WO2008087197A1 - In vivo screening models for treatment of alzheimer's disease and other qpct-related disorders - Google Patents

In vivo screening models for treatment of alzheimer's disease and other qpct-related disorders Download PDF

Info

Publication number
WO2008087197A1
WO2008087197A1 PCT/EP2008/050532 EP2008050532W WO2008087197A1 WO 2008087197 A1 WO2008087197 A1 WO 2008087197A1 EP 2008050532 W EP2008050532 W EP 2008050532W WO 2008087197 A1 WO2008087197 A1 WO 2008087197A1
Authority
WO
WIPO (PCT)
Prior art keywords
qpct
mouse
transgenic
genbank accession
transgene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2008/050532
Other languages
English (en)
French (fr)
Inventor
Stephan Schilling
Holger Cynis
Torsten Hoffmann
Hans-Ulrich Demuth
Michael Wermann
Katrin Schulz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Vivoryon Therapeutics AG
Original Assignee
Probiodrug AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Probiodrug AG filed Critical Probiodrug AG
Priority to JP2009545932A priority Critical patent/JP2010516235A/ja
Priority to HR20110651T priority patent/HRP20110651T1/hr
Priority to SI200830434T priority patent/SI2121944T1/sl
Priority to EP08707977A priority patent/EP2121944B1/en
Priority to AU2008206936A priority patent/AU2008206936B2/en
Priority to AT08707977T priority patent/ATE521711T1/de
Priority to NZ578513A priority patent/NZ578513A/en
Priority to CA002675192A priority patent/CA2675192A1/en
Priority to DK08707977.8T priority patent/DK2121944T3/da
Publication of WO2008087197A1 publication Critical patent/WO2008087197A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • A01K67/0275Genetically modified vertebrates, e.g. transgenic
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/14Prodigestives, e.g. acids, enzymes, appetite stimulants, antidyspeptics, tonics, antiflatulents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • A61P15/08Drugs for genital or sexual disorders; Contraceptives for gonadal disorders or for enhancing fertility, e.g. inducers of ovulation or of spermatogenesis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/06Antipsoriatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/02Drugs for disorders of the nervous system for peripheral neuropathies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/20Hypnotics; Sedatives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • C12N9/104Aminoacyltransferases (2.3.2)
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • A01K2217/052Animals comprising random inserted nucleic acids (transgenic) inducing gain of function
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0306Animal model for genetic diseases
    • A01K2267/0312Animal model for Alzheimer's disease
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/0306Animal model for genetic diseases
    • A01K2267/0318Animal model for neurodegenerative disease, e.g. non- Alzheimer's

Definitions

  • the present invention relates generally to transgenic animals as well as methods and compositions for screening and treating diseases, especially in relation to Qpct .
  • the invention relates to Qpct (i.e. glutaminyl peptide cyclotransferase) , also termed glutaminyl cyclase (QC,
  • EP 02 011 349.4 discloses polynucleotides encoding insect glutaminyl cyclase, as well as polypeptides encoded thereby.
  • This application further provides host cells comprising expression vectors comprising polynucleotides of the invention.
  • Isolated polypeptides and host cells comprising insect QC are useful in methods of screening for agents that reduce glutaminyl cyclase activity. Such agents are described as useful as pesticides .
  • AD Alzheimer's disease
  • astrocytes reactive astrocytes and microglia
  • Intagaki S. et al . 1989 J Neuroimmunol 24, 173-182
  • Funato H. et al . 1998 Am J Pathol 152, 983-992
  • Selkoe D. J.
  • Amyloid-beta (abbreviated as A ⁇ ) peptides are the primary components of senile plaques and are considered to be directly involved in the pathogenesis and progression of AD, a hypothesis supported by genetic studies (Glenner, G. G. and Wong, C. W. 1984 Biochem Biophys Res Comm 120, 885-890; Borchelt, D. R. et al. 1996 Neuron 17, 1005-1013; Lemere, C. A. et al . 1996 Nat Med 2, 1146-1150; Mann, D. M. and Iwatsubo, T. 1996 Neurodegeneration 5, 115-120; Citron, M. et al .
  • a ⁇ is generated by proteolytic processing of the ⁇ -amyloid precursor protein (APP) (Rang, J. et al . 1987 Nature 325, 733-736; Selkoe, D. J. 1998 Trends Cell Biol 8, 447-453), which is sequentially cleaved by ⁇ -secretase at the N-terminus and by ⁇ -secretase at the C-terminus of A ⁇ (Haass, C. and Selkoe, D. J. 1993 Cell 75, 1039-1042; Simons, M. et al. 1996 J Neurosci 16 899-908) .
  • APP ⁇ -amyloid precursor protein
  • N-terminally truncated forms occurs in senile plaques.
  • Such shortened peptides are reported to be more neurotoxic in vitro and to aggregate more rapidly than the full-length isoforms (Pike, C. J. et al. 1995 J Biol Chem 270, 23895-23898).
  • N-truncated peptides are known to be overproduced in early onset familial AD
  • Russo C, et al. 2000 Nature 405, 531-532
  • DS Down's syndrome
  • their amount reflects the progressive severity of the disease (Russo, C. et al. 1997 FEBS Lett 409, 411-416; Guntert, A. et al . 2006 Neuroscience 143, 461-475).
  • Additional post-translational processes may further modify the N-terminus by isomerization or racemization of the aspartate at position 1 and 7 and by cyclization of glutamate at residues 3 and 11.
  • Pyroglutamate- containing isoforms at position 3 [pGlu3A ⁇ 3-40/42 ] represent the prominent forms -approximately 50 % of the total A ⁇ amount - of the N-truncated species in senile plaques (Mori, H. et al . 1992 J Biol Chem 267, 17082-17086, Saido, T. C. et al . 1995 Neuron 14, 457-466; Russo, C. et al .
  • [pGlu 3 ]A ⁇ by amino acid substitution and deletion.
  • a spontaneous conversion or an enzymatic conversion by glutaminyl cyclase to pyroglutamate was suggested.
  • the cyclization mechanism of N-terminal glutamate at position 3 in the natural precursor of [pGlu 3 ]A ⁇ was neither determined in vitro, in situ nor in vivo (Shirotani, K. et al . 2002 NeuroSci Lett 327, 25- 28) .
  • the present invention comprises methods and compositions for non-human transgenic, in particular mammal, models for Qpct- related diseases. Specifically, the present invention comprises non-human transgenic animal models that overexpress Qpct .
  • the present invention further comprises compositions and methods for screening for biologically active agents that modulate Qpct- related diseases including, but not limited to, Mild Cognitive Impairment (MCI), Alzheimer's Disease (AD), cerebral amyloid angiopathy, Lewy body dementia, neurodegeneration in Down Syndrome, hereditary cerebral hemorrhage with amyloidosis (Dutch type) , Familial Danish Dementia, Familial British Dementia, ulcer disease and gastric cancer with or w/o Helicobacter pylori infections, pathogenic psychotic conditions, schizophrenia, infertility, neoplasia, inflammatory host responses, cancer, psoriasis, rheumatoid arthritis, atherosclerosis, restenosis, lung fibrosis, liver fibrosis, renal fibrosis, Acquired Immune Deficiency Syndrome, graft rejection, Chorea Huntington (HD), impaired humoral and cell-mediated immune responses, leukocyte adhesion and migration processes in the end
  • the present invention comprises methods and compositions for the treatment and/or prevention of Qpct-related diseases, particularly methods and compositions that inhibit or promote Qpct.
  • MCI Mild Cognitive Impairment
  • AD Alzheimer's Disease
  • cerebral amyloid angiopathy Lewy body dementia
  • neurodegeneration in Down Syndrome hereditary cerebral hemorrhage with amyloidosis
  • Dutch type hereditary cerebral hemorrhage with amyloidosis
  • Familial Danish Dementia Familial British Dementia
  • ulcer disease and gastric cancer with or w/o Helicobacter pylori infections
  • pathogenic psychotic conditions schizophrenia, infertility, neoplasia, inflammatory host responses, cancer, psoriasis, rheumatoid arthritis, atherosclerosis, restenosis, lung fibrosis, liver fibrosis, renal fibrosis, Acquired Immune Deficiency Syndrome, graft rejection, Chorea Huntington (HD), impaired humoral and cell-mediated immune responses, leukocyte adhesion and migration processes in the endothelium
  • MCI Mild Cognitive Impairment
  • AD Alzheimer
  • effectors of QC activity to a mammal it can be possible to stimulate gastrointestinal tract cell proliferation, preferably proliferation of gastric mucosal cells, epithelial cells, acute acid secretion and the differentiation of acid producing parietal cells and histamine- secreting enterochromaffin-like cells.
  • the present invention provides pharmaceutical compositions for parenteral, enteral or oral administration, comprising at least one effector of QC optionally in combination with customary carriers and/or excipients.
  • FIG. 2 Cloning strategy.
  • the Qpct cDNA was isolated first via Nsil and Notl from the pPCR-Script Cam SK(+) vector backbone and subcloned via Pstl and Notl into the pBlueScript SK+ (1 + 2) . Subsequently the cDNA cassette was subcloned via the restriction sites HindIII and Notl into a plasmid CAG Pr in pcDNA3.1 (3 + 4).
  • the resulting pTG-CAG-mQC consists of the Qpct cDNA cassette under the control of a ubiquitously expressing CAG promoter and the BGH polyA signal .
  • Figure 3 Restriction map of the transgenic construct plasmid pTG-CAG-mQC and its restriction analysis.
  • A The sequenced regions are labelled as narrow lines (SEQ ID No: 1 and 2) .
  • the binding sites of the genotyping primers and the restriction sites of the enzymes used in the restriction analysis are indicated in the plasmid map.
  • the position of the genotyping primers (CAG-Pr-Fl and GX1675-TOR1-FF) are shown as grey arrows (B, C) .
  • All DNA digests resulted in the expected fragment sizes as predicted in the table M: MassRuler DNA-Ladder Mix (GeneRuler; MBI) .
  • Figure 4 Testing the sensitivity of the screening PCR.
  • the optimised PCR screen was conducted using serial dilutions of the pTG-CAG-mQC plasmid in H 2 O (- WT DNA) or in 150 ⁇ g genomic wild-type DNA (+ WT DNA). The equivalent of 0.1, 1 and 10 copies of the transgenic vector per mouse genome were tested. PCR amplification of the transgenic DNA with the primer pair CAG-Pr-
  • F1/GX1675 yielded a 1585 bp product.
  • Wild-type genomic DNA (WT) and H 2 O ( ⁇ ) were included as negative controls.
  • M lkb DNA ladder
  • Figure 6 Pronuclei microinjections.
  • Figure 7 Screening for founders.
  • PCR result for the last born 19 pups is shown.
  • PCR with the primers CAG-Pr-Fl/GX1675-TORl-FF (transgene PCR; 1.6 kb) and with the primer pair BGH-Fl/CAG-Pr-R2 (head-to-tail PCR; 0.8 kb) was performed with genomic DNA from the FO generation.
  • Positive control (+) for the transgene PCR was the plasmid pTG-CAG-mQC, diluted with wild-type genomic DNA. The quality of the DNA was confirmed by a control PCR amplifying a 431 bp wild-type signal.
  • Positive control (TG) for the head-to-tail PCR was the genomic DNA of a transgenic line with same promoter-polyA signal sequences giving rise to a 1.3 kb PCR product.
  • Negative control was wild-type DNA (WT) .
  • H O ( ⁇ ) was used as an additional negative control.
  • M 100 bp DNA-Ladder (New England Biolabs, NEB)
  • FIG. 8 Genotyping of Fl generation .
  • the PCR result of 17 pups is shown as an example.
  • PCR with primers CAG-Pr-Fl/GX1675-TORl-FF (transgene PCR; 1.6 kb) was performed with genomic DNA from the Fl generation.
  • Positive control (+) for the transgene PCR was the plasmid pTG-CAG-mQC, diluted with wild-type genomic DNA.
  • Negative control was wild- type DNA (WT) .
  • WT wild- type DNA
  • H2O (0) was used as an additional negative control.
  • Ml 100 bp DNA-Ladder (NEB) Figure 9
  • 1OA QC activity in EDTA plasma, liver and brain referred to volume (plasma) or wet weight (tissue) , determined by quantification of pyroglutamyl-beta-naphthylamine using HPLC.
  • 1OB QC activity in EDTA plasma, liver and brain referred protein content .
  • 1OC Qualitative PCR of mouse QC from generated cDNA of brain (a) , liver (b) and kidney (c) from two transgenic QC-mice (QC) and controls (WT) .
  • Figure 11 QC activity in brain homogenate of a transgenic mouse (hQC-line 53 No.27, squares) and a non-transgenic littermate (hQC-line 53 No.25, circles). Activity was determined using an assay, which is based on detection and quantification of pyroglutamyl-beta-naphthylamine using HPLC. The higher slope in case of the transgenic animal proves expression of the transgene (human QC) .
  • Figure 12 QC activity in brain homogenate of a transgenic mouse (hQC-line 53 No.27, squares) and a non-transgenic littermate (hQC-line 53 No.25, circles). Activity was determined using an assay, which is based on fluorometric detection of QC activity. The higher slope in case of the transgenic animal proves expression of the transgene QC.
  • Figure 13 Comparison of QC-activity in the brain homogenates of transgenic mice expressing human QC neuron-specifically driven by the Thy-1 promotor (Line 53, Line 37 and Line 43) or murine QC ubiquitously (pbdl7E3) .
  • Figure 14 Western-Blot analysis of brain homogenates of different transgenic animals. A primary polyclonal antibody was used, detecting murine and human QC. The results reflect the analysis of QC activity exactly. Highest QC immunoreactivity was obtained in transgenic animals of line 53. Only a faint staining was observed in pbdl7E3 mice. The migration of QC is shown by the positive control, recombinant human QC. Lines: 1: Standard Proteins, 2: hQC-Line 53 No.23 (tg, female), 3: hQC-Line 53 No.25 (ntg, female), 4: hQC-Line 53 No.27 (tg, female), 5: hQC-Line 37
  • Figure 16 Analytical restriction digestion of the generated plasmid vector. The fragment with a size of 7929 was used for microinjection. Lanes : 1, Hind III - Ladder; 2, pUC18-mThyl-hQC / Not I / Pvu I (7929bp + 1443bp + 896 bp) ; 3, Pst I - Ladder; 4, PCR: pUC18-mThyl-hQC 27 ng (1316 bp) ; 5, PCR: pUC18-mThyl-hQC 27 ng + 100 ng gDNA (1316 bp) ; 6, PCR: 100 ng gDNA; 7, PCR: Non template control; 8, 1 kb Ladder
  • Figure 17 Quantitative determination of transcript levels of human QC (real-time PCR) of three different founder lines. The levels are depicted as relative values compared with a standard, GAPDH (Glyceraldehyd-3-Phosphate Dehydrogenase) . Highest transcript levels were determined with line 53, which also displayed the highest QC activity.
  • GAPDH Glyceraldehyd-3-Phosphate Dehydrogenase
  • the present invention comprises methods and compositions for the generation of a transgenic animal model for the study of Qpct-related diseases and the transgenic non-human animal per se.
  • the present invention specifically comprises methods and compositions for generating a transgenic animal model that overexpresses glutaminyl-peptide cyclotransferase enzyme (Qpct) and the transgenic non-human animal per se.
  • the present invention further comprises methods and compositions for testing Qpct inhibitors and promoters and methods of prevention/treatment and pharmaceutical compositions with Qpct inhibitors/promoters .
  • the present invention also provides a new method for the treatment of Mild Cognitive Impairment (MCI), Alzheimer's disease, Familial Danish Dementia, Familial British Dementia and neurodegeneration in Down Syndrome.
  • MCI Mild Cognitive Impairment
  • the pGlu formation is an important event in the development and progression in the disease, since the modified amyloid ⁇ -peptides, ADan and ABri show an enhanced tendency to amyloid aggregation and toxicity, likely worsening the onset and progression of the disease. (Russo, C. et al . 2002 J Neurochem 82, 1480-1489; Ghiso, J. et al . 2001 Amyloid 8, 277- 284) .
  • glutamic acid is present as an N-terminal amino acid.
  • transgene means a segment of DNA that has been incorporated into a host genome or is capable of autonomous replication in a host cell and is capable of causing the expression of one or more cellular products. Exemplary transgenes will provide the host cell, or animals developed therefrom, with a novel phenotype relative to the corresponding non-transformed cell or animal.
  • transgenic animal means a non-human animal, usually a mammal, having a non-endogenous nucleic acid sequence present as an extrachromosomal element in a portion of its cells or stably integrated into its germ line DNA.
  • construct means a recombinant nucleic acid, generally recombinant DNA, that has been generated for the purpose of the expression of a specific nucleotide sequence (s), or is to be used in the construction of other recombinant nucleotide sequences.
  • the recombinant nucleic acid can encode e.g. a chimeric or humanized polypeptide.
  • Polypeptide here pertains to all possible amino acid sequences comprising more than 10 amino acids.
  • operably linked means that a DNA sequence and a regulatory sequence (s) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequence (s) .
  • operatively inserted means that a nucleotide sequence of interest is positioned adjacent a nucleotide sequence that directs transcription and translation of the introduced nucleotide sequence of interest.
  • the Qpct polynucleotides comprising the transgene of the present invention include Qpct cDNA and shall also include modified Qpct cDNA.
  • a "modification" of a nucleic acid can include one or several nucleotide additions, deletions, or substitutions with respect to a reference sequence.
  • a modification of a nucleic acid can include substitutions that do not change the encoded amino acid sequence due to the degeneracy of the genetic code, or which result in a conservative substitution. Such modifications can correspond to variations that are made deliberately, such as the addition of a Poly A tail, or variations which occur as mutations during nucleic acid replication.
  • the term "substantially the same nucleotide sequence” refers to DNA having sufficient identity to the reference polynucleotide, such that it will hybridize to the reference nucleotide under moderately stringent, or higher stringency, hybridization conditions.
  • DNA having "substantially the same nucleotide sequence" as the reference nucleotide sequence can have an identity ranging from at least 60% to at least 95% with respect to the reference nucleotide sequence.
  • Moderately stringent hybridization refers to conditions that permit a target-nucleic acid to bind a complementary nucleic acid.
  • the hybridized nucleic acids will generally have an identity within a range of at least about 60% to at least about 95%.
  • Moderately stringent conditions are conditions equivalent to hybridization in 50% formamide, 5x Denhart ' s solution, 5x saline sodium phosphate EDTA buffer
  • High stringency hybridization refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018M NaCl at about 65° C, for example, if a hybrid is not stable in 0.018M NaCl at about 65° C, it will not be stable under high stringency conditions, as contemplated herein.
  • High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5x Denhart ' s solution, 5x SSPE, 0.2% SDS at about 42° C, followed by washing in 0. Ix SSPE, and 0.1% SDS at about 65° C.
  • the amino acid sequence encoded by the transgene of the present invention can be a Qpct sequence from a human or the Qpct homologue from any species, preferably from a murine species.
  • the amino acid sequence encoded by the transgene of the present invention can also be a fragment of the Qpct amino acid sequence so long as the fragment retains some or all of the function of the full-length Qpct sequence.
  • the sequence may also be a modified Qpct sequence.
  • a "modification" of the amino acid sequence encompasses conservative substitutions of the amino acid sequence. Conservative substitution tables providing functionally similar amino acids are well known in the art. The following six groups each contain amino acids that are conservative substitutions for one another:
  • Phenylalanine (F) , Tyrosine (Y) , Tryptophan (W) Other minor modifications are included within the sequence so long as the polypeptide retains some or all of the structural and/or functional characteristics of a Qpct polypeptide. Exemplary structural or functional characteristics include sequence identity or substantial similarity, antibody reactivity, the presence of conserved structural domains such as RNA binding domains or acidic domains.
  • the invention further provides a DNA construct comprising the Qpct transgene as described above.
  • DNA construct refers to a specific arrangement of genetic elements in a DNA molecule.
  • the invention also provides a DNA construct using polypeptides from other species as well as Qpct mutant non-human mammals expressing BACEl from non-human species.
  • the DNA constructs can be engineered to be operatively linked to appropriate expression elements such as promoters or enhancers to allow expression of a genetic element in the DNA construct in an appropriate cell or tissue.
  • appropriate expression elements such as promoters or enhancers to allow expression of a genetic element in the DNA construct in an appropriate cell or tissue.
  • the use of the expression control mechanisms allows for the targeted delivery and expression of the gene of interest.
  • the constructs of the present invention may be constructed using an expression cassette which includes in the 5 '-3' direction of transcription, a transcriptional and translational initiation region associated with gene expression in brain tissue, DNA encoding a mutant or wild-type Qpct protein, and a transcriptional and translational termination region functional in the host animal.
  • One or more introns also can be present.
  • the transcriptional initiation region can be endogenous to the host animal or foreign or exogenous to the host animal.
  • DNA constructs described herein may be incorporated into vectors for propagation or transfection into appropriate cells to generate Qpct overexpressing mutant non-human mammals and are also comprised by the present invention.
  • One skilled in the art can select a vector based on desired properties, for example, for production of a vector in a particular cell such as a mammalian cell or a bacterial cell.
  • Vectors can contain a regulatory element that provides tissue specific or inducible expression of an operatively linked nucleic acid.
  • tissue-specific promoter or enhancer that allows expression of Qpct polypeptides in a desired tissue. It should be noted that tissue-specific expression as described herein does not require a complete absence of expression in tissues other than the preferred tissue. Instead, “cell-specific” or “tissue-specific” expression refers to a majority of the expression of a particular gene of interest in the preferred cell type or tissue.
  • inducible promoters or enhancers can also be included in the vector for expression of a Qpct polypeptide or nucleic acid that can be regulated.
  • inducible systems include, for example, tetracycline inducible System (Gossen & Bizard, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992); Gossen et al., Science, 268:17664769 (1995); Clontech, Palo Alto, Calif.); metallothionein promoter induced by heavy metals; insect steroid hormone responsive to ecdysone or related steroids such as muristerone (No et al . , Proc. Natl. Acad. Sci.
  • MMTV induced by steroids such as glucocorticoid and estrogen
  • regulatory elements including promoters or enhancers, can be constitutive or regulated, depending upon the nature of the regulation, and can be regulated in a variety of tissues, or one or a few specific tissues.
  • the regulatory sequences or regulatory elements are operatively linked to one of the polynucleotide sequences of the invention such that the physical and functional relationship between the polynucleotide sequence and the regulatory sequence allows transcription of the polynucleotide sequence.
  • Vectors useful for expression in eukaryotic cells can include, for example, regulatory elements including the CAG promoter, the SV40 early promoter, the cytomegalovirus (CMV) promoter, the mouse mammary tumor virus (MMTV) steroid-inducible promoter, Pgtf, Moloney marine leukemia virus (MMLV) promoter, thy-1 promoter and the like.
  • regulatory elements including the CAG promoter, the SV40 early promoter, the cytomegalovirus (CMV) promoter, the mouse mammary tumor virus (MMTV) steroid-inducible promoter, Pgtf, Moloney marine leukemia virus (MMLV) promoter, thy-1 promoter and the like.
  • the vector can contain a selectable marker.
  • a selectable marker refers to a genetic element that provides a selectable phenotype to a cell in which the selectable marker has been introduced.
  • a selectable marker is generally a gene whose gene product provides resistance to an agent that inhibits cell growth or kills a cell.
  • selectable markers can be used in the DNA constructs of the invention, including, for example, Neo, Hyg, hisD, Gpt and BIe genes, as described, for example in Ausubel et al . (Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999)) and U.S. Patent No. 5,981,830.
  • Drugs useful for selecting for the presence of a selectable marker include, for example, G418 for Neo, hygromycin for Hyg, histidinol for hisD, xanthine for Gpt, and bleomycin for BIe (see Ausubel et al, supra, (1999); U.S. Patent No. 5,981,830).
  • DNA constructs of the invention can incorporate a positive selectable marker, a negative selectable marker, or both (see, for example, U.S. Patent No. 5,981,830).
  • the invention primarily provides a non-human transgenic animal whose genome comprises a transgene encoding a Qpct polypeptide.
  • the DNA fragment can be integrated into the genome of a transgenic animal by any method known to those skilled in the art.
  • the DNA molecule containing the desired gene sequence can be introduced into pluripotent cells, such as ES cells, by any method that will permit the introduced molecule to undergo recombination at its regions of homology.
  • Techniques that can be used include, but are not limited to, calcium phosphate/DNA co- precipitates, microinjection of DNA into the nucleus, electroporation, bacterial protoplast fusion with intact cells, transfection, and polycations, (e.g., polybrene, polyornithine, etc.)
  • the DNA can be single or double stranded DNA, linear or circular. (See for example, Hogan et al . , Manipulating the Mouse
  • the zygote is a good target for microinjection, and methods of microinjecting zygotes are well known (see US 4, 873, 191) .
  • Embryonal cells at various developmental stages can also be used to introduce transgenes for the production of transgenic animals. Different methods are used depending on the stage of development of the embryonal cell.
  • Such transfected embryonic stem (ES) cells can thereafter colonize an embryo following their introduction into the blastocoele of a blastocyst-stage embryo and contribute to the germ line of the resulting chimeric animal (reviewed in Jaenisch, Science 240:1468-1474 (1988)).
  • the transfected ES cells Prior to the introduction of transfected ES cells into the blastocoele, the transfected ES cells can be subjected to various selection protocols to enrich the proportion of ES cells that have integrated the transgene if the transgene provides a means for such selection.
  • PCR can be used to screen for ES cells that have integrated the transgene.
  • retroviral infection can also be used to introduce transgenes into a non-human animal.
  • the developing non-human embryo can be cultured in vitro to the blastocyst stage.
  • the blastomeres can be targets for retroviral infection (Janenich, Proc. Nati. Acad. Sci. USA 73:1260-1264 (1976)).
  • Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Hogan et al . , supra, 1986) .
  • the viral vector system used to introduce the transgene is typically a replication-defective retrovirus carrying the transgene (Jahner et al . , Proc. Natl. Acad Sci.
  • transgenes may be introduced into the germline by intrauterine retroviral infection of the mid-gestation embryo (Jahner et al . , supra, 1982).
  • retroviruses or retroviral vectors to create transgenic animals known to those of skill in the art involves the micro-injection of retroviral particles or mitomycin C-treated cells producing retrovirus into the perivitelline space of fertilized eggs or early embryos (WO 90/08832 (1990); Haskell and Bowen, MaI. Reprod. Dev. 40:386 (1995)) .
  • any other technology to introduce transgenes into a non-human animal e.g. the knock-in or the rescue technologies can also be used to solve the problem of the present invention.
  • the knock-in technology is well known in the art as described e.g. in Casas et al. (2004) Am J Pathol 165, 1289-1300.
  • founder animals can be bred, inbred, outbred, or crossbred to produce colonies of the particular animal.
  • breeding strategies include, but are not limited to: outbreeding of founder animals with more than one integration site in order to establish separate lines; inbreeding of separate lines in order to produce compound transgenics that express the transgene at higher levels because of the effects of additive expression of each transgene; crossing of heterozygous transgenic mice to produce mice homozygous for a given integration site in order to both augment expression and eliminate the need for screening of animals by DNA analysis; crossing of separate homozygous lines to produce compound heterozygous or homozygous lines; breeding animals to different inbred genetic backgrounds so as to examine effects of modifying alleles on expression of the transgene and the effects of expression.
  • the transgenic animals are screened and evaluated to select those animals having the phenotype of interest.
  • Initial screening can be performed using, for example, Southern blot analysis or PCR techniques to analyze animal tissues to verify that integration of the transgene has taken place.
  • the level of mRNA expression of the transgene in the tissues of the transgenic animals can also be assessed using techniques which include, but are not limited to, Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis, and reverse transcriptase-PCR (rt-PCR) . Samples of the suitable tissues can be evaluated immunocytochemically using antibodies specific for Qpct or with a tag such as EGFP.
  • the transgenic non-human mammals can be further characterized to identify those animals having a phenotype useful in methods of the invention.
  • transgenic non-human mammals overexpressing Qpct can be screened using the methods disclosed herein. For example, tissue sections can be viewed under a fluorescent microscope for die present of fluorescence, indicating the presence of the reporter gene.
  • tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al . , (1987) Genes Dev. 1:268-277); lymphoid-specific promoters (Calame and Eaton (1988) Adv. Immunol. 43:235-275), in particular promoters of T cell receptors (Winoto and Baltimore (1989) EMBO J. 8:729- 733) and immunoglobulins (Banerji et al .
  • albumin promoter liver-specific; Pinkert et al . , (1987) Genes Dev. 1:268-277
  • lymphoid-specific promoters Calame and Eaton (1988) Adv. Immunol. 43:235-275
  • promoters of T cell receptors Winoto and Baltimore (1989) EMBO J. 8:729- 733
  • immunoglobulins Bonerji et al .
  • neuron-specific promoters e.g., the neurofilament promoter, the Thy-1 promoter or the Bri-protein promoter; Sturchler-Pierrat et al . , (1997) Proc. Natl. Acad Sci. USA 94:13287-13292, Byrne and Ruddle (1989) PNAS 86:5473-5477
  • pancreas-specific promoters Edlund et al .
  • the invention further provides an isolated cell containing a DNA construct of the invention.
  • the DNA construct can be introduced into a cell by any of the well-known transfection methods
  • the cell can be obtained by isolating a cell from a mutant non-human mammal created as described herein.
  • the invention provides a cell isolated from a Qpct mutant non-human mammal of the invention, in particular, a Qpct mutant mouse.
  • the cells can be obtained from a homozygous Qpct mutant non-human mammal such as a mouse or a heterozygous Qpct mutant non-human mammal such as a mouse.
  • Effectors are defined as molecules that bind to enzymes and increase ( * promote) or decrease
  • Enzymes ( _ inhibit) their activity in vitro and/or in vivo.
  • Some enzymes have binding sites for molecules that affect their catalytic activity; a stimulator molecule is called an activator. Enzymes may even have multiple sites for recognizing more than one activator or inhibitor. Enzymes can detect concentrations of a variety of molecules and use that information to vary their own activities.
  • Effectors can modulate enzymatic activity because enzymes can assume both active and inactive conformations: activators are positive effectors, inhibitors are negative effectors. Effectors act not only at the active sites of enzymes, but also at regulatory sites, or allosteric sites, terms used to emphasize that the regulatory site is an element of the enzyme distinct from the catalytic site and to differentiate this form of regulation from competition between substrates and inhibitors at the catalytic site (Darnell, J., Lodish, H. and Baltimore, D. 1990, Molecular Cell Biology 2"d Edition, Scientific American Books, New York, page 63) .
  • each amino acid residue is represented by a one- letter or a three-letter designation, corresponding to the trivial name of the amino acid, in accordance with the following conventional list:
  • QC or “Qpct” as used herein are both intended to refer to the same and comprise glutaminyl cyclase (QC) , i . e . glutaminyl-peptidecyclotransferase (EC 2.3.2.5.) and QC-like enzymes.
  • QC and QC-like enzymes have identical or similar enzymatic activity, further defined as QC activity.
  • QC-like enzymes can fundamentally differ in their molecular structure from QC.
  • QC activity is defined as intramolecular cyclization of N-terminal glutamine residues into pyroglutamic acid (pGlu*) or of N-terminal L-homoglutamine or L- ⁇ -homoglutamine to a cyclic pyro-homoglutamine derivative under liberation of ammonia. See schemes 1 and 2.
  • EC as used herein comprises the side activity of QC and QC-like enzymes as glutamate cyclase (EC) , further defined as EC activity.
  • EC activity as used herein is defined as intramolecular cyclization of N-terminal glutamate residues into pyroglutamic acid (pGlu*) by QC. See scheme 3.
  • metal-dependent enzyme as used herein is defined as enzyme (s) that require a bound metal ion in order to fulfil their catalytic function and/or require a bound metal ion in order to form the catalytically active structure.
  • Qpct-related disease refers to all those diseases, disorders or conditions that are modulated by Qpct.
  • the methods and compositions of the present invention are particularly useful in the evaluation of effectors of Qpct and for the development of drugs and therapeutic agents for the treatment and prevention of amyloid-associated diseases such as Mild Cognitive Impairment, Alzheimer's disease, neurodegeneration in Down Syndrome, Familial Danish Dementia and Familial British Dementia.
  • the transgenic animal or the cells of the transgenic animal of the invention can be used in a variety of screening assays.
  • any of a variety of potential agents suspected of affecting Qpct and amyloid accumulation, as well as the appropriate antagonists and blocking therapeutic agents can be screened by administration to the transgenic animal and assessing the effect of these agents upon the function and phenotype of the cells and on the (neurological) phenotype of the transgenic animals.
  • Behavioral studies may also be used to test potential therapeutic agents, such as those studies designed to assess motor skills, learning and memory deficits.
  • An example of such a test is the Morris Water maze (Morris (1981) Learn Motivat 12:239-260) .
  • behavioral studies may include evaluations of locomotor activity such as with the rotor-rod and the open field.
  • the methods of the invention can advantageously use cells isolated from a homozygous or heterozygous Qpct mutant non-human mammal, to study amyloid accumulation as well as to test potential therapeutic compounds.
  • the methods of the invention can also be used with cells expressing Qpct such as a transfected cell line.
  • a cell overexpressing Qpct can be used in an in vitro method to screen compounds as potential therapeutic agents for treating A ⁇ associated disease.
  • a compound is contacted with a cell overexpressing Qpct, a transfected cell or a cell derived from a Qpct mutant non-human animal, and screened for alterations in a phenotype associated with expression of Qpct.
  • the changes in A ⁇ production in the cellular assay and the transgenic animal can be assessed by methods well known to those skilled in the art.
  • a Qpct fusion polypeptide such as Qpct can be particularly useful for such screening methods since the expression of Qpct can be monitored by fluorescence intensity.
  • Other exemplary fusion polypeptides include other fluorescent proteins, or modifications thereof, glutathione S transferase (GST) , maltose binding protein, poly His, and the like, or any type of epitope tag.
  • GST glutathione S transferase
  • Such fusion polypeptides can be detected, for example, using antibodies specific to the fusion polypeptides.
  • the fusion polypeptides can be an entire polypeptide or a functional portion thereof so long as the functional portion retains desired properties, for example, antibody binding activity or fluorescence activity.
  • the invention further provides a method of identifying a potential therapeutic agent for use in treating the diseases as mentioned above.
  • the method includes the steps of contacting a cell containing a DNA construct comprising polynucleotides encoding a Qpct polypeptide with a compound and screening the cell for decreased Qpct production, thereby identifying a potential therapeutic agent for use in treating Qpct-related diseases.
  • the cell can be isolated from a transgenic non-human mammal having nucleated cells containing the Qpct DNA construct.
  • the cell can contain a DNA construct comprising a nucleic acid encoding a green fluorescent protein fusion, or other fusion polypeptide, with a Qpct polypeptide.
  • cells expressing a Qpct polypeptide can be used in a preliminary screen to identify compounds as potential therapeutic agents having activity that alters a phenotype associated with Qpct expression.
  • an appropriate control cell can be used to compare the results of the screen.
  • the effectiveness of compounds identified by an initial in vitro screen using cells expressing Qpct can be further tested in vivo using the invention Qpct mutant non-human mammals, if desired.
  • the invention provides methods of screening a large number of compounds using a cell-based assay, for example, using high throughput screening, as well as methods of further testing compounds as therapeutic agents in an animal model of A ⁇ -related disorders .
  • QC is involved in the formation of pyroglutamic acid that favors the aggregation of amyloid ⁇ -peptides.
  • an inhibition of QC leads to a prevention of the precipitation of the plaque-forming [pGlu 3 ] A ⁇ 3-40/42/43 or [pGlu 11 ] A ⁇ ll-40/42/43, causing the onset and progression of Alzheimer's disease and Down Syndrome, independently of the mechanism by which cyclization occurs.
  • Glutamate is found in positions 3, 11 and 22 of the amyloid ⁇ - peptide.
  • the mutation from glutamic acid (E) to glutamine (Q) in position 22 (corresponds to amino acid 693 of the amyloid precursor protein APP770, Swissprot entry: P05067) has been described as the so-called Dutch type cerebroarterial amyloidosis mutation.
  • ⁇ -amyloid peptides with a pyroglutamic acid residue in position 3, 11 and/or 22 have been described to be more cytotoxic and hydrophobic than A ⁇ l-40/4243 (Saido T. C. 2000 Medical Hypotheses 54(3): 427-429).
  • the multiple N-terminal variations can be generated by the ⁇ - secretase enzyme ⁇ -site amyloid precursor protein-cleaving enzyme (BACE) at different sites (Huse J. T. et al . 2002 Biol. Chem. 277 (18): 16278-16284), and/or by aminopeptidase processing.
  • BACE ⁇ -site amyloid precursor protein-cleaving enzyme
  • the N-terminal Glu-residue in Glu-containing peptides is predominantly bivalently charged at neutral pH.
  • Glutamate exhibits pK a -values of about 4.2 and 7.5 for the ⁇ -carboxylic and for the CC-amino moiety, respectively, i.e. at neutral pH and above, although the ⁇ -amino nitrogen is in part or fully unprotonated and nucleophilic, the ⁇ -carboxylic group is unprotonated, and so exercising no electrophilic carbonyl activity. Hence, intramolecular cyclization is impossible .
  • -/K ] y [ ) of the QC-catalyzed glutamate cyclization might be in the range of l*10 5 - l*10 6 fold slower than the one for glutamine cyclization.
  • the nonenzymatic turnover of both model substrates Glu- ⁇ NA and GIn- ⁇ NA is negligible, being conform with the observed negligible pGlu-peptide formation.
  • an acceleration of at least 10 8 can be estimated from the ratio of the enzymatic versus non-enzymatic rate constants (comparing the second-order rate constants for the enzyme catalysis with the respective nonenzymatic cyclization first-order rate constants the catalytic proficiency factor is 10 9 -10 10 M "1 for the GIn- and the Glu-conversion, respectively) .
  • the conclusion from these data is, that in vivo only an enzymatic path resulting pGlu- formations seems conceivable.
  • the present invention provides the use of activity-decreasing effectors of QC and EC, as selected with use of the present inventive animal model, for the suppression of pGlu-Amyloid peptide formation in Mild Cognitive Impairment, Alzheimer's disease, Down Sydrome, Famlilial Danish Dementia and Familial British Dementia.
  • the present invention provides the use of activity-increasing effectors of QC, as selected with use of the present inventive animal model, for the stimulation of gastrointestinal tract cell proliferation, especially gastric mucosal cell proliferation, epithelial cell proliferation, the differentiation of acid-producing parietal cells and histamine- secreting enterochromaffin-like (ECL) cells, and the expression of genes associated with histamine synthesis and storage in ECL cells, as well as for the stimulation of acute acid secretion in mammals by maintaining or increasing the concentration of active [pGlu-L] -Gastrin.
  • gastrointestinal tract cell proliferation especially gastric mucosal cell proliferation, epithelial cell proliferation, the differentiation of acid-producing parietal cells and histamine- secreting enterochromaffin-like (ECL) cells, and the expression of genes associated with histamine synthesis and storage in ECL cells, as well as for the stimulation of acute acid secretion in mammals by maintaining or increasing the concentration of active [pGlu-L] -Gastrin.
  • the present invention provides the use of activity decreasing effectors of QC, as selected with use of the present inventive animal model, for the treatment of duodenal ulcer disease and gastric cancer with or without Helicobacter pylori in mammals by decreasing the conversion rate of inactive [GIn ⁇ ] Gastrin to active [pGlu-L] Gastrin .
  • Neurotensin is a neuropeptide implicated in the pathophysiology of schizophrenia that specifically modulates neurotransmitter systems previously demonstrated to be misregulated in this disorder.
  • Clinical studies in which cerebrospinal fluid (CSF) NT concentrations have been measured revealed a subset of schizophrenic patients with decreased CSF NT concentrations that are restored by effective antipsychotic drug treatment.
  • CSF cerebrospinal fluid
  • NT systems in the mechanism of action of antipsychotic drugs.
  • the behavioural and biochemical effects of centrally administered NT remarkably resemble those of systemically administered antipsychotic drugs, and antipsychotic drugs increase NT neurotransmission. This concatenation of findings led to the hypothesis that NT functions as an endogenous antipsychotic.
  • typical and atypical antipsychotic drugs differentially alter NT neurotransmission in nigrostriatal and mesolimbic dopamine terminal regions, and these effects are predictive of side effect liability and efficacy, respectively (Binder, E. B. et al. 2001 Biol Psychiatry 50 856-872) .
  • the present invention provides the use of activity increasing effectors of QC, as selected with use of the present inventive animal model, for the preparation of antipsychotic drugs and/or for the treatment of schizophrenia in mammals.
  • the effectors of QC either maintain or increase the concentration of active [pGlu-L] neurotensin .
  • Fertilization promoting peptide (FPP) , a tripeptide related to thyrotrophin releasing hormone (TRH) , is found in seminal plasma. Recent evidence obtained in vitro and in vivo showed that FPP plays an important role in regulating sperm fertility. Specifically, FPP initially stimulates nonfertilizing (incapacitated) spermatozoa to "switch on” and become fertile more quickly, but then arrests capacitation so that spermatozoa do not undergo spontaneous acrosome loss and therefore do not lose fertilizing potential. These responses are mimicked, and indeed augmented, by adenosine, known to regulate the adenylyl cyclase (AC) /cAMP signal transduction pathway.
  • AC adenylyl cyclase
  • FPP and adenosine have been shown to stimulate cAMP production in incapacitated cells but inhibit it in capacitated cells, with FPP receptors somehow interacting with adenosine receptors and G proteins to achieve regulation of AC. These events affect the tyrosine phosphorylation state of various proteins, some being important in the initial "switching on”, and others possibly being involved in the acrosome reaction itself.
  • Calcitonin and angiotensin II also found in seminal plasma, have similar effects in vitro on incapacitated spermatozoa and can augment responses to FPP. These molecules have similar effects in vivo, affecting fertility by stimulating and then maintaining fertilizing potential.
  • the present invention provides the use of activity-lowering effectors of QC, as selected with the present inventive animal model, for the preparation of fertilization prohibitive drugs and/or to reduce the fertility in mammals.
  • the activity lowering effectors of QC decrease the concentration of active [pGlu ⁇ JFPP, leading to a prevention of sperm capacitation and deactivation of sperm cells.
  • activity-increasing effectors of QC are able to stimulate fertility in males and to treat infertility.
  • the present invention provides the use of effectors of QC, as selected with use of the present inventive animal model, for the preparation of a medicament for the treatment of pathophysiological conditions, such as suppression of proliferation of myeloid progenitor cells, neoplasia, inflammatory host responses, cancer, malign metastasis, melanoma, psoriasis, rheumatoid arthritis, atherosclerosis, lung fibrosis, liver fibrosis, renal fibrosis, graft rejection, acquired immune deficiency syndrom, impaired humoral and cell- mediated immunity responses, leukocyte adhesion and migration processes at the endothelium.
  • pathophysiological conditions such as suppression of proliferation of myeloid progenitor cells, neoplasia, inflammatory host responses, cancer, malign metastasis, melanoma, psoriasis, rheumatoid arthritis, atherosclerosis, lung fibrosis, liver fibrosis,
  • the present invention provides the use of effectors of QC, as selected with use of the present inventive animal model, for the preparation of a medicament for the treatment of impaired food intake and sleep-wakefulness, impaired homeostatic regulation of energy metabolism, impaired autonomic function, impaired hormonal balance and impaired regulation of body fluids.
  • the present invention therefore provides the use of effectors of QC, as selected with the present inventive animal model, for the preparation of a medicament for the treatment of Parkinson disease and Huntington's disease.
  • the present invention provides a general way to reduce or inhibit the enzymatic activity of QC by using the test agent selected above.
  • human QC and other animal QCs are metal-dependent enzymes, as revealed by the inhibition characteristics of QC by 1, 10- phenanthroline, dipicolinic acid, 8-hydroxy-quinoline and other chelators and by the reactivation of QC by transition metal ions.
  • metal dependence is outlined by a sequence comparison to other metal-dependent enzymes, showing a conservation of the chelating amino acid residues also in human QC.
  • the interaction of compounds with the active-site bound metal ion represents a general way to reduce or inhibit QC activity.
  • mammalian QC in particular human or murine QC, or Papaya QC.
  • mammalian QC since the effectors identified by these screening methods shall be used for the treatment of diseases in mammals, especially in humans.
  • transgene encodes an isoenzyme of Qpct .
  • isoenzymes having significant sequence similarity to glutaminyl cyclase are proteins (Qpctl's) from human (further named as human isoQC) (GenBank accession no. NM_017659), mouse (GenBank accession no. NM 027455), Macaca fascicularis (GenBank accession no. AB168255), Macaca mulatta (GenBank accession no.
  • BT026254 or an analogue thereof having at least 50% / 75% sequence identity / similarity, preferably 70% / 85% sequence identity / similarity, most preferably 90% / 95% sequence identity / similarity.
  • sequences are given in SEQ. ID NOS: 15 to 25. Further disclosed are nucleic acid sequences coding for these proteins (SEQ. ID NOS: 26 to 36) .
  • Qpctl's selected from the group consisting of human Qpctl including isoforms and spliceforms thereof, given in SEQ. ID NOS: 15 to 17, 24 and 25; rat (SEQ. ID NO: 21) and mouse (SEQ. ID NO: 22) .
  • Qpctl's selected from the group consisting of human Qpctl including isoforms, given in SEQ. ID NOS: 15 to 17; and mouse (SEQ. ID NO: 22) .
  • Qpctl's selected from the group consisting of human (SEQ. ID NO: 15), and mouse (SEQ. ID NO: 22) .
  • the agents selected by the above-described screening methods can work by decreasing the conversion of at least one substrate of QC (negative effectors, inhibitors) , or by increasing the conversion of at least one substrate of QC (positive effectors, activators) .
  • the compounds of the present invention can be converted into acid addition salts, especially pharmaceutically acceptable acid addition salts.
  • the salts of the compounds of the invention may be in the form of inorganic or organic salts.
  • the compounds of the present invention can be converted into and used as acid addition salts, especially pharmaceutically acceptable acid addition salts.
  • the pharmaceutically acceptable salt generally takes a form in which a basic side chain is protonated with an inorganic or organic acid.
  • Representative organic or inorganic acids include hydrochloric, hydrobromic, perchloric, sulfuric, nitric, phosphoric, acetic, propionic, glycolic, lactic, succinic, maleic, fumaric, malic, tartaric, citric, benzoic, mandelic, methanesulfonic, hydroxyethanesulfonic, benzenesulfonic, oxalic, pamoic, 2- naphthalenesulfonic, p-toluenesulfonic, cyclohexanesulfamic, salicylic, saccharinic or trifluoroacetic acid. All pharmaceutically acceptable acid addition salt forms of the compounds of the present invention are intended to be embraced by the scope of
  • the compounds according to this invention may accordingly exist as enantiomers. Where the compounds possess two or more chiral centers, they may additionally exist as diastereomers . It is to be understood that all such isomers and mixtures thereof are encompassed within the scope of the present invention. Furthermore, some of the crystalline forms of the compounds may exist as polymorphs and as such are intended to be included in the present invention. In addition, some of the compounds may form solvates with water (i.e. hydrates) or common organic solvents, and such solvates are also intended to be encompassed within the scope of this invention .
  • the compounds, including their salts, can also be obtained in the form of their hydrates, or include other solvents used for their crystallization.
  • the present invention provides a method of preventing or treating a condition mediated by modulation of the QC enzyme activity in a subject in need thereof which comprises administering any of the compounds of the present invention or pharmaceutical compositions thereof in a quantity and dosing regimen therapeutically effective to treat the condition.
  • the present invention includes the use of the compounds of this invention, and their corresponding pharmaceutically acceptable acid addition salt forms, for the preparation of a medicament for the prevention or treatment of a condition mediated by modulation of the QC activity in a subject.
  • the compound may be administered to a patient by any conventional route of administration, including, but not limited to, intravenous, oral, subcutaneous, intramuscular, intradermal, parenteral and combinations thereof.
  • the invention relates to pharmaceutical compositions, that is to say, medicaments, that contain at least one compound of the invention or salts thereof, optionally in combination with one or more pharmaceutically acceptable carriers and/or solvents.
  • the pharmaceutical compositions may, for example, be in the form of parenteral or enteral formulations and contain appropriate carriers, or they may be in the form of oral formulations that may contain appropriate carriers suitable for oral administration. Preferably, they are in the form of oral formulations .
  • the effectors of QC activity administered according to the invention may be employed in pharmaceutically administrable formulations or formulation complexes as inhibitors or in combination with inhibitors, substrates, pseudosubstrates, inhibitors of QC expression, binding proteins or antibodies of those enzyme proteins that reduce the QC protein concentration in mammals.
  • the compounds of the invention make it possible to adjust treatment individually to patients and diseases, it being possible, in particular, to avoid individual intolerances, allergies and side-effects.
  • the compounds also exhibit differing degrees of activity as a function of time.
  • the physician providing treatment is thereby given the opportunity to respond differently to the individual situation of patients: he is able to adjust precisely, on the one hand, the speed of the onset of action and, on the other hand, the duration of action and especially the intensity of action .
  • a preferred treatment method according to the invention represents a new approach for the prevention or treatment of a condition mediated by modulation of the QC enzyme activity in mammals. It is advantageously simple, susceptible of commercial application and suitable for use, especially in the treatment of diseases that are based on unbalanced concentration of physiological active QC substrates in mammals and especially in human medicine.
  • the compounds may be advantageously administered, for example, in the form of pharmaceutical preparations that contain the active ingredient in combination with customary additives like diluents, excipients and/or carriers known from the prior art.
  • they can be administered parenterally (for example i.v. in physiological saline solution) or enterally (for example orally, formulated with customary carriers) .
  • one or more doses of the compounds can be given per day in order to achieve the desired normalisation of the blood glucose values.
  • a dosage range in humans may be in the range of from about 0.01 mg to 250.0 mg per day, preferably in the range of about 0.01 to 100 mg of compound per kilogram of body weight.
  • effectors of QC activity to a mammal it could be possible to stimulate gastrointestinal tract cell proliferation, preferably proliferation of gastric mucosal cells, epithelial cells, acute acid secretion and the differentiation of acid producing parietal cells and histamine- secreting enterochromaffin-like cells.
  • the prevent invention provides a method for the regulation and control of male fertility and the use of activity lowering effectors of QC for the preparation of contraceptive medicaments for males. Furthermore, by administering effectors of QC activity to a mammal it may be possible to suppress the proliferation of myeloid progenitor cells.
  • the compounds used according to the invention can accordingly be converted in a manner known per se into conventional formulations, such as, for example, tablets, capsules, dragees, pills, suppositories, granules, aerosols, syrups, liquid, solid and cream-like emulsions and suspensions and solutions, using inert, non-toxic, pharmaceutically suitable carriers and additives or solvents.
  • the therapeutically effective compounds are preferably present in a concentration of approximately from 0.1 to 80 % by weight, more preferably from 1 to 50 % by weight, of the total mixture, that is to say, in amounts sufficient for the mentioned dosage latitude to be obtained.
  • the substances can be used as medicaments in the form of dragees, capsules, bitable capsules, tablets, drops, syrups or also as suppositories or as nasal sprays.
  • the formulations may be advantageously prepared, for example, by extending the active ingredient with solvents and/or carriers, optionally with the use of emulsifiers and/or dispersants, it being possible, for example, in the case where water is used as diluent, for organic solvents to be optionally used as auxiliary solvents .
  • excipients useful in connection with the present invention include: water, non-toxic organic solvents, such as paraffins (for example natural oil fractions) , vegetable oils
  • emulsifiers such as non-ionic and anionic emulsifiers (for example polyoxyethylene fatty acid esters, polyoxyethylene fatty alcohol ethers, alkylsulphonates and arylsulphonates) , dispersants (for example lignin, sulphite liquors, methylcellulose, starch and polyvinylpyrrolidone) and lubricants (for example magnesium stearate, talcum, stearic acid and sodium lauryl sulphate) and optionally flavourings.
  • natural powdered minerals for example highly dispersed silica, silicates
  • sugars for example raw sugar, lactose and dextrose
  • emulsifiers such as non-ionic and anionic emulsifiers (for example polyoxyethylene fatty acid esters, polyoxyethylene fatty alcohol ethers, alkylsulphonates and arylsulphonates)
  • dispersants for example lignin, sulphite liquor
  • Administration may be carried out in the usual manner, preferably enterally or parenterally, especially orally.
  • tablets may contain in addition to the mentioned carriers further additives such as sodium citrate, calcium carbonate and calcium phosphate, together with various additives, such as starch, preferably potato starch, gelatin and the like.
  • lubricants such as magnesium stearate, sodium lauryl sulphate and talcum, can be used concomitantly for tabletting.
  • various taste correctives or colourings can be added to the active ingredients in addition to the above-mentioned excipients.
  • solutions of the active ingredients using suitable liquid carriers can be employed.
  • Pichia pastoris strain X33 (AOXl, AOX2), used for the expression of human QC was grown, transformed and analyzed according to the manufacturer's instructions (Invitrogen) .
  • the media required for P. pastoris i.e. buffered glycerol (BMGY) complex or methanol (BMMY) complex medium, and the fermentation basal salts medium were prepared according to the manufacturer's recommendations.
  • the pQE-31 vector (Qiagen) was used to express the human QC in E. coll.
  • the cDNA of the mature QC starting with codon 38 was fused in frame with the plasmid encoded ⁇ xhistidine tag.
  • the fragment was inserted into the expression vector employing the restriction sites of Sphl and Hindlll. Transformation of P. pastoris and mini-scale expression Plasmid DNA was amplified in E. coli JM109 and purified according to the recommendations of the manufacturer (Qiagen) .
  • plasmid In the expression plasmid used, pPICZCCB, three restriction sites are provided for linearization. Since Sacl and BstXI cut within the QC cDNA, Pmel was chosen for linearization. 20-30 ⁇ g plasmid DNA was linearized with Pmel, precipitated by ethanol, and dissolved in sterile, deionized water. 10 ⁇ g of the DNA was then applied for transformation of competent P. pastoris cells by electroporation according to the manufacturer's instructions (BioRad) . Selection was done an plates containing 150 ⁇ g/ml Zeocin. One transformation using the linearized plasmid yielded several hundred transformants .
  • recombinant yeast clones were grown for 24 h in 10 ml conical tubes containing 2 ml BMGY. Afterwards, the yeast was centrifuged and resuspended in 2 ml BMMY containing 0.5 % methanol. This concentration was maintained by addition of methanol every 24 h up to 72 h. Subsequently, QC activity in the supernatant was determined. The presence of the fusion protein was confirmed by western blot analysis using an antibody directed against the ⁇ xhistidine tag (Qiagen) . Clones that displayed the highest QC activity were chosen for further experiments and fermentation.
  • the pH was adjusted to 6.8 by addition of NaOH, and the resultant turbid solution was centrifuged again at 37000xg, 4°C for 40 min. In cases of continued turbidity, an additional filtration step was applied using a cellulose membrane (pore width 0.45 ⁇ m) .
  • the His-tagged QC was first purified by immobilized metal affinity chromatography (IMAC) .
  • IMAC immobilized metal affinity chromatography
  • 1000 ml of culture supernatant were applied to a Ni2+-loaded Chelating Sepharose FF column (1.6 x 20 cm, Pharmacia), that was equilibrated with 50 mM phosphate buffer, pH 6.8, containing 750 mM NaCl, at a flow rate of 5 ml/min.
  • the bound protein was eluted by a shift to 50 mM phosphate buffer, pH 6.8, containing 150 mM NaCl and 100 mM histidine.
  • the resulting eluate was dialyzed against 20 mM Bis-Tris/HCI, pH 6.8, at 4°C overnight.
  • the QC was further purified by anion exchange chromatography an a Mono Q6 column (BioRad) , equilibrated with dialysis buffer. The QC-containing fraction was loaded onto the column using a flow rate of 4 ml/min.
  • the construct encoding the QC was transformed into M15 cells
  • the solution was clarified by centrifugation at 37000 xg, 4 0 C for 30 min, followed by a filtration applying a glass frit (DNA separation) and two additional filtration steps applying cellulose filters for crude and fine precipitates.
  • the supernatant (approx. 500 ml) was applied onto a Ni 2+ -affinity column (1.6 x 20 cm) at a flow rate of 1 ml/min.
  • Elution of QC was carried out with 50 mM phosphate buffer containing 150 mM NaCl and 100 mM histidine.
  • the QC- containing fraction was concentrated by ultrafiltration.
  • QC from papaya latex was prepared using the BioCAD 700E (Perseptive Biosystems, Wiesbaden, Germany) with a modified version of a previously reported method (Zerhouni, S. et al . 1989 Biochim Biophys Acta 138, 275-290) . 50 g latex was dissolved in water and centrifugated as described therein. Inactivation of proteases was performed with S-methyl methane thiosulfonate, and the resultant crude extract was dialyzed.
  • Concentration and buffer changes to 0.02 M Tris/HCI, pH 8.0 were performed via ultrafiltration (Amicon; molecular mass cut-off of the membrane 10 kDa) .
  • Ammonium sulfate was added to the concentrated papaya enzyme, obtained from the ion exchange chromatography step to a final concentration of 2 M.
  • This solution was applied onto a (21X2.5 cm i.d.) Butyl Sepharose 4 Fast Flow column (flow rate 1.3 ml/min) , equilibrated with 2 M ammonium sulfate, 0,02 M Tris/HCl, pH 8.0. Elution was performed in three steps with decreasing concentrations of ammonium sulfate.
  • the first step a linear gradient from 2 to 0.6 M ammonium sulfate, 0.02 M Tris/HCl, pH 8.0 was applied for 0.5 column volumes at a flow rate of 1.3 ml/min.
  • the second step was a linear gradient from 0.6 to 0 M ammonium sulfate, 0.02 M Tris/HCl, pH 8.0, in 5 column volumes at a flow rate of 1.5 ml/min.
  • the last elution step was carried out by applying 0.02 M Tris/HCl at pH 8.0 for 2 column volumes at a flow rate of 1.5 ml/min. All fractions containing QC activity were pooled and concentrated by ultrafiltration. The resultant homogenous QC was stored at 70°C. Final protein concentrations were determined using the method of Bradford, compared to a standard curve obtained with bovine serum albumin.
  • the cDNA sequence of human Qpct is shown in SEQ ID No: 12, while the protein sequence is shown in SEQ ID No: 13.
  • QC activity was determined from a standard curve of ⁇ - naphthylamine under assay conditions. One unit is defined as the amount of QC catalyzing the formation of 1 ⁇ mol pGlu- ⁇ NA from H- Gln- ⁇ NA per minute under the described conditions.
  • QC was activity was determined using H-GIn-AMC as substrate. Reactions were carried out at 30 0 C utilizing the NOVOStar reader for microplates (BMG labtechnologies) . The samples consisted of varying concentrations of the fluorogenic substrate, 0.1 U pyroglutamyl aminopeptidase (Qiagen) in 0.05 M Tris/HCI, pH 8.0 containing 5 mM EDTA and an appropriately diluted aliquot of QC in a final volume of 250 ⁇ l . Excitation/emission wavelengths were 380/460 nm. The assay reactions were initiated by addition of glutaminyl cyclase. QC activity was determined from a standard curve of 7- amino-4-methylcoumarin under assay conditions. The kinetic data were evaluated using GraFit sofware.
  • This novel assay was used to determine the kinetic parameters for most of the QC substrates.
  • QC activity was analyzed spectrophotometrically using a continuous method, that was derived by adapting a previous discontinuous assay (Bateman, R. C. J. 1989 J Neurosci Methods 30, 23-28) utilizing glutamate dehydrogenase as auxiliary enzyme.
  • Samples consisted of the respective QC substrate, 0.3 mM NADH, 14 mM CC-ketoglutaric acid and 30 U/ml glutamate dehydrogenase in a final volume of 250 ⁇ l . Reactions were started by addition of QC and pursued by monitoring of the decrease in absorbance at 340 nm for 8-15 min.
  • the initial velocities were evaluated and the enzymatic activity was determined from a standard curve of ammonia under assay conditions. All samples were measured at 30 0 C, using either the SPECTRAFIuor Plus or the Sunrise (both from TECAN) reader for microplates. Kinetic data was evaluated using GraFit software.
  • the sample composition was the same as described above, except for the putative inhibitory compound added.
  • samples contained 4 mM of the respective inhibitor and a substrate concentration at 1 K ] v [ .
  • influence of the inhibitor on the auxiliary enzymes was investigated first. In every case, there was no influence on either enzyme detected, thus enabling the reliable determination of the QC inhibition.
  • the inhibitory constant was evaluated by fitting the set of progress curves to the general equation for competitive inhibition using GraFit software .
  • Matrix-assisted laser desorption/ionization mass spectrometry was carried out using the Hewlett-Packard G2025 LD-TOF System with a linear time of flight analyzer.
  • the instrument was equipped with a 337 nm nitrogen laser, a potential acceleration source (5 kV) and a 1.0 m flight tube.
  • Detector operation was in the positive-ion mode and signals were recorded and filtered using LeCroy 9350M digital storage oscilloscope linked to a personal computer. Samples (5 ⁇ l) were mixed with equal volumes of the matrix solution.
  • DHAP/DAHC prepared by solving 30 mg 2 ' , 6 ' -dihydroxyacetophenone (Aldrich) and 44 mg diammonium hydrogen citrate (Fluka) in 1 ml acetonitrile/0.1% TFA in water (1/1, v/v) .
  • a small volume ( ⁇ 1 ⁇ l) of the matrix-analyte-mixture was transferred to a probe tip and immediately evaporated in a vacuum chamber (Hewlett-Packard G2024A sample prep accessory) to ensure rapid and homogeneous sample crystallization.
  • a ⁇ -derived peptides were incubated in 100 ⁇ l 0.1 M sodium acetate buffer, pH 5.2 or 0.1 M Bis-Tris buffer, pH 6.5 at 30 0 C. Peptides were applied in 0.5 mM [A ⁇ 3-ll a] or 0.15 mM [A ⁇ 3-21a] concentrations, and 0.2 U QC was added all 24 hours. In case of A ⁇ 3-21a, the assays contained 1 % DMSO. At different times, samples were removed from the assay tube, peptides extracted using ZipTips
  • Murine Qpct was isolated from murine insulinoma cell line ⁇ -TC 3 by RT-PCR using primers derived from a putative murine QC cDNA, which was deposited in the nucleotide database as entry AK017598 and sub-cloned into vector pPCR Script CAM SK(+) (Schilling S. et al.; Biochemistry 44(40) 13415-13424).
  • Murine Qpct as used in the following examples is comprised in a construct, i.e. a gene cassette (SEQ ID No:9); the amino acid sequence is shown in SEQ ID No:9
  • the primers for isolation of the open reading frame of mQC were designed using PubMed nucleotide entry AK017598, encoding the putative mQC.
  • the primer sequences were as follows: sense 5' ATATGCATGCATGGCAGGCAGCGAAGACAAGC (SEQ ID NO:11); antisense 5' ATATAAGCTTTTACAAGTGAAGATATTCCAACACAAAGAC (SEQ ID NO: 12).
  • Total RNA was isolated from murine insulinoma cell line ⁇ -TC 3 cells using the RNeasy Mini Kit (Qiagen) and reversely transcribed by SuperScriptII (Invitrogen) .
  • mQC cDNA was amplified on a 1:12.5 dilution of generated product in a 50 ⁇ l reaction with Herculase Enhanced DNA-Polymerase (Stratagene) , inserted into the PCR Script CAM Cloning vector (Stratagene) and verified by sequencing.
  • the cDNA fragment encoding the mature mQC was amplified using the primers 5' ATACTCGAGAAAAGAGCCTGGACGCAGGAGAAG
  • the digested fragment was ligated into the vector pPICZ ⁇ B, propagated in E. coli and verified by sequencing of the sense and antisense strand. Finally, the expression plasmid was linearized using Pmel, precipitated, and stored at -20 0 C. Transformation of P. pastoris and Mini-Scale Expression of Murine QC
  • plasmid DNA 1-2 ⁇ g were applied for transformation of competent P. pastoris cells by electroporation according to the manufacturer's instructions (BioRad) . Selection was done on plates containing 100 ⁇ g/ml Zeocin.
  • recombinants were grown for 24 h in 10 ml conical tubes containing 2 ml BMGY. Afterwards, the yeast was centrifuged and resuspended in 2 ml BMMY containing 0.5 % methanol. This concentration was maintained by addition of methanol every 24 h for about 72 h. Subsequently, QC activity in the supernatant was determined. Clones that displayed the highest activity were chosen for further experiments and fermentation.
  • mQC Large Scale Expression and Purification of Murine QC
  • the expression of mQC was performed in a 5 L reactor (Biostad B, B. Braun biotech, Melsungen, Germany) . Fermentation was carried out in basal salts medium supplemented with trace salts at pH 5.5. Initially, biomass was accumulated in a batch and a fed batch phase with glycerol as the sole carbon source for about 28 h. Expression of mQC was initiated by methanol feeding according to a three-step profile recommended by Invitrogen for an entire fermentation time of approximately 65 h.
  • the fermentation broth was diluted with water to a conductivity of about 5 mS/cm and applied in reversed flow direction (15 mL/min) onto a Streamline SP XL column (2.5 x 100 cm), equilibrated with 0.05 M phosphate buffer, pH 6.4.
  • proteins were eluted at a flow rate of 8 mL/min using 0.15 M Tris buffer, pH 7.6, containing 1.5 M NaCl in forward direction.
  • QC-containing fractions were pooled and ammonium sulfate added to a final concentration of 1 M.
  • the resulting solution was applied onto a Butyl Sepharose FF column (1.6 x 13 cm) at a flow rate of 4 mL/min.
  • Bound mQC was washed with 0.05 M phosphate buffer, pH 6.8 containing 0.75 M ammonium sulfate for 5 column volumes and eluted in reversed flow direction with 0.05 M phosphate buffer, pH 6.8.
  • the fractions containing mQC were pooled and desalted overnight by dialysis against 0.025 M Tris, pH 7.5. Afterwards, the pH was adjusted to 8.0 by addition of NaOH and applied (4.0 mL/min) onto an Uno Q column (Bio Rad) , equilibrated with 0.02 M Tris, pH 8.1. After a washing step using equilibration buffer, mQC was eluted using the same buffer containing 0.18 M NaCl. Fractions exhibiting QC activity were pooled and the pH adjusted to 7.4 by addition of 1 M Bis-Tris buffer, pH 6.0. mQC was stable at 4 0 C for up to 1 month. For long-term storage at - 20 0 C, 50 % glycerol was added.
  • the vector 'mQC cDNA in pPCR Script Cam is an aliquot of circular plasmid DNA. It contains the open reading frame (ORF) of murine Qpct as shown above using primers containing additional restriction sites. This amplified cDNA was inserted into the vector pPCR Script CAM SK(+) (Stratagene) via the Srfl restriction site (see Figure IA) .
  • the delivered plasmid was verified by restriction analysis using Ncol, Notl and Nsil. The expected digestion profile was obtained and no sign of degradation was observed.
  • the Qpct cDNA cassette was isolated via the restriction sites Nsil (5') and Notl (3') and was inserted within the cloning vector pBlue Script SK+ (Stratagene) , which was linearised using the restriction enzyme Pstl and Notl (see figure 2) .
  • the religation of the NsiI-/PstI-overhangs led to the deletion of the intervening ATG leaving the remaining of the start-ATG of the Qpct-ORF intact.
  • the modified cDNA cassette was isolated via HindIII and Notl from the pBlue Script SK+ backbone and inserted into an expression vector already containing the CAG-promoter and the BGH polyA signal sequences within the pcDNA3.1 vector backbone (Invitrogen) (see figure 2).
  • the resulting plasmid contains the ORF of the murine glutaminyl- peptide cyclotransferase gene downstream of the ubiquitously overexpressing CAG promoter cassette and upstream of the BGH polyA signal.
  • the transgenic vector was named pTG-CAG-mQC.
  • the plasmid pTG-CAG-mQC was verified by restriction analysis (see figure 3) and sequencing.
  • the transgenic construct can be removed from the plasmid backbone using an ApaLI/ DraIII restriction double-digest.
  • the pTG-CAG-mQC DNA was still detectable at a dilution of 0.1 copy per reaction mix, confirming the PCR screen is sufficiently sensitive to detect an integration event for the screening of potential founder mice.
  • the ApaLI/Dralll restriction sites allow the transgenic construct DNA to be isolated from the plasmid backbone.
  • the plasmid pTG-CAG-mQC will be digested with this enzyme and the resulting 3806 bp sized fragment will be isolated and purified for microinjection into mouse oocytes.
  • the transgenic construct pTG-CAG-mQC generated in Examples 1 to 3 as shown above, was injected into the male pronucleus of fertilized oocytes. Following overnight cultivation, the resulting two-cell embryos were transplanted into pseudo- pregnant foster mothers. The mice born were characterised for transgene integration by PCR analysis.
  • the pTG-CAG-mQC vector was cloned as shown above.
  • the Qpct gene cassette was directly cloned downstream of the hybrid CMV enhancer/ chicken beta-actin (CAG) promoter and upstream of the bovine growth hormone (BGH) polyA signal, generating the transgenic vector pTG-CAG-mQC.
  • the pTG-CAG-mQC plasmid was digested by DraIII and Sail restriction enzymes and the 3552 bp fragment containing the transgenic construct of interest was separated from the vector backbone electrophoretically ( Figure 5) .
  • the -3.6 kb transgenic construct fragment was isolated, purified and diluted in microinjection buffer to a concentration of 5 ng/ ⁇ l .
  • the construct purity and the concentration were verified by agarose gel electrophoresis ( Figure 5) .
  • Tail tip biopsies from the 61 weaned pups were prepared and DNA was extracted.
  • the individual DNAs were genotyped by the transgenic screening PCR which was established in the previous examples.
  • the primer pair CAG-Pr-Fl/ GX1675-TOR1-FF (depicted in figure 5A as dark arrows, SEQ ID Nos: 4 and 7) amplifies the promoter-cDNA junction, yielding a specific 1585 bp PCR product when the transgenic construct has integrated into the host genome .
  • a second PCR using a forward primer BGH-Fl (SEQ ID No:7), binding to the BGH polyA sequence of the transgenic construct, and a reverse primer CAG-Pr-R2 (SEQ ID No : 8 ) , binding to the 5' end of the promoter cassette, takes advantage of the frequently observed head-to-tail integration of the transgenic construct and amplifies an approx. 834 bp fragment. This amplification product only occurs when more than one copy of the transgenic construct has tandemly integrated.
  • CAG-Pr-R2 CTGCCAAGTAGGAAAGTCCCAT
  • Examples 4 and 5 summarize the work performed for the generation of the CAG-mQC transgenic mouse model using the pronuclear microinjection (PNI) approach.
  • PNI pronuclear microinjection
  • the transgenic construct pTG-CAG-mQC was prepared, purified and injected into the male pronucleus of fertilized oocytes and a total of 689 embryos were transferred into foster mothers. These microinjection sessions led to the birth of 61 viable pups. The PCR screening led to the identification of one female founder carrying the transgenic construct integrated into the genome.
  • a low rate of transgenic construct integration is frequently associated with either oocyte toxicity or with a phenotypic effect which is incompatible with embryonic development.
  • transgenic construct pTG-CAG-mQC was injected into the male pronucleus of 689 fertilized oocytes, resulting in the identification of one born transgenic founder, namely animal No. 37460. This female founder was crossed with
  • the transgenic construct was isolated from the pTG-CAG-mQC vector, cloned as shown above.
  • Recipient oocytes were isolated from pregnant C57BL/6J females with a SPF (Specific and Pathogen Free) health status.
  • SPF Specific and Pathogen Free
  • the transgene DNA were injected into the male pronucleus of 689 fertilized oocytes and these manipulated embryos were re- implanted into 23 OFl pseudo-pregnant females with an SOPF (Specific and Opportunistic Pathogen Free) health status.
  • the transgenic female No. 37460 was bred with a wild-type C57BL/6 male (health status SOPF - Specific an Opportunist Pathogen Free) from 12th July 2005 to establish the transgenic CAG-mQC mouse line by generating Fl transgenic mice.
  • Tail tip biopsies from the 17 weaned pups were prepared and DNA was extracted.
  • the individual DNAs were genotyped by the transgenic screening PCR which was established as shown above.
  • the primer pair CAG-Pr-Fl/ GX1675-TOR1-FF (SEQ ID No: 4 and 6) amplifies the promoter-cDNA junction, yielding a specific 1585 bp PCR product when the transgenic construct has integrated into the host genome.
  • the primer sequences and the optimised PCR condition are listed in table 9. The quality of the DNA was confirmed using primers specific for a control gene.
  • Figure 8 shows an example of the PCR screening results.
  • the examples 6-8 summarize the work performed for the establishment of the CAG-mQC transgenic mouse line generated by breeding the female founder No. 37460 with C57BL/6 males.
  • the purpose of the following examples was the determination of the activity of the enzyme glutaminyl cyclase (QC) in heterozygous transgenic mice supposed to overexpress this enzyme.
  • QC glutaminyl cyclase
  • the activity of glutaminyl cyclase should be determined in brain, liver, kidney and EDTA-plasma of two transgenic animals and two wildtype controls with an equal genetic background.
  • the expression of QC-mRNA in the described organs should be examined. All animals were of female gender.
  • the QC activity in tissue of wild type and transgenic animals was assessed by quantification of the QC-mediated cyclization of
  • Detection of glutaminyl-beta-naphthylamine and pyroglutamyl- beta-naphthylamine was performed by use of a Diode Array Detector L7455 manufactured by Hitachi Corporation at a wavelength of 280 nm. All measurements were carried out at room temperature. The concentration of pyroglutamyl-beta- naphthylamine was calculated using a standard curve.
  • Determinations of QC-activity were performed using tissue homogenates from brain, liver, kidney and plasma.
  • the plasma was centrifuged at 4 0 C and 13000 xg for 10 min and applied for the QC-assay.
  • the plasma of the control group could be used directly unwatered for measurement (100 ⁇ l)
  • that of the QC-transgenic mice was diluted 1:25 using MOPS-buffer (25 mM, pH 7.0) .
  • Tissue of brain, liver and kidney was mixed in 40fold volume lysis buffer and homogenized by use of a Downs homogenizer.
  • the lysis-buffer (pH 7.5) consisted of Tris-base (10 mM) , EDTA (5mM), Triton (0.5%) and glycerine (10%).
  • the samples were treated with an ultrasonic stick (16 cycles, intensity 70%) and afterwards centrifuged (25 min, 13000 xg, 4 0 C) .
  • the supernatants were taken and immediately used for the measurement (100 ⁇ l) .
  • every determination of pyroglutamyl-beta-naphthylamine was carried out according to the following protocol, which has been identical for measurement of the standard curve with purified recombinant QC enzyme and of the time-turnover-graphs with QC from the homogenized tissue samples .
  • a 1.5 mL tube 500 ⁇ L substrate solution (100 ⁇ M Glutaminyl- beta-naphthylamine in 25 mM MOPS-buffer, pH 7. 0) were mixed with 400 ⁇ L N-ethyl-maleimide solution (250 ⁇ M, in 25 mM MOPS- buffer, pH 7. 0) as a cysteine-protease-inhibitor .
  • the mixture was allowed to equilibrate at 30 0 C for 10 min in a heating block at 350 rpm. After equilibration, the reaction was started by addition of 100 ⁇ L of cell lysate or plasma (diluted in case of tissue of transgenic animals) to a total volume of 1000 ⁇ L .
  • the reaction mixture was then incubated for 45 min at 30 0 C at 350 rpm. From the total reaction volume, samples (100 ⁇ L) were removed after 0, 4, 8, 12, 16, 20, 24, 35 and 45 min. To stop the ongoing conversion from glutaminyl-beta-naphthylamine into pyroglutamyl-beta-naphtylamine, these samples were immediately heated for 5 min in boiling water to inactivate the enzyme glutaminyl-cyclase . Afterwards, the samples were immediately frozen at -20 0 C. The experiment was run in three replicates at the same time. Prior to analysis using HPLC, all samples have been frozen once.
  • the samples were thawed and thereafter centrifuged for 10 min at 13000 rpm at room temperature before starting the measuring process on the HPLC system. Then, 25 ⁇ L of the sample were diluted 1:1 with water bidest and mixed. This solution was injected completely with a 100 ⁇ L Hamilton syringe into the 20 ⁇ L sample loop of the HPLC system. Between the measurements, the Hamilton syringe was cleaned two times with water, two times with acetone and thereafter two times with water again. Before drawing the syringe with a new sample the needle was rinsed two times (2 x 3 ⁇ L) with the new sample.
  • the resulting peak areas for pyroglutamyl-beta-naphthylamine (Rt : ⁇ 6. 8 min, the retention time of glutaminyl-beta- naphthylamine was at Rt: ⁇ 4. 85 min) were converted into concentrations of pyroglutaminyl-beta-naphthylamine by use of the standard curve.
  • the resulting figures were plotted in a time (x-axis) - turnover (y-axis) - diagram.
  • the initial velocity of the reaction converting glutaminyl-beta-naphtylamine into pyroglutaminyl-beta-naphtylamine was calculated by linear regression in the region of linear product formation, which was usually observed during the first 20 minutes of the reaction.
  • the resulting diagrams and initial velocities are exemplary shown for QC-activity in brain (see Fig. 9) .
  • Example 10 QC activity in EDTA plasma and tissue homogenates
  • Total mRNA was isolated from tissue of liver, kidney and brain by use of the NucleoSpin-Kit (Macherey Nagel) according to the manufacturers' protocol and thereafter 1 ⁇ g of isolated mRNA was transcribed into cDNA applying random hexamer oligonucleotides for priming.
  • QC mRNA concentrations were strongly increased compared to the control group (Fig. 10D) .
  • the highest expression was observed in the kidney with a 66-fold raise of QC mRNA concentration.
  • Example 11 Characterization of transgenic mice overexpressing human QC neuron-specifically .
  • Transgenic mice overexpressing human QC, driven by the Thy-1 promoter were generated, essentially as described in examples 1- 9 for transgenic mice overexpressing murine QC ubiquitously and is further outlined in Example 12. Three founders were efficiently crossbred, and the QC-expression characterized using QC-activity assays and Western-Blotting applying specific antibodies.
  • 50 mg of brain tissue were homogenized in 1 ml of buffer consisting of 1OmM Tris pH 7,5, 10OmM NaCl, 5mM EDTA and 0,5% Triton X-100 and 10% Glycerol.
  • the tissue was homogenized by several strokes in Downs-homogenizer and poured into a 12ml conical tube. The homogenate was then subjected to 3x 10s of ultrasonic shock. The resulting homogenate was centrifuged at 4°C for 25min and the QC-activity of the supernatant determined.
  • hQC activity was determined applying a HPLC-assay, essentially as described in example 9. Briefly, samples consisted of 500 ⁇ l substrate (Q- ⁇ NA, 50 ⁇ M final concentration) , 400 ⁇ l N-Ethylmaleimide (10OyM final concentration) and lOO ⁇ l sample containing QC. The reaction was incubated at 30 0 C and samples were removed after
  • the reaction was terminated by incubation in a boiling water bath for 5 min.
  • the sample obtained from a transgenic animal carrying the hQC transgene contained a significantly reduced QC-activity compared to a non-transgenic littermate, clearly proving the hQC expression in the transgenic animals .
  • human QC was characterized for three different founder mouse lines (line 53, 37 and 43) and the murine QC overexpressing line pbdl7E3, as shown in Figure 13A.
  • Significant overexpression of QC was detected in all hQC tg animals.
  • murine QC of pbdl7E3 was less expressed in brain, caused by the different promoters used (ubiquitous CAG promoter in pbdl7E3 and murine Thy-1 neuron-specific promoter in hQC transgenic mice) .
  • the hQC-transgenic mouse founder line 53 displayed the highest expression of QC ( Figure 13B) .
  • mice are best suited for the development of transgenic mice, which aim at the modelling of disease conditions which are related to QC and/or which are facilitated or accelerated by QC, e.g. Alzheimer's disease, Familial British Dementia, Familial Danish Dementia, Huntington' s disease.
  • Example 12 Generation of transgenic mice overexpressing human QC neuron-specifically .
  • the plasmid pcDNA3.1-hQC containing the open reading frame of human QC was used as template for PCR amplification of the hQC cDNA with the following primers:
  • the PCR product was digested with Xhol and BsrGI and ligated with the pUC18-mThyl vector plasmid ( Figure 15) .
  • the correct plasmid clone was identified by restriction and sequencing.
  • the transgenic plasmid pUC18-mThyl-hQC was linearized with Pvu I and Not I to eliminate plasmid sequences.
  • the 7929 bp fragment corresponding to the transgenic construct was separated from the vector backbone by agarose gel electrophoresis and further purified.
  • the plasmid backbone was removed by digestion with Not I and Pvu I ( Figure 16) .
  • a resulting 7929 bp DNA fragment was applied for pronuclear microinjection into (C57BL/6 x CBA) F2 oocytes followed by Re-implantation of minimal 150 viable microinjected oocytes into pseudo-pregnant mice.
  • Reverse primer mThylRl 5'- GAAGGACTTGGGGAGGGAG -3' (SEQ ID No.
  • Probe 13p 5'-FAM- CAAGTAAGTCGAGGTCCTTCCTCTGCA -TAMRA-3' (SEQ ID NO: 1

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Neurology (AREA)
  • Immunology (AREA)
  • Neurosurgery (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Environmental Sciences (AREA)
  • Molecular Biology (AREA)
  • Diabetes (AREA)
  • Psychology (AREA)
  • Rheumatology (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Urology & Nephrology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Reproductive Health (AREA)
  • Endocrinology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
PCT/EP2008/050532 2007-01-19 2008-01-18 In vivo screening models for treatment of alzheimer's disease and other qpct-related disorders Ceased WO2008087197A1 (en)

Priority Applications (9)

Application Number Priority Date Filing Date Title
JP2009545932A JP2010516235A (ja) 2007-01-19 2008-01-18 アルツハイマー病及び他のqpct関連障害の治療のためのインビボスクリーニングモデル
HR20110651T HRP20110651T1 (hr) 2007-01-19 2008-01-18 Modeli pretraživanja in vivo radi liječenja alzheimerove bolesti i drugih poremećaja povezanih s qpct
SI200830434T SI2121944T1 (sl) 2007-01-19 2008-01-18 In vivo presejalni modeli za zdravljenje Alzheimerjeve bolezni in drugih motenj, povezanih s QPCT
EP08707977A EP2121944B1 (en) 2007-01-19 2008-01-18 In vivo screening models for treatment of alzheimer's disease and other qpct-related disorders
AU2008206936A AU2008206936B2 (en) 2007-01-19 2008-01-18 In vivo screening models for treatment of Alzheimer's disease and other Qpct-related disorders
AT08707977T ATE521711T1 (de) 2007-01-19 2008-01-18 In-vivo-screening-modelle zur behandlung der alzheimer-krankheit und anderer erkrankungen in zusammenhang mit dem qpct-gen
NZ578513A NZ578513A (en) 2007-01-19 2008-01-18 In vivo screening models for treatment of alzheimer's disease and other qpct-related disorders
CA002675192A CA2675192A1 (en) 2007-01-19 2008-01-18 In vivo screening models for treatment of alzheimer's disease and other qpct-related disorders
DK08707977.8T DK2121944T3 (da) 2007-01-19 2008-01-18 In vivo screeningsmodeller til behandling af Alzheimers sygdom og andre QPCT-relaterede lidelser

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US88564907P 2007-01-19 2007-01-19
US60/885,649 2007-01-19

Publications (1)

Publication Number Publication Date
WO2008087197A1 true WO2008087197A1 (en) 2008-07-24

Family

ID=39271322

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2008/050532 Ceased WO2008087197A1 (en) 2007-01-19 2008-01-18 In vivo screening models for treatment of alzheimer's disease and other qpct-related disorders

Country Status (13)

Country Link
US (1) US20080200567A1 (https=)
EP (2) EP2395095A1 (https=)
JP (1) JP2010516235A (https=)
AT (1) ATE521711T1 (https=)
AU (1) AU2008206936B2 (https=)
CA (1) CA2675192A1 (https=)
DK (1) DK2121944T3 (https=)
ES (1) ES2372229T3 (https=)
HR (1) HRP20110651T1 (https=)
NZ (1) NZ578513A (https=)
SI (1) SI2121944T1 (https=)
WO (1) WO2008087197A1 (https=)
ZA (1) ZA200904353B (https=)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009090190A1 (en) * 2008-01-14 2009-07-23 Probiodrug Ag Mouse models carrying a knock-out mutation of the glutaminyl cyclase gene
KR20110049781A (ko) * 2008-07-31 2011-05-12 프로비오드룩 아게 신경변성 질환에 대한 진단적/예후적 지표로서 글루타미닐 사이클라제
WO2012028706A1 (en) 2010-09-02 2012-03-08 Probiodrug Ag IN VIVO SCREENING MODELS FOR TREATMENT OF isoQC-RELATED DISORDERS
WO2012059413A1 (en) 2010-11-02 2012-05-10 Probiodrug Ag Crystal structure of isoglutaminyl cyclase
WO2013024043A2 (en) 2011-08-12 2013-02-21 Probiodrug Ag In vivo screening models for treatment of qc-related disorders
US8409837B2 (en) 2010-08-19 2013-04-02 Probiodrug Ag Crystal structure of glutaminyl cyclase
US9277737B2 (en) 2006-09-21 2016-03-08 Probiodrug Ag Mouse models carrying a knock-out mutation of the QPCTL-gene

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5612860B2 (ja) * 2007-03-09 2014-10-22 プロビオドルグ エージー グルタミニルシクラーゼ阻害剤としてのイミダゾ[1,5−a]ピリジン誘導体
EP2160380B1 (en) * 2007-04-18 2014-04-02 Probiodrug AG Cyano-guanidine derivatives as glutaminyl cyclase inhibitors
DK2160389T3 (da) * 2007-04-18 2014-06-23 Probiodrug Ag Thioxoquinazolinonderivater som glutaminylcyclaseinhibitorer
ES2468551T3 (es) * 2007-04-18 2014-06-16 Probiodrug Ag Derivados de nitrovinil-diamina como inhibidores de la glutaminil ciclasa
EP2142514B1 (en) * 2007-04-18 2014-12-24 Probiodrug AG Thiourea derivatives as glutaminyl cyclase inhibitors
WO2008128986A1 (en) * 2007-04-18 2008-10-30 Probiodrug Ag Urea derivatives as glutaminyl cyclase inhibitors
ES2473621T3 (es) * 2007-04-18 2014-07-07 Probiodrug Ag Derivados de nitrovinil-diamina como inhibidores de glutaminil ciclasa
WO2008128984A1 (en) * 2007-04-20 2008-10-30 Probiodrug Ag Aminopyrimidine derivatives as glutaminyl cyclase inhibitors
AU2008297070A1 (en) * 2007-09-12 2009-03-19 Probiodrug Ag Transgenic mice
US11219696B2 (en) * 2008-12-19 2022-01-11 Nationwide Children's Hospital Delivery of polynucleotides using recombinant AAV9
AU2013296425B2 (en) 2012-08-01 2018-06-07 Nationwide Children's Hospital Intrathecal delivery of recombinant adeno-associated virus 9
US20180318260A1 (en) * 2015-11-04 2018-11-08 The Scripps Research Institute Compositions and methods for treating cystic fibrosis
MC200185B1 (fr) 2016-09-16 2017-10-04 Coronal Audio Dispositif et procédé de captation et traitement d'un champ acoustique tridimensionnel
MC200186B1 (fr) 2016-09-30 2017-10-18 Coronal Encoding Procédé de conversion, d'encodage stéréophonique, de décodage et de transcodage d'un signal audio tridimensionnel

Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0264166A1 (en) 1986-04-09 1988-04-20 Genzyme Corporation Transgenic animals secreting desired proteins into milk
US4873316A (en) 1987-06-23 1989-10-10 Biogen, Inc. Isolation of exogenous recombinant proteins from the milk of transgenic mammals
US4873191A (en) 1981-06-12 1989-10-10 Ohio University Genetic transformation of zygotes
WO1990008832A1 (en) 1989-01-27 1990-08-09 National Research Development Corporation Retroviral vector and its use in the production of transgenic animals
US5175384A (en) 1988-12-05 1992-12-29 Genpharm International Transgenic mice depleted in mature t-cells and methods for making transgenic mice
EP0653154A2 (en) * 1993-11-12 1995-05-17 Hoechst Japan Limited Transgenic animal for alzheimer's disease
US5602299A (en) 1992-09-23 1997-02-11 Mount Sinai School Of Medicine Of The City University Of New York Transgenic animal models for neurodegenerative disease
US5981830A (en) 1997-05-30 1999-11-09 Schering Aktiengesellschaft Knockout mice and their progeny with a disrupted hepsin gene
US6066778A (en) 1996-11-06 2000-05-23 The Regents Of The University Of Michigan Transgenic mice expressing APC resistant factor V
WO2004098625A2 (en) 2003-05-05 2004-11-18 Probiodrug Ag Medical use of inhibitors of glutaminyl and glutamate cyclases
WO2005049027A2 (en) * 2003-11-03 2005-06-02 Probiodrug Ag Combinations useful for the treatment of neuronal disorders
EP2011349A2 (en) 2006-03-17 2009-01-07 Vodafone Group PLC Improvements in an ehspa architecture

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6948038B2 (en) * 2001-07-24 2005-09-20 Microsoft Corporation System and method for backing up and restoring data
EP1961416B1 (en) * 2003-05-05 2013-01-23 Probiodrug AG Use of inhibitors of glutaminyl cyclase for treating psoriasis, rheumatoid arthritis or atherosclerosis.
WO2004098591A2 (en) * 2003-05-05 2004-11-18 Probiodrug Ag Inhibitors of glutaminyl cyclase and their use in the treatment of neurological diseases
CA2554809C (en) * 2004-02-05 2014-04-29 Probiodrug Ag Novel n-alkyl thiourea- and thioamide-substituted imidazolyl inhibitors of glutaminyl cyclase
EA016584B1 (ru) * 2006-09-21 2012-06-29 Пробиодруг Аг Новые гены, родственные гену глутаминилциклазы

Patent Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4873191A (en) 1981-06-12 1989-10-10 Ohio University Genetic transformation of zygotes
EP0264166A1 (en) 1986-04-09 1988-04-20 Genzyme Corporation Transgenic animals secreting desired proteins into milk
US4873316A (en) 1987-06-23 1989-10-10 Biogen, Inc. Isolation of exogenous recombinant proteins from the milk of transgenic mammals
US5175384A (en) 1988-12-05 1992-12-29 Genpharm International Transgenic mice depleted in mature t-cells and methods for making transgenic mice
WO1990008832A1 (en) 1989-01-27 1990-08-09 National Research Development Corporation Retroviral vector and its use in the production of transgenic animals
US5602299A (en) 1992-09-23 1997-02-11 Mount Sinai School Of Medicine Of The City University Of New York Transgenic animal models for neurodegenerative disease
EP0653154A2 (en) * 1993-11-12 1995-05-17 Hoechst Japan Limited Transgenic animal for alzheimer's disease
US6037521A (en) 1993-11-12 2000-03-14 Hoechst Japan Limited Transgenic mouse expressing an β-Amyloid transgene
US6066778A (en) 1996-11-06 2000-05-23 The Regents Of The University Of Michigan Transgenic mice expressing APC resistant factor V
US5981830A (en) 1997-05-30 1999-11-09 Schering Aktiengesellschaft Knockout mice and their progeny with a disrupted hepsin gene
WO2004098625A2 (en) 2003-05-05 2004-11-18 Probiodrug Ag Medical use of inhibitors of glutaminyl and glutamate cyclases
WO2005049027A2 (en) * 2003-11-03 2005-06-02 Probiodrug Ag Combinations useful for the treatment of neuronal disorders
EP2011349A2 (en) 2006-03-17 2009-01-07 Vodafone Group PLC Improvements in an ehspa architecture

Non-Patent Citations (99)

* Cited by examiner, † Cited by third party
Title
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1999, JOHN WILEY & SONS
BANERJI ET AL., CELL, vol. 33, 1983, pages 729 - 740
BATEMAN, R. C. ET AL., BIOCHEMISTRY, vol. 40, 2001, pages 11246 - 11250
BATEMAN, R. C. J., J NEUROSCI METHODS, vol. 30, 1989, pages 23 - 28
BATEMAN, R.C.J. ET AL., BIOCHEMISTRY, vol. 40, 2001, pages 11246 - 11250
BINDER, E. B. ET AL., BIOL PSYCHIATRY, vol. 50, 2001, pages 856 - 872
BOCKERS, T. M. ET AL., J NEUROENDOCRINOL, vol. 7, 1995, pages 445 - 453
BOOTH, R.E. ET AL., BMC BIOLOGY, vol. 2, 2004
BORCHELT, D. R. ET AL., NEURON, vol. 17, 1996, pages 1005 - 1013
BRADFORD, M. M., ANAL BIOCHEM, vol. 72, 1976, pages 248 - 254
BUSBY, W. H. J. ET AL., J BIOL CHEM, vol. 262, 1987, pages 8532 - 8536
BYRNE; RUDDLE, PNAS, vol. 86, 1989, pages 5473 - 5477
CALAME; EATON, ADV. IMMUNOL., vol. 43, 1988, pages 235 - 275
CASAS ET AL., AM J PATHOL, vol. 165, 2004, pages 1289 - 1300
CEBALLOS-PICOT ET AL., BRAIN RES., vol. 552, 1991, pages 198 - 214
CITRON, M. ET AL., NAT MED, vol. 3, 1997, pages 67 - 72
CONSALVO, A. P. ET AL., ANAL BIOCHEM, vol. 175, 1988, pages 131 - 138
CYNIS ET AL: "Inhibition of glutaminyl cyclase alters pyroglutamate formation in mammalian cells", BIOCHIMICA ET BIOPHYSICA ACTA (BBA) - PROTEINS & PROTEOMICS, ELSEVIER, vol. 1764, no. 10, October 2006 (2006-10-01), pages 1618 - 1625, XP005707926, ISSN: 1570-9639 *
DAHL, S. W. ET AL., PROTEIN EXPR PURIF, vol. 20, 2000, pages 27 - 36
DARNELL, J.; LODISH, H.; BALTIMORE, D.: "Molecular Cell Biology", 1990, SCIENTIFIC AMERICAN BOOKS, pages: 63
EDLUND ET AL., SCIENCE, vol. 230, 1985, pages 912 - 916
EL MOUSSAOUI, A. ET AL., CELL MOL LIFE SCI, vol. 58, 2001, pages 556 - 570
FISCHER, W. H.; SPIESS, J., PROC NATL ACAD SCI U S A, vol. 84, 1987, pages 3628 - 3632
FORSS-PETTER ET AL., NEURON, vol. 5, 1990, pages 197 - 197
FRASER, L.R.; ADEOYA-OSIGUWA, S. A., VITAM HORM, vol. 63, 2001, pages 1 - 28
FUNATO, H. ET AL., AM J PATHOL, vol. 152, 1998, pages 983 - 992
GARDEN, R. W.; MOROZ, T. P; GLEESON, J. M.; FLOYD, P. D; LI, L. J.; RUBAKHIN, S. S; SWEEDLER, J. V., J NEUROCHEM, vol. 72, 1999, pages 676 - 681
GEDDES, J. W. ET AL., NEUROBIOL AGING, vol. 20, 1999, pages 75 - 79
GHISO, J. ET AL., AMYLOID, vol. 8, 2001, pages 277 - 284
GILL, S.C.; VON HIPPEL, P.H., ANAL BIOCHEM, vol. 182, 1989, pages 319 - 326
GLENNER, G. G.; WONG, C. W., BIOCHEM BIOPHYS RES COMM, vol. 120, 1984, pages 885 - 890
GOLOLOBOV, M. Y. ET AL., BIOL CHEM HOPPE SEYLER, vol. 377, 1996, pages 395 - 398
GOSSEN ET AL., SCIENCE, vol. 268, 1995, pages 17664769
GOSSEN; BIZARD, PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 5547 - 5551
GUNTERT, A. ET AL., NEUROSCIENCE, vol. 143, 2006, pages 461 - 475
HAASS, C.; SELKOE, D. J., CELL, vol. 75, 1993, pages 1039 - 1042
HARIGAYA, Y. ET AL., BIOCHEM BIOPHYS RES COMMUN, vol. 276, 2000, pages 422 - 427
HASKELL; BOWEN, MAL. REPROD. DEV., vol. 40, 1995, pages 386
HE, W.; BARROW, C. J., BIOCHEMISTRY, vol. 38, 1999, pages 10871 - 10877
HOGAN ET AL.: "Manipulating the Mouse Embryo: A Laboratory Manual", 1986, COLD SPRING HARBOR LABORATORY
HOGAN ET AL.: "Manipulating the Mouse Embryo: A Laboratory Manual", 1994, COLD SPRING HARBOR LABORATORY
HOSODA R. ET AL., J NEUROPATHOL EXP NEUROL., vol. 57, 1998, pages 1089 - 1095
HUSE J.T. ET AL., BIOL. CHEM., vol. 277, no. 18, 2002, pages 16278 - 16284
INTAGAKI, S. ET AL., J NEUROIMMUNOL, vol. 24, 1989, pages 173 - 182
IWATSUBO, T; SAIDO, T. C.; MANN, D. M.; LEE, V. M; TROJANOWSKI, J. Q., AM J PATHOL, vol. 149, 1996, pages 1823 - 1830
J BIOL CHEM, vol. 266, 1991, pages 24613 - 24620
JAENISCH, SCIENCE, vol. 240, 1988, pages 1468 - 1474
JAHNER D. ET AL., NATURE, vol. 298, 1982, pages 623 - 628
JAHNER ET AL., PROC. NATL. ACAD SCI. USA, vol. 82, 1985, pages 6927 - 6931
JANENICH, PROC. NATI. ACAD. SCI. USA, vol. 73, 1976, pages 1260 - 1264
KANG, J. ET AL., NATURE, vol. 325, 1987, pages 733 - 736
LALOWSKI, M. ET AL., J BIOL CHEM, vol. 271, 1996, pages 33623 - 33631
LAVITRANO ET AL., CELL, vol. 57, 1989, pages 717 - 723
LEE ET AL., NATURE, vol. 294, 1981, pages 228 - 232
LEMERE, C. A. ET AL., NAT MED, vol. 2, 1996, pages 1146 - 1150
LO, MOL CELL. BIOL., vol. 3, 1983, pages 1803 - 1814
M.R. SNAITH ET AL.: "The use of transgenic systems in pharmaceutical research", BRIEFINGS IN FUNCTIONAL GENOMICS AND PROTEOMICS, vol. 1, no. 2, July 2002 (2002-07-01), pages 119 - 130, XP002476966 *
MANN, D. M.; IWATSUBO, T., NEURODEGENERATION, vol. 5, 1996, pages 115 - 120
MAUE ET AL., NEURON, vol. 4, 1990, pages 223 - 231
MESSER, M., NATURE, vol. 4874, 1963, pages 1299
MORI, H. ET AL., J BIOL CHEM, vol. 267, 1992, pages 17082 - 17086
MORRIS, LEARN MOTIVAT, vol. 12, 1981, pages 239 - 260
NO ET AL., PROC. NATL. ACAD. SCI. USA, vol. 93, 1996, pages 3346 - 3351
PIKE, C. J. ET AL., J BIOL CHEM, vol. 270, 1995, pages 23895 - 23898
PINKERT ET AL., GENES DEV., vol. 1, 1987, pages 268 - 277
POHL, T. ET AL., PROC NATL ACAD SCI U S A, vol. 88, 1991, pages 10059 - 10063
PROKAL, L.; PROKAI-TATRAI, K.; OUYANG, X.; KIM, H. S.; WU, W. M; ZHARIKOVA, A.; BODOR, N., J MED CHEM, vol. 42, 1999, pages 4563 - 4571
QUEEN; BALTIMORE, CELL, vol. 33, 1983, pages 741 - 748
RAY ET AL., GENES AND DEVELOPMENT, vol. 5, 1991, pages 2265 - 2273
RUSS A ET AL: "Random mutagenesis in the mouse as a tool in drug discovery", DDT - DRUG DISCOVERY TODAY, ELSEVIER SCIENCE LTD, GB, vol. 7, no. 23, 1 December 2002 (2002-12-01), pages 1175 - 1183, XP002359650, ISSN: 1359-6446 *
RUSSO, C ET AL., NATURE, vol. 405, 2000, pages 531 - 532
RUSSO, C. ET AL., FEBS LETT, vol. 409, 1997, pages 411 - 416
RUSSO, C. ET AL., J NEUROCHEM, vol. 82, 2002, pages 1480 - 1489
RUSSO, C. ET AL., NEUROBIOL DIS, vol. 8, 2001, pages 173 - 180
SAIDO T.C., MEDICAL HYPOTHESES, vol. 54, no. 3, 2000, pages 427 - 429
SAIDO, T. C. ET AL., NEURON, vol. 14, 1995, pages 457 - 466
SAIDO, T.C., MED HYPOTHESES, vol. 54, no. 3, March 2000 (2000-03-01), pages 427 - 9
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR PRESS
SASAHARA ET AL., CELL, vol. 64, 1991, pages 217 - 227
SCHILLING ET AL., ANAL. BIOCHEM., vol. 303, 2002, pages 49 - 56
SCHILLING S. ET AL., BIOCHEMISTRY, vol. 44, no. 40, pages 13415 - 13424
SCHILLING S.: "Charakterisierung der humanen Glutaminyl-Cyclase im Vergleich mit dem analogen Enzym aus Carica papaya", 5 May 2004, ULB SACHSEN ANHALT, XP002476967 *
SELKOE, D. J., PHYSIOL REV, vol. 81, 2001, pages 741 - 766
SELKOE, D. J., TRENDS CELL BIOL, vol. 8, 1998, pages 447 - 453
SHIROTANI, K. ET AL., NEUROSCI LETT, vol. 327, 2002, pages 25 - 28
SIMONS, M. ET AL., J NEUROSCI, vol. 16, 1996, pages 899 - 908
SNAITH ET AL., BRIEFINGS IN FUNCTIONAL GENOMICS AND PROTEMICS, vol. 1, no. 2, 2002, pages 119 - 130
STEWART ET AL., EMBO J., vol. 6, 1987, pages 383 - 388
STURCHLER-PIERRAT ET AL., PROC. NATL. ACAD SCI. USA, vol. 94, 1997, pages 13287 - 13292
TEKIRIAN, T. L. ET AL., J NEUROCHEM, vol. 73, 1999, pages 1584 - 1589
TEKIRIAN, T. L. ET AL., J NEUROPATHOL EXP NEUROL, vol. 57, 1998, pages 76 - 94
TERRY, R. D.; KATZMAN, R., ANN NEUROL, vol. 14, 1983, pages 497 - 506
THOMPSON ET AL., CELL, vol. 56, 1989, pages 313 - 321
VAN DER PUTTEN ET AL., PROC. NATL. ACAD SCI. USA, vol. 82, 1985, pages 6148 - 6152
VAN DER PUTTEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 6148 - 6152
WINOTO; BALTIMORE, EMBO J., vol. 8, 1989, pages 729 - 733
XI ET AL., NATURE, vol. 340, 1989, pages 35 - 42
YAO ET AL., NATURE, vol. 366, 1993, pages 476 - 479
ZERHOUNI, S. ET AL., BIOCHIM BIOPHYS ACTA, vol. 138, 1989, pages 275 - 290

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9277737B2 (en) 2006-09-21 2016-03-08 Probiodrug Ag Mouse models carrying a knock-out mutation of the QPCTL-gene
WO2009090190A1 (en) * 2008-01-14 2009-07-23 Probiodrug Ag Mouse models carrying a knock-out mutation of the glutaminyl cyclase gene
US9462793B2 (en) 2008-01-14 2016-10-11 Probiodrug Ag Mouse carrying a knock-out mutation of the Qpct-gene
KR20110049781A (ko) * 2008-07-31 2011-05-12 프로비오드룩 아게 신경변성 질환에 대한 진단적/예후적 지표로서 글루타미닐 사이클라제
JP2011529571A (ja) * 2008-07-31 2011-12-08 プロビオドルグ エージー 神経変性疾患の診断/予後判定の指標としてのグルタミニルシクラーゼ
KR101682728B1 (ko) 2008-07-31 2016-12-05 프로비오드룩 아게 신경변성 질환에 대한 진단적/예후적 지표로서 글루타미닐 사이클라제
US8859250B2 (en) 2010-08-19 2014-10-14 Probiodrug Ag Crystal structure of glutaminyl cyclase
US8409837B2 (en) 2010-08-19 2013-04-02 Probiodrug Ag Crystal structure of glutaminyl cyclase
WO2012028706A1 (en) 2010-09-02 2012-03-08 Probiodrug Ag IN VIVO SCREENING MODELS FOR TREATMENT OF isoQC-RELATED DISORDERS
US8741614B2 (en) 2010-11-02 2014-06-03 Probiodrug Ag Crystal structure of isoglutaminyl cyclase
WO2012059413A1 (en) 2010-11-02 2012-05-10 Probiodrug Ag Crystal structure of isoglutaminyl cyclase
WO2013024043A3 (en) * 2011-08-12 2013-06-06 Probiodrug Ag In vivo screening models for treatment of qc-related disorders
WO2013024043A2 (en) 2011-08-12 2013-02-21 Probiodrug Ag In vivo screening models for treatment of qc-related disorders

Also Published As

Publication number Publication date
SI2121944T1 (sl) 2011-12-30
EP2121944A1 (en) 2009-11-25
EP2121944B1 (en) 2011-08-24
ES2372229T3 (es) 2012-01-17
NZ578513A (en) 2012-01-12
AU2008206936B2 (en) 2013-03-14
DK2121944T3 (da) 2011-10-31
ATE521711T1 (de) 2011-09-15
JP2010516235A (ja) 2010-05-20
HRP20110651T1 (hr) 2011-10-31
EP2395095A1 (en) 2011-12-14
ZA200904353B (en) 2010-09-29
AU2008206936A1 (en) 2008-07-24
US20080200567A1 (en) 2008-08-21
CA2675192A1 (en) 2008-07-24

Similar Documents

Publication Publication Date Title
EP2121944B1 (en) In vivo screening models for treatment of alzheimer's disease and other qpct-related disorders
US8283517B2 (en) Transgenic mouse models of Aβ overexpression
EP2432314B1 (en) Mouse models carrying a knock-out mutation of the qpctl-gene
US9462793B2 (en) Mouse carrying a knock-out mutation of the Qpct-gene
US20130052203A1 (en) In vivo screening models for treatment of qc-related disorders
US9277737B2 (en) Mouse models carrying a knock-out mutation of the QPCTL-gene
Stephan5Halle et al. Demuth et al.(43) Pub. Date: Oct. 31, 2013
TOWER Schilling et al.(43) Pub. Date: Jul. 16, 2009
US20150150225A1 (en) Transgenic mouse expressing human isoglutaminyl cyclotransferase
Graubner et al. Graubner
HK1146735A (en) Transgenic mice
WO2004062627A9 (en) In vivo screening models for treatment of alzheimer's disease and other neurodegenerative disorders

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08707977

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2008707977

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2675192

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2009545932

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2008206936

Country of ref document: AU

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 578513

Country of ref document: NZ

ENP Entry into the national phase

Ref document number: 2008206936

Country of ref document: AU

Date of ref document: 20080118

Kind code of ref document: A