WO2004062627A9

WO2004062627A9 - In vivo screening models for treatment of alzheimer's disease and other neurodegenerative disorders

Info

Publication number: WO2004062627A9
Application number: PCT/US2004/000883
Authority: WO
Inventors: Eliezer Masliah; Edward Rockenstein
Original assignee: Univ California; Eliezer Masliah; Edward Rockenstein
Priority date: 2003-01-13
Filing date: 2004-01-13
Publication date: 2004-09-16
Also published as: WO2004062627A3; WO2004062627A2

Abstract

The present invention provides a transgenic non-human animal, in particular a transgenic mouse encoding BACE1 proteins, which have been implicated in amyloid deposits and neurodegenerative diseases. The present invention additionally provides cells and cell lines comprising transgenes encoding for BACE1. The present invention further provides methods and compositions for evaluating agents that affect BACE1, for use in compositions for the treatment of neurodegenerative diseases.

Description

IN VIVO SCREENING MODELS FOR TREATMENT OF ALZHEIMER'S DISEASE AND OTHER NEURODEGENERATIVE DISORDERS

The U.S. Government has a paid-up license in this invention and the right in limited circumstances to require the patent owner to license others on reasonable terms as provided for by the terms of National Institutes of Health grant AG 18440, AG 10869 and AG5131.

FIELD OF THE INVENTION The present invention relates generally to methods and compositions for screening and treating neurodegenerative diseases, particularly those caused by the deposition of amyloid beta (Aβ) proteins. Specifically, the present invention comprises methods and compositions for effecting β-site amyloid precursor protein cleaving enzyme (BACEl) function.

BACKGROUND OF THE INVENTION A number of impairments in brain function are linked with the deposition of amyloid β (Aβ) including, but not limited to, Alzheimer's Disease (AD), cerebral amyloid angiopathy, Lewy body dementia, Down's Syndrome, hereditary cerebral hemorrhage with amyloidosis (Dutch type), and the Guam Parkinson- Dementia complex. Aβ plaques also occur in persons who have sustained a head trauma, critical coronary disease, and other disease processes. While Aβ is found predominantly in the nervous system, there have been reports of its presence in non-neural tissue. Aβ is a 4 kD protein, 39-43 amino acids long. It can be deposited in extracellular neurofibrillary tangles, within classical or diffuse senile plaques, and in vessel walls. It is expressed by a gene located on chromosome 21 and is derived by proteolytic cleavage through at least two alternate pathways from the interior of a much larger (770 residue) cell protein called amyloid precursor protein (APP). Cleavage of APP by α-secretase results in the secretion of a large N-terminal ectodomain. APP is also cleaved by β-secretase (also referred to as BACEl) on the luminal side of the membrane, to generate a soluble NH2-terminal fragment (APPS) and a 12-kDa COOH-terminal fragment (C99), which remains membrane bound. C99 is further cleaved by γ-secretase, resulting in the production of Aβ peptides, which vary in length (18). The β-site APP-cleaving enzyme (BACEl) or β-amyloid-converting enzyme 1, has been recently identified as a membrane-bound aspartic protease and is now considered to carry the major BACE activity in vivo (14,15,19). It is currently believed to be the rate limiting step of Aβ production.

After excision, amyloid β is polymerized into amyloid filaments, which in turn aggregate into visible amyloid plaque deposits. Neuropathological studies in human and animal models indicate that cells proximal to amyloid deposits are disturbed in their normal functions. (Mandybur (1989) Acta Neuropathol. 78:329- 331; Kawai et al. (1993) Brain Res. 623:142-6; Martin et al. (1994) Am. J. Pathol. 145:1348-1381; Kalaria et al. (1995) Neuroreport 6:477-80; Masliah et al. (1996) J. Neurosci. 16:5795-5811). AD studies additionally indicate that amyloid fibrils may actually initiate neurodegeneration (Lendon et al. (1997) J. Am. Med. Assoc. 277:825-31; Yankner (1996) Nat. Med. 2:850-2; Selkoe (1996) J. Biol. Chem. 271:18295-8; Hardy (1997) Trends Neurosci. 20:154-9).

The precise mechanisms by which neuritic plaques are formed and the relationship of plaque formation to the neurodegenerative processes are not well defined. However, evidence indicates that disregulated expression and/or processing of APP gene products or derivatives of these gene products are involved in the pathophysiological process leading to neurodegeneration and plaque formation. For example, missense mutations in APP are tightly linked to autosomal dominant forms of AD (Hardy (1994) Clin. Geriatr. Med. 10:239-247; Mann et al. (1992) Neurodegeneration 1:201-215). The role of APP in neurodegenerative disease is further implicated by the observation that persons with Down's syndrome who carry an additional copy of the human APP (hAPP) gene on their third chromosome 21 show an overexpression of hAPP (Goodison et al. (1993) J. Neuropathol. Exp. Neurol. 52:192-198; Oyama et al. (1994) J. Neurochem. 62:1062-1066) as well as a prominent tendency to develop AD-type pathology early in life (Wisniewski et al. (1985) Ann. Neurol. 17:278-282). APP is encoded by a 19-exon gene: exons 1-13, exon 13a, and 14-18 (Yoshikai et al. (1990) Gene 82:257-263; see FIG. 1 for a map of the hAPP exon- intron organization of the hAPP gene). Alternative splicing of APP gene-derived transcripts results in at least 10 isoforms (Sandbrink et al. (1994) J. Biol. Chem. 269:1510-1517). The predominant transcripts are APP695 (exons 1-6, 9-18, not 13a), APP751 (exons 1-7, 9-18, not 13a) and APP770 (exons 1-18, not 13a). All of these encode multidomain proteins with a single membrane-spanning region. They differ in that APP751 and APP770 contain exon 7, which encodes a serine protease inhibitor domain. APP695 is a predominant form in neuronal tissue, whereas APP751 is the predominant variant elsewhere. Aβ is derived from that part of the protein encoded by parts of exons 16 and 17. In three APP mutants, valine-642 in the transmembrane domain of APP(695) is replaced by isoleucine, phenylalanine, or glycine in association with dominantly inherited familial Alzheimer's disease. Several transgenic animals expressing human APP (hAPP) have been developed as models for AD (Higgins et al. (1994) Ann. Neurol 35:598-607; Mucke et al. (1994) Brain Res. 666:151-167; Games et al. (1995) Nature 373:523- 527; Games et al. (1995) Soc. Neurosci Abstr. 21:258). Most transgenic models were designed based on the observation that a number of APP mutations co- segregate with the familial form of AD; patients carrying these APP mutations exhibit neuropathological alterations that are indistinguishable from sporadic AD (Chartier-Harlin et al. (1991) Nature 353:844-846; Goate et al. (1991) Nature 349:704; Murrell et al. (1991) Science 254:97-99; Clark et al. (1993) Arch. Neurol. 50:1164-1172). Although presently available transgenic animals are promising models for

AD and AD-related neuropathologies, the current models do not address the role of BACEl. Accordingly, the need remains for a model that overexpresses hBACEI resulting in neurodegeneration in the model, which is suitable for screening and testing novel BACEl inhibitors for the treatment of AD and other Aβ related diseases. BRIEF SUMMARY OF THE INVENTION The present invention comprises methods and compositions for non-human transgenic mammal models for amyloid diseases. Specifically, the present invention comprises methods and compositions for non-human transgenic animal models that overexpress B ACE 1.

The present invention further comprises compositions and methods for screening for biologically active agents that modulate amyloid diseases including, but not limited to, Alzheimer's Disease (AD), cerebral amyloid angiopathy, Lewy body dementia, Down's Syndrome, hereditary cerebral hemorrhage with amyloidosis (Dutch type), and the Guam Parkinson-Dementia complex. Another aspect of the present invention comprises methods and compositions for screening for BACEl inhibitors.

Additionally, the present invention comprises methods and compositions for the treatment of neurodegenerative diseases, particularly methods and compositions that inhibit B ACE 1.

Accordingly it is an object of the invention to provide a transgenic animal which expresses BACEl.

It is another object of the invention to provide DNA constructs encoding for BACEl. It is an additional object of the invention to provide DNA constructs encoding for BACEl linked to a promoter.

It is a further object of the invention to provide a non-human animal model system.

It is an additional object of the invention to provide a non-human animal model system to study the in vivo and in vitro regulation and effects of BACEl in specific tissue types.

It is a further object of the invention to provide a non-human animal model system to examine the role of BACEl proteins in the accumulation of Aβ.

It is yet another object of the invention to provide a transgenic non-human animal useful for developing therapies for Aβ related conditions. It is an object of the invention to provide a transgenic non-human animal that expresses a neurological phenotype that is representative of neurodegeneration.

It is still another object of the present invention to provide a method for screening compounds for use in treating and preventing neurodegenerative disorders caused by Aβ deposits.

It is a further object of the present invention to provide a method for treating and preventing neurodegenerative disorders caused by Aβ deposits.

Other objects, advantages and features of the invention will become apparent upon consideration of the following detailed description.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 A is an autoradiograph depicting the levels of BACEl expression in the brain tissue of three-month-old Thyl-hBACEl transgenic mice, age matched non-transgenic mice, and a 60 year old non-demented human using RPA.

Figures 1B-C are graphs depicting RNA levels expressed as hBACE/actin and mBACE/actin, respectively, determined by RPA in the brain tissue of three- month-old Thyl-hBACEl transgenic mice, age matched non-transgenic mice, and a 60 year old non-demented human. Figure ID is an image of a Western blot of hBACEI protein in the frontal cortex of three-month-old Thyl-hBACEl transgenic mice and age matched non- transgenic mice.

Figure IE is a graph depicting quantitation of Western blot bands of hBACEI immunoreactivity in the frontal cortex of three-month-old Thyl-hBACEl transgenic mice and age matched non-transgenic mice.

Figure IF is a graph depicting BACE activity in three-month-old Thyl- hBACEl transgenic mice and age matched non-transgenic mice using a construct containing the bacterial maltose binding protein fused to the C-terminal 125 amino acid of APP as a substrate. Figures 1G-J are photomicrographs depicting immunoperoxidase staining for hBACEI in the frontal cortex of a non-transgenic mouse (G) and hBACEI transgenic mice from lines 39(H), 2(1) and 1(J), with the bar measuring 25 μm. Figure 2A is an image of a Western blot analysis for a full length APP

(22C11 clone, monoclonal antibody), c-terminal APP (CT15 polyclonal antibody and Aβ (4G8 clone, monoclonal antibody) c-terminal APP (CT15 polyclonal antibody) and actin Aβ (mouse monoclonal antibody) from different lines of 6- month old hBACEI transgenic mice and age matched non-transgenic mice.

Figures 2B-C are graphs of Image Quant aided analysis of levels of full length APP and c-terminal APP (n=4/animals per group) of the Western Blot bands of Figure 2A.

Figure 2D is a western blot of samples from hBACEI /hAPP doubly transgenic mice and singly transgenic controls from hBACEI line 1 and hAPP line J9.

Figures 2E, F are charts depicting quantitation of western blot bands (n = 4 mice/group).

Figures 2G-L are pictures of double immunolabeling and confocal microscopic analysis of hBACEI and C-terminal APP in the frontal cortex of 6- month-old hBACEI transgenic (G-I) and non-transgenic (J-L) mice, with the bar measuring 20 μm.

Figure 3 A is a graph of the results of the Morris water maze for six-month- old mice from the low expresser line 39 (n = 8 transgenic and n = 8 non-transgenic mice).

Figure 3B is a graph of the rotor-rod analysis of 6-month-old mice from different hBACEI transgenic lines.

Figure 3C is a chart of the open field analysis of 6-month-old mice.

Figures 4A-D are micrographs of the neuronal cytoarchitecture in the frontal cortex of 12-month-old non-transgenic control and hBACEI transgenic mice from different lines stained with cresyl violet and imaged with bright field microscopy, where the bar measures lOOμm.

Figures 4E-H are micrographs of neuronal shrinkage and degeneration (arrows) in layers 2-3 of the frontal cortex in hBACEI transgenic mice, where the bar measures 30 μm. Figures 4I-L are micrographs of the neuronal cytoarchitecture in the hippocampus of 12-month-old non-transgenic control and hBACEI transgenic mice from different lines, where the bar measures lOOμm.

Figures 4M-P are micrographs of the neuronal alterations (arrows) in the CA3 region of hBACEI transgenic mice, where the bar measures 30μm.

Figures 5A-D are micrographs of the neurodegenerative cytoskeletal alterations and reactive astrocytosis in the frontal cortex of 12-month-old hBACEI transgenic compared to age-matched non-transgenic control mice.

Figures 5E-H are micrographs depicting a depletion of microtubule associated protein 2 (MAP2) immunoreactivity in neuronal dendrites and cell bodies, as demonstrated by immunostaining and laser scanning confocal microscopy compared with an age-matched non-transgenic control mouse.

Figures 5J-L are micrographs comparing a reactive astrocytosis as revealed by GFAP immunostaining and bright field microscopy in the frontal cortex of 12- month-old hBACEI transgenic and age-matched non-transgenic control mice, where the bar measures 20μm.

Figures 5M-O are graphs of quantitative assessment of the levels of neurofilaments (M), MAP2 (N), and GFAP (O) immunoreactivities (n = 6 mice/group and immunostain) where *p < 0.05 vs non-transgenic (Dunnett's t test).

Figures 6A-C are micrographs depicting ultrastructural characterization of neuronal alterations in the frontal cortex of 12-month-old hBACEI transgenic mice with neuronal (n), dendritic (d), and axonal (a) alterations marked.

Figures 6D-F are micrographs depicting ultrastructural characterization of the frontal cortex of 12-month-old non transgenic control mice with preserved neuronal (n), dendritic (d), and axonal (a) structures marked.

Figure 7A is a micrograph of the neuromuscular alterations in the spinal cord stained with H&E of a 6-month old non-transgenic mouse where motorneuronal (n), and dendritic (d) structures are marked. Figure 7B is a micrograph of the neuromuscular alterations in the ganglion cells in the dorsal root ganglia stained with H&E in a 6-month old non-transgenic mouse. Figure 7C is a micrograph depicting the neuromuscular alterations in skeletal muscle fibers from the quadriceps stained with H&E in a 6-month old non-transgenic mouse.

Figure 7D is a micrograph of the neuromuscular alterations in the spinal cord stained with H&E of a 6-month old non-transgenic mouse.

Figure 7E is a micrograph of the neuromuscular alterations in the ganglion cells in the dorsal root ganglia stained with H&E in a 6-month old hBACEI transgenic mouse from line 1 where (n) motorneurons are marked.

Figure 7F is a micrograph depicting the neuromuscular alterations in skeletal muscle fibers from the quadriceps stained with H&E in a 6-month old hBACEI transgenic mouse from line 1.

Figure 7G is a micrograph depicting the neuromuscular alterations in skeletal muscle fibers from the quadriceps stained with H&E in a 6-month old hBACEI transgenic mouse from line 1. Figure 7H is a micrograph of the neuromuscular alterations in the spinal cord stained with H&E of a 6-month old hBACEI transgenic mouse from line 1.

Figure 8A is a micrograph of a toludine blue stained semi-thin section of the sciatic nerve in a 6-month-old non-transgenic mouse visualized by bright field microscopy, where the bar measures 5μm. Figure 8B is a micrograph of a toludine blue stained semi-thin section of the sciatic nerve from a 6-month old hBACEI transgenic mouse from line 1 visualized by bright field microscopy.

Figure 8C is a micrograph of osmium tetraoxide and uranyl acetate stained ultra-thin sections of myelinated axons from the sciatic nerve of a 6-month-old non-transgenic mouse.

Figure 8D is a micrograph of osmium tetraoxide and uranyl acetate stained ultra-thin sections of myelinated axons from the sciatic nerve of a 6-month old hBACEI transgenic mouse from line 1, analyzed by electron microscopy and demonstrating Wallerian degeneration with phagocytosis of myelin debris by a Schwann cell and collapsed myelin sheath at the center.

Figure 8E is a micrograph of a phagocytic cell containing myeloid bodies and other myelin debris in a 6-month-old hBACE transgenic mouse from line 1. Figure 8F is a micrograph of a myelin ovoid and early regenerating cluster with variably myelinated axonal sprouts in a 6-month-old hBACE transgenic mouse from line 1.

Figure 8G is a micrograph of an endoneurial fibroblast and remyelinating axon in a 6-month-old hBACE transgenic mouse from line 1.

Figure 8H is a micrograph of a large diameter axon surrounded by an inappropriately thin myelin sheath showing vesicular degeneration in 6-month-old hBACEI transgenic mouse from line 1.

Figure 9A is a chart of the results of the open field test in three-month-old hBACEI transgenic mice from line 1 and non-transgenic controls (n = 6 per genotype and treatment) treated for 14 days with daily intraperitoneal injections of the BACE inhibitor N-benzyloxycarbonyl-val-leu-leucinal (Calbiochem,

Darmstadt, Germany; 1.25 mg/kg per dose, diluted in DMSO) or with vehicle.

Figure 9B is a graph of the results of the rotor-rod test in three-month-old hBACEI transgenic mice from line 1 and non-transgenic controls (n = 6 per genotype and treatment) treated for 14 days with daily intraperitoneal injections of the BACE inhibitor N-benzyloxycarbonyl-val-leu-leucinal (Calbiochem,

Darmstadt, Germany; 1.25 mg/kg per dose, diluted in DMSO) or with vehicle.

Figure 9C is a western blot analysis of frontal cortex homogenates with antibodies against full-length APP (22C11) and C-terminal APP fragments (CT15) in three-month-old hBACEI transgenic mice from line 1 and non-transgenic controls (n = 6 per genotype and treatment) treated for 14 days with daily intraperitoneal injections of the BACE inhibitor N-benzyloxycarbonyl-val-leu- leucinal (Calbiochem, Darmstadt, Germany; 1.25 mg/kg per dose, diluted in DMSO) or with vehicle.

Figure 9D is a chart quantifying the western blot bands of the frontal cortex homogenates of three-month-old hBACEI transgenic mice from line 1 and non- transgenic controls (n = 6 per genotype and treatment) treated for 14 days with daily intraperitoneal injections of the BACE inhibitor N-benzyloxycarbonyl-val- leu-leucinal (Calbiochem, Darmstadt, Germany; 1.25 mg/kg per dose, diluted in DMSO) or with vehicle *p < 0.05. DETAILED DESCRIPTION OF INVENTION The present invention comprises methods and compositions for creating a transgenic animal model for the study of amyloid related diseases. The present invention specifically comprises methods and compositions for creating a transgenic animal model that overexpresses β-site amyloid precursor protein cleaving enzyme (BACEl). The present invention further comprises methods and compositions for testing BACEl inhibitors and methods of treatment of neurodegenerative and amyloid related diseases using BACEl inhibitors.

DEFINITIONS

The term "transgene" means a segment of DNA that has been incorporated into a host genome or is capable of autonomous replication in a host cell and is capable of causing the expression of one or more cellular products. Exemplary transgenes will provide the host cell, or animals developed therefrom, with a novel phenotype relative to the corresponding non-transformed cell or animal.

The term "transgenic animal" means a non-human animal, usually a mammal, having a non-endogenous nucleic acid sequence present as an extrachromosomal element in a portion of its cells or stably integrated into its germ line DNA. The term "construct" means a recombinant nucleic acid, generally recombinant DNA, that has been generated for the purpose of the expression of a specific nucleotide sequence(s), or is to be used in the construction of other recombinant nucleotide sequences.

The term "operably linked" means that a DNA sequence and a regulatory sequence(s) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequence(s).

The term "operatively inserted" means that a nucleotide sequence of interest is positioned adjacent a nucleotide sequence that directs transcription and translation of the introduced nucleotide sequence of interest (i.e., facilitates the production of, e.g., a polypeptide encoded by an APP sequence). Immunocytochemical studies in the brains of Alzheimer's Disease (AD) patients have shown increased BACEl expression around amyloid plaques. Additionally, in AD brain homogenates, BACEl levels and the amyloid precursor protein (APP) c-terminus fragment are elevated (23-26). While not wishing to be bound, it is currently believed that increased BACEl activity accelerates or augments AD-like pathology and carries out the β-secretase activity for Aβ formation. BACE is a typical aspartic proteinase in which cleavage of the pro- domain to generate the mature enzyme occurs on the carboxylterminal site resulting in the generation of a mature protein starting at E46 (22). It has the same general polypeptide fold seen in other members of this family and the unusual disulfide bonding pattern suggests that the enzyme might reveal novel substrate specificities. Many glycosyltransferases are type II membrane proteins and are retained in the Golgi apparatus for oligosaccharide biosynthesis (22). In the compositions and methods of the present invention, increased hBACEI activity in the brains of transgenic mice resulted in increased accumulation of APP c-terminal fragments which was associated with neurological deficits and neurodegeneration.

Increased expression of hBACEI in transgenic mice results in alterations in

APP metabolism, resulting in behavioral deficits and neurodegeneration that involves the neocortex, hippocampus, peripheral nerves and skeletal muscles. It is theorized that the increased expression of hBACEI results in neuronal damage by one of three mechanisms either alone or in combination: a) increasing the generation of APP neurotoxic products, b) promoting aberrant protein glycosylation associated with increased cleavage of sialyl transferase and/or c) increasing the proteolysis of yet unidentified substrates necessary for neuronal survival and plasticity. Supporting the first possibility, and in agreement with a previous report (36), the compositions and methods of the present invention showed that increased hBACEI expression is associated with increased generation of APP c-terminal products, but not Aβ, and caused prominent age related neurodegeneration and neurological decline. BACE acts at two beta cleavage sites (β and β') of APP generating the classical c-terminal stub (C99) and the alternative C89 fragment (24,37). Recent studies have suggested that most of the β-site proteolysis occurs at the endoplasmic reticulum, while the β'-site proteolysis at the trans-Golgi network and intracellular accumulation of the C99 fragment in this compartment might trigger neurodegeneration (24). For example, in primary cultures accumulation of the C99 fragment has been shown to promote apoptosis (38). Overexpression of the C99 fragment in transgenic animals resulted in hippocampal degeneration accompanied by long-term potentiation and memory deficits (39,40), possibly by interfering with signaling pathways and disregulation of calcium homeostasis (38). In addition to the c-terminal products, cleavage of APP by BACE results in the generation of N-terminal secreted APP β (sAPPβ), while cleavage by α- secretase results in the production of secreted APP α (sAPPα) (43). It has been previously proposed that sAPPα enhances synapse formation and glutamate clearance by activating glutamate transporters (44,45), while sAPPβ lacks this ability (45,46). Then, since BACE overexpression favors sAPPβ production over sAPPα, this might have deleterious effects by virtue of loss of function. Supporting this possibility, decreased glutamate transport functioning and increased sAPPβ production has been associated with motor and learning deficits (47,48). Other potentially toxic APP products that are generated following BACEl proteolysis, include, but are not limited to, Aβl-42/40 and Aβl 1-42/40. The subsequent cleavage of the C99 stub by γ-secretase results in the production of Aβl -42/40, while γ-secretase degradation of the C89 fragment generates Aβl 1- 42/40 (24,43). In double transgenic mice (hAPP and hBACEI), β-secretase overexpression has been shown to result in a modest increase of Aβl -42 generated from hAPPsw (Swedish mutation) but with no apparent neurodegeneration (36).

The precise role for BACEl in the pathogenesis of AD is under investigation, but recent studies have pointed to the possibility that BACEl activity might be increased in AD. Supporting this, immunocytochemical studies in the brains of AD patients have shown increased BACEl expression around amyloid plaques. Furthermore in AD brain homogenates, BACEl levels and the APP c-terminus fragment are elevated (23-26). Thus, while not wishing to be bound to any particular theory, it is currently thought that increased BACEl activity might accelerate or augment AD like pathology. Transgenes

The BACEl polynucleotides comprising the transgene of the present invention include BACEl cDNA and can also include modified BACEl cDNA. As used herein, a "modification" of a nucleic acid can include one or several nucleotide additions, deletions, or substitutions with respect to a reference sequence. A modification of a nucleic acid can include substitutions that do not change the encoded amino acid sequence due to the degeneracy of the genetic code, or which result in a conservative substitution. Such modifications can correspond to variations that are made deliberately, such as the addition of a Poly A tail, or variations which occur as mutations during nucleic acid replication.

As employed herein, the term "substantially the same nucleotide sequence" refers to DNA having sufficient identity to the reference polynucleotide, such that it will hybridize to the reference nucleotide under moderately stringent, or higher stringency, hybridization conditions. DNA having "substantially the same nucleotide sequence" as the reference nucleotide sequence, can have an identity ranging from at least 60% to at least 95% with respect to the reference nucleotide sequence.

The phrase "moderately stringent hybridization" refers to conditions that permit a target-nucleic acid to bind a complementary nucleic acid. The hybridized nucleic acids will generally have an identity within a range of at least about 60% to at least about 95%. Moderately stringent conditions are conditions equivalent to hybridization in 50% formamide, 5x Denhart's solution, 5x saline sodium phosphate EDTA buffer (SSPE), 0.2% SDS (Aldrich) at about 42°C, followed by washing in 0.2x SSPE, 0.2% SDS (Aldrich), at about 42° C.

High stringency hybridization refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018M NaCl at about 65° C, for example, if a hybrid is not stable in 0.018M NaCl at about 65° C, it will not be stable under high stringency conditions, as contemplated herein. High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5x Denhart's solution, 5x SSPE, 0.2% SDS at about 42° C, followed by washing in O.lx SSPE, and 0.1% SDS at about 65° C. Other suitable moderate stringency and high stringency hybridization buffers and conditions are well known to those of skill in the art and are described, for example, in Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Plainview, N.Y. (1989); and Ausubel et al. {Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999)).

The amino acid sequence encoded by the transgene of the present invention can be a BACEl sequence from a human or the BACEl homologue from any species. The amino acid sequence encoded by the transgene of the present invention can also be a fragment of the BACEl amino acid sequence so long as the fragment retains some or all of the function of the full-length BACEl sequence. The sequence may also be a modified BACEl sequence. Individual substitutions, deletions or additions, which alter, add or delete a single amino acid or a small percentage of amino acids (typically less than 10%, more typically less than 5%, and still more typically less than 1%.) A "modification" of the amino acid sequence encompasses conservative substitutions of the amino acid sequence. Conservative substitution tables providing functionally similar amino acids are well known in the art. The following six groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Serine (S), Threonine (T);

2) Aspartic acid (D), Glutamic acid (E);

3) Asparagine (N), Glutamine (Q);

4) Arginine (R), Lysine (K);

5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).

Other minor modifications are included within the sequence so long as the polypeptide retains some or all of the structural and/or functional characteristics of a BACEl polypeptide. Exemplary structural or functional characteristics include sequence identity or substantial similarity, antibody reactivity, the presence of conserved structural domains such as RNA binding domains or acidic domains. DNA Constructs and Vectors

The invention further provides a DNA construct comprising the BACEl transgene as described above. As used herein, the term "DNA construct" refers to a specific arrangement of genetic elements in a DNA molecule. In addition to human BACEl, or mutant forms thereof, the invention also provides a DNA construct using BACEl polypeptides from other species as well as BACEl mutant non-human mammals expressing BACEl from non-human species.

If desired, the DNA constructs can be engineered to be operatively linked to appropriate expression elements such as promoters or enhancers to allow expression of a genetic element in the DNA construct in an appropriate cell or tissue. The use of the expression control mechanisms allows for the targeted delivery and expression of the gene of interest. For example, the constructs of the present invention may be constructed using an expression cassette which includes in the 5'-3' direction of transcription, a transcriptional and translational initiation region associated with gene expression in brain tissue, DNA encoding a mutant or wild-type BACEl protein, and a transcriptional and translational termination region functional in the host animal. One or more introns also can be present. The transcriptional initiation region can be endogenous to the host animal or foreign or exogenous to the host animal. The DNA constructs described herein may be incorporated into vectors for propagation or transfection into appropriate cells to generate BACEl overexpressing mutant non-human mammals are also comprised by the present invention. One skilled in the art can select a vector based on desired properties, for example, for production of a vector in a particular cell such as a mammalian cell or a bacterial cell.

Vectors can contain a regulatory element that provides tissue specific or inducible expression of an operatively linked nucleic acid. One skilled in the art can readily determine an appropriate tissue-specific promoter or enhancer that allows expression of BACEl polypeptides in a desired tissue. It should be noted that tissue-specific expression as described herein does not require a complete absence of expression in tissues other than the preferred tissue. Instead, "cell- specific" or "tissue-specific" expression refers to a majority of the expression of a particular gene of interest in the preferred cell type or tissue.

Any of a variety of inducible promoters or enhancers can also be included in the vector for expression of a BACEl polypeptide or nucleic acid that can be regulated. Such inducible systems, include, for example, tetracycline inducible system (Gossen & Bizard, Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992); Gossen et al, Science, 268:1766-1769 (1995); Clontech, Palo Alto, Calif.); metalothionein promoter induced by heavy metals; insect steroid hormone responsive to ecdysone or related steroids such as muristerone (No et al, Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996); Yao et al, Nature, 366:476-479 (1993); Invitrogen, Carlsbad, Calif); mouse mammary tumor virus (MMTV) induced by steroids such as glucocorticoid and estrogen (Lee et al, Nature, 294:228-232 (_.1981); and heat shock promoters inducible by temperature changes; the rat neuron specific enolase gene promoter (Forss-Petter, et al., Neuron 5; 197- 197 (1990)); the humanβ-actin gene promoter (Ray, et al., Genes and Development (1991) 5:2265-2273); the human platelet derived growth factor B (PDGF-B) chain gene promoter (Sasahara, et al., Cell (1991) 64:217-227); the rat sodium channel gene promoter (Maue, et al., Neuron (1990) 4:223-231); the human copper-zinc superoxide dismutase gene promoter (Ceballos-Picot, et al, Brain Res. (1991) 552:198-214); and promoters for members of the mammalian POU-domain regulatory gene family (Xi et al., (1989) Nature 340:35-42).

Regulatory elements, including promoters or enhancers, can be constitutive or regulated, depending upon the nature of the regulation, and can be regulated in a variety of tissues, or one or a few specific tissues. The regulatory sequences or regulatory elements are operatively linked to one of the polynucleotide sequences of the invention such that the physical and functional relationship between the polynucleotide sequence and the regulatory sequence allows transcription of the polynucleotide sequence. Vectors useful for expression in eukaryotic cells can include, for example, regulatory elements including the SV40 early promoter, the cytomegalo virus (CMV) promoter, the mouse mammary tumor virus (MMTV) steroid-inducible promoter, Pgtf, Moloney murine leukemia virus (MMLV) promoter, thy-1 promoter and the like. If desired, the vector can contain a selectable marker. As used herein, a "selectable marker" refers to a genetic element that provides a selectable phenotype to a cell in which the selectable marker has been introduced. A selectable marker is generally a gene whose gene product provides resistance to an agent that inhibits cell growth or kills a cell. A variety of selectable markers can be used in the DNA constructs of the invention, including, for example, Neo, Hyg, hisD, Gpt and Ble genes, as described, for example in Ausubel et al {Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999)) and U.S. Patent No. 5,981,830. Drugs useful for selecting for the presence of a selectable marker include, for example, G418 for Neo, hygromycin for Hyg, histidinol for hisD, xanthine for Gpt, and bleomycin for Ble (see Ausubel et al, supra, (1999); U.S. Patent No. 5,981,830). DNA constructs of the invention can incorporate a positive selectable marker, a negative selectable marker, or both (see, for example, U.S. Patent No. 5,981,830).

Non-Human Transgenic Animals

The invention additionally provides a nonhuman transgenic animal whose genome comprises a transgene encoding a BACEl polypeptide. The DNA fragment can be integrated into the genome of a transgenic animal by any method known to those skilled in the art. The DNA molecule containing the desired gene sequence can be introduced into pluripotent cells, such as ES cells, by any method that will permit the introduced molecule to undergo recombination at its regions of homology. Techniques that can be used include, but are not limited to, calcium phosphate/DNA co-precipitates, microinjection of DNA into the nucleus, electroporation, bacterial protoplast fusion with intact cells, transfection, and polycations, (e.g., polybrene, polyornithine, etc.) The DNA can be single or double stranded DNA, linear or circular. (See for example, Hogan et al, Manipulating the Mouse Embryo: A Laboratory Manual Cold Spring Harbor Laboratory (1986); Hogan et al, Manipulating the Mouse Embryo: A Laboratory Manual, second ed., Cold Spring Harbor Laboratory (1994), U.S. Patent Nos. 5,602,299; 5,175,384; 6,066,778; 4,873,191 and 6,037,521; retrovirus mediated gene transfer into germ lines (Van der Putten et al, Proc. Natl. Acad. Sci. USA 82:6148-6152 (1985)); gene targeting in embryonic stem cells (Thompson et al, Cell 56:313-321 (1989)); electroporation of embryos (Lo, Mol Cell. Biol. 3:1803- 1814 (1983)); and sperm-mediated gene transfer (Lavitrano et al, Cell 57:717-723 (1989))). For example, the zygote is a good target for micro-injection, and methods of microinjecting zygotes are well known to those of skill in the art (see U.S. Patent No. 4,873,191). In the mouse, the male pronucleus reaches the size of approximately 20 micrometers in diameter, which allows reproducible injection of 1-2 picoliters (pi) of DNA solution. The use of zygotes as a target for gene transfer has a major advantage in that in most cases the injected DNA will be incorporated into the host genome before the first cleavage (Brinster, et al, Proc. Natl. Acad. Sci. USA 82:4438-4442 (1985)). As a consequence, all somatic cells of the transgenic non-human animal will carry the incorporated transgene. This will in general, also be reflected in the efficient transmission of the transgene to offspring of the founder since 50% of the germ cells will harbor the transgene. The injected zygotes are transplanted to the oviducts/uteri of pseudopregnant females and finally transgenic animals are obtained.

Embryonal cells at various developmental stages can also be used to introduce transgenes for the production of transgenic animals. Different methods are used depending on the stage of development of the embryonal cell. Such transfected embryonic stem (ES) cells can thereafter colonize an embryo following their introduction into the blastocoele of a blastocyst-stage embryo and contribute to the germ line of the resulting chimeric animal (reviewed in Jaenisch, Science 240:1468-1474 (1988)). Prior to the introduction of transfected ES cells into the blastocoele, the transfected ES cells can be subjected to various selection protocols to enrich the proportion of ES cells that have integrated the transgene if the transgene provides a means for such selection. Alternatively, PCR can be used to screen for ES cells that have integrated the transgene.

In addition, retroviral infection can also be used to introduce transgenes into a non-human animal. The developing non-human embryo can be cultured in vitro to the blastocyst stage. During this time, the blastomeres can be targets for retroviral infection (Janenich, Proc. Natl Acad. Sci. USA 73:1260-1264 (1976)). Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Hogan et al, supra, 1986). The viral vector system used to introduce the transgene is typically a replication-defective retrovirus carrying the transgene (Jahner et al, Proc. Natl. Acad Sci. USA 82:6927-6931 (1985); Van der Putten et al, Proc. Natl. Acad Sci. USA 82:6148-6152 (1985)). Transfection is easily and efficiently obtained by culturing the blastomeres on a monolayer of virus-producing cells (Van der Putten, supra, 1985; Stewart et al, EMBO J. 6:383-388 (1987)). Alternatively, infection can be performed at a later stage. Virus or virus-producing cells can be injected into the blastocoele (Jahner D. et al, Nature 298:623-628 (1982)). Most of the founders will be mosaic for the transgene since incorporation occurs only in a subset of cells which form the transgenic animal. Further, the founder can contain various retroviral insertions of the transgene at different positions in the genome, which generally will segregate in the offspring. In addition, transgenes may be introduced into the germline by intrauterine retroviral infection of the mid-gestation embryo (Jahner et al, supra, 1982). Additional means of using retroviruses or retroviral vectors to create transgenic animals known to those of skill in the art involves the micro-injection of retroviral particles or mitomycin C-treated cells producing retrovirus into the perivitelline space of fertilized eggs or early embryos (WO 90/08832 (1990); Haskell and Bowen, Mol Reprod. Dev. 40:386 (1995)).

Once the founder animals are produced, they can be bred, inbred, outbred, or crossbred to produce colonies of the particular animal. Examples of such breeding strategies include, but are not limited to: outbreeding of founder animals with more than one integration site in order to establish separate lines; inbreeding of separate lines in order to produce compound transgenics that express the transgene at higher levels because of the effects of additive expression of each transgene; crossing of heterozygous transgenic mice to produce mice homozygous for a given integration site in order to both augment expression and eliminate the need for screening of animals by DNA analysis; crossing of separate homozygous lines to produce compound heterozygous or homozygous lines; breeding animals to different inbred genetic backgrounds so as to examine effects of modifying alleles on expression of the transgene and the effects of expression. The transgenic animals are screened and evaluated to select those animals having the phenotype of interest. Initial screening can be performed using, for example, Southern blot analysis or PCR techniques to analyze animal tissues to verify that integration of the transgene has taken place. The level of mRNA expression of the transgene in the tissues of the transgenic animals can also be assessed using techniques which include, but are not limited to, Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis, and reverse transcriptase-PCR (rt-PCR). Samples of the suitable tissues can be evaluated immunocytochemically using antibodies specific for BACEl or with a tag such as EGFP. The transgenic non-human mammals can be further characterized to identify those animals having a phenotype useful in methods of the invention. In particular, transgenic non-human mammals overexpressing BACEl can be screened using the methods disclosed herein. For example, tissue sections can be viewed under a fluorescent microscope for the present of fluorescence, indicating the presence of the reporter gene.

Another method to affect tissue specific expression of the BACEl protein is through the use of tissue-specific promoters. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al, (1987) Genes Dev. 1:268-277); lymphoid-specific promoters (Calame and Eaton (1988) Adv. Immunol. 43:235-275), in particular promoters of T cell receptors (Winoto and Baltimore (1989) EMBO J. 8:729-733) and immunoglobulins (Banerji et al, (1983) Cell 33:729-740; Queen and Baltimore (1983) Cell 33:741-748), neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle (1989) PNAS 86:5473-5477), pancreas-specific promoters (Edlund et al, (1985) Science 230:912-916), cardiac specific expression (alpha myosin heavy chain promoter, Subramaniam, A, Jones WK, Gulick J, Wert S, Neumann J, and Robbins J. Tissue-specific regulation of the alpha-myosin heavy chain gene promoter in transgenic mice. J Biol Chem 266: 24613-24620, 1991.), and mammary gland-specific promoters (e.g., milk whey promoter; U.S. Patent No. 4,873,316 and European Application Publication No. 264,166). The invention further provides an isolated cell containing a DNA construct of the invention. The DNA construct can be introduced into a cell by any of the well known transfection methods (Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Plainview, NY. (1989); Ausubel et al, supra, (1999)). Alternatively, the cell can be obtained by isolating a cell from a mutant non-human mammal created as described herein. Thus, the invention provides a cell isolated from a BACEl mutant non-human mammal of the invention, in particular, a BACEl mutant mouse. The cells can be obtained from a homozygous BACEl mutant non-human mammal such as a mouse or a heterozygous BACEl mutant non-human mammal such as a mouse.

Assays and Identification of Therapeutic Agents

The methods and compositions of the present invention are particularly useful in the evaluation of regulators of BACEl and for the development of drugs and therapeutic agents for the treatment and prevention of Aβ associated diseases such as Alzheimer's disease.

Compounds useful as potential therapeutic agents can be generated by methods well known to those skilled in the art, for example, well known methods for producing pluralities of compounds, including chemical or biological molecules such as simple or complex organic molecules, metal-containing compounds, carbohydrates, peptides, proteins, peptidomimetics, glycoproteins, lipoproteins, nucleic acids, antibodies, and the like, are well known in the art and are described, for example, in Huse, U.S. Patent No. 5,264,563; Francis et al, Curr. Opin. Chem. Biol 2:422-428 (1998); Tietze et al, Curr. Biol., 2:363-371 (1998); Sofia, Mol Divers. 3:75-94 (1998); Eichler et al, Med. Res. Rev. 15:481- 496 (1995); and the like. Libraries containing large numbers of natural and synthetic compounds also can be obtained from commercial sources. Combinatorial libraries of molecules can be prepared using well known combinatorial chemistry methods (Gordon et al, J. Med. Chem. 37: 1233-1251 (1994); Gordon et al. , J. Med. Chem. 37: 1385-1401 (1994); Gordon et al. , Ace. Chem. Res. 29:144-154 (1996); Wilson and Czarnik, eds., Combinatorial Chemistry: Synthesis and Application, John Wiley & Sons, New York (1997)). The transgenic animal or the cells of the transgenic animal of the invention can be used in a variety of screening assays. For example, any of a variety of potential agents suspected of affecting BACEl and amyloid accumulation, as well as the appropriate antagonists and blocking therapeutic agents, can be screened by administration to the transgenic animal and assessing the effect of these agents upon the function and phenotype of the cells and on the neurological phenotype of the transgenic animals.

Behavioral studies may also be used to test potential therapeutic agents, such as those studies designed to assess motor skills, learning and memory deficits. An example of such a test is the Morris Water maze (Morris (1981) Learn Motivat 12:239-260). Additionally, behavioral studies may include evaluations of locomotor activity such as with the rotor-rod and the open field.

The methods of the invention can advantageously use cells isolated from a homozygous or heterozygous BACEl mutant non-human mammal, to study amyloid accumulation as well as to test potential therapeutic compounds. The methods of the invention can also be used with cells expressing BACEl such as a transfected cell line.

A cell overexpressing BACEl can be used in an in vitro method to screen compounds as potential therapeutic agents for treating Aβ associated disease. In such a method, a compound is contacted with a cell overexpressing BACEl, either a transfected cell or a cell derived from a BACEl mutant non-human mammal, and screened for alterations in a phenotype associated with expression of BACEl. The changes in Aβ production in the cellular assay and the transgenic animal can be assessed by methods well known to those skilled in the art. A BACEl fusion polypeptide such as BACEl -EGFP can be particularly useful for such screening methods since the expression of BACEl can be monitored by fluorescence intensity. Other exemplary fusion polypeptides include other fluorescent proteins, or modifications thereof, glutathione S transferase (GST), maltose binding protein, poly His, and the like, or any type of epitope tag. Such fusion polypeptides can be detected, for example, using antibodies specific to the fusion polypeptides. The fusion polypeptides can be an entire polypeptide or a functional portion thereof so long as the functional portion retains desired properties, for example, antibody binding activity or fluorescence activity.

The invention further provides a method of identifying a potential therapeutic agent for use in treating Aβ associated diseases, including, but not limited to, Alzheimer's Disease (AD), cerebral amyloid angiopathy, Lewy body dementia, Down's Syndrome, hereditary cerebral hemorrhage with amyloidosis (Dutch type), and the Guam Parkinson-Dementia complex. The method includes the steps of contacting a cell containing a DNA construct comprising polynucleotides encoding a BACEl polypeptide with a compound and screening the cell for decreased BACEl production, thereby identifying a potential therapeutic agent for use in treating amyloid diseases. The cell can be isolated from a transgenic non-human mammal having nucleated cells containing the BACEl DNA construct. Alternatively, the cell can contain a DNA construct comprising a nucleic acid encoding a green fluorescent protein fusion, or other fusion polypeptide, with a BACEl polypeptide.

Additionally, cells expressing a BACEl polypeptide can be used in a preliminary screen to identify compounds as potential therapeutic agents having activity that alters a phenotype associated with BACEl expression. As with in vivo screens using BACEl mutant non-human mammals, an appropriate control cell can be used to compare the results of the screen. The effectiveness of compounds identified by an initial in vitro screen using cells expressing BACEl can be further tested in vivo using the invention BACEl mutant non-human mammals, if desired. Thus, the invention provides methods of screening a large number of compounds using a cell-based assay, for example, using high throughput screening, as well as methods of further testing compounds as therapeutic agents in an animal model of Aβ disorders.

Compounds identified as therapeutic agents by methods of the invention can be administered to an individual, for example, to prevent, inhibit or reverse neurodegenerative diseases. One skilled in the art will know or can readily determine the alleviation of the clinical index, signs or symptoms associated with amyloid associated neurodegenerative diseases such as Alzheimer's Disease. For use as a therapeutic agent, the compound can be formulated with a pharmaceutically acceptable carrier to produce a pharmaceutical composition, which can be administered to a human or other animal. A pharmaceutically acceptable carrier can be, for example, water, sodium phosphate buffer, phosphate buffered saline, normal saline or Ringer's solution or other physiologically buffered saline, or other solvent or vehicle such as a glycol, glycerol, an oil such as olive oil or an injectable organic ester. A pharmaceutically acceptable carrier can also contain physiologically acceptable compounds that act, for example, to stabilize or increase the absorption of the modulatory compound. One skilled in the art would know that the choice of a pharmaceutically acceptable carrier, including a physiologically acceptable compound, depends, for example, on the route of administration of the composition.

The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following examples. These examples are described solely for purposes of illustration and are not intended to limit the scope of the invention. Although specific terms have been employed herein, such terms are intended in a descriptive sense and not for purposes of limitation.

EXAMPLES

EXAMPLE 1 Constructs, generation ofmThl-hBACEl transgenic mice and tissue processing.

Transgenic mice were generated as previously described (27) using the murine (m) Thy-1 expression cassette (provided by Dr. H. van der Putten, Ciba- Geigy, Bazel). The wildtype (wt) hBACEI cDNA fragment was produced by reverse transcriptase-polymerase chain reaction (RT-PCR) from human brain mRNA, as previously described (28). Specifically, the human BACEl coding sequence was cloned from RNA extracted from human brain tissue using the Tri Reagent (MRC Inc., Cincinati OH). cDNA was created using reverse transcription, and the coding sequence (SEQ ID NO: 1) was cloned out using forward primer 5'- gtcgac/gccacc/atggcccaagccctgccctg (SEQ ID NO:2) and reverse primer 5'- ctcgag/tcacttcagcagggagatg (SEQ ID NO:3) with Sail restriction site and Kozak sequence at the 5' end and a Xhol restriction site at the 3 'end as follows:

Sail/ Kozak/ Coding sequence gtcgac/gccacc/atggcccaagccctgccctggctcctgctgtggatgggcgcgggagtgctgcctgcccacgg cacccagcacggcatccggctgcccctgcgcagcggcctggggggcgcccccctggggctgcggctgccccgg gagaccgacgaagagcccgaggagcccggccggaggggcagctttgtggagatggtggacaacctgaggggca agtcggggcagggctactacgtggagatgaccgtgggcagccccccgcagacgctcaacatcctggtggatacag gcagcagtaactttgcagtgggtgctgccccccaccccttcctgcatcgctactaccagaggcagctgtccagcacat accgggacctccggaagggtgtgtatgtgccctacacccagggcaagtgggaaggggagctgggcaccgacctg gtaagcatcccccatggccccaacgtcactgtgcgtgccaacattgctgccatcactgaatcagacaagttcttcatca acggctccaactgggaaggcatcctggggctggcctatgctgagattgccaggcctgacgactccctggagcctttct ttgactctctggtaaagcagacccacgttcccaacctcttctccctgcagctttgtggtgctggcttccccctcaaccagt ctgaagtgctggcctctgtcggagggagcatgatcattggaggtatcgaccactcgctgtacacaggcagtctctggt atacacccatccggcgggagtggtattatgaggtgatcattgtgcgggtggagatcaatggacaggatctgaaaatgg actgcaaggagtacaactatgacaagagcattgtggacagtggcaccaccaaccttcgtttgcccaagaaagtgtttg aagctgcagtcaaatccatcaaggcagcctcctccacggagaagttccctgatggtttctggctaggagagcagctgg tgtgctggcaagcaggcaccaccccttggaacattttcccagtcatctcactctacctaatgggtgaggttaccaacca gtccttccgcatcaccatccttccgcagcaatacctgcggccagtggaagatgtggccacgtcccaagacgactgtta caagtttgccatctcacagtcatccacgggcactgttatgggagctgttatcatggagggcttctacgttgtctttgatcg ggcccgaaaacgaattggctttgctgtcagcgcttgccatgtgcacgatgagttcaggacggcagcggtggaaggcc cttttgtcaccttggacatggaagactgtggctacaacattccacagacagatgagtcaaccctcatgaccatagcctat gtcatggctgccatctgcgccctcttcatgctgccactctgcctcatggtgtgtcagtggcgctgcctccgctgcctgcg ccagcagcatgatgactttgctgatgacatctccctgctgaagtga/ctcgag (SEQ ID NO:l)

/Xhol The PCR product was cloned into PCRII vector (Invitrogen, CA) for sequence confirmation and further cloning into mThyl expression cassette. The PCRII-hBACE was digested with Sail and Xhol to remove from PCRII and clone into mThyl vector. The mThyl expression cassette vector was then linearized by digesting with Xhol restriction ezyme and the hBACE fragment was ligated into it. The final mThyl-hBACEl vector was sequence confirmed at the junctions.

In order to prepare the transgene for microinjection, 20μg of DNA was digested with EcoRI and Pvul enzymes to release the mThyl transgene from the vector backbone. This was then purified and then microinjected into fertilized mouse eggs. This cDNA (SEQ ID NO:l, nt 7-1518) included a Kozak consensus sequence (GCC ACC ATG) (SEQ ID NO:4) at the 5'end to enhance expression. The hBACEI cDNA fragment was inserted into the mThy-1 expression cassette between exons 2 and 4, purified and microinjected into one-cell embryos (C57BL/6xDBA/2 FI). EXAMPLE 2

Identification of transgenic mice

Genomic DNA was extracted from tail biopsies using the protocol from S.A. Miller et al, Nucleic Acids Res. 16, 1215 (1988) and analyzed by PCR amplification as follows. The mTHy-1 hBACEI DNA sequences were identified using sense primer, 5'-CCACGTCCCAAGACGACTG (SEQ ID NO:7) and antisense primer, 5'-GATGATGGCATGCAGCACTGG (SEQ ID NO:8). Approximately lOOng/μl of the extracted DNA was diluted with lOmM Tris at a pH of 8.0. 1.5μl of the diluted DNA was combined with lμl of the sense primer (lOOng/μl) and lμl of antisense primer (lOOng/μl). To this mixture 22 μl of distilled water and 35 μl of PCR Master mix were added to a total volume of 50μl. Cycle conditions were 94.0°C for 3 minutes, then five cycles of 94.0°C for 30 seconds, 49.0°C for 30 seconds, 72.0°C for 1 minute, and thirty cycles of 94.0°C for 30 seconds, 49.0°C for 30 seconds, 72.0°C for 1 minute and a final cycle of 72.0°C for 5 minutes. These primers produce a 200nt amplicon, which was visualized on a 1% agarose gel. Of the 5-60 mice obtained from microinjections of the mTHy-1 hBACEI construct, four founders were positive by DNA analysis.

EXAMPLE 3 Maintenance of the Mice

Transgenic lines were maintained by crossing heterozygous transgenic mice with nontransgenic C57BL/6 x DBA/2 FI breeders. All transgenic mice were heterozygous with respect to the transgene and the nontransgenic littermates served as controls. Following NIH guidelines for the humane treatment of animals, mice were anesthetized with chloral hydrate and flush-perfused transcardially with 0.9% saline. Brains and peripheral tissues were removed and divided sagitally. One hemibrain, muscle and nerves were post-fixed in phosphate-buffered 4% paraformaldehyde (pH 7.4) at 4°C for 48 hours for neuropathological analysis, while the other hemibrain and set of peripheral tissues were snap-frozen and stored at -70°C for subsequent RNA or protein analysis. EXAMPLE 4

RNA extraction and analysis

Total RNA from snap-frozen hemibrains or from dissected brain regions (neocortex and hippocampus) as described in Example 3 was isolated with TRI reagent (Molecular Research Center, Cincinnati, OH) and stored in formazol buffer (Molecular Research) at -20°C. Total RNA was analyzed by solution hybridization RNase protection assay (RPA), as described previously (29). Samples were separated on 5% acrylamide/8 M urea Tris/borate/EDTA gels, and dried gels were exposed to Kodak XAR film (Eastman Kodak, Rochester, NY). Levels of mRNA were quantitated from Phosphorlmager readings of probe- specific signals corrected for RNA content/loading errors by normalization to β- actin signals (29). The following ³²P-labeled antisense riboprobes were used to identify specific mRNAs [protected nucleotides (GenBank accession number)]: hBACEI [nt 1305-1599 (No. AF190725) SEQ ID NO:5]; mBACEl [nt 1280-1574 (No. AF190726) SEQ ID NO:6]; mAPP770 (SEQ ID NO:9) [nt 811-1314 (No. XM 28362) of mAPP exon 6-9 ] and mβ-actin (SEQ ID NO: 10) [nt 480-565 (X03672)].

EXAMPLE 5 Analysis of the transgenic lines 1, 2 and 39.

Based on the levels of mRNA expression by RPA, three transgenic lines were selected for further analysis. Line 1 was the highest expresser, followed by lines 2 and 39 (Figure 1A, B). Compared to non-transgenic controls, endogenous levels of mBACEl were decreased by 30-50% in all lines (Figure IC). Consistent with the mRNA analysis, levels of hBACEI immunoreactivity by Western blot (Figure ID, E), hBACEI activity (Figure IF) and immunocytochemistry (Figure IG-J) were highest in transgenic mice from line 1, followed by lines 2 and 39. In mice from all 3 lines, the highest levels of hBACEI immunoreactivity were observed in pyramidal neurons in layers 4-5 of the neocortex (Figure IG-J). In the hippocampus of mice from line 1, hBACEI immunoreactivity was detected in neurons of the dentate gyrus and in the CA1 region (not shown). In the hippocampus of mice from lines 2 and 39 pyramidal neurons in CA1-3, but not the granular cells of the dentate gyrus, were labeled (not shown). Moderate hBACEI immunoreactivity was also detected in subcortical nuclei, and cerebellum of all 3 lines. No immunoreactivity with the hBACE 1- specific antibody was observed in nontransgenic mice (Figure 1 D, E, G) and no enzyme activity was detected with the BACE assay (Figure IF). The spinal cord showed levels of hBACEI expression (for line 1 signal to actin ratio 1.67+/-0.4) comparable to the brain (for line 1 signal to actin ratio 1.45+/-0.3) and proportional to the transgenic line. In the peripheral nerves and skeletal muscle very low levels of hBACEI mRNA were detected, these levels were equivalent to 1% of what was observed in the brain or spinal cord. hBACEI expression was restricted to the nervous system since no hBACEI mRNA was detected in any other organs (liver, spleen, kidneys, lungs) (not shown).

EXAMPLE 6

Determination of hBACE and mAPP expression

Levels of the transgene derived hBACEI and mAPP immunoreactivity were determined, as previously described (30), in brain homogenates by Western blot and in vibratome sections by immunocytochemistry. For Western blot analysis, homogenates were separated into cytosolic and particulate fractions, assayed by the Lowry method, loaded (15 μg per lane) into 10% SDS -PAGE gels and blotted onto nitrocellulose. Blots were incubated with a rabbit polyclonal antibody against hBACEI pro-active region (736, Elan Pharmaceuticals, South San Francisco, CA, 1:1000), mouse monoclonal antibody against total APP (clone 22C11, Chemicon International, Temecula, CA, 1:1000) or with the rabbit polyclonal antibody against the c-terminal APP (CT15, courtesy of Dr. Edward Koo) (1:20,000), or the mouse monoclonal antibody against Aβ (4G8 clone) followed by ¹²⁵I protein A. Blots were exposed to Phosphorlmager (Molecular Dynamics, Piscataway, NJ) screens and analyzed with ImageQuant software. For immunocytochemical analysis of hBACEI expression, 40μm-thick vibratome sections from mThyl-hBACEl transgenic and nontransgenic mice were incubated overnight at 4°C with anti-hBACEl primary antibody (736, Elan, 1:100). Binding of primary antibody was detected utilizing the Vector ABC Elite kit (Vector Laboratories, Burlingame, CA) and diaminobenzidine tetrahydrochloride (DAB) with 0.001 % H₂0₂. Vibratome sections were incubated overnight at 4°C with anti-hBACEl (1:1000) and developed with tyramide Signal Amplification Direct System (NEN Life Sciences, Boston, MA; 1:100). Sections were then incubated overnight with anti-C terminal APP (1:100), followed by incubation with FITC-tagged secondary goat anti-rabbit (Vector, 1:75) and imaging by laser scanning confocal microscopy (MRC 1024, BioRad, Hercules, CA).

EXAMPLE 7

Analysis of BACEl activity and APP expression in transgenic mice

Briefly, as previously described (31), extracted supernatants from mouse brains were neutralized with Tris base and assayed for BACEl activity using as substrate a construct containing the bacterial maltose binding protein fused to the

C-terminal 125 of APP. Enzyme reactions were incubated for 2 hrs at 37°C and diluted 1:5 prior to ELISA assay. Purified hBACEI was used as standard control.

Levels of full length mAPP and its metabolic products were analyzed in the brains of hBACEI transgenic mice by Western blot. Full length mAPP was detected as a triple band at an estimated molecular weight (MW) of 110-120 kDa, in both the nontransgenic and transgenic mice (Figure 2A). However, in the hBACEI transgenic mice, there was a reduction in the levels of full length mAPP in the particulate fraction, this decrease was most apparent for the two upper bands (Figure 2 A, B). In contrast, in the cytosolic fractions there were no differences between nontransgenic and transgenic mice for full length mAPP (Figure 2A). Western blot analysis with an antibody (CT15) against the c-terminal site of APP that recognizes the BACE cleavage products - C89 and 99, showed that in hBACEI transgenic mice there was increased by 60-70% in the higher expresser (line 1) transgenic mice when compared to nontransgenic controls (Figure 2 A, C). Similarly, but to a lower extent, levels of Aβ were increased by 15-20% compared to nontransgenic controls (Figure 2A). Consistent with these observations, double labeling studies showed that neurons displaying higher levels of hBACEI- immunoreactivity also presented more intense immunostaining with the c-terminal APP antibody in the neocortex and hippocampus (Figure 2G-I) compared to nontransgenic controls (Figure 2J-L). Singly, transgenic mice expressing an FAD- mutant hAPP minigene (line J9 (19, 20)) showed an increase in overall levels of cerebral APP expression compared with non-transgenic controls (Fig. 2D-F). As in singly transgenic hBACEI mice, overexpression of hBACEI (line 1) decreased the levels of full-length APP and increased the levels of C-terminal APP fragments in hBACEl/hAPP doubly transgenic mice (Fig. 2D-F).

EXAMPLE 8

Neuropathological analysis

Vibratome sections were incubated overnight at 4°C with the mouse monoclonal antibody against the neuronal dendritic marker microtubule-associated protein 2 (MAP2), the axonal marker SMI 312 (Sternberger Imniuocytochemicals, Baltimore, MD) and with an antibody against glial fibrillary acidic protein (GFAP) (Chemicon International), a marker of astroglial cells (32). Binding of primary antibody was detected by two methods: i) with the Vector Elite kit and DAB/H₂0₂, and ii) with the FITC-conjugated Avidin-D (1:75, Vector). Sections reacted with DAB/H₂0₂ were examined with an Olympus Vanox light microscope. The FITC- labeled immunofluorescent sections were analyzed with the laser scanning confocal microscope (LSCM) (BioRad, Hercules, CA, 1024)(32,33). Additional neuropathological analysis was performed in vibratomed sections stained with cresyl violet or with hematoxylin & eosin (H&E) and in paraffin sections labeled for DNA fragmentation by a modified version of the in situ TdT-mediated dUTP nick end labeling (TUNEL) method as previously described (34). For the spinal cord, peripheral nerve and muscle, paraffin embedded sections were stained with cresyl violet or with H&E. Additional specimens from the thigh muscles were flash frozen in isopentane precooled in liquid nitrogen, sectioned at 8 μm, and stained with H&E and modified Gomori trichrome, and reacted for NADH dehydrogenase and myofibrillar ATPase localization. For brain and sciatic nerve samples, additional blocks were processed for subsequent ultrastructural analysis. For this purpose, tissues were postfixed with 2% glutar aldehyde/0.1 % osmium tetroxide in 0.1 M sodium cacodylate buffer and embedded in Epoxy. Blocks were sectioned with an Ultracut E ultramicrotorne (Leica, Nussloch, Germany) and analyzed with a Zeiss EM 10 electron microscope (Carl Zeiss, Oberkochen, Germany) (27). These analyses showed that in hBACEI transgenic mice (from all of the 3 lines), pyramidal neurons in layers 2-3 of the neocortex (Figure 4A-H) and in the CA3 region of the hippocampus (Figure 4M-P) were shrunken and disorganized. Consistent with these findings, immunocytochemical analysis showed that compared to nontransgenic littermates (Figure 5 A, 5E, 51, 5M), in the hBACEI transgenic mice the axonal (Figure 5B-D) and dendritic processes (Figure 5F-H) of pyramidal neurons diminished and were often disrupted or vacuolized (Figure 5G, H). These alterations were present at 3 months of age but became more prominent at 6 and 12 months of age. Furthermore, at 12 months of age, neurodegeneration was accompanied by fragmentation of the pyramidal neurons DNA (Figure 5J-L) and mild astrogliosis (Figure 5N-P) as revealed by TUNEL labeling and immunocytochemical analysis with an antibody against GFAP respectively. Ultrastructural analysis in hBACEI -transgenic (line 1; 6 month old) confirmed the light microscopy results and showed that compared to nontransgenic controls (not shown) the neuronal cytoarchitecture was disrupted with collapsed cytoplasm, dissolution of the mitochondria and accumulation of electrodense material (not shown). The adjacent neuropil showed extensive vacuolization of the dendritic arbor (not shown) and the axonal processes displayed widespread degeneration with splinting and disorganization of the myelin laminations (not shown). Since hBACEI transgenic mice also displayed locomotor deficits, neuropathological analysis of the spinal cord, nerves and skeletal muscle was performed. Compared to nontransgenic controls (Figure 7A-D), no significant alterations were observed in the spinal cord motorneurons (Figure 7E) or dorsal root ganglia (Figure 7F) of the hBACEI transgenic mice at any of the ages studied. In contrast, muscle from hBACEI transgenic mice from line 1 displayed progressively severe atrophy. At 12 months of age, muscle sections showed a pattern of atrophy consistent with denervation including small and large group atrophy, central nuclei, fatty infiltration and mild interstitial fibrosis (Figure 7G). Atrophic fibers were of both muscle fiber types without type grouping (Figure 7H). Compared to nontransgenic controls (Figure 8A,B) and consistent with the denervation muscle atrophy, Wallerian-like (axonal) degeneration characterized by phagocytosis of myelin debris by Schwann cells, myelin ovoids, regenerating clusters, and degeneration of myelin sheaths was present within the sciatic nerve specimens in hBACEI transgenic mice from line 1 (Figure 8C-H). Compared to the higher expresser line (line 1), mice from lower expresser lines (2 and 39) only displayed mild muscle and nerve fiber atrophy at 12 months of age (not shown).

EXAMPLE 9 Behavioral analysis

A total of 48 mice (n=24/6 month old; n=24/12 month old) were analyzed, of them 12 (n=6/ 6 month old; n=6/ 12 month old) were nontransgenic; 12 (n=6/ 6 month old; n=6/ 12 month old) were from line 1; 12 (n=6/ 6 month old; n=6/ 12 month old) were from line 2 and 12 (n=6/ 6 month old; n=6/ 12 month old) from line 39.

Locomotor activity was evaluated with the Morris water maze, the rotor- rod and the open field. Mice had free access to food and water and all experiments were carried out during the light cycle.

The water maze test was carried out as described (23). Briefly, a pool (diameter 180 cm) was filled with opaque water (24°C) and six-month-old mice from the low expresser line 39 (n=8 transgenic and n=8 non-transgenic mice) were first trained to locate a visible platform (days 1-3) and then a submerged hidden platform (days 4-7) in three daily trials 2-3 min apart. Mice that failed to find the hidden platform within 90 s were put on it for 30 s. The same platform location was used for all sessions and all mice. The starting point at which each mouse was placed into the water was changed randomly between two alternative entry points located at a similar distance from the platform. On day 8, another visible platform trial was performed to exclude differences in motivation and fatigue. Time to reach the platform (latency), path length, and swim speed were recorded with a Noldus Instruments Etho Vision video tracking system (San Diego Instruments, San Diego, CA) set to analyze two samples per second. (Figure 3A)

For the rotor-rod (San Diego Instruments, San Diego, CA), mice were analyzed for 2 days, as previously described (35). On the first day mice were trained for 5 trials: the first one at lOrpm, the second at 20rpm and third to fifth at 40rpm. On the second day, mice were tested for 7 trials at 40 rpm each. Mice were placed individually on the cylinder and the speed of rotation increased from 0 to 40 rpm over a period of 240 sec. The length of time mice remained on the rod (fall latency) was recorded and used as a measure of motor function. (Figure 3B) For the open field, mice were tested in a clear plastic open field (36 x 20 x

16 cm) for 32 min subdivided into eight, 4 min intervals to determine total activity and % time spent in the periphery (thigmotaxis). Locomotor activity was detected by the interruption of equally spaced infrared light beams 2cm above floor level (4 in the x axis and 8 in the y axis). (Figure 3C) At 3 months of age, mice from line 1 showed mild alterations moving around the cage with weakness of the hind limbs, and when lifted from the tail they crossed their hind limbs rather than extending them as in the nontransgenic controls (not shown). This phenotype became more apparent at 6 month of age and by 12 month of age mice displayed considerable difficulty walking and hind limb muscle atrophy (not shown). Mice from lines 2 and 39 showed only mild motor alterations when inspected. Consistent with the clinical observations, the rotor-rod test showed that hBACEI transgenic mice (line 1) displayed the most significant impairment compared to nontransgenic controls (Figure 3B). Mice from lines 2 and 39 were also significantly impaired but to a lesser extent (Figure 3C). Analysis in the open field showed that hBACEI transgenic mice (line 1) had a significant reduction in rearing and total activity (Figure 3C). Mice from lines 2 and 39 showed mild alterations in the open field but deficits were not statistically significant when compared to nontransgenic controls (Figure 3C). Total activity and thigmotaxis were slightly decreased in hBACEI transgenic mice however the differences were not significant compared to nontransgenic controls. EXAMPLE 10

Transgenic mice treatment with BACE inhibitors

A total of 12 BACEl transgenic mice (line 1) and 12 nontransgenic littermates (3 month old) were included for this study. From each group half of the mice received daily injections for 14 consecutive days with the BACE inhibitor- N-Benzyloxycarbonyl-val-leu-leucinal (Calbiochem, Darmstadt, Germany) (1.25 mg/kg) diluted in DMSO and the other half received vehicle alone. At the end of the treatment, mice were tested in the rotor-rod and open field and then were sacrificed for analysis of APP expression by Western blot and BACE activity. Treatment with this BACE inhibitor reduced the transgenic mice deficits in the open field and rotor-rod (Figure 9A, B). While compared to nontransgenic controls, vehicle treated hBACEI transgenic mice continued to display locomotor deficits, treatment with the BACE inhibitor resulted in improved performance in the open field and rotor-rod (Figure 9 A, B). Consistent with these findings, western blot analysis showed that BACE inhibitor treatment, increased levels of full length APP and decreased levels of c-terminal APP products in the hBACEI transgenic mice (Figure 9C, D). Taken together, these findings suggest that treatment with BACE inhibitors ameliorated the motor deficits by decreasing the generation of neurotoxic APP c-terminal products.

EXAMPLE 11

Statistical analysis

Analysis was carried out with the StatView 5.0 program (SAS Institute

Inc., Cary, NC). Differences among means were assessed by one-way ANOVA followed by post-hoc Dunnet's or Tukey-Kramer as indicated. Correlation studies were carried out by simple regression analysis. The null hypothesis was rejected at the 0.05 level. REFERENCES

1. Masliah, E. (2000) Ann NY Acad Sci 924, 68-75

2. Terry, R., et al. (1981) Ann. Neurol. 10, 184-192

3. Beach, T., et al. (1989) Glia 2, 420-436 4. Masliah, E., et al. (1991) Ada Neuropathol. 83, 12-20

5. Rogers, J., et al. (1988) Neurobiol .Aging 9, 339-349

6. Hof, P., et al. (1994) in Alzheimer disease (Terry, R., Katzman, R., and Bick, K., eds), pp. 197-230, Raven Press, New York

7. Terry, R., et al. (1994) in Alzheimer disease (Terry, R., and Katzman, R, eds), pp. 179-196, Raven Press, New York

8. Clark, R., et al. (1993) Arch.Neurol 50, 1164-1172

9. Goate, A., et al. (1991) Nature 349, 704

10. Johnson-Wood, K., et al. (1997) Proc.Natl.Acad.Sci. USA 94, 1550-1555

11. Games, D., et al. (1995) Nature 373, 523-527 12. Sisodia, S., et al. (1990) Science 248, 492-494

13. Selkoe, D. J. (1999) Nature 399 (6738 Suppl), A23-31

14. Sinha, S., et al. (1999) Nature 402, 537-540

15. Vassar, R., et al. (1999) Science 286, 735-741

16. Cal, H, et al. (2001) Nat Neurosci 4, 233-234 17. Luo, Y, et al. (2001) Nat Neurosci 4, 231 -232

18. Esler, W. P., et al. (2001) Science 293, 1449-1454

19. Sinha, S., et al. (2000) Ann NY Acad Sci 920, 206-208

20. Moore, C. L., et al. (2000) Ann NY Acad Sci 920, 197-205

21. Wolfe, M. S., et al. (1999) Nature 398, 513-517 22. Kitazume, S., et al. (2001) Proc Natl Acad Sci USA 9S, 13554-13559

23. Holsinger, R. M., et al. (2002) Ann Neurol 51, 783-786

24. Huse, J. T., et al. (2002) JBiol Chem

25. Rossner, S., et al. (2001) J Neurosci Res 64, 437-446

26. Fukumoto, H, et al. (2002) Arch Neurol 59, 1381-1389 27. Rockenstein, E., et al. (2001) J Neurosci Res 66, 573-582

28. Rockenstein, E., et al. (2002) J Neurosci Res 68, 568-578

29. Rockenstein, E., et al. (1995) J.Biol Chem. 270, 28257-28267 30. Mucke, L, et al. (1994) Brain Res. 666, 151-167

31. Roberds, S. L., et al. (2001) Hum Mol Genet 10, 1317-1324

32. Mucke, L., et al. (2000) Am JPathol 157, 2003-2010

33. Mucke, L., et al. (2000) J.Neurosci. 20, 4050-4058 34. Masliah, E., et al. (1998) J.Neuropathol.Exp. Neurol 57, 1041-1052

35. Masliah, E., et al. (2001) Proc Natl Acad Sci USA 98, 12245-12250

36. Bodendorf, U., et al. (2002) JNeurochem 80, 799-806

37. Huse, J. T., et al. (2000) JBiol Chem 275, 33729-33737

38. Kim, H. S., et al. (2000) Faseb J 14, 1508-1517 39. Song, D. K., et al. (1998) JNeurochem 71, 875-878

40. Oster-Granite, M., et al. (1996) J.Neurosci. 16, 6732-6741

41. Abbenante, G., et al. (2000) Biochem Biophys Res Commun 268, 133-135

42. Tung, J. S., et al. (2002) JMed Chem 45, 259-262

43. Evin, G., et al. (2002) Peptides 23, 1285-1297 44. Masliah, E., et al. (1997) J Biol. Chem.

45. Masliah, E. (1997) Lab.lnvest. 11, 197-209

46. Furukawa, K., et al. (1996) JNeurochem. 67, 1882-1892

47. Moechars, D., et al. (1996) EMBOJ. 15, 1265-1274

48. Masliah, E., et al. (2000) Exp.Neurol 163, 381-387 49. Kawai, H, et al. (2001) JBiol Chem 276, 6885-6888

50. Sheikh, K. A., et al. (1999) Proc Natl Acad Sci USA 96, 7532-7537

51. Eckhardt, M., et al. (2000) J Neurosci 20, 5234-5244

52. Mucke, L., et al. (1991) New Biologist 3, 465-474

All patents, publications and abstracts cited above are incorporated herein by reference in their entirety. It should be understood that the foregoing relates only to preferred embodiments of the present invention and that numerous modifications or alterations may be made therein without departing from the spirit and the scope of the present invention as defined in the following claims.

Claims

What is claimed is:

1. A transgenic non-human animal for overexpressing BACEl comprising cells containing a DNA transgene encoding for BACEl.

2. The transgenic non-human animal of claim 1, wherein the animal is heterozygous for the transgene.

3. The transgenic non-human animal of claim 1, wherein the animal is homozygous for the transgene.

4. A method for screening for biologically active agents that inhibit BACEl production in vivo, comprising: administering a test agent to the transgenic non-human animal of claim 1, and determining the effect of the agent on the amount of BACEl produced.

5. The method of Claim 4, wherein the transgenic non-human animal is heterozygous for the transgene.

6. The method of Claim 4, wherein the transgenic non-human animal is homozygous for the transgene.

7. The transgenic non-human animal according to any of claims 1 to 3, wherein the transgene is operably linked to a tissue-specific promoter.

8. A cell or cell line derived from the transgenic non-human animal according to any of claims 1 to 3.

9. A transgenic mouse comprising a transgenic nucleotide sequence encoding human BACEl operably linked to a promoter, integrated into the genome of the mouse, wherein the mouse demonstrates a neurological phenotype that can be reversed or ameliorated with an hBACEI inhibitor.

10. The mouse of Claim 9, wherein the mouse overexpresses hBACE 1.

11. The mouse of Claim 9, wherein the mouse is heterozygous for hBACEI.

12. The mouse of Claim 9, wherein the mouse is homozygous for hBACEI.

13. A method for screening for therapeutic agents that inhibit BACE activity comprising

(a) administering test agents to the transgenic mouse of Claim 9,

(b) evaluating the effects of the test agent on the neurological phenotype of the mouse.

14. A method of the treatment of neurodegenerative disease comprising (a) administering the composition of Claim 13; and (b) monitoring the patient for a decreased clinical index for neurodegenerative diseases.