WO2008093083A2 - Marqueur pronostique pour le cancer - Google Patents

Marqueur pronostique pour le cancer Download PDF

Info

Publication number
WO2008093083A2
WO2008093083A2 PCT/GB2008/000313 GB2008000313W WO2008093083A2 WO 2008093083 A2 WO2008093083 A2 WO 2008093083A2 GB 2008000313 W GB2008000313 W GB 2008000313W WO 2008093083 A2 WO2008093083 A2 WO 2008093083A2
Authority
WO
WIPO (PCT)
Prior art keywords
onzin
cancer
hpv
expression
activity
Prior art date
Application number
PCT/GB2008/000313
Other languages
English (en)
Other versions
WO2008093083A3 (fr
Inventor
Ian Hampson
Lynne Hampson
Original Assignee
Vibio Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vibio Limited filed Critical Vibio Limited
Publication of WO2008093083A2 publication Critical patent/WO2008093083A2/fr
Publication of WO2008093083A3 publication Critical patent/WO2008093083A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds

Definitions

  • the present invention relates to prognostic and diagnostic tests for cancer and in particular cancers associated with human papilloma virus infections.
  • the invention also concerns agents that may be use in the prevention and treatment of cancer.
  • prognostic assays that are able to indicate whether or not a patient will respond favourably to treatment for metastatic cancer
  • hi general treatments for cancer comprise relatively "harsh” regimes.
  • Such treatment regimes, and the ill-effects that they may cause, are generally justified in the case of patients who may not be expected to respond to less rigorous treatment. However it will generally be preferred to avoid subjecting patients who are likely to respond favourably to more "gentle” treatment to unnecessary harsh regimes.
  • Human tumour viruses are emerging as a major cause of human cancer and there is now a great deal of evidence that supports the contention that these viruses cause cancer by inducing genetic instability in infected cells.
  • the E6 protein from high risk forms of the human papilloma virus such as type 16 (HPV 16) is known to induce genetic instability producing abnormal numbers of centrosomes, multinucleation and nuclear atypia although the mechanisms underlying this process are poorly understood.
  • an in vitro method for identifying a subject predisposed to, or suffering from, a cancer caused by a human tumour virus comprising examining Onzin levels in a bodily sample from a test subject and comparing activity or expression levels with a reference derived from an individual who does not suffer from cancer, wherein raised activity or a raised concentration of Onzin in the bodily sample from the test subject suggests that the subject is suffering from cancer or is predisposed to developing cancer.
  • the human tumor virus is a human papilloma virus (HPV). It has been recognised that high-risk types of the human papilloma virus particularly type 16 (HPV 16) or human papilloma virus type 18 (HPV 18) are associated with the aetiology of cervical carcinoma whereas low-risk viruses such as HPV6/11 are associated with genital warts. Low and high risk HPVs produce different forms of the viral E6 oncoprotein with HPV 16 E6 or HPV 18 E6 producing effects, which are thought to more readily promote malignant conversion than, for example, HPV6 E6.
  • HPV 16 human papilloma virus
  • HPV 18 human papilloma virus
  • the human tumour virus is HPV 16 or HPV 18.
  • the subject is a woman suspected of being predisposed to developing, or having cervical cancer.
  • the invention has been based on the inventor's research into the complicated signalling pathways that lead to oncogenesis in cells infected with Human tumour viruses.
  • tumour suppressor p53 plays a key role in preventing the development of tumours.
  • An increase in p53 will decrease cell proliferation and induce apoptosis in abnormal cells. This has the effect of preventing tumour genesis.
  • Many hundreds of factors are known that will reduce p53 activity (e.g. many different oncogene products) or increase its activity.
  • the regulation of p53 levels is a complex and incompletely understood biological process (e.g. see Michael & Oren (2003) Seminars in Cancer Biology 13 p49-58 & Meek & Knippschild (2003) Molecular Cancer Research 1 pi 017- 1026).
  • the inventors conducted experiments investigating the influence of E6 on transformation of cells and p53 activity. They were first surprised to establish that E6 binds to phospholipid scramblase 1 (PLSCRl). PLSCRl has been shown previously to have tumour suppressive like qualities and to interact with Onzin (see Youjun et al. (2006) MoI. Cell. Biol. (26) p3401-3413). The inventors therefore decided to test the hypothesis that E6 may in turn modulate Onzin activity (whether directly or by modulating PLSCRl). To their surprise they found that Onzin RNA levels (see the Examples) were significantly and dramatically up-regulated by forced expression of E6 in a HPV negative cervical carcinoma cell line. They further demonstrated that Onzin is very much up-regulated in human cervical smear cells from abnormal biopsies as opposed to normal.
  • PLSCRl phospholipid scramblase 1
  • Onzin is an important marker for identifying subjects who are predisposed to developing a cancer, or aiding in the diagnosis of subjects with cancer, that are caused by human tumour viruses.
  • E6 has a dual effect in human tumour virus infected cells.
  • E6 interacts with PLSCRl and removes the ability of PLSCRl to negatively regulate Onzin.
  • Furthemore E6 also causes a massive increase in Onzin expression. Onzin then induces p53 degradation or reduces p53 expression or activity and this reduction in p53 activity thereby permits the accumulation of genetic damage and the eventual transformation of HPV infected cells.
  • Onzin polypeptide as well as nucleic acid encoding Onzin polypeptide, would have useful applications in the methods of diagnosing human tumour virus induced oncogenesis.
  • Onzin polypeptide is included any Onzin polypeptide or fragment thereof, or any variant thereof, which is competent to reduce p53 activity or expression. Onzin is also known as Plac8 or Cl 5.
  • ONZEST gene Further information on the ONZEST gene is provided in the NCBI Entrez database.
  • An examples of a human ONZIN polypeptide has Genbank Accession number NM 016619 and is provided in SEQ E) NO:1 below:
  • Onzin polypeptides may be identified further Onzin polypeptides.
  • BLAST searching http://www.ncbi.nlm.nih.gov/BLAST/
  • Onzin polypeptides are encompassed by the definition of "Onzin polypeptide” given above.
  • These polypeptide are also included within the scope of the term "Onzin polypeptide” when referred to herein.
  • a polypeptide may have at least 50%, 60% to 70% and more preferrably 70% to 80%, 80 to 90%, 90 to 95%, 96%, 97%, 98%, 99% or more sequence identity with a Onzin polypeptide sequence provided herein, for example as given in one of the listed accession numbers above or that of SEQ ID NO: 1.
  • any further polypeptide comprises less than 50%, 40%, 30%, 20%, 10%, 5%, 2%, 1%, 0.5%, 0.1%, 0.01% or less of the total polypeptide by weight.
  • a "fragment" of the Onzin polypeptide can be considered to be an Onzin polypeptide with a region that is able to interact with p53 or a further factor that in turn will down-regulate p53 activity or expression.
  • Such a fragment may comprise, for example, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more or of the polypeptide sequence of full length Onzin polypeptide.
  • a “variant” will have a region which has at least 50% (preferably 60%, 70%, 80%, 90%, 95%, 86%, 97%, 98%, 99% or more) sequence identity with an Onzin polypeptide as described herein.
  • the percentage identity may be calculated by reference to a region of at least 50 amino acids (preferably at least 60, 75, or 100) of the candidate variant molecule, allowing gaps of up to 5%.
  • variants we also include insertions, deletions and substitutions, either conservative or non- conservative. In particular we include variants of the polypeptide where such changes do not substantially alter the protein activity or ability to bind to particular binding partners, as appropriate.
  • nucleic acid sequence could be varied or changed without substantially affecting the sequence of the protein encoded thereby, to provide a functional variant thereof.
  • small non-polar, hydrophobic amino acids include glycine, alanine, leucine, isoleucine, valine, proline, and methionine.
  • Large non-polar, hydrophobic amino acids include phenylalanine, tryptophan and tyrosine.
  • the polar neutral amino acids include serine, threonine, cysteine, asparagine and glutamine.
  • the positively charged (basic) amino acids include lysine, arginine and histidine.
  • the negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Therefore by "conservative substitutions” is intended to include combinations such as GIy, Ala; VaI, He, Leu; Asp, GIu; Asn, GIn; Ser, Thr; Lys, Arg; and Phe, Tyr.
  • Calculation of percentage identities between different amino acid/polypeptide/nucleic acid sequences may be carried out as follows.
  • a multiple alignment is first generated by the ClustalX program (pairwise parameters: gap opening 10.0, gap extension 0.1, protein matrix Gonnet 250, DNA matrix IUB; multiple parameters: gap opening 10.0, gap extension 0.2, delay divergent sequences 30%, DNA transition weight 0.5, negative matrix off, protein matrix gonnet series, DNA weight IUB; Protein gap parameters, residue-specific penalties on, hydrophilic penalties on, hydrophilic residues GPSNDQERK, gap separation distance 4, end gap separation off).
  • the percentage identity is then calculated from the multiple alignment as (N/T)*100, where N is the number of positions at which the two sequences share an identical residue, and T is the total number of positions compared.
  • percentage identity can be calculated as (N/S)*100 where S is the length of the shorter sequence being compared.
  • the amino acid/polypeptide/nucleic acid sequences may be synthesised de novo, or may be native amino acid/polypeptide/nucleic acid sequence, or a derivative thereof.
  • determining whether a sample of body fluid or tissue contains a certain level of Onzin may be diagnostic of cancer or it may be used by a clinician as an aid in reaching a diagnosis.
  • the methods of the invention may be used for presymptomatic screening of a patient who is in a risk group for developing a cancer, e.g. a patient having a family history of such diseases. Hence the methods of the invention may also be considered as aiding in the diagnosis of cancer.
  • the level of Onzin polypeptide which can be considered to be an indicator of cancer may be, for example, at least 1 1 A fold higher, or it may be at least 2-fold, or 3-fold, or even higher, in the sample than the level of Onzin in a body fluid or tissue sample taken from an individual who is not suffering from a cancer.
  • Onzin is usually low in the non-transformed or non-HPV infected cells they have studied.
  • kits for identifying a subject predisposed to, or suffering from, cancer associated with Human Tumour Viruses comprising:-
  • the method according to the first aspect of the invention is useful for enabling a clinician to make decisions with regards to the best course of treatment for a subject who is suffering from cancer or is suspected of developing cancer. It is preferred that the diagnostic method is used to enable a clinician to decide how to treat a subject who is suffering from cancer.
  • the method of the first aspect is useful to a clinician because it allows him or her to monitor the efficacy of a putative treatment for cancer.
  • the kit according to the second aspect is useful for providing prognostic information with regards a cancer patient's condition, such that the clinician can carry out a treatment.
  • the kit can also be used to monitor the efficacy of a putative treatment for cancer. The method and the kit are therefore very useful for guiding a cancer treatment regime for the clinician, and to monitor the efficacy of such a treatment regime.
  • Onzin expression levels may be used as a diagnostic and/or prognostic marker for a large variety of cancer conditions.
  • the cancer may be leukaemia or cancer of the lung, breast, oesophagus, stomach, pancreas, liver, kidney, small intestine, colon, uterus, ovaries, prostate, bladder, testes or brain.
  • the method is applicable particularly, but by no means exclusively, to precancerous conditions and cancers caused by oncogenic viruses. It is especially preferred that Onzin expression is used as a diagnostic and/or prognostic marker for cancers associated with oncogenic types of HPV and in particular HPV 18 or HPV 16.
  • the method of the first aspect of the invention is particularly useful for identifying subjects who are predisposed to, or suffering from, cancer of the cervix, vulva or anus or penile carcinoma.
  • the method may also be used to assay laryngeal or oral samples to test for a predisposition or existence of recurrent respiratory papillomatosis
  • the method may also be utilised such that it provides clinically useful information about "viral or HPV positivity". It will be appreciated that the infection with such viruses will be associated with raised Onzin levels and the risk of malignancies associated with infection.
  • the inventors have also found that the method according to the first aspect of the invention is useful for identifying subjects who are at risk of developing or have warts caused by low risk HPV infections. For instance the method may be used to identify if a subject is at risk of developing warts of the vulva, anus or penis (e.g. caused by "low risk” HPV6/11).
  • Onzin polypeptide levels may be measured.
  • the sample may be any bodily sample into which the Onzin polypeptide may be secreted, e.g. it may be lymph or interstitial fluid.
  • the sample may be a urine sample.
  • Onzin polypeptide may be measured or assayed in a blood sample.
  • the blood sample may be venous or arterial. Blood samples may be assayed immediately. Alternatively, the blood may be stored in a fridge or even frozen before the assay is conducted. Measurement may be made in whole blood. However, in preferred embodiments of the invention, the blood may be further processed before an assay is performed. For instance, an anticoagulant, such as heparin, citrate, EDTA, and others may be added. Alternatively, the blood sample may be centrifuged or filtered to prepare a plasma or serum fraction for further analysis.
  • the diagnostic test is most suitably conducted on samples derived from blood when the cancer is a leukaemia.
  • the Onzin polypeptide is an intracellular protein that is up-regulated in the cytosol of a transformed cell. It is therefore preferred that the diagnostic test is conducted on samples that are derived from a sample comprising cells or cell lysated from a tissue that is suspected of containing a tumour.
  • the sample may be a smear sample or even a biopsy of cervical tissue.
  • the sample preferably comprises a tissue sample or sample of cells, which has been removed or extracted from the body.
  • the sample may comprise at least one cell taken from a site of the body thought to be cancerous. It will also be appreciated that smear or biopsy samples may be analysed immediately after they have been taken from a subject.
  • the samples may be treated with an appropriate fixative (eg RNALater, Ambion Ltd) or be frozen (e.g. by dipping fresh samples in liquid nitrogen) and stored. The sample may then be analysed at a later date.
  • Onzin expression may be measured by a number of ways known to one skilled in the art. It will be appreciated that Onzin polypeptide may be detected by labelling a compound having affinity for the protein.
  • Agents according to the third aspect of the inventions discussed below
  • such as antibodies, aptamers and the like may be labelled and used in an assay. It is particularly preferred that an antibody according to the third aspect of the invention (see below) is used in this method.
  • Onzin polypeptide may be detected by non-immuno based assays.
  • non- immuno based assays may utilise fluorometric or chemiluminescent labels.
  • immunoassays are employed to detect Onzin polypeptide concentration in the sample. Examples of immunoassays include immunofluorescence techniques known to the skilled technician, immunohistochemistry, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay analyses.
  • a preferred method of measuring Onzin polypeptide comprises carrying out an ELISA on the sample. It may be required to first separate the proteins in the sample, for example, using isoelectric focussing before the ELISA step. As will be appreciated, such techniques are routine laboratory methods and are well known to the skilled person.
  • the method according to the first aspect of the invention may be designed to detect Onzin mRNA or derivatives thereof (e.g. Onzin cDNA).
  • Levels of mRNA encoding the polypeptide may be assayed using the RT-PCR method. Briefly, this method involves converting mRNA isolated from a biological sample to cDNA using a reverse transcriptase enzyme. The cDNA products are then subject to PCR according to conventional techniques. After a suitable number of rounds to achieve amplification, the PCR reaction product corresponding to the mRNA encoding the polypeptide is quantified. Variations on the RT-PCR method will be apparent to the skilled person. Any set of oligonucleotide primers which will amplify reverse transcribed target mRNA can be used and can be designed as will be well known to those skilled in the art. Levels of mRNA encoding the polypeptide can also be assayed using northern blotting, a method well known to those skilled in the art and described further in Sambrook et al. supra.
  • Further methods which may be of use in measuring mRNA levels, include in situ hybridisation, in situ amplification, nuclease protection, probe arrays, and amplification based systems.
  • Such methods can also be used to determine if there is any variation in the location of the mRNA encoding the polypeptide, hi addition, microarray analysis, a technique well known to those skilled in the art, may also be used to assess both the amount and/or location of mRNA encoding the Onzin polypeptide.
  • the diagnostic methods may need a "reference sample".
  • a reference sample By comparing the amount and/or activity of Onzin polypeptide, or nucleic acid encoding Onzin, in a sample of protein or nucleic acid taken from an animal or cell which has not been exposed to the test compound, or from a patient that does not have cancer, to the amount and/or function of polypeptide or nucleic acid in a sample taken from an animal or cell which has no cancer of HPV infection it is possible to determine whether the patient has cancer or will be predisposed to developing it.
  • the inventors further realised that their work has made it possible to develop agents that will be useful for treating or preventing the development of cancers cause by Human Tumour Viruses such as HPV.
  • composition comprising an agent that reduces the activity or expression of Onzin and a pharmaceutically acceptable vehicle for use as a medicament.
  • a fourth aspect of the present invention there is provided a use of an agent according to the third aspect of the invention for the manufacture of a medicament for the prevention or treatment of cancer caused by Human
  • a method for the prevention or treatment of cancer caused by Human Tumour Viruses comprising administering to a person in need of such treatment a therapeutically effective amount of an agent according to the third aspect of the invention.
  • Onzin polypeptide expression is associated with cancerous cellular phenotype.
  • the inventors have identified and prepared agents that reduce the activity or expression of Onzin. It is therefore apparent that such agents have great utility in the preparation of medicaments for the treatment of cancer caused by viruses and particularly by HPV.
  • agents include where the agent may bind to the Onzin polypeptide and prevent Onzin functional activity, e.g. antibodies and fragments and derivatives thereof (e.g. domain antibodies or Fabs).
  • the agent may be a peptide that can bind to Onzin polypeptide.
  • the agent may act as a competitive inhibitor to Onzin by binding to other agents or polypeptides to which Onzin polypeptide normally binds, so as to prevent Onzin function.
  • the agent may bind to mRNA encoding Onzin polypeptide in such a manner as to lead to a reduction that mRNA and hence a reduction in Onzin polypeptide.
  • the agent may bind to a nucleic sequence encoding Onzin in such a manner that leads to a reduction in the amount of transcribed mRNA encoding Onzin polypeptide.
  • the agent according to the third aspect of the invention can reduce the activity or expression of Onzin but not bind to Onzin polypeptide or nucleic acid encoding Onzin polypeptide.
  • the agent may be a competitive inhibitor to Onzin by binding to other agents or polypeptides to which
  • Onzin polypeptide normally binds.
  • the agent may bind to genomic nucleic acid sequence to reduce the amount of Onzin polypeptide produced.
  • the agent may bind to coding or non-coding regions of the Onzin gene or to DNA 5' or 3' of the Onzin and thereby reduce expression of the protein.
  • the agent of the fourth aspect of the invention which reduces the activity or expression of Onzin, binds to Onzin polypeptide or to a nucleic acid encoding Onzin polypeptide.
  • the agent binds to an epitope defined by the polypeptide of SEQ ID NO.1 that has been correctly folded into its native form.
  • the agent may bind to a peptide of up to about 30 amino acids long (e.g. 25 amino acids long) from SEQ ID No.l. It is preferred that the agents binds to an epitope on the C terminal end of Onzin.
  • the agent binds to the peptide: NH2 - RDINRRRAMRTF - CONH2 (SEQ BD NO. 2) which corresponds to c terminal of human Onzin or a fragment thereof.
  • Agents which bind to SEQ ID No. 2 are particularly useful for binding to Onzin (they are therefore useful as markers for use in the method of the first aspct of the invention). Such agents also have a dramatic effect on Onzin activity and are also particularly effective for stopping the progression of tumour growth. This peptide represent an important feature according to the present invention.
  • An embodiment of this aspect of the invention is wherein the agent is an antibody or fragment thereof.
  • antibodies as agents to modulate polypeptide activity are well known. Indeed, therapeutic agents based on antibodies are increasingly being used in medicine. As set out above, the inventors realised that Onzin polypeptide expression is associated with cancerous cellular phenotype. It is therefore apparent that such agents have great utility as medicaments for the treatment of cancer. Moreover, such antibodies can be used in the diagnostic methods and screening methods(see below) of the invention.
  • Antibodies may be produced as polyclonal sera by injecting antigen into animals.
  • Preferred polyclonal antibodies may be raised by inoculating an animal (e.g. a rabbit) with antigen (e.g. all or a fragment of the Onzin polypeptide) using techniques known to the art.
  • Polyclonal antibodies for use in treating human subjects, may be raised against Onzin, a number of peptides derived from the human Onzin polypeptide, or peptides comprising amino acid sequences corresponding to those found in the human Onzin polypeptide.
  • the antibody may be monoclonal. Conventional hybridoma techniques may be used to raise such antibodies.
  • the antigen used to generate monoclonal antibodies according to the present invention may be the same as would be used to generate polyclonal sera.
  • antibodies or immunoglobulin proteins are Y-shaped molecules usually exemplified by the ⁇ -immunoglobulin (IgG) class of antibodies.
  • the molecule consists of four polypeptide chains two identical heavy (H) chains and two identical (L) chains of approximately 5OkD and 25kD each respectively. Each light chain is bound to a heavy chain (H- L) by disulphide and non-covalent bonds.
  • H-L chain combinations Two identical H-L chain combinations are linked to each other by similar non- covalent and disulphide bonds between the two H chains to form the basic four chain immunoglobulin structure (H-L) 2 .
  • Light chain immunoglobulins are made up of one V-domain (V L ) and one constant domain (C L ) whereas heavy chains consist of one V-domain and, depending on H chain isotype, three or four C-domains (C H I , C H 2, C H 3 and C H 4).
  • V domain At the ⁇ terminal region of each light or heavy chain is a variable (V) domain that varies greatly in sequence, and is responsible for specific binding to antigen.
  • Antibody specificity for antigen is actually determined by amino acid sequences within the V-regions known as hypervariable loops or Complementarity Determining Regions (CDRs).
  • CDRs Complementarity Determining Regions
  • Each H and L chain V regions possess 3 such CDRs, and it is the combination of all 6 that forms the antibody's antigen binding site.
  • the remaining V- region amino acids which exhibit less variation and which support the hypervariable loops are called frameworks regions (FRs).
  • variable domains The regions beyond the variable domains (C-domains) are relatively constant in sequence.
  • the characterising feature of antibodies according to the invention is the V H and V L domains.
  • the precise nature of the C H and C L domains is not, on the whole, critical to the invention.
  • preferred antibodies according to the invention may have very different C H and C L domains.
  • preferred antibody functional derivatives may comprise the Variable domains without a C- domain (e.g. scFV antibodies).
  • Preferred antibodies considered to be agents according to the third aspect of the invention may have the V L (first domain) and VH (second domain) domains.
  • a derivative thereof may have 75% sequence identity, more preferably 90% sequence identity and most preferably has at least 95% sequence identity. It will be appreciated that most sequence variation may occur in the framework regions (FRs) whereas the sequence of the CDRs of the antibodies, and functional derivatives thereof, should be most conserved.
  • a number of preferred embodiments of the agent of the third aspect of the invention relate to molecules with both Variable and Constant domains.
  • antibody fragments e.g. scFV antibodies or FAbs
  • scFV antibodies or FAbs are also encompassed by the invention that comprise essentially the Variable region of an antibody without any Constant region.
  • An scFV antibody fragment considered to be an agent of the third aspect of the invention may comprise the whole of the V H and V L domains of an antibody raised against Onzin polypeptide.
  • the V H and V L domains may be separated by a suitable linker peptide.
  • Antibodies, and particularly mAbs, generated in one species are known to have several serious drawbacks when used to treat a different species. For instance when murine antibodies are used in humans they tend to have a short circulating half- life in serum and may be recognised as foreign proteins by the immune system of a patient being treated. This may lead to the development of an unwanted human anti- mouse antibody (HAMA) response. This is particularly troublesome when frequent administration of an antibody is required as it can enhance its clearance, block its therapeutic effect, and induce hypersensitivity reactions. These factors limit the use of mouse monoclonal antibodies in human therapy and have prompted the development of antibody engineering technology to generate humanised antibodies.
  • HAMA human anti- mouse antibody
  • antibodies and fragments thereof are humanised.
  • Humanisation may be achieved by splicing V region sequences (e.g. from a monoclonal antibody generated in a non-human hybridoma) with C region (and ideally FRs from V region) sequences from human antibodies.
  • V region sequences e.g. from a monoclonal antibody generated in a non-human hybridoma
  • C region and ideally FRs from V region sequences from human antibodies.
  • the resulting 'engineered' antibodies are less immunogenic in humans than the non- human antibodies from which they were derived and so are better suited for clinical use.
  • Humanised antibodies may be chimaeric monoclonal antibodies, in which, using recombinant DNA technology, rodent immunoglobulin constant regions are replaced by the constant regions of human antibodies.
  • the chimaeric H chain and L chain genes may then be cloned into expression vectors containing suitable regulatory elements and induced into mammalian cells in order to produce fully glycosylated antibodies.
  • the biological activity of the antibody may be pre-determined.
  • Such chimaeric molecules may be used to treat or prevent cancer according to the present invention.
  • Such antibodies may involve CDR-grafting or reshaping of antibodies.
  • Such antibodies are produced by transplanting the heavy and light chain CDRs of a non-human antibody (which form the antibody's antigen binding site) into the corresponding framework regions of a human antibody.
  • Humanised antibody fragments represent preferred agents for use according to the invention.
  • Human FAbs recognising V-ATPase epitope may be identified through screening a phage library of variable chain human antibodies.Techniques known to the art (e.g developed by Morphosys or Cambridge Antibody Technology) may be employed to generate Fabs that may be used as agents according to the invention.
  • a human combinatorial Fab antibody library may be generated by transferring the heavy and light chain variable regions from a single-chain Fv library into a Fab display vector. This library may yield 2.1 X 10 10 different antibody fragments.
  • the peptide according to the first aspect of the invention may then be used as "bait" to identify antibody fragments from then library that have the desired binding properties.
  • dAbs represent another preferred agent that may be used according to this embodiment of the invention.
  • dAbs are the smallest functional binding unit of antibodies and correspond to the variable regions of either the heavy or light chains of human antibodies.
  • Such dAbs may have a molecule weight of around 13kDa (corresponding to about 1/10 (or less) the size of a full antibody).
  • peptides may be used to reduce the activity or expression of Onzin.
  • Such peptides represent other preferred agents for use according to the invention.
  • These peptides may be isolated, for example, from libraries of peptides by identifying which members of the library are able to bind to Onzin and reduce the activity or expression of Onzin. Suitable libraries may be generated using phage display techniques. Examples of such peptides include those sold commercially Affibody AB.
  • Aptamers represent another preferred agent of the third aspect of the invention.
  • Aptamers are nucleic acid molecules that assume a specific, sequence- dependent shape and bind to specific target ligands based on a lock-and-key fit between the aptamer and ligand.
  • aptamers may comprise either single- or double-stranded DNA molecules (ssDNA or dsDNA) or single-stranded RNA molecules (ssRNA).
  • Aptamers may be used to bind both nucleic acid and non-nucleic acid targets. Accordingly aptamers may be generated that recognise and so reduce the activity or expression of Onzin.
  • Suitable aptamers may be selected from random sequence pools, from which specific aptamers may be identified which bind to the selected target molecules (e.g. a peptide of SEQ ID No. 2) with high affinity.
  • Methods for the production and selection of aptamers having desired specificity are well known to those skilled in the art, and include the SELEX (systematic evolution of ligands by exponential enrichment) process. Briefly, large libraries of oligonucleotides are produced, allowing the isolation of large amounts of functional nucleic acids by an iterative process of in vitro selection and subsequent amplification through polymerase chain reaction.
  • Antisense molecules represent another preferred agent of the third aspect of the invention.
  • Antisense molecules are typically single-stranded nucleic acids, which can specifically bind to a complementary nucleic acid sequence produced by a gene and inactivate it, effectively turning that gene "off.
  • the molecule is termed "antisense” as it is complementary to the gene's mRNA, which is called the “sense” sequence, as appreciated by the skilled person.
  • Antisense molecules are typically 15 to 35 bases in length of DNA, RNA or a chemical analogue.
  • Antisense nucleic acids have been used experimentally to bind to mRNA and prevent the expression of specific genes. This has lead to the development of "antisense therapies” as drugs for the treatment of cancer, diabetes and inflammatory diseases.
  • One antisense drug has recently been approved by the US FDA for human therapeutic use. Accordingly, by designing an antisense molecule to polynucleotide sequence encoding Onzin polypeptide (for example the polynucleotide sequence encoding the polypeptide of SEQ ID NO. 1), it would be possible to reduce the expression of Onzin in a cell.
  • small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, represent particularly preferred agents for use according to the third aspect of the invention.
  • Onzin expression is associated with cancerous cellular phenotype and it is therefore desirable to reduce Onzin activity or expression in order that cancer may be treated. They therefore realised that siRNA molecules, which can reduce Onzin expression, have great utility in the preparation of medicaments for the treatment of cancer.
  • siRNA are a class of 19-25 nucleotide-long RNA molecules that are involved in the RNA interference pathway (RNAi). siRNA can lead to a reduction in expression of a specific gene, or specifically interfere with the translation of such mRNA thereby inhibiting expression of protein encoded by the mRNA.
  • siRNAs have a well defined structure: a short (usually about 21-nt) double-strand of RNA (dsRNA) with 1-5 nt 3' overhangs on either end. Each strand may have a 5' phosphate group and a 3' hydroxyl (-OH) group. In vivo this structure is the result of processing by Dicer, an enzyme that converts either long dsRNAs or hairpin RNAs into siRNAs.
  • Dicer an enzyme that converts either long dsRNAs or hairpin RNAs into siRNAs.
  • siRNAs can also be exogenously (artificially) introduced into cells by various transfection methods to bring about the specific knock-down of a gene of interest.
  • any gene of which the sequence is known can thus be targeted based on sequence complementarity with an appropriately tailored siRNA.
  • siRNA Methods of making siRNA are known to the art. For example they are described in US 7,078,196.
  • RNAi via siRNAs has generated a great deal of interest in both basic and applied biology.
  • RNAi screens that are designed to identify the important genes in various biological pathways.
  • disease processes also depend on the activity of multiple genes, it is expected that in some situations turning off the activity of a gene with a siRNA could produce a therapeutic benefit.
  • RNAi for biomedical research and drug development.
  • Recent phase I results of the first two therapeutic RNAi trials demonstrate that siRNAs are well tolerated and have suitable pharmacokinetic properties. siRNAs and related RNAi induction methods therefore stand to become an important new class of drugs in the foreseeable future.
  • siRNA molecules designed to nucleic acid encoding Onzin can be used to reduce the expression of Onzin.
  • the agent is a siRNA molecule having complementary sequence to a polynucleotide encoding Onzin.
  • siRNA molecules having complementary sequence to Onzin polynucleotide.
  • a simple internet search yields many websites that can be used to design siRNA molecules.
  • siRNA molecule we include a double stranded RNA molecule that is about 19 to 25 nucleotides-long, as well as each of the two single RNA strands that make up a double stranded siRNA molecule.
  • siRNA molecules designed to nucleic acid encoding ONZIN are demonstrated to reduce the expression of ONZIN in host cells.
  • the polynucleotide sequence of preferred siRNA molecules are provided below:
  • siRNA #1 sense strand CAUUUCCUGCUCGGAACCUUGUUUA [SEQ ID NO: 3] and antisense strand UAAACAAGGUUCCGAGCAGGAAAUG [SEQ ID NO: 4];
  • SEQ ID No. 3 corresponds to position 42 of NM 016619.
  • siRNA #2 sense strand CCUUGUUUACUAAUUUCCACUGCUU [ SEQ ID NO: 5] and antisense strand AAGCAGUGGAAAUUAGUAAACAAGG [SEQ ID NO: 6];
  • SEQ ID No. 5 corresponds to position 58 of NM 016619.
  • the siRNA molecule comprises polynucleotide sequence of SEQ ID NOs 3-6.
  • the siRNA molecule comprises SEQ ID NOs 3 and 4 or 5 and 6.
  • the siRNA molecule is in the form of hair pin RNA (shRNA).
  • shRNA hair pin RNA
  • Such shRNA may comprise two complementary siRNA molecules that are linked by a spacer sequence (e.g. of about 9 nueclotides). The complementary siRNA molecules may fold such that they bind together.
  • Preferred shRNA for use according to the invention may comprise SEQ ID Nos 3 and 4 linked by a spacer; or SEQ ID Nos 5 and 6 linked by a spacer. Spacers for forming shRNA will be known to a skilled person.
  • Preliminary experiments carried out by the inventors analysed the effects of knocking down Onzin with the preferred siRNA molecules. These experiments utilised RNA oligonucleotide sequences complimentary to portions of the Onzin mRNA sequence (siRNA). These were then transfected into cells and the inventors observed a knock-down in Onzin expression.
  • agents according to the invention i.e. siRNA to Onzin
  • siRNA molecules for use according to the third aspect of the invention may involve testing the effect of such molecules over an extended period of time in a cell line that is adapted to stably express siRNA sequences.
  • the inventors have established that the vector pSUPER (Oligoengine) may be used to transform a number of standard cell lines (e.g. a human cell line) with most preferred shRNA. The effect of the shRNA may then be observed on long term Onzin expression. It will be appreciated that a long term reduction in Onzin expression will mean that the agent is particularly efficacious for preventing or treating cancer.
  • Constructs may be made comprising two of the siRNA sequences (e.g.
  • SEQ ID NOs 3 and 4 separated by a nine base pair linker suitable for forming a hair pin.
  • the sequences should also contain restriction sites for cloning into pSUPER.
  • This construct may then be spliced into the pSUPER vector.
  • the recombinant pSUPER vector may then be transfected into a cell line.
  • the linker folds and allows the two complimentary sequences to anneal, forming a hairpin RNA (shRNA) line and the effect of long term expression of shRNA on Onzin expression can be observed.
  • shRNA hairpin RNA
  • the inventors have established that the agents according to the third aspect of the invention are particularly useful for application to a site of viral infection (or site of potential infection) and thereby act as a treatment or prophylactic against virus infection and the development of virus related cancers.
  • HPV infected individuals i.e. those with a viral infection but no evidence of malignant disease
  • HPV infected individuals with pre malignant cells may be treated according to the invention by administration of the agents with a view to treating the viral infection and thereby preventing the development of cancer.
  • the invention may be applied to range of cancers, in which Human Tumour Viruses (and particularly HPV) are implicated.
  • cancers include cervical, vulval, anal and oral carcinomas.
  • HPVs transforming human papilloma viruses
  • agents as defined herein are useful for eliminating HPV from tissues and thereby reverse the predisposition state of "HPV positivity". It will be appreciated that the elimination of this virus will reduce the risk of malignancies associated with infection as well as being useful for reducing/preventing other conditions/diseases associated with this virus.
  • the agents may be topically applied to the cervix, vulva, anus or oral cavity to treat or prevent the development of a cancer caused by HPV.
  • the agents are used to prevent or treat cancers caused by high risk HPVs (e.g. HPV 16, HPV 18 and other high risk types).
  • the agents may be topically applied to the larynx or oral cavity to treat, or prevent, HPV related oral conditions such as recurrent respiratory papillomatosis
  • the agents according to the third aspect of the invention are not only useful for treating HPV related cancer but are also surprisingly useful for preventing the development of HPV related cancer. Accordingly the agents have a most preferred use as a prophylactic.
  • the agents according to the third aspect of the invention may be used to prevent or treat warts caused by low risk HPV infections.
  • the agent may be topically applied to the vulva, anus or penis to treat, or prevent, genital warts (e.g. caused by the abovementioned low risk HPV6/11).
  • the agents may be topically applied to skin to treat, or prevent cutaneous HPV related warts caused by HPV type 2 and others.
  • the agents may be given to subjects with a genetic disposition to developing cancer (most particularly cervical carcinoma) or even those facing environmental risk (e.g. people exposed to carcinogens).
  • the inhibitors may be given to women who are at risk of developing cervical cancer.
  • Such women can include those who have been diagnosed according to the first aspect of the invention as having raised Onzin levels and who have, or have a high risk of, HPV infection (e.g.. HPV 16 or HPVl 8) of the urino-genital tract (and particularly the cervix).
  • HPV infection e.g... HPV 16 or HPVl 8
  • HPV infection e.g... 16 or HPVl 8
  • the agents may be topically applied to the cervix, vulva or anus of women with a viral infection at these sites with a view to preventing the development of cancer at a future date.
  • the agents may be used to prevent or treat cancer as a monotherapy (i.e. use of the agent alone) or in combination with other compounds or treatments used in cancer therapy (e.g. chemotherapeutic agents, radiotherapy). It is most preferred that the agents are used to treat humans (e.g. women at risk of developing cervical, vulval or anal cancer or at risk of HPV infection). However it will be appreciated that the agents may also have some veterinary use.
  • the medicaments used according to the invention may take a number of different forms depending, in particular on the manner in which the medicament is to be applied topically.
  • the medicament may be in the form of a powder, tablet, capsule, liquid, ointment, cream, gel, hydrogel, aerosol, spray, micelle, liposome or any other suitable form that may be administered to a person or animal.
  • the vehicle of the medicament of the invention should be one which is well tolerated by the subject to whom it is given and enables delivery of the inhibitors to the effected or target site.
  • the agents are formulated for topical use (e.g as creams or ointments).
  • topical use e.g as creams or ointments
  • they when used to treat (or prevent the development of) cervical cancer, it is preferred that they are formulated as creams or ointments that may be applied directly to the vulva, penis or cervix by techniques known to the art.
  • the agents may be formulated in a pessary according to techniques known to the art.
  • Examples of preferred formulations for use according to the invention are gels or hydro-gels containing the active agent and which are specifically formulated for application to the target tissue (e.g. the cervix).
  • a more preferred hydro-gel may be composed of: polyoxyethylene or polyoxypropylene block copolymers. Alternatively it may comprisetive ethylene oxide, styrene oxide di-block copolymers or poly(ethylene oxide)-block-poly(DL-lactide) copolymers.
  • Most preferred hydro-gels for use for vaginal delivery according to the invention may comprise monoolein (e.g. the Myverol 18-99)/water lyotrophic liquid crystalline gels. These gels show good bioadhesive characteristics and will bind to the cervix when delivered into the vagina and thereby represent a good means of delivering the active agent to a target tissue. Furthermore such gels are able to absorb water when delivered to the vagina until they reach an equilibrium water content of approximately 40% in the vagina but still maintain there physical integrity. Such gels can delivery (to the cervix) the active agent over a time period of approximately 18 hours and will follow square route of time kinetics (i.e. the rate of release of the agent is diffusion controlled).
  • the hydrogel may comprise a triblock copolymer of pol(epsilon- caprolactone) and poly (oxyethylene).
  • Such gels also exhibit good release properties of agents according to the first aspect of the invention within the vagina (e.g. for use in the prevention of cervical cancer).
  • the amount of the agent required is determined by biological activity and bioavailability which in turn depends on the mode of administration, the physicochemical properties of the compound employed and whether the compound is being used as a monotherapy or in a combined therapy.
  • the frequency of administration will also be influenced by the abovementioned factors and particularly the half-life of the compound within the subject being treated.
  • Optimal dosages to be administered may be determined by those skilled in the art, and will vary with the particular compound in use, the strength of the preparation, the mode of administration, and the advancement of the disease condition. Additional factors depending on the particular subject being treated will result in a need to adjust dosages, including subject age, weight, gender, diet, and time of administration.
  • a daily dose of .between 0.01 ⁇ g/kg of body weight and 1.0 g/kg of body weight of an agent may be used for the prevention or treatment of cancer - depending upon which specific agent is used. More preferably, the daily dose is between 0.01 mg/kg of body weight and
  • an ointment or cream should comprise at least between about 0.1 ⁇ M and 1OmM of an inhibitor according to the invention and preferably a greater concentration that will be effective for delivering an effective concentration of inhibitor to the tissue being treated by the ointment or cream.
  • Daily doses may be given as a single administration (e.g. as a pessary).
  • the agent used may require administration twice or more times during a day.
  • an aptamer for preventing the development of cervical cancer may be administered as a hydrogel or cream, once, twice, three or more times a day in an amount sufficient to ensure between about 0.1 ⁇ M and 1OmM of the agent reaches the target cells.
  • This invention further provides a pharmaceutical composition
  • a pharmaceutical composition comprising a therapeutically effective amount of an agent according to the third aspect of the invention and a pharmaceutically acceptable vehicle.
  • the amount of the agent is an amount from about 0.01 mg/ml to about 100 mg/ml. In another embodiment, the amount is from about 0.1 mg/ml to about 100 mg/ml.
  • the vehicle is a liquid and the composition is a solution.
  • the vehicle is a gel and the composition is a suppository or pessary.
  • the vehicle is an emulsion (or other pharmaceutically acceptable base) and the composition is a cream.
  • This invention provides a process for making a pharmaceutical composition
  • a pharmaceutical composition comprising combining a therapeutically effective amount of an agent according to the first aspect of the invention and a pharmaceutically acceptable vehicle.
  • therapeutically effective amount we mean any amount of an agent or composition which, when administered to a subject suffering from a disease against which the agent is effective, causes reduction, remission, or regression of the malignant disease or HPV infection or prevents the development of malignant disease or HPV infection.
  • a "subject” is a vertebrate, mammal, domestic animal or preferably a human being.
  • the “pharmaceutically acceptable vehicle” may be any physiological vehicle known to those of ordinary skill in the art useful in formulating pharmaceutical compositions.
  • Liquid vehicles are used in preparing solutions, suspensions, emulsions, syrups, elixirs and pressurized compositions.
  • the active ingredient can be dissolved or suspended in a pharmaceutically acceptable liquid vehicle such as water, an organic solvent, a mixture of both or pharmaceutically acceptable oils or fats.
  • the liquid vehicle can contain other suitable pharmaceutical additives such as solubilizers, emulsifiers, buffers, preservatives, sweeteners, flavoring agents, suspending agents, thickening agents, colors, viscosity regulators, stabilizers or osmo-regulators.
  • suitable examples of liquid vehicles for oral and parenteral administration include water (partially containing additives as above, e.g.
  • cellulose derivatives preferably sodium carboxymethyl cellulose solution
  • alcohols including monohydric alcohols and polyhydric alcohols, e.g. glycols) and their derivatives, and oils (e.g. fractionated coconut oil and arachis oil).
  • the vehicle can also be an oily ester such as ethyl oleate and isopropyl myristate.
  • Sterile liquid vehicles are useful in sterile liquid form compositions for parenteral administration.
  • the liquid vehicle for pressurized compositions can be halogenated hydrocarbon or other pharmaceutically acceptable propellent.
  • a method of screening a test compound to determine whether the compound has efficacy for treating or preventing cancer comprising:
  • the methods of the fifth aspect of the invention relate to screening methods for drugs or lead compounds.
  • the test compound may be a drug-like compound or lead compound for the development of a drug-like compound.
  • the method according to the fifth aspect of the invention may be adapted such that it is used to test whether or not a compound causes cancer.
  • a method of screening a compound, to test whether the compound may cause cancer comprising:
  • the screening methods of the invention are based upon the inventors' realisation that the extent of Onzin gene product activity may be closely related to the development and progression of cancer.
  • the screening method of the fifthaspect of the invention is particularly useful for screening libraries of compounds to identify compounds that may be used as anti-cancer agents according to the first aspect of the invention.
  • the sixth aspect of the invention may be used to identify compounds that are carcinogenic. Accordingly the screen according to the sixth aspect of the invention may be used for environmental monitoring (e.g. to test effluents from factories) or in toxicity testing (e.g. to test the safety of putative pharmaceuticals, cosmetics, foodstuffs and the like).
  • biological system we include any experimental system that would be understood by a skilled person to provide insight as to the effects a compound may have on Onzin in the physiological environment.
  • the system may comprise: (a) an experimental test subject when an in vivo test is to be employed; (b) a biological sample derived from a test subject (for instance: blood or a blood fraction (e.g. serum or plasma), lymph or a cell/biopsy sample); (c) a cell line model (e.g. a cell expressing Onzin in its cytosol or a cell engineered to express the protein); or even (d) an in vitro system that comprises the Onzin and simulates the physiological environment such that Onzin activity can be measured.
  • a biological sample derived from a test subject for instance: blood or a blood fraction (e.g. serum or plasma), lymph or a cell/biopsy sample
  • a cell line model e.g. a cell expressing Onzin in its cytosol or a cell engineered to express the protein
  • an in vitro system that comprises
  • the screen preferably assays biological cells or lysates thereof.
  • the screen involves the assay of cells, they may be contained within an experimental animal (e.g. a mouse or rat) when the method is an in vivo based test.
  • the cells may be in a tissue sample (for ex vivo based tests) or the cells may be grown in culture. It will be appreciated that such cells should express, or may be induced to express, functional Onzin gene product.
  • the screening methods of the invention include a step of detecting the effect of a test compound on the activity or expression of Onzin.
  • Means to detect the amount of polypeptide or nucleic acid in a sample are provided in the assays discussed in connection with the diagnostic method (see above). Such methods can be used to determine the effect of the test compound on Onzin.
  • the screening methods may be further adapted to measure binding affinities of compounds. This may be achieved using conventional binding assays. For instance a known ligand for the polypeptide (e.g. an antibody raised against Onzin) may be radiolabeled and incubated cells expressing the protein. Tests may be conducted to evaluate whether or not a candidate compound is able to displace the label. Any compound that does so may be considered to be a potential therapeutic agent or carcinogen and may then be subjected to further tests whereby the effect of the compound on enzyme activity may be assayed.
  • a known ligand for the polypeptide e.g. an antibody raised against Onzin
  • Tests may be conducted to evaluate whether or not a candidate compound is able to displace the label. Any compound that does so may be considered to be a potential therapeutic agent or carcinogen and may then be subjected to further tests whereby the effect of the compound on enzyme activity may be assayed.
  • the test may be an immunoassay-based test.
  • labelled antibodies e.g. an antibody according to the invention with a conventional radiolabel or dye attached
  • an immunoassay e.g. an ELISA
  • a reduction in bound label (relative to controls) in the sample would suggest that the test compound competes with the label for binding to the protein.
  • ELISAs immunoassay techniques well known to the art represent particularly preferred assays for carrying out the screens of the invention.
  • Figure 1 is a schematic illustrating the pathway by which the inventor believes HPV 16 E6 modulates Onzin dependent degradation of p53 and thereby illustrating a link between Onzin and oncogenesis.
  • Figure 2 illustrates that HPV 16 E6 degrades p53 in C33A cells.
  • the photograph is a Western immunoblot of proteins isolated from HPV -ve human C33A cervical carcinoma cells stably transfected with pcDNA3.1 vector (C33AV) or HPV16 E6 in the same expression vector (C33AE6) Immunoprobed with anti p53.
  • C33AV pcDNA3.1 vector
  • C33AE6 HPV16 E6 in the same expression vector
  • FIG. 3 illustrates that Onzin is upregulated by expression of HPV 16 E6 in transformed cells.
  • RT PCR analysis of onzin RNA expression levels which shows that transformed C33AE6, cells express much higher levels of onzin RNA than do C33AV cells whereas non transformed human Tert keratinocytes express very low levels of onzin in the presence or absence of E6.
  • CaSki cells are a malignant cervical carcinoma line known to express high levels of HPV 16 E6 and they also have high levels of onzin expression. Actin was used as a housekeeping control for equal cDNA input.
  • Figure 4 shows expression of Onzin in RNA isolated from normal and abnormal ThinPrep Pap smear cytology samples.
  • Lanes labelled abnormal were from patients diagnosed by coloposcopy as having high grade cervical intraepithelial neoplasia.
  • Lanes labelled normal were from patients diagnosed by coloposcopy as having normal histology. The results show that the abnormal smears have much higher levels of onzin RNA than the normals.
  • Expression of the housekeeping gene PLA is used to control for equal cDNA input.
  • Figure 5 illustrates a western blot analysis of proteins extracted from C33A Vector & C33AE6 cells treated with and without alpha interferon.
  • the p53 protein was degraded in C33AE6 cells while onzin protein was up-regulated compared to C33A vector cells.
  • IFN- ⁇ treatment induced expression of the negative onzin regulator PLSCRl which coincided with the observed up-regulation of p53 in HPV16 E6 expressing C33A.
  • Example 1 demonstrates that human tumour viruses degrade p53. This lead the inventors to investigate whether or not human tumour viruses were able to modulate any other agents that participate in the signalling pathways that control oncogenesis. To their surprise they found that the viruses (as illustrated with E6) was able to modulate Onzin levels (see Examples 2). This lead them to realise that Onzin levels may be prognostic/diagnostic as disclosed herein and as illustrated in Example 3 and 5.
  • Example 4 discloses an antibody which may be used according to the invention.
  • HPV 16 E6 up-regulates the expression of a number of cell signalling factors.
  • the inventors found that HPV 16 E6 up-regulates Onzin RNA in transformed cells.
  • RNA 2 ul to 10 ul ( about 1.4 ug/ul to 0.0014 ug/ul)
  • Exon 3 forward sense primer 5 -ATTTTGTTTCCCGTGCCTTGG-3' [SEQ ID NO. 7]
  • Exon 4 reverse antisense primer 5 ' -GCTGTCCTCATTGTACTCTTTGCC-S ' [SEQ ID NO. 8]
  • PCR products were separated by electrophoresis through a 1% agarose gel and visualised by ethidium bromide staining.
  • Figure 3 shows that C33AE6 cells expressed much higher levels of onzin RNA than C33AV cells.
  • Non transformed normal human Tert keratinocytes showed low onzin expression in the presence or absence of E6.
  • HPVl 6 positive human CaSki cervical carcinoma cells express high levels of onzin.
  • An immunoassay for detecting Onzin levels in a sample e.g. ThinPrep cells taken for a smear test or alternatively sections cut from wax embedded punch biopsies taken at the time of colposcopy was developed by indirectly labelling an antibody that bound Onzin.
  • a polyclonal antibody was raised in a rabbit, using conventional techniques, that recognised a peptide which was specific to Onzin and also immunogenic by antigenicity plot.
  • the peptide sequence chosen as antigen was the carboxyl terminal of Onzin: RDINRRRAMRTF (SEQ ID No. 2).
  • the anti-Onzin antibody was then used as a primary antibody and incubated with the de-waxed sample slides in humidified conditions (primary antibody diluted appropriately in phosphate buffered saline). After incubation the slides were washed, and incubated with an appropriate secondary antibody capable of binding specifically to the anti-Onzin antibody (TRITC-labelled anti-rabbit antibody). After a further incubation period with the secondary antibody, the slides were washed once more in PBS, nuclei counter-stained with Hoechst, and the slides mounted with coverslips. Expression of Onzin was detected using a fluorescent microscope (Onzin expression appearing as red fluorescence).
  • Proteins extracts were prepared as described Example 1 from C33A and C33AE6 cells which had been treated with and without interferon alpha, electrophoresed on SDS PAGE and electroblotted onto Hybond C Extra. This was then immunoprobed (as described in Example 1) with antibodies to phospholipid scramblasel, p53 and the antibody raised against the carboxyl terminal of Onzin: (SEQ ID No. 2) at a concentration of 1 :500. Protein signals were visualised by enhanced chemi- luminescence as described in Example 1
  • FIG. 5 illustrates that C33AE6 cells express more onzin protein than C33A vector control cells with our without interferon treatment which is entirely consistent with the RNA results shown in Examples 2 & 3.
  • Interferon is known to up-regulate expression of phospholipid scramblase 1 which was confirmed in both C33A and C33AE6 cells.
  • the C33AE6 cells express very low levels of p53 when compared to the parental C33AV cells yet most significant was the observation that up-regulation of scramblase protein by interferon also caused an increase in p53 levels in C33AE6 cells.

Abstract

La présente invention concerne un procédé in vitro permettant d'identifier un sujet prédisposé à un cancer provoqué par un virus oncogène humain, ou souffrant de celui-ci. Le procédé comprend l'examen des taux d'Onzin dans un échantillon corporel provenant d'un sujet test et la comparaison des niveaux d'activité ou d'expression avec une référence dérivée d'un individu qui ne souffre pas d'un cancer, une activité augmentée ou une concentration augmentée d'Onzin dans l'échantillon corporel provenant du sujet test suggérant que le sujet souffre d'un cancer ou qu'il est prédisposé au développement d'un cancer. L'invention concerne également l'utilisation d'agents qui réduisent l'activité ou l'expression de l'Onzin pour la prévention ou le traitement d'un cancer provoqué par des virus oncogènes humains (HPV), ou pour la prévention ou le traitement de verrues non malignes provoquées par des HPV à bas risque.
PCT/GB2008/000313 2007-01-31 2008-01-31 Marqueur pronostique pour le cancer WO2008093083A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB0701818A GB0701818D0 (en) 2007-01-31 2007-01-31 Prognostic marker for cancer
GB0701818.7 2007-01-31

Publications (2)

Publication Number Publication Date
WO2008093083A2 true WO2008093083A2 (fr) 2008-08-07
WO2008093083A3 WO2008093083A3 (fr) 2008-09-25

Family

ID=37891018

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2008/000313 WO2008093083A2 (fr) 2007-01-31 2008-01-31 Marqueur pronostique pour le cancer

Country Status (2)

Country Link
GB (1) GB0701818D0 (fr)
WO (1) WO2008093083A2 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999066946A1 (fr) * 1998-06-24 1999-12-29 Trustees Of The University Of Pennsylvania Compositions et procedes servant a provoquer une apoptose chez des cellules exprimant e6
WO2005033333A2 (fr) * 2003-10-07 2005-04-14 Dako Denmark A/S Methodes et compositions pour le diagnostic de cancer

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999066946A1 (fr) * 1998-06-24 1999-12-29 Trustees Of The University Of Pennsylvania Compositions et procedes servant a provoquer une apoptose chez des cellules exprimant e6
WO2005033333A2 (fr) * 2003-10-07 2005-04-14 Dako Denmark A/S Methodes et compositions pour le diagnostic de cancer

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HAMPSON LYNNE ET AL: "Specific HIV protease inhibitors inhibit the ability of HPV16 E6 to degrade p53 and selectively kill E6-dependent cervical carcinoma cells in vitro." ANTIVIRAL THERAPY 2006, vol. 11, no. 6, 2006, pages 813-825, XP008093944 ISSN: 1359-6535 *
LEDFORD JULIE G ET AL: "Impaired host defense in mice lacking ONZIN" JOURNAL OF IMMUNOLOGY, vol. 178, no. 8, April 2007 (2007-04), pages 5132-5143, XP002487076 ISSN: 0022-1767 *
LI YOUJUN ET AL: "The negative c-Myc target onzin affects proliferation and apoptosis via its obligate interaction with phospholipid scramblase I" MOLECULAR AND CELLULAR BIOLOGY, vol. 26, no. 9, May 2006 (2006-05), pages 3401-3413, XP002487075 ISSN: 0270-7306 *
ROGULSKI KENNETH ET AL: "Onzin, a c-Myc-repressed target, promotes survival and transformation by modulating the Akt-Mdm2-p53 pathway" ONCOGENE, vol. 24, no. 51, November 2005 (2005-11), pages 7524-7541, XP002487074 ISSN: 0950-9232 *

Also Published As

Publication number Publication date
WO2008093083A3 (fr) 2008-09-25
GB0701818D0 (en) 2007-03-14

Similar Documents

Publication Publication Date Title
JP6636067B2 (ja) ｃ−ＭＡＦを用いた前立腺がん転移の診断、予後診断および処置のための方法
US9316654B2 (en) TAZ/WWTR1 for diagnosis and treatment of cancer
WO2015089575A1 (fr) Procédé de diagnostic et de traitement
US20140100127A1 (en) Liver cancer diagnosis marker and use thereof
McKinnon et al. Glucose transporter expression in eutopic endometrial tissue and ectopic endometriotic lesions
US20150132764A1 (en) Bag3 as biochemical serum and tissue marker
WO2014061419A1 (fr) Marqueur de cancer innovant et son utilisation
Wang et al. Loss of Barx1 promotes hepatocellular carcinoma metastasis through up-regulating MGAT5 and MMP9 expression and indicates poor prognosis
AU2013202668B2 (en) Inhibition of cancer growth and metastasis
JP6271636B2 (ja) 肺癌および結腸直腸癌におけるｂａｒｄ１アイソフォームおよびその使用
JP7175526B2 (ja) 細胞遊走調節に関する疾患の予防・治療剤および肺間質の疾患の疾患活動性判定・予後評価
Song et al. TULP3 silencing suppresses cell proliferation, migration and invasion in gastric cancer via the PTEN/Akt/Snail pathway
JP6498114B2 (ja) 成人ｔ細胞白血病の診断方法および成人ｔ細胞白血病の治療薬のスクリーニング方法
WO2008093083A2 (fr) Marqueur pronostique pour le cancer
Lau et al. Dysregulation of clathrin promotes thyroid cell growth and contributes to multinodular goiter pathogenesis
JP7250307B2 (ja) 子宮癌の発症、転移又は再発の予測方法
DK2691526T3 (en) COMPOSITIONS FOR USE IN TREATMENT AND PROCEDURES FOR DIAGNOSIS AND CANCER MONITORING
CN104630338B (zh) Rrm2b基因或其蛋白在肝癌转移中的应用
WO2009071880A2 (fr) Marqueur de pronostic de cancer
WO2014034798A1 (fr) Méthode de détection d'un cancer, médicament à usage diagnostique et nécessaire de diagnostic d'un cancer, et composition pharmaceutique utilisable en vue du traitement d'un cancer
WO2016029051A1 (fr) Évaluation de l'insuffisance cardiaque et stratification du risque arythmique par mesure des protéines hu circulantes
KR20210130479A (ko) 방광암 세포의 이동성 예측용 조성물 및 이를 포함하는 키트
JP2007075072A (ja) プロサイモシンαの機能抑制用組成物を含む抗癌剤、およびプロサイモシンα遺伝子の発現抑制用組成物に含有される核酸
WO2017061125A1 (fr) Thérapie, diagnostic, et criblage utilisant card14
El-Achkar et al. Pathophysiology of Acute Kidney Injury: Tamm-Horsfall protein translocates to the basolateral domain of thick ascending limbs, interstitium, and circulation during recovery from acute kidney injury

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08701982

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08701982

Country of ref document: EP

Kind code of ref document: A2