the gene, or level of RNA molecules or equivalent RNA molecules encoding one or more proteins or protein subunits, or activity of one or more proteins or protein subunits, is reduced below that observed in the absence of the mNS molecules of the invention.
- inhibition, down-regulation, or reduction with a mNS molecule results in a level that is below the level observed in the presence of an inactive or attenuated molecule.
- inhibition, down-regulation, or reduction with mNS molecules results in a level that is below the level observed in the presence of, for example, a mNS molecule with scrambled sequence or with mismatches.
- inhibition, down-regulation, or reduction of gene expression with a nucleic acid molecule of the instant invention is greater in the presence of the nucleic acid molecule than in its absence.
- RNA nucleic acid that encodes an RNA
- the target gene may be a gene derived from a cell, an endogenous gene, a transgene, or exogenous genes, such as genes of a pathogen (e.g., a virus), which is present in the cell after infection.
- the cell containing the target gene may be derived from or contained in any organism, such as a plant, animal, protozoan, virus, bacterium, or fungus.
- Non-limiting examples of plants include monocots, dicots, or gymnosperms, and more specifically, Arabidopsis, sunflower, cotton, rapeseed, maize, palm, tobacco, peanut or soybean.
- Non-limiting examples of animals include vertebrates or invertebrates.
- Non-limiting examples of fungi include molds or yeasts.
- Highly conserved sequence region means a nucleotide sequence of one or more regions in a target gene that does not vary significantly from one generation to the other or from one biological system to the other.
- Sense region means a nucleotide sequence of a siNA molecule having complementarity to an antisense region of the siNA molecule.
- the sense region of a siNA molecule may comprise a nucleic acid sequence having homology (i.e., sequence identity or partial identity) with a target nucleic acid sequence.
- Antisense region means a nucleotide sequence of a siNA molecule having complementarity to a target nucleic acid sequence.
- the antisense region of a siNA molecule may optionally comprise a nucleic acid sequence having complementarity to a sense region of the siNA molecule.
- Target nucleic acid means any nucleic acid sequence whose expression or activity is to be modulated.
- the target nucleic acid may be DNA or RNA, such as endogenous DNA or RNA, viral DNA or viral RNA, or other RNA encoded by a gene of a virus, bacteria, fungus, animal, or plant.
- “treating” or “treatment” does not require a complete alteration of a phenotype. It means that the symptoms of the underlying condition are at least reduced, and/or that one or more of the underlying cellular, physiological, or biochemical causes or mechanisms causing the symptoms are reduced and/or eliminated. It is understood that reduced, as used in this context, means relative to the state of the condition, including the molecular state of the condition, not just the physiological state of the condition.
- condition any state in a subject or organism that one might wish to alter. Such a state should be attributable to the expression or lack of expression of a gene, nucleotide sequence and/or protein.
- conditions include, but are not limited to, diseases, genetic abnormalities, infections, cancers, mutations, and cosmetic conditions including, but not limited to, alopecia, obesity, and skin wrinkling.
- a further non-limiting example of a condition is the normal state in a subject.
- the normal fatty acid production in a plant e.g., Arabidopsis, sunflower, cotton, rapeseed, maize, palm, tobacco, peanut or soybean
- the term condition includes any state which might be altered for scientific, agricultural, medical, and/or personal reasons.
- nucleic acid may form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick, Hoogstein base- pairing, and/or reverse Hoogstein base-pairing or other non-traditional types, hi reference to the nucleic molecules of the present invention, the binding free energy for a nucleic acid molecule with its complementary sequence is sufficient to allow the relevant function of the nucleic acid to proceed (e.g., RNAi activity).
- RNAi activity e.g., RNAi activity
- Determination of binding free energies for nucleic acid molecules is well known in the art (see, e.g., Turner et al., 1987, CSH Symp. Quant. Biol. LII pp. 123-133; Frier et al., 1986, Proc. Nat. Acad. ScL USA 83:9373-9377; Turner et al., 1987, J. Am. Chem. Soc. 109:3783-3785).
- a percent complementarity indicates the percentage of contiguous residues in a nucleic acid molecule that may form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementarity).
- Perfect complementarity means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
- the siNA molecules of the invention represent a novel therapeutic approach to a broad spectrum of diseases and conditions, including cancer or cancerous disease, infectious disease, cardiovascular disease, neurological disease, prion disease, inflammatory disease, autoimmune disease, pulmonary disease, renal disease, liver disease, mitochondrial disease, endocrine disease, reproduction related diseases and conditions, animal or plant product synthesis, and any other indications that may respond to the level of an expressed gene product in a cell or organsim.
- diseases and conditions including cancer or cancerous disease, infectious disease, cardiovascular disease, neurological disease, prion disease, inflammatory disease, autoimmune disease, pulmonary disease, renal disease, liver disease, mitochondrial disease, endocrine disease, reproduction related diseases and conditions, animal or plant product synthesis, and any other indications that may respond to the level of an expressed gene product in a cell or organsim.
- cell is used in its usual biological sense and does not refer to an entire multicellular organism.
- the cell may be present in an organism (e.g., plants and animals, including mammals).
- the cell may be prokaryotic (e.g., bacterial cell) or eukaryotic (e.g., mammalian or plant cell).
- the cell may be of somatic or germ line origin, totipotent or pluripotent, dividing or non-dividing.
- the cell may also be derived from or may comprise a gamete or embryo, a stem cell, or a fully differentiated cell, such as, for example, from an animal, bacteria, plant, or seed.
- the mNS molecules of the invention can be added directly or may be complexed with cationic lipids, packaged within liposomes, or otherwise delivered to target cells or tissues.
- the nucleic acid or nucleic acid complexes may be locally administered to relevant tissues ex vivo, or in vivo through, for example, injection, gene gun delivery, infusion pump or stent, with or without their incorporation in biopolymers.
- the invention provides cells containing one or more mNS molecules of this invention.
- the one or more mNS molecules may independently be targeted to the same or different sites.
- RNA means a molecule comprising at least one ribonucleotide residue.
- ribonucleotide is meant a nucleotide with a hydroxyl group at the 2' position of a / 3-D-ribo-furanose moiety.
- the terms include double-stranded RNA, single-stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides.
- Such alterations may include addition of non-nucleotide material, such as to the end(s) of the siNA or internally (e.g. , at one or more nucleotides of the RNA).
- Nucleotides in the RNA molecules of the instant invention may also comprise non- standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs may be referred to as analogs or as analogs of naturally-occurring RNA.
- subject is meant an organism, which is a donor or recipient of explanted cells or the cells themselves. “Subject” also refers to an organism to which the nucleic acid molecules of the invention may be administered.
- a subject may be a plant, plant cells, a mammal, or mammalian cells, including human cells.
- Another embodiment of the invention provides a method of producing a plant with modified levels of endogenous component fatty acids.
- the method includes modulating the levels of a heterologous gene, such as a fatty acid synthesis or lipid metabolism gene.
- Fatty acid production in plants and seeds can be modified.
- Representative plants that can be modified through the present invention include, for example, Arabidopsis, sunflower, cotton, rapeseed (including canola), maize, wheat, castor, palm, tobacco, peanut, sorghum, sugarcane, and soybean.
- the mNS of the instant invention may be used to treat diseases or conditions discussed herein (e.g., cancers and other proliferative conditions, viral infection, inflammatory disease, autoimmunity, pulmonary disease, renal disease, ocular disease, etc.).
- diseases or conditions discussed herein e.g., cancers and other proliferative conditions, viral infection, inflammatory disease, autoimmunity, pulmonary disease, renal disease, ocular disease, etc.
- the mNS molecules may be administered to a subject or may be administered to other appropriate cells evident to those skilled in the art, individually or in combination with one or more drugs under conditions suitable for the treatment.
- the mNS molecules may be used in combination with other known treatments to treat conditions or diseases discussed above.
- the described molecules could be used in combination with one or more known therapeutic agents to treat a disease or condition.
- Non-limiting examples of other therapeutic agents that may be readily combined with a mNS molecule of the invention are enzymatic nucleic acid molecules, allosteric nucleic acid molecules, antisense, decoy, or aptamer nucleic acid molecules, antibodies (such as monoclonal antibodies), small molecules, and other organic and/or inorganic compounds including metals, salts and ions.
- Computer modeling techniques for use in predicting/evaluating derivatives of the present invention include, but are not limited to: MFoId version 3.1 available from Genetics Corporation Group, Madison, WI (see Zucker et al, Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide. In RNA Biochemistry and Biotechnology, 11-43, J. Barciszewski & B.F.C. Clark, eds., NATO ASI Series, Kluwer Academic Publishers, Dordrecht, NL, (1999); Zucker et al, Expanded Sequence Dependence of Thermodynamic Parameters Improves Prediction of RNA Secondary Structure. J. MoI. Biol.
- Plasmid construction pPHAS-Fabl-HP Hairpin RNAi was employed to decrease levels of KASIJ (also known as, and frequently referred to as, "Fabl" herein).
- the sense, antisense and intron fragments were assembled in the plasmid vector pGEM-T-Easy (Promega) before cloning into binary vector pDsRed-PHAS as Pacl-Xhol fragment.
- the first intron of FAD2 was then amplified using oligonucleotides
- HTMl to create pGEM-T-Easy-HTM2.
- the original 178 bp 5'UTR fragment was amplified using primers CTGCAGAAACCCGGGCATCGAAGCTCTCTGCACGC (SEQ ID NO:5) and
- GAGCTCCTCGAGGGCTTTGAGAAGAACCCAG SEQ ID NO:6
- Fabl hairpin sequence was excised from pGEM-T-Easy-HTM3 and inserted into pDs- red-PHAS as a PacFXhoI fragment to produce pPHAS-F ABl-HP (FIG. 1).
- pPHAS-Fabl-HPAS 107bp first exon of Fabl gene was amplified from DNA genomic using primers KasII-5'exon-BglII
- pPHAS-Fabl-AS The 178 5'UTR of FABl gene above was amplified using primers KasII-5UTR-NheI/XhoI
- pPHAS-Fad2-HP The 118bp of 5'UTR sense and antisense of Fad2 uncoded sequences was amplified from genomic DNA and replaced with 5'UTR sense and antisense of KasII in pPHAS-Fabl-HP, as represented in FIG. 2.
- pPHAS-Fad2-HPAS 1152 bp of Fad2 gene was amplified with primers FAD2-
- pPHAS-Fad2-AS The Fad2 gene was amplified with primers FAD2-5'XhoI (CCCTCGAGATGGGTGCAGGTGGAAGAAT (SEQ ID NO: 13)) and FAD2-3'PacI (CCTTAATTAATCATAACTTATTGTTGTACCA (SEQ ID NO: 14)), then replaced with Fad2-F£P cassette in pPHAS -Fad2-HP at Pacl-Xhol as antisense direction as represented in FIG. 3.
- pPHAS-Fad3-HP 138bp of 3'UTR sense and antisense of Fad3 gene were amplified from genomic DNA.
- pPHAS-Fad3-HPAS 301bp first exon of Fad3 gene was amplified with primers
- Fad3-anti-3'SpeI GGGACT AGTGTTGTTGCTATGGACCAACGC (SEQ ID NO: 16)
- Fad3-anti-3'SpeI GGGACT AGTGTTGTTGCTATGGACCAACGC (SEQ ID NO: 16)
- pPHAS-Fad3-AS The 301bp first exon of Fad3 gene was amplified from DNA genomic using primers Fad3-anti-5'PacI
- Arabidopsis was cultivated under ⁇ 250uE of light with a photoperiod of 16/8 h (light/dark) at 2OC.
- the vectors were introduced into Agrobacterium tumefaciens strain GV3101 pMP90 by electroporation and used to transform Arabidopsis thaliana plants by the floral dip method (Bechtold, N., Ellis, J., and Pelletier, G. (1993) C. R. Acad. Sci. Paris 316, 1194-1198). Transformation was performed ⁇ 5 days after initial flowering.
- mNAs containing hairpin RNAi and antisense sequences may be more potent in gene silencing through a model such as that depicted in FIG 4.
- a DNA fragment containing an antisense portion of the gene would be created, thus providing an additional potential method of reduction of gene expression in addition to the RNAi, dicer substrate that is generated.
- Example 5 Modulation of FABl Expression
- FABl elongates 16 C atom (C 16) to 18 C atom (C 18) fatty acids in the plastid.
- levels of 16:0 plus 16:1 fatty acids were compared with the levels of its product 18:0 and 18:1 plus metabolites 18:2 and 18:3.
- Wild type Arabidopsis was compared to the fab lfael mutant line and with the fab 1 fael mutant line transformed with either the FABl hairpin (Fab 1-HP) or with the FABl including the combined hairpin and antisense (fab 1 -HPAS). The results are presented in FIG. 6 and graphically summarized in FIG. 7.
- the fab 1 fael line showed a significant increase in Cl 8 fatty acids due to the fael mutation which blocks further elongation to the 2OC level.
- Introduction of the fab 1 -HP into the fab 1 fael mutant background decreased the Cl 8 fatty acids from 74.2% to 53.4%, whereas introduction of the fabl-HPAS construct resulted in a decrease to 41.6% 18C fatty acids.
- FAD2 levels of 18:1 fatty acids (the substrate for FAD2) were compared with the levels of its product 18:2 and the metabolite 18:3. For analysis, 18:2 was summed with 18:3 to estimate the total fatty acid proportion that had been desaturated by FAD2. Wild type Arabidopsis was compared to FAD2-antisense (Fad2-AS), FAD2 hairpin RNAi (Fad2-HP), and FAD2 was compared with the combined hairpin and antisense
- WT levels of 18:2+18:3 were 43%, which declined to 18.9% in the Fad2-AS, and to 9.4% in the Fad2-HP line. Both changes were significant at the PO.01 level.
- the decline from 9.4% in the Fad2-HP line to 7.2% in the Fad2-HPAS line was significant at the P ⁇ 0.05 level.
- the 7.2% in the Fad2-HPAS line was not significantly different from that of the fad2-MT at 7.5%.
- FAD2 levels of 18:1 fatty acids (the substrate for FAD2) were compared with the levels of its product 18:2 and the metabolite 18:3. For analysis, 18:2 was summed with 18:3 to get the total fatty acid proportion that had been desaturated by FAD2. Wild type Arabidopsis was compared to FAD2 hairpin RNAi containing the GUS gene in the intron (Fad2-HP-GUS). The results are presented in FIGs. 11 and 12.
- WT levels of 18:2+18:3 were 49%, which declined to 12.3% in the Fad2-HP- GUS.
- the change was significant at the PO.01 level.
- blue staining for GUS was apparent in transformed seeds, indicating expression of GUS in those seeds.
- WT levels of 18:3 were 17.0%, declined to 10.7% in the Fad3-AS, 4.5% in the Fad3-HP line and 3.0% in the Fad3-HPAS line. All of the treatments were significantly different from all other treatments at the PO.01 level.
- the Fad3-HPAS line at 3.0% was not significantly different from the strongest mutant Fad3 allele, Fad3-3, at 2.8%.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Nutrition Science (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP20080732595 EP2129680B1 (en) | 2007-03-21 | 2008-03-20 | Combined hairpin-antisense compositions and methods for modulating expression |
| ES08732595.7T ES2538217T3 (es) | 2007-03-21 | 2008-03-20 | Composiciones combinadas antisentido de horquilla y métodos para modular la expresión |
| JP2009554750A JP5759673B2 (ja) | 2007-03-21 | 2008-03-20 | 組み合わされたヘアピン−アンチセンス組成物および発現を調節するための方法 |
| AU2008228814A AU2008228814B2 (en) | 2007-03-21 | 2008-03-20 | Combined hairpin-antisense compositions and methods for modulating expression |
| CA002681323A CA2681323A1 (en) | 2007-03-21 | 2008-03-20 | Combined hairpin-antisense compositions and methods for modulating expression |
| DK08732595.7T DK2129680T3 (en) | 2007-03-21 | 2008-03-20 | COMBINED hairpin ANTISENSE COMPOSITIONS AND METHODS FOR MODULATING EXPRESSION OF |
| PL08732595T PL2129680T3 (pl) | 2007-03-21 | 2008-03-20 | Łączone kompozycje cząsteczek antysensownych o strukturze spinki do włosów oraz sposoby modulacji ekspresji |
| BRPI0809130A BRPI0809130A8 (pt) | 2007-03-21 | 2008-03-20 | Composições combinadas hairpin-antissenso e métodos para modulação da expressão |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US89621207P | 2007-03-21 | 2007-03-21 | |
| US60/896,212 | 2007-03-21 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2008116094A2 true WO2008116094A2 (en) | 2008-09-25 |
| WO2008116094A3 WO2008116094A3 (en) | 2008-11-20 |
Family
ID=39766774
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2008/057704 Ceased WO2008116094A2 (en) | 2007-03-21 | 2008-03-20 | Combined hairpin-antisense compositions and methods for modulating expression |
Country Status (13)
| Country | Link |
|---|---|
| US (2) | US8796442B2 (https=) |
| EP (1) | EP2129680B1 (https=) |
| JP (1) | JP5759673B2 (https=) |
| AR (3) | AR066194A1 (https=) |
| AU (1) | AU2008228814B2 (https=) |
| BR (1) | BRPI0809130A8 (https=) |
| CA (1) | CA2681323A1 (https=) |
| DK (1) | DK2129680T3 (https=) |
| ES (1) | ES2538217T3 (https=) |
| HU (1) | HUE027018T2 (https=) |
| PL (1) | PL2129680T3 (https=) |
| PT (1) | PT2129680E (https=) |
| WO (1) | WO2008116094A2 (https=) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012017919A1 (ja) * | 2010-08-03 | 2012-02-09 | 株式会社ボナック | 含窒素脂環式骨格を有する一本鎖核酸分子 |
| WO2012074038A1 (ja) * | 2010-12-02 | 2012-06-07 | 第一三共株式会社 | 修飾1本鎖ポリヌクレオチド |
| US8785121B2 (en) | 2010-07-08 | 2014-07-22 | Bonac Corporation | Single-stranded nucleic acid molecule for controlling gene expression |
| US10238752B2 (en) | 2012-05-26 | 2019-03-26 | Bonac Corporation | Single-stranded nucleic acid molecule for regulating expression of gene having delivering function |
| US10612020B2 (en) | 2013-12-26 | 2020-04-07 | Tokyo Medical University | Artificial mimic miRNA for controlling gene expression, and use of same |
| US10934542B2 (en) | 2013-12-27 | 2021-03-02 | Bonac Corporation | Artificial match-type miRNA for controlling gene expression and use therefor |
| US11027023B2 (en) | 2014-12-27 | 2021-06-08 | Bonac Corporation | Natural type miRNA for controlling gene expression, and use of same |
| US11142769B2 (en) | 2015-03-27 | 2021-10-12 | Bonac Corporation | Single-stranded nucleic acid molecule having delivery function and gene expression regulating ability |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2129680B1 (en) | 2007-03-21 | 2015-05-06 | Brookhaven Science Associates, LLC | Combined hairpin-antisense compositions and methods for modulating expression |
| US10316352B2 (en) | 2008-05-13 | 2019-06-11 | Gen-Probe Incorporated | Methods of capturing a target nucleic acid for amplification and detection using an inactivatable target capture oligomer |
| US20130136727A1 (en) * | 2009-11-19 | 2013-05-30 | President And Fellows Of Harvard College | Angiogenin and Variants Thereof for Treatment of Neurodegenerative Diseases |
| EP4007813A4 (en) * | 2019-08-02 | 2023-08-30 | Commonwealth Scientific and Industrial Research Organisation | Rna molecules for modulating flowering in plants |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999049029A1 (en) | 1998-03-20 | 1999-09-30 | Benitec Australia Ltd | Control of gene expression |
| WO2000063364A2 (en) | 1999-04-21 | 2000-10-26 | American Home Products Corporation | Methods and compositions for inhibiting the function of polynucleotide sequences |
| WO2001004313A1 (en) | 1999-07-09 | 2001-01-18 | American Home Products Corporation | Methods and compositions for preventing the formation of aberrant rna during transcription of a plasmid sequence |
| WO2001070949A1 (en) | 2000-03-17 | 2001-09-27 | Benitec Australia Ltd | Genetic silencing |
| WO2002038805A2 (en) | 2000-11-09 | 2002-05-16 | Cenix Bioscience Gmbh | Eukaryotic cell division genes and their use in diagnosis and treatment of proliferative diseases |
| WO2002044321A2 (en) | 2000-12-01 | 2002-06-06 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Rna interference mediating small rna molecules |
| WO2002055693A2 (de) | 2001-01-09 | 2002-07-18 | Ribopharma Ag | Verfahren zur hemmung der expression eines zielgens |
| WO2002055692A2 (de) | 2001-01-09 | 2002-07-18 | Ribopharma Ag | Verfahren zur hemmung der expression eines zielgens und medikament zur therapie einer tumorerkrankung |
| EP1144623B1 (de) | 1999-01-30 | 2002-08-28 | Ribopharma AG | Verfahren und medikament zur hemmung der expression eines vorgegebenen gens |
| US6506559B1 (en) | 1997-12-23 | 2003-01-14 | Carnegie Institute Of Washington | Genetic inhibition by double-stranded RNA |
Family Cites Families (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5453566A (en) | 1986-03-28 | 1995-09-26 | Calgene, Inc. | Antisense regulation of gene expression in plant/cells |
| WO1992003568A1 (en) | 1990-08-13 | 1992-03-05 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
| US6653458B1 (en) * | 1993-09-03 | 2003-11-25 | Isis Pharmaceuticals, Inc. | Modified oligonucleotides |
| GB9710475D0 (en) | 1997-05-21 | 1997-07-16 | Zeneca Ltd | Gene silencing |
| US6395713B1 (en) | 1997-07-23 | 2002-05-28 | Ribozyme Pharmaceuticals, Inc. | Compositions for the delivery of negatively charged molecules |
| AR013269A1 (es) | 1997-08-04 | 2000-12-13 | Scras | Producto que contiene por lo menos un rna de doble filamento combinado con por lo menos un agente anti-viral, para la utilizacion terapeutica en eltratamiento de una enfermedad viral, en especial de la hepatitis viral |
| US5952657A (en) | 1997-08-22 | 1999-09-14 | Thermo Microscopes, Corp. | Atomic force microscope with integrated optics for attachment to optical microscope |
| CN1202246C (zh) | 1998-04-08 | 2005-05-18 | 联邦科学和工业研究组织 | 获得修饰表型的方法和措施 |
| US6106982A (en) | 1998-05-11 | 2000-08-22 | Avery Dennison Corporation | Imaged receptor laminate and process for making same |
| AR020078A1 (es) | 1998-05-26 | 2002-04-10 | Syngenta Participations Ag | Metodo para alterar la expresion de un gen objetivo en una celula de planta |
| GB9827152D0 (en) | 1998-07-03 | 1999-02-03 | Devgen Nv | Characterisation of gene function using double stranded rna inhibition |
| CA2361201A1 (en) | 1999-01-28 | 2000-08-03 | Medical College Of Georgia Research Institute, Inc. | Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna |
| US6160215A (en) | 1999-03-26 | 2000-12-12 | Curtin; Lawrence F. | Method of making photovoltaic device |
| HK1047109A1 (zh) | 1999-10-15 | 2003-02-07 | University Of Massachusetts | 作为指定基因干预工具的rna干预轨迹基因 |
| GB9927444D0 (en) | 1999-11-19 | 2000-01-19 | Cancer Res Campaign Tech | Inhibiting gene expression |
| WO2001038551A1 (en) | 1999-11-29 | 2001-05-31 | Cold Spring Harbor Laboratory | Regulation of polycomb group gene expression for increasing seed size in plants |
| RU2164944C1 (ru) | 1999-12-09 | 2001-04-10 | Институт молекулярной биологии им. В.А. Энгельгардта РАН | Способ изменения генетических свойств организма |
| IT1316982B1 (it) | 2000-01-17 | 2003-05-26 | Univ Roma | Isolamento e caratterizzazione di un gene per il silenziamento genicoda n.crassa e suoi usi. |
| EP1272630A2 (en) | 2000-03-16 | 2003-01-08 | Genetica, Inc. | Methods and compositions for rna interference |
| WO2001070944A2 (de) | 2000-03-22 | 2001-09-27 | Aventis Pharma Deutschland Gmbh | Nematoden als modellorganismen zur untersuchung neurodegenerativer erkrankungen und insbesonder der parkinsonschen erkrankung, verwendungen und verfahren zum auffinden von substanzen und genen, die bei der behandlung solcher erfrankungen eingesetz werden können, sowie identifizierung eines nematodengens. |
| GB0007268D0 (en) | 2000-03-24 | 2000-05-17 | Cyclacel Ltd | Cell cycle progression proteins |
| WO2001092513A1 (en) | 2000-05-30 | 2001-12-06 | Johnson & Johnson Research Pty Limited | METHODS FOR MEDIATING GENE SUPPRESION BY USING FACTORS THAT ENHANCE RNAi |
| US20030130186A1 (en) | 2001-07-20 | 2003-07-10 | Chandra Vargeese | Conjugates and compositions for cellular delivery |
| US6566524B2 (en) | 2001-12-21 | 2003-05-20 | The Procter & Gamble Co. | Methods for synthesis of amino-tetrahydroisoquinoline-sulfonamide hydroxamic acids |
| CA2478904A1 (en) * | 2002-03-14 | 2003-09-18 | Commonwealth Scientific And Industrial Research Organisation | Modified gene-silencing rna and uses thereof |
| EP1348943A3 (en) | 2002-03-25 | 2003-12-17 | Sysmex Corporation | Sheath liquid for particle analyzer |
| US20040053876A1 (en) * | 2002-03-26 | 2004-03-18 | The Regents Of The University Of Michigan | siRNAs and uses therof |
| US7387896B2 (en) * | 2003-03-26 | 2008-06-17 | The Regents Of The University Of Michigan | MicroRNA vectors |
| EP2129680B1 (en) | 2007-03-21 | 2015-05-06 | Brookhaven Science Associates, LLC | Combined hairpin-antisense compositions and methods for modulating expression |
-
2008
- 2008-03-20 EP EP20080732595 patent/EP2129680B1/en active Active
- 2008-03-20 HU HUE08732595A patent/HUE027018T2/en unknown
- 2008-03-20 JP JP2009554750A patent/JP5759673B2/ja active Active
- 2008-03-20 CA CA002681323A patent/CA2681323A1/en not_active Abandoned
- 2008-03-20 ES ES08732595.7T patent/ES2538217T3/es active Active
- 2008-03-20 AU AU2008228814A patent/AU2008228814B2/en active Active
- 2008-03-20 US US12/052,658 patent/US8796442B2/en active Active
- 2008-03-20 WO PCT/US2008/057704 patent/WO2008116094A2/en not_active Ceased
- 2008-03-20 BR BRPI0809130A patent/BRPI0809130A8/pt not_active Application Discontinuation
- 2008-03-20 PT PT87325957T patent/PT2129680E/pt unknown
- 2008-03-20 DK DK08732595.7T patent/DK2129680T3/en active
- 2008-03-20 PL PL08732595T patent/PL2129680T3/pl unknown
- 2008-03-25 AR ARP080101204A patent/AR066194A1/es unknown
-
2011
- 2011-03-23 AR ARP110100994A patent/AR080722A2/es unknown
-
2014
- 2014-08-05 US US14/452,049 patent/US9193972B2/en active Active
- 2014-10-21 AR ARP140103952A patent/AR098140A2/es active IP Right Grant
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6506559B1 (en) | 1997-12-23 | 2003-01-14 | Carnegie Institute Of Washington | Genetic inhibition by double-stranded RNA |
| WO1999049029A1 (en) | 1998-03-20 | 1999-09-30 | Benitec Australia Ltd | Control of gene expression |
| EP1144623B1 (de) | 1999-01-30 | 2002-08-28 | Ribopharma AG | Verfahren und medikament zur hemmung der expression eines vorgegebenen gens |
| WO2000063364A2 (en) | 1999-04-21 | 2000-10-26 | American Home Products Corporation | Methods and compositions for inhibiting the function of polynucleotide sequences |
| WO2001004313A1 (en) | 1999-07-09 | 2001-01-18 | American Home Products Corporation | Methods and compositions for preventing the formation of aberrant rna during transcription of a plasmid sequence |
| WO2001070949A1 (en) | 2000-03-17 | 2001-09-27 | Benitec Australia Ltd | Genetic silencing |
| WO2002038805A2 (en) | 2000-11-09 | 2002-05-16 | Cenix Bioscience Gmbh | Eukaryotic cell division genes and their use in diagnosis and treatment of proliferative diseases |
| WO2002044321A2 (en) | 2000-12-01 | 2002-06-06 | MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. | Rna interference mediating small rna molecules |
| WO2002055693A2 (de) | 2001-01-09 | 2002-07-18 | Ribopharma Ag | Verfahren zur hemmung der expression eines zielgens |
| WO2002055692A2 (de) | 2001-01-09 | 2002-07-18 | Ribopharma Ag | Verfahren zur hemmung der expression eines zielgens und medikament zur therapie einer tumorerkrankung |
Non-Patent Citations (4)
| Title |
|---|
| FRIER ET AL., PROC. NAT. ACAD. SCL USA, vol. 83, 1986, pages 9373 - 9377 |
| See also references of EP2129680A4 |
| TURNER ET AL., CSHSYMP. QUANT. BIOL. LII, 1987, pages 123 - 133 |
| TURNER ET AL., J. AM. CHEM. SOC., vol. 109, 1987, pages 3783 - 3785 |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8785121B2 (en) | 2010-07-08 | 2014-07-22 | Bonac Corporation | Single-stranded nucleic acid molecule for controlling gene expression |
| JP2013034470A (ja) * | 2010-08-03 | 2013-02-21 | Bonac Corp | 含窒素脂環式骨格を有する一本鎖核酸分子 |
| US9200278B2 (en) | 2010-08-03 | 2015-12-01 | Bonac Corporation | Single-stranded nucleic acid molecule having nitrogen-containing alicyclic skeleton |
| WO2012017919A1 (ja) * | 2010-08-03 | 2012-02-09 | 株式会社ボナック | 含窒素脂環式骨格を有する一本鎖核酸分子 |
| JP2013138681A (ja) * | 2010-08-03 | 2013-07-18 | Bonac Corp | 含窒素脂環式骨格を有する一本鎖核酸分子 |
| US8691782B2 (en) | 2010-08-03 | 2014-04-08 | Bonac Corporation | Single-stranded nucleic acid molecule having nitrogen-containing alicyclic skeleton |
| US9206422B2 (en) | 2010-08-03 | 2015-12-08 | Bonac Corporation | Single-stranded nucleic acid molecule having nitrogen-containing alicyclic skeleton |
| JP4965745B2 (ja) * | 2010-08-03 | 2012-07-04 | 株式会社ボナック | 含窒素脂環式骨格を有する一本鎖核酸分子 |
| US8987226B2 (en) | 2010-12-02 | 2015-03-24 | Daiichi Sankyo Company, Limited | Modified single-stranded polynucleotides |
| WO2012074038A1 (ja) * | 2010-12-02 | 2012-06-07 | 第一三共株式会社 | 修飾1本鎖ポリヌクレオチド |
| US10238752B2 (en) | 2012-05-26 | 2019-03-26 | Bonac Corporation | Single-stranded nucleic acid molecule for regulating expression of gene having delivering function |
| US10612020B2 (en) | 2013-12-26 | 2020-04-07 | Tokyo Medical University | Artificial mimic miRNA for controlling gene expression, and use of same |
| US10934542B2 (en) | 2013-12-27 | 2021-03-02 | Bonac Corporation | Artificial match-type miRNA for controlling gene expression and use therefor |
| US11027023B2 (en) | 2014-12-27 | 2021-06-08 | Bonac Corporation | Natural type miRNA for controlling gene expression, and use of same |
| US11142769B2 (en) | 2015-03-27 | 2021-10-12 | Bonac Corporation | Single-stranded nucleic acid molecule having delivery function and gene expression regulating ability |
Also Published As
| Publication number | Publication date |
|---|---|
| PL2129680T3 (pl) | 2015-10-30 |
| US20140342453A1 (en) | 2014-11-20 |
| ES2538217T3 (es) | 2015-06-18 |
| AR080722A2 (es) | 2012-05-02 |
| PT2129680E (pt) | 2015-08-28 |
| WO2008116094A3 (en) | 2008-11-20 |
| AR066194A1 (es) | 2009-08-05 |
| EP2129680A2 (en) | 2009-12-09 |
| HUE027018T2 (en) | 2016-08-29 |
| JP2010521973A (ja) | 2010-07-01 |
| EP2129680B1 (en) | 2015-05-06 |
| US9193972B2 (en) | 2015-11-24 |
| AU2008228814A1 (en) | 2008-09-25 |
| JP5759673B2 (ja) | 2015-08-05 |
| CA2681323A1 (en) | 2008-09-25 |
| AR098140A2 (es) | 2016-05-04 |
| DK2129680T3 (en) | 2015-08-10 |
| EP2129680A4 (en) | 2010-10-20 |
| BRPI0809130A8 (pt) | 2021-11-03 |
| BRPI0809130A2 (pt) | 2014-08-26 |
| US20080311658A1 (en) | 2008-12-18 |
| AU2008228814B2 (en) | 2014-03-06 |
| US8796442B2 (en) | 2014-08-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2129680B1 (en) | Combined hairpin-antisense compositions and methods for modulating expression | |
| US20050142578A1 (en) | RNA interference mediated target discovery and target validation using short interfering nucleic acid (siNA) | |
| Wu et al. | The N-terminal double-stranded RNA binding domains of Arabidopsis HYPONASTIC LEAVES1 are sufficient for pre-microRNA processing | |
| JP4558711B2 (ja) | 短いdsRNA配列を用いた植物中での効率的遺伝子サイレンシング | |
| Volkov et al. | Selective protection of nuclease-sensitive sites in siRNA prolongs silencing effect | |
| WO2005007860A1 (en) | Cationic oligopeptide-mediated rna delivery into plants | |
| Varley et al. | Chemical strategies for strand selection in short-interfering RNAs | |
| CN101952434A (zh) | 使用合成的聚合物递送对基因沉默有活性的核酸的工具 | |
| Dinç et al. | Synthetic antisense oligodeoxynucleotides to transiently suppress different nucleus-and chloroplast-encoded proteins of higher plant chloroplasts | |
| Dafny-Yelin et al. | pSAT RNA interference vectors: a modular series for multiple gene down-regulation in plants | |
| WO2005014810A1 (ja) | ダンベル型dnaの効率的な製造方法 | |
| WO2007149521A2 (en) | Nucleotide motifs providing localization elements and methods of use | |
| Tomita et al. | Transgene overexpression with cognate small interfering RNA in tobacco | |
| WO2004007721A1 (en) | Conjugate for double-stranded rna sequence releasing and methods thereof | |
| EP1668144A2 (en) | Nucleotide sequences promoting the trans-membrane transport of nucleic acids | |
| Lingor et al. | Targeting neurological disease with RNAi | |
| Tang et al. | Post-transcriptional gene silencing induced by short interfering RNAs in cultured transgenic plant cells | |
| KR20080044909A (ko) | 세포 내로 리보핵산의 전달을 위한 약학 조성물 | |
| Tang et al. | Differential gene silencing induced by short interfering RNA in cultured pine cells associates with the cell cycle phase | |
| Kumar et al. | Control of gene expression by RNAi: A revolution in functional genomics | |
| KR20250064055A (ko) | 라이코펜이 증가된 형질전환 벼 캘러스 및 이의 제조 방법 | |
| Kurreck | The role of backbone modifications in oligonucleotide-based strategies | |
| Rossi | RNA interference: application to drug discovery and challenges to pharmaceutical development | |
| Wang et al. | Synthesis of complementary RNA by RNA-dependent RNA polymerases in plant extracts is independent of an RNA primer | |
| Sanan-Mishra et al. | Design and delivery of small RNAs for RNAi technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 08732595 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2681323 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009554750 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008228814 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008732595 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2008228814 Country of ref document: AU Date of ref document: 20080320 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: PI0809130 Country of ref document: BR Kind code of ref document: A2 Effective date: 20090921 |