WO2008072547A1

WO2008072547A1 - Promoter and expression vector for actinomycetes

Info

Publication number: WO2008072547A1
Application number: PCT/JP2007/073586
Authority: WO
Inventors: Eitora Yamamura; Noboru Fujimoto; Keiji Sakamoto
Original assignee: Daiichi Fine Chemical Co., Ltd.
Priority date: 2006-12-12
Filing date: 2007-12-06
Publication date: 2008-06-19
Also published as: JPWO2008072547A1; JP5155880B2

Abstract

It is intended to provide a promoter capable of highly expressing a target protein by promoting gene expression in actinomycetes, an expression vector containing the promoter, and a transformant transfected with the vector. It is also intended to provide a method for producing a target protein capable of producing a large amount of a target protein using the promoter, vector or transformant. A promoter for actinomycetes containing any of nucleotide sequences represented by SEQ ID NOS: 1 to 4, an expression vector for actinomycetes containing the promoter, actinomycetes transfected with the expression vector, and a method for producing a target protein using the transformant are provided.

Description

Specification

Actinomycetes promoter and expression vector

Technical field

[0001] The present invention relates to a promoter for actinomycetes, an expression vector for actinomycetes having the promoter, and actinomycetes transformed with the expression vector. The present invention also relates to a method for producing a target protein in actinomycetes using these promoters, vectors or transformants.

Background art

[0002] Actinomycetes of the genus Rhodococcus are known to produce enzymes involved in the metabolism of nitriles and enzymes that asymmetrically reduce aminoketones (aminoketone asymmetric reductases). In particular, Rhodococcus erythropolis is known to have an extremely high aminoketone asymmetric reduction activity. Such actinomycetes and enzymes act on α-amino ketones to produce optically active / 3-amino alcohols with high yield and high selectivity (for example, Patent Documents 1 and 2). Therefore, the development of recombinant DNA technology aimed at mass production of useful enzymes in actinomycetes, especially the development of host vector systems, has long been expected.

[0003] However, Escherichia coli, yeast, Bacillus subtilis, etc. are generally used as host microorganisms in the production of recombinants and transformants using recombinant DNA technology, and many expression vectors have been developed for this purpose. Development of expression vectors and promoters that use force S and actinomycetes as hosts is delayed.

[0004] The present inventors have already developed a novel shuttle vector aimed at high expression of a protein using Rhodococcus actinomycetes as a host (Patent Document 3). These shuttle vectors were derived from Rhodococcus actinomycetes and Escherichia coli, and were confirmed to function in both Rhodococcus actinomycetes and Escherichia coli. However, development of vectors and promoters for high expression of the target protein in actinomycetes including Rhodococcus is still expected.

[0005] On the other hand, Non-Patent Document 1 discloses a promoter derived from the lactic acid bacterium Lactobacillus plantarum. It is disclosed that these promoters function in lactic acid bacteria and E. coli. However, the use and function of these promoters in actinomycetes are not known.

Patent Document 1: International Publication WO01 / 73100 Pamphlet

Patent Document 2: International Publication WO02 / 070714 Pamphlet

Patent Document 3: International Publication WO05 / 042739 Pamphlet

Non-Patent Document 1: M. Kakikawa et al., Gene, 215, 371-379 (1998) Disclosure of the Invention

Problems to be solved by the invention

[0006] The present invention provides a promoter capable of highly expressing a target protein by promoting gene expression in actinomycetes, an expression vector having the promoter, and a transformant having the vector introduced therein. The purpose is to provide. Another object of the present invention is to provide a method for producing a target protein capable of mass-producing the target protein using the promoter, vector or transformant.

Means for solving the problem

[0007] As a result of intensive screening of promoters that function in actinomycetes by the present inventors in order to solve the above-mentioned problems, promoters pR and pL derived from the lactic acid bacterium Lactobacillus plant arum disclosed in Non-Patent Document 1 It has been found that it functions in actinomycetes and has as high an activity as a promoter derived from actinomycetes, and the present invention has been completed.

That is, according to the present invention, there is provided a promoter for actinomycetes having the base sequence described in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4. The base sequences described in SEQ ID NOs: 1 and 2 are complementary to each other and contain promoters pR and pL regions derived from lactic acid bacteria Lactobacillus plantarum, respectively. The base sequence described in base sequence 3 is a pR promoter region derived from the lactobacillus Lactobacillus plantarum, and the base sequence described in base sequence 4 is a pL promoter region derived from the lactic acid bacterium Lactobacillus plantarum. A base sequence containing these base sequences can function as a promoter in actinomycetes. According to the promoter of the present invention, the ability S to express a target gene or a target protein at high levels in actinomycetes can be obtained. [0009] The promoter for actinomycetes is preferably used as a promoter for Rhodococcus actinomycetes, Mycobacterium sp.

[0010] Further, according to the present invention, there is provided an expression vector for actinomycetes having the above! / Or any promoter. According to the expression vector of the present invention, the expression vector and the target protein can be expressed at high levels in actinomycetes.

[0011] Further, according to the present invention, actinomycetes transformed with the above expression vector are provided. According to the transformed actinomycetes (transformant) of the present invention, the target gene and the target protein can be highly expressed in the transformant.

[0012] Further, according to the present invention, there is provided a method for producing a target protein using the transformant. According to the method for producing a target protein of the present invention, the target protein can be efficiently mass-produced in the transformant.

[0013] Further, according to the present invention, a gene encoding the target protein is inserted into the expression vector having the above! /, One of the promoters so that the gene can be expressed downstream of the promoter.

A step of obtaining an expression vector capable of expressing the target protein, a step of transforming actinomycetes with the obtained expression vector, obtaining a transformant, and a step of culturing the obtained transformant in a growth medium And a step of purifying the target protein from the transformant obtained in the culturing step. According to the method for producing a target protein of the present invention, the target protein can be efficiently mass-produced in actinomycetes.

The invention's effect

[0014] According to the promoter, expression vector or transformant of the present invention, high expression of a target gene or target protein can be realized in actinomycetes, and various useful proteins can be efficiently mass-produced depending on the purpose. can do. Such proteins also contribute to various industrial production. For example, in an enzyme, oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase and the like can be efficiently produced in large quantities. When the target protein is an aminoketone asymmetric reductase, it enables high-yield and highly selective production of optically active / 3-amino alcohol. Also, the method for producing the target protein of the present invention According to the method, the target protein can be efficiently mass-produced in actinomycetes. BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described according to preferred embodiments.

In the present specification, “for actinomycetes” means to function in actinomycetes. That is, in the case of a promoter for actinomycetes, when the promoter is introduced into actinomycetes in some form (for example, in a form incorporated into a vector), it is expressed in actinomycetes! This means that the protein encoded by the gene can be produced. In the case of an actinomycetes expression vector, when the vector is introduced into actinomycetes, it can be replicated in the actinomycetes or inserted into the actinomycetes genome, and the actinomycetes contained in the expression vector This means that the promoter can also function.

[0017] Here, gene expression refers to both transcription into mRNA and translation of the protein from the mRNA force. Here, protein expression refers to the synthesis of a protein as a result of transcription of a gene and translation.

[0018] The first promoter of the present invention is characterized by having the base sequence set forth in SEQ ID NO: 1. The base sequence described in SEQ ID NO: 1 is a sequence contained in a phage isolated from the lactic acid bacterium Lactobacillus plantarum, and includes a pR promoter region that is a lactic acid bacterium promoter, a transcription initiation site, and a base sequence corresponding to the GATAC box, respectively. It is. It was first demonstrated by the present inventors that a nucleic acid comprising this base sequence functions as a promoter even in actinomycetes.

[0019] The first promoter of the present invention is a translation initiation site, translation termination site, transcription initiation site, ribosome binding site, transcription regulatory gene region, upstream or / and downstream of the nucleotide sequence set forth in SEQ ID NO: 1. (Repressor, enhancer, etc.), terminator, or restriction enzyme sites for gene recombination or any other base sequence that does not inhibit the promoter function. The length of the first promoter of the present invention is 173 bp or more, preferably 173 bp to 500 bp, more preferably <173 bp to 300 bp.

[0020] The first promoter of the present invention may be a synthetic oligonucleotide, and also uses two partially complementary synthetic oligonucleotides such as those shown in SEQ ID NOs: 13 and 14, for example. It can be amplified by PCR (Polymerase Chain Reaction), or can be amplified by PCR using an appropriate template and primers. Examples of such a cage include lactic acid bacteria Lactobacillus plantarum template phage φgle and a plasmid, vector or genome having the base sequence described in SEQ ID NO: 1. Such a primer is not particularly limited as long as it is a primer capable of amplifying the first promoter, but can be designed by those skilled in the art as needed.

[0021] The second promoter of the present invention is characterized by having the base sequence set forth in SEQ ID NO: 2. The base sequence described in SEQ ID NO: 2 is a sequence contained in a phage isolated from the lactic acid bacterium Lactobacillus plantarum, and includes a pL promoter region that is a lactic acid bacterium promoter and a base sequence corresponding to the GATAC box. . The present inventors have proved for the first time that a nucleic acid comprising this nucleotide sequence functions as a promoter in actinomycetes.

[0022] The second promoter of the present invention is a translation initiation site, translation termination site, transcription initiation site, ribosome binding site, transcription regulatory gene region, upstream or / and downstream of the base sequence set forth in SEQ ID NO: 2. (Repressor, enhancer, etc.), terminator, or restriction enzyme sites for gene recombination or any other base sequence that does not inhibit the promoter function. The length of the second promoter of the present invention is 172 bp or more, preferably 172 bp to 500 bp, more preferably <172 bp to 300 bp.

[0023] The second promoter of the present invention may be a synthetic oligonucleotide, or by PCR using two partially complementary synthetic oligonucleotides such as those shown in SEQ ID NOs: 13 and 14, for example. It can also be amplified, or can be amplified by PCR using appropriate cages and primers. Examples of such cages include lactic acid bacteria Lactobacill us plantarum template phage φgle and a plasmid, vector or genome having the base sequence set forth in SEQ ID NO: 2. Such a primer is not particularly limited as long as it is a primer capable of amplifying the second promoter, but can be designed as needed by those skilled in the art.

[0024] A third promoter of the present invention is characterized by having the base sequence set forth in SEQ ID NO: 3. To do. The base sequence described in SEQ ID NO: 3 is a base sequence corresponding to the pR promoter region contained in a phage isolated from the lactic acid bacterium Lactobacillus plantarum.

[0025] The third promoter of the present invention includes a translation initiation site, a translation termination site, a transcription initiation site, a ribosome binding site, a transcription regulatory gene region, upstream or / and downstream of the base sequence shown in SEQ ID NO: 3. (Repressor, enhancer, etc.), terminator, or restriction enzyme sites for gene recombination or any other base sequence that does not inhibit the promoter function. Furthermore, the third promoter of the present invention may have one or more bases deleted, substituted or added in the base sequence other than the pR region of the first promoter of the present invention. The length of the third promoter of the present invention is 32 bp or more, preferably 32 bp to 500 bp, more preferably <32 bp to 300 bp.

[0026] The third promoter of the present invention may be a synthetic oligonucleotide, or may be amplified by PCR using an appropriate cage and primer as necessary. Furthermore, the third promoter of the present invention can be obtained by substitution, deletion or addition of one or more bases in the base sequence other than the pR region of the first promoter of the present invention.

[0027] The fourth promoter of the present invention is characterized by having the base sequence set forth in SEQ ID NO: 4. The base sequence described in SEQ ID NO: 4 is a base sequence corresponding to the pL promoter region contained in a phage isolated from the lactic acid bacterium Lactobacillus plantarum.

[0028] The fourth promoter of the present invention is a translation initiation site, translation termination site, transcription initiation site, ribosome binding site, transcription regulatory gene region, upstream or / and downstream of the base sequence shown in SEQ ID NO: 4. (Repressor, enhancer, etc.), terminator, or restriction enzyme sites for gene recombination or any other base sequence that does not inhibit the promoter function. Furthermore, the fourth promoter of the present invention may have one or more bases deleted, substituted or added in the base sequence other than the pL region of the second promoter of the present invention. The length of the fourth promoter of the present invention is 27 bp or more, preferably 27 bp to 500 bp, more preferably <27 bp to 300 bp.

[0029] The fourth promoter of the present invention may be a synthetic oligonucleotide or may be amplified by PCR using an appropriate cage and primer as necessary. Furthermore, the fourth promoter of the present invention has a nucleotide sequence other than the pL region of the second promoter of the present invention. It can be obtained by substitution, deletion or addition of one or more bases.

[0030] The expression vector of the present invention is characterized by having the first, second, third or fourth promoter of the present invention and can function in a host cell when introduced into an actinomycete host. wear. Here, functioning means that it is possible to express a foreign gene inserted downstream of the promoter. In addition, introduction into an actinomycete host means insertion into the genome gene of the host cell, or presence as a plasmid capable of self-proliferation outside the host cell chromosome. It leads to sustained or transient expression of the gene.

[0031] When the expression vector of the present invention is inserted into a host cell genomic gene, the entire expression vector may be inserted into the host cell genomic gene. For example, at least the promoter of the present invention A region and a gene region encoding a target protein downstream thereof may be inserted, and a marker region such as a reporter gene may be inserted as necessary. The insertion may be a random recombination or a homologous recombination targeting a specific position on the genome. In the case of homologous recombination, a sequence having homology with the DNA sequence in the expression vector before, after, or both of the target region to be inserted into the host genome, and before, after, or both of the target specific positions. Preferably to introduce! / ,.

[0032] On the other hand, when the expression vector of the present invention is introduced into a host cell and exists as a plasmid that can self-replicate outside the host cell chromosome, the expression vector of the present invention is a self-replicating vector having self-replicating ability. Is preferred. In this case, the number of expression increases by self-replication, and the expression level of the foreign gene in the host can be increased. In order for the expression vector of the present invention to self-replicate in actinomycetes, at least one DNA replication region and a region encoding a protein involved in DNA replication (hereinafter referred to as a DNA replication-related protein coding region) are at least one. It is preferable to provide one.

[0033] The DNA replication region and the coding region of the DNA replication-related protein may be those that are generally known and have different forces depending on the plasmid or microorganism. For example, in the case of pRETl lOO derived from Rho dococcus erythropolis IAM1400, the base sequence described in SEQ ID NOs: 19 to 21 has been identified as the DNA replication region, and the coding region of the DNA replication related protein has been identified as SEQ ID NO: 22-24) base sequence (orfl), arrangement Base sequence described in column number 25 (orf2), base sequence described in sequence numbers 26-37 (orf3), base sequence described in sequence numbers 38-42 (orf4), base sequence described in sequence numbers 43-47 (Orf5), base sequence (orf 6) described in SEQ ID NO: 48 or 49, base sequence (orf 7) described in base sequence 50 or 51, base sequence (orf8) described in SEQ ID NO: 52 or 53, SEQ ID NO: The nucleotide sequence (orf 9) described in 54 or 55 has been identified.

[0034] In addition, in the case of pRETlOOO derived from Rhodococcus rhodnii JCM3203, the DNA replication region has been identified by the nucleotide sequence set forth in SEQ ID NOs: 56-58, and the coding region of DNA replication-related protein is SEQ ID NO: 59. The base sequence described in -62 (orf 10), the base sequence described in SEQ ID NO: 63 or 64 (orf 11), the base sequence described in SEQ ID NO: 65 (orf 12), the base described in SEQ ID NO: 66 or 67 Sequence (orf 13), base sequence (orf 14) described in SEQ ID NOs: 68 to 70, base sequence (orf 15) described in SEQ ID NO: 71 or 72, base sequence (orf 16 described in SEQ ID NO: 73 or 74) ), The base sequence described in SEQ ID NO: 75 (orf 17), the base sequence described in SEQ ID NOS: 76 to 80 (orf 18), the base sequence described in SEQ ID NO: 81 (orf 19), and the sequence described in SEQ ID NO: 82 The base sequence (orf20) and the base sequences (orf21) described in SEQ ID NOs: 83 to 89 have been identified.

[0035] Therefore, when the vector of the present invention is a self-replicating vector, for example, at least one DNA replication region derived from pRETl 100 or pRETl 000 and a coding region of a DNA replication-related protein derived from pRETl 100 or pRETlOOO ( orf) is preferred.

[0036] The expression vector of the present invention is a gene encoding a multicloning site necessary for gene recombination, a drug resistance marker gene or reporter gene for selecting a transformant, and other proteins, if necessary. It may contain a region (open reading frame; orf), a translation initiation site, a translation termination site, a transcription initiation site, a ribosome binding site, a transcription regulatory gene region (such as rebresser and enhancer), and a terminator. These are all known in the art. For example, the drug resistance marker gene includes a neomycin resistance gene, a kanamycin resistance gene, and a neugromycin resistance gene. Reporter genes include the lacZ gene. [0037] The expression vector of the present invention can be constructed using a conventional DNA recombination technique based on a known plasmid or vector. For example, a promoter derived from Rhodococcus spp. Such as pRET1000, pRETHOO, pRET1200, pRET1300, pRET1400, pRET1500, pRET1600, pRET1700, pRET1800, and pRET0500 is inserted into any one of the first to fourth promoters of the present invention. It is obtained by doing. These plasmids can be separated from Rhodococcus erythropolis (IAM 1400, IAM1503, JCM2893, JCM2894 and JCM2895) and Rhodococcus rhodnii (JCM3203) forces. R. erythropolis IAM1400 and IAM1503 are described in “IAM Catalog of Strains, Third Edition, 2004” published by the Institute for Molecular Cell Biology, University of Tokyo, and can be obtained from the laboratory. R. erythropolis JCM2893, JCM2894 and JCM2895, and R. rhodnii JCM3203 are described in the “JCM Catalog of Strains, Eighth Edition 2002” published by RIKEN It can be obtained.

[0038] Furthermore, since the expression vector of the present invention can be obtained in large quantities, it can be replicated in E. coli. For example, a part of the vector for E. coli (preferably the DNA replication region for E. coli and the DNA replication-related protein code) Including the region). For example, a shuttle vector of a plasmid derived from actinomycetes and a plasmid or vector for E. coli is preferably used. In this case, sequences that are not related to self-replication and sequences of other unnecessary genes can be cleaved and removed by restriction enzyme treatment. Furthermore, the expression vector of the present invention can be inserted into a host chromosome to produce the target protein.

[0039] The expression vector of the present invention is preferably about 2 kbp or more, more preferably 2 kbp to 20 kbp, particularly preferably 3 kbp to;! Okbp.

[0040] The transformed actinomycetes (transformants) of the present invention are characterized by being transformed with the expression vector of the present invention. In the present specification, “actinomycetes” refers to all microorganisms belonging to actinomycetes, and representative actinomycetes include Rhodococcus, Mycobacterium, Goldia, Dieza or Amicolatopsis. Examples include microorganisms.

[0041] Representative Rhodococcus actinomycetes include Rhodococcus baikon urensis, Rhodococcus coprophilus, Rhodococcus corvnebactenoides, R hodococcus equi, Rhodococcus erythropolis, Rhodococcus fascians, R hodococcus globerulus, Rhodococcus gordoniae, Rhodococcus imteche nsis, Rhodococcus jostii, Rhodococcus koreensis, Rhodococcus kroppe nstedtii, Rhodococcus maanshanensis ^ Rhocenocs Examples include Rhodococcus rhodochrous, Rhodococcus ruber, Rhodococcus triatomae, Rhodococcus tukisamuensis, Rhodococcu s wratislaviensis, Rhodococcus yunnanensis ^ Rhodococcus zopfii.

Representative Mycobacterium actinomycetes include Mycobacteri um acapulcensis, Mycobacterium agreste, Mycobacterium agn, Mycob acterium aichiense, Mycobacterium alvei, Mycobacterium aiaticum, Mycobacterium aurum, Mycobacterium austroafricanum, Mycobacterium brumae, My cobacterium celatum, Mycobacterium chelonae, Mycobacterium chim aera, Mycobacterium chitae, Mycobacterium chlorophenolicum ^ Mycob acterium chubuense, Mycobacterium confluentis, Mycobacterium con spicuum, Mycobacterium convolutum ^ Mycobacterium cookri, Mycoba cterium cosmeticum, Mycobacterium coernhoferi, Mycobacterium elephantis, Mycobacteriu m iailax _s Mycobacterium flavescens, Mycobacterium florentinum, My cobacterium xenopi, Mycobacterium f luoranthenivorans _s Mycobacteriu m fortuitum subsp.acetamidolyticum, Mycobacterium fortuitum s u bsp. fortuitum ^ Mycobacterium gadium, Mycobacterium piscium, My cobacterium gallinarum, Mycobacterium gastri, Mycobacterium gilvum, Mycobacterium goodii, Mycobacterium gordonae, Mycobacterium hassiacum, Mycobacterium hiberniae, Mycobacterium hodleri, Mycoba cterium holsgenum ^ Mycobacterium ntermedium Mycobacterium intracellulare Mycobacterium kansasii Mycobacterium kubicae Mycobacterium kumamotonense Mycobacter ium lentiflavum Mycobacterium madagascariense Mycobacterium ma geritense Mycobacterium malmoense Mycobacterium marinum Myco bacterium moriokaense Mycobacterium mucogenicum Mycobacteriu m murale Mycobacterium neoaurum Mycobacterium nonchromogeni cum Mycobacterium novum s Mycobacterium obuense Mycobacterium parafortuitum Mycobacterium parascromlaceum Mycobacterium tri viale Mycobacterium parmense Mycobacterium peregrimim Mycobac terium phlei Mycobacterium porci m Mycobacterium poriferae My cobacterium psychrotolerans Mycobacterium pulveris Mycobacterium rhodeche Mycobacterium rhodochrous Mycobacterium runyonn ^ My cobacterium saskatchewanense Mycobacterium scrofulaceum Mycobai erium tokaiense Mycobacterium triplex ^ Mycobacterium tusciae Mycobacterium vaccae Mycobacterium vanbaalenii ^ Mycobacterium wolinskyi Mycobacterium abscessus Mycobacterium avium subsp. a vium Mycobacterium avium subsp. paratuberculosis Mycobacteriu m bovis Mycobacterium chelonae microco

Representative Gordonia actinomycetes include Gordonia aichiensis, Gor doma alkanivorans ^ Gordonia amarae ^ Gordonia amicalis ^ gordonia ar aii Gordonia bronchialis Gordonia desulfuricans Gordonia effusa Goordonia ordusa nitsonia ns, Gordonia polyisoprenivorans ^ Gordonia rhizosphera, Gordonia rubri pertincta, ordonia rubropertinctus ^ Gordonia shandongensis _s Gordonia sihwensis, Gordonia sinesedis, Gordonia soli, Gordonia sputi, Gordon ia terrap

[0044] Representative Dietzia actinomycetes include Dietzia cinnamea, Dietzia kunjamensis, Dietzia maris _s uietzia natronolimnaea ^ Dietzia natronoli mnaios, Dietzia psychralcaliphila and the like.

[0045] Typical Amycolatopsis (Amycolatopsis) actinomycetes include Amycolatopsis alba, Amycolatopsis a! Bidoflavus, Amycolatopsis azurea, Amycolatopsis benzoatilytica, Amycolatopsis coloradensis, Amycolatopsis echigonen sis, Amycolatopmy e , Amycolatopsis japonica, Amycolatopsis jejuensis ^ Amy colatopsis kentuckyensis s Amycolatopsis keratiniphila subsp. keratini phila, Amycolatopsis keratiniphila subsp. nogabecina, Amycolatopsis丄exingtonensis, Amycolatopsis iurida, Amycolatopsis mediterraneiゝAm ycolatopsis methanolica, Amycolatopsis minnesotensis ^ Amycolatopsis nigrescens, Amycolatopsis migatensis, Amycolatopsis orientalis, Amy colatopsis orientalis subsp.lurida, Amycolatopsis palatopharyngis, A mycolatopsis plumensis, Amycolatopsis pretoriensis, Amycolatopsis rif amycinica, Amycolatopsis rubida, Amycolatopsis rugosa, Amycolatopsi s s saccharic A Examples include mycolatopsis sulphurea, Amycolatopsis thermoflava, Amy colatopsis tolypomycina, Amycolatopsis taiwanensis, and Amycolatopsis to lypophorus.

[0046] The expression vector can be introduced by a known method, for example, a calcium phosphate method, a lipolysis method, an electo-poration method, a microinjection method, or the like.

[0047] A first method for producing a protein of the present invention uses the transformant of the present invention described above. It is characterized by that. First, a vector in which a gene encoding a target protein is inserted downstream of the promoter of the present invention is introduced into the transformant. Next, by culturing the transformant, the target protein is expressed by the function of the promoter of the present invention, and the target protein can be produced by purifying the protein.

[0048] In the second method for producing a target protein of the present invention, a gene encoding the target protein can be expressed downstream of the promoter in an expression vector having any one of the promoters of the first to fourth aspects of the present invention. To obtain an expression vector capable of expressing the target protein, transforming actinomycetes with the obtained expression vector, obtaining a transformant, and proliferating the obtained transformant. A step of culturing in a possible medium, and a step of purifying the target protein from the transformant obtained in the step of culturing.

[0049] The target protein is not particularly limited as long as it can be synthesized in actinomycetes, and examples thereof include proteins and peptides having various useful enzymes and physiological functions. Examples of enzymes include oxidoreductase, transferase, hydrolase, lyase, isomerase, and ligase. As described above, the aminoketone asymmetric reductase produced by Rhodococcus Ellis mouth police is particularly preferable because it is very useful for the production of optically active amino alcohols.

[0050] The gene encoding the target protein may be any gene that contains an open reading frame (ORF) from the start codon to the stop codon that encodes all the amino acid sequences of the target protein. It may be a cDNA consisting of only. The length of the gene is not particularly limited, but is preferably lOObp to 10 kbp, more preferably 300 bp to 4 kbp

[0051] To insert so that it can be expressed downstream of the promoter means to insert a gene encoding the target protein downstream (3 ') of the promoter and under the control of the promoter. .

[0052] In order to obtain an expression vector capable of expressing the target protein, for example, a promoter can be first inserted into the vector, and then a gene encoding the target protein can be expressed further downstream of the promoter. How to insert, or promoter and target tamper There is a method in which a DNA fragment gene having both a protein encoding gene is prepared in advance so that it can be expressed, and then inserted into a vector.

[0053] In the former case, for example, a promoter is first amplified by PCR with a primer to which a restriction enzyme site is added, the promoter and vector are treated with a restriction enzyme, ligated by a known ligation method, and then the target protein is similarly produced. The gene that codes for is inserted. At this time, the insertion position should be designed in advance so that the frame of the gene does not shift. In some cases, a treatment for smoothening the ends of the DNA after the restriction enzyme treatment may be performed.

[0054] In the latter case, for example, a gene encoding a target protein is amplified by PCR using a primer containing a nucleotide sequence corresponding to a restriction enzyme site and a promoter, and after ligation to a vector by a known ligation method after restriction enzyme treatment. Is mentioned. Also at this time, primers should be designed in advance so that the frame of the gene does not shift. In some cases, a treatment for smoothening the ends of the DNA after the restriction enzyme treatment may be performed.

[0055] The methods such as restriction enzyme treatment, PCR, ligation and the like can be performed according to the instruction manual using commercially available reagent kits. In addition, if the original vector does not have an appropriate restriction enzyme site, it is possible to insert it into another vector first, cut out the necessary part with an appropriate restriction enzyme, and then insert it into the target vector. It is. Such techniques are well known in the art. Further, since the expression vector obtained in this step is the same as the expression vector of the present invention described above, the description of the vector is omitted here.

[0056] Next, the step S for transforming actinomycetes with the obtained expression vector to obtain a transformant, the transformation method and the transformant are as described above.

[0057] Next, the obtained transformant is cultured in a medium capable of growth. The medium for culturing the transformant is not particularly limited as long as the microorganism to be used can grow, and a known method can be used. Usually, a liquid medium containing a carbon source, a nitrogen source, and other nutrients is used. . As the carbon source of the medium, any of the above microorganisms can be used. Specifically, glucose, fructose, sucrose, dextrin, Sugars such as starch and sorbitol, alcohols such as methanol, ethanol and glycerol, organic acids such as fumaric acid, citrate, acetic acid and propionic acid and salts thereof, hydrocarbons such as paraffin, and mixtures thereof Can be used. As the nitrogen source, any of the above microorganisms can be used. Specifically, ammonium salts of inorganic acids such as ammonium chloride, ammonium sulfate, and ammonium phosphate; ammonium salts of organic acids such as ammonium fumarate and ammonium quenate; nitrates such as sodium nitrate and potassium nitrate; meat Inorganic or organic nitrogen-containing compounds such as extract, yeast extract, malt extract, and peptone, or a mixture thereof can be used. In addition, nutrient sources used in normal culture such as inorganic salts, trace metal salts, and vitamins may be added to the medium as appropriate. If necessary, the medium may contain substances that promote the growth of microorganisms, buffer substances that are effective for maintaining the pH of the medium, and the like.

[0058] The transformant can be cultured under conditions suitable for growth. Specifically, the medium can be heated at pH 3 to 10, preferably 4 to 9, and temperature 0 to 50 ° C, preferably 20 to 40 ° C. Microbial culture can be performed under aerobic or anaerobic conditions. The culture time is preferably 10 to 150 hours, but should be appropriately determined according to each microorganism.

[0059] The last is a step of purifying the target protein from the transformant obtained in the culturing step. The purification method is not particularly limited as long as the target protein can be obtained. For example, there are the following methods. First, if the target protein is synthesized and remains in the microbial cell, the cell must be disrupted. For example, the culture solution of the microbial cells cultured as described above is filtered or centrifuged, and the cells are thoroughly washed with water or a buffer solution. The washed cells are suspended in an appropriate amount of buffer, and the cells are disrupted. The crushing method is not particularly limited, and examples thereof include mechanical crushing methods such as a mortar, dynomill, french press, and ultrasonic crusher. Solids are removed from the resulting microorganism disruption solution by filtration or centrifugation to obtain a cell-free extract, and the target protein is collected from the extract by a conventional method for protein isolation. In addition, when the target protein is synthesized and secreted outside the microbial cell, it is not necessary to disrupt the cell. For example, the culture solution of the microbial cells cultured as described above is filtered or centrifuged to obtain a cell-free culture solution, and the target protein is collected from this culture solution by a conventional method for protein isolation. Yes

[0060] As a protein isolation method, a known method without particular limitation can be used. For example, salting out such as ammonium sulfate precipitation method; gel filtration method using cefadex, etc .; ! /, Is an ion-exchange chromatography method using a carrier having a carboxymethyl group or the like; a hydrophobic chromatography method using a carrier having a hydrophobic group such as a butyl group, an octyl group, or a phenyl group; Purification by gel chromatography method; electrophoresis method; permeation; ultrafiltration method; affinity chromatography method; high performance liquid chromatography method.

[0061] Furthermore, the protein can also be used as an immobilized enzyme. Examples of such methods include the ability to use known methods that are not particularly limited and include immobilized proteins or protein-producing cells, including carrier binding methods such as covalent bonding methods and adsorption methods, bridge methods, and comprehensive methods. Can be fixed by law. Further, a condensing agent such as dartalaldehyde, hexamethylene diisocyanate, hexamethylene diisothiocyanate may be used as necessary. Other immobilization methods include, for example, a monomer method in which a monomer is gelled by a polymerization reaction; a prepolymer method in which a molecule larger than a normal monomer is polymerized; a polymer method in which a polymer is gelled; Immobilization using polyacrylamide; Immobilization using natural polymers such as alginic acid, collagen, gelatin, agar, and Kappa Ichigo Laguinan; Immobilization using synthetic polymers such as photo-curing resin and urethane polymer Is mentioned.

[0062] The target protein thus purified is judged to be sufficiently purified if a single band is confirmed by electrophoresis (SDS-PAGE or the like).

Example

[0063] Hereinafter, the present invention will be described more specifically by way of examples. However, these examples do not limit the technical scope of the present invention. The restriction enzymes used in all examples are products of “Toyobo Co., Ltd.” unless otherwise specified. Reagents other than restriction enzymes are “Wako Pure Chemical Industries, Ltd.” unless otherwise specified. Company "product.

[0064] (Example 1) Construction of a shuttle vector comprising a part of a plasmid derived from Rhodococcus actinomycetes and a part of pHSG299

A plasmid derived from Rhodococcus erythropolis IAM 1400 was purified. Rhodoco ecus erythropolis IAM1400 (distributed by Cell Function Information Center, Institute of Molecular Cell Biology, The University of Tokyo) was planted in 5mL of GPY (containing 1% glucose, 0.5% bactopeptone and 0.3% yeast extratate). And cultured with shaking at 25 ° C. In the logarithmic growth phase, 250 L of a 100 mg / mL ampicillin solution was added, and the mixture was further cultured with shaking at 25 ° C for 2 hours.

[0065] The culture solution is centrifuged at 12, OOOrpm for 5 minutes, the supernatant is removed, and the bacteria are suspended in 1 mL of 50 mM Tris-HCl (pH 7.5), and centrifuged at 12, OOOrpm for 5 minutes. The supernatant was removed. 250 L of 10 mg / mL lysozyme solution dissolved in TE (containing 10 mM Tris-HCl (pH 7.5) and ImM EDTA (Dojindo Laboratories)) was added and suspended, and the mixture was allowed to stand at 37 ° C for 30 minutes. After standing, 100% 3 ^ 1 NaCl and 25% 10% SDS were added and left overnight at 20 ° C.

[0066] Thereafter, the mixture was centrifuged at 12, OOOrpm for 5 minutes, and 50 g / mL proteinase was added to the supernatant.

After adding 0.5 L of K (Qiagen) and SO ^ g / mL RNase A (Qiagen), each was allowed to stand at 37 ° C for 15 minutes, and then 375 L of phenol / chloroform / isoamyl alcohol solution was added. After centrifuging at 12, OOOrpm for 5 minutes, remove the supernatant 300, add 75 O ^ L ethanol, and centrifuge at 12, OOOrpm for 5 minutes to dissolve the precipitate in 50 L of sterile water .

[0067] Plasmid DNA was purified from this solution using GFX ™ PCR DNA and Gel Band Purification Kit (GE Healthcare Bioscience). The obtained plasmid DN was a mixture of pRETl 100 (5444 bp) and pRET 1200 (5421 bp) disclosed in International Publication No. WO05 / 042739.

[0068] The plasmid DNA mixture obtained above was digested with Alw44 I at 37 ° C for 2 hours, and then blunt-ended using Blunting high (Toyobo) to obtain a DNA fragment derived from pRETl100. After digesting this DNA fragment and pHSG299 (Takara Bio) with Hinc II at 37 ° C for 2 hours, add phenol / chloroform / isoamyl alcohol solution as described above and precipitate with ethanol. The DNA fragment obtained by the above was ligated using Ligation high (Toyobo).

[0069] After that, the ligation product was produced using E. coli using Competent high (Toyobo). DH5a was transformed. The obtained transformed Escherichia coli was divided into 30 0.1 M IPTG (isopropyl 1 / 3-galactoside) and 30% 4% X-gal (5-bromo-4 chloro-3-intoluene 13 for a 90 mm diameter petri dish. LB (1% tryptone, 0.5% yeast extract and 1% sodium chloride; ρΗ7.2) coated with —D galatatopyranoside) and containing lOO g / mL kanamycin; And left at 30 ° C for 60 hours.

[0070] Among the appearing colonies, white colonies were inoculated into LB liquid medium containing 100 g / mL kanamycin, and cultured with shaking at 30 ° C for 60 hours. Vector DNA was purified from the obtained culture solution using Labo Pass (trademark) Mini (Hokkaido System Science). The obtained vector DNA was confirmed by 0.8% agarose gel electrophoresis (Nacalai Tester). This vector was named pRETl102.

[0071] In addition to the above, plasmid DNA isolated and purified from Rhodococcus erythropolis IAM1400 was digested with BspLU 1 II (Roche Diagnostics) at 48 ° C for 2 hours, and then blunted with Blunting high. At the end, a DNA fragment derived from pRET1200 was obtained. This DNA fragment and the DNA fragment obtained by digesting pHSG299 with Hinc II at 37 ° C for 2 hours were ligated using Ligation high.

[0072] The ligation product was transformed into E. coli DH5α using Competent high. The resulting transformed E. coli was plated on a LB agar medium coated with 30 L of 0.1M I PTG and 30 L of 4% X-gal on a petri dish with a diameter of 90 mm and containing 100 g / mL kanamycin. And left at 30 ° C for 60 hours.

[0073] Among the appearing colonies, white colonies were inoculated into LB liquid medium containing 100 g / mL kanamycin, and cultured with shaking at 30 ° C for 60 hours. From the obtained culture broth, vector DNA was purified using Labo Pass (trademark) Mini. The obtained vector DNA was confirmed by subjecting to 0.8% agarose gel electrophoresis. This vector was named pRET1202.

(Example 2) Reduction in size of pRET1102 and pRET1202

The PRET1102 obtained in Example 1 was digested with BamHI and HincII at 37 ° C for 2 hours and then subjected to 0.8% agarose gel electrophoresis using GFX ™ PCR DNA and Ge 1 Band Purification Kit. And a DNA fragment of about 2.7 kbp was obtained. this The size marker used was Loading Quick DNA size Marker λ / EcoR I + Hind III double digest (Toyobo).

[0075] This DNA fragment and pHSG299 were digested with BamH I and Hinc II at 37 ° C for 2 hours and then subjected to 0.8% agarose gel electrophoresis using GFX ™ PCR DNA and Gel Band Purification Kit. The purified DNA fragment of about 2 · 7 kbp was ligated using Ligation high.

[0076] The ligation product was transformed into E. coli JM109 using Competent high. The resulting transformed E. coli was plated on a LB agar medium coated with 30 L of 0.1M I PTG and 30 L of 4% X-gal on a petri dish with a diameter of 90 mm and containing 100 g / mL kanamycin. And left at 30 ° C for 60 hours.

[0077] Among the formed colonies, white colonies were inoculated into LB liquid medium containing 100 g / mL kanamycin, and cultured with shaking at 30 ° C for 60 hours. From the obtained culture broth, vector DNA was purified using Labo Pass (trademark) Mini. The obtained vector DNA was confirmed by subjecting it to 0.8% capillary gel electrophoresis.

[0078] This vector was digested with Pst I for 2 hours, blunt-ended using Blunting high, and ligated using Ligation high. The ligation product was transformed into Escherichia coli JM109 using Competent high, plated on an LB agar medium containing lOO ^ g / mL kanamycin, and allowed to stand at 30 ° C for 36 hours.

[0079] The formed colonies were inoculated into an LB liquid medium containing 100 µg / mL kanamycin and cultured at 30 ° C for 24 hours, and then the vector DNA was purified using Labo Pass ™ Mini. The obtained vector DNA was confirmed by subjecting it to 0.8% agarose gel electrophoresis. This vector was named PRET1132. This pRET1132 was digested with Pst 1 for 1 hour and then subjected to 0.8% agarose gel electrophoresis. As a result, it was confirmed that pRETl 132 was not cleaved by Pst I! /.

[0080] In addition, pRET1202 obtained in Example 1 was digested with EcoR I and Dra III (Roche Diagnostatus) for 2 hours, then blunted using Blunting high, and 0.8% agarose gel electrophoresis. And purified using GFX ™ PCR DNA and Gel Band Purification Kit to obtain a DNA fragment of about 3.7 kbp. At this time, the size marker One used Loading Quick DNA size Marker λ / EcoR I + Hind III double digest.

[0081] This DNA fragment and pHSG299 were digested with BamH I and Hinc II for 2 hours, then subjected to 0.8% agarose gel electrophoresis and purified using GFX ™ PCR DNA and Gel Band Purification Kit The DNA fragment of about 2 · 7 kbp was ligated using Ligation high.

[0082] The ligation product was introduced into E. coli JM109 using Competent high. The obtained transformed Escherichia coli was plated on a LB agar medium coated with 30 L of 0.1 M IPTG and 30 L of 4% X-gal on a petri dish with a diameter of 90 mm and containing 100 g / mL kanamycin. And left at 30 ° C for 60 hours.

[0083] Among the appearing colonies, white colonies were inoculated into LB liquid medium containing 100 g / mL kanamycin, and cultured with shaking at 30 ° C for 60 hours. From the obtained culture broth, vector DNA was purified using Labo Pass (trademark) Mini. When this vector was digested with Sac I, BamH I, Pst I or EcoR I for 2 hours to confirm the vector, it was found that the region derived from Rhodococcus sp. This vector was named pRE T1204 (about 5.9 kbp).

(Example 3) Construction of an expression vector inserted with an aminoketone asymmetric reductase gene

Rhodococcus erythropolis MAK— 34 (National Institute of Advanced Industrial Science and Technology, National Institute of Advanced Industrial Science and Technology (now National Institute of Advanced Industrial Science and Technology, Patent Biodeposition Center (IPOD)); 305—8566 Tsukuba Rokuto, Ibaraki, Japan 1-chome, 1st, center No. 6) Accession number: FERM BP-7451 (contracted on 15 February 2001) was inoculated into 5 mL of GPY medium and cultured at 30 ° C for 48 hours with shaking. Was transferred to lOOmL GPY medium and cultured at 30 ° C for 10 hours at 200 rpm. The culture solution was purified using Genomic DNA Buffer set (Qiagen) and Genomic tip 500 / g (Qiagen) to obtain genomic DNA.

[0085] Using the obtained genomic DNA as a saddle type, the base sequence corresponding to the aminoketone asymmetric reductase gene (mak gene) was amplified by PCR. As a primer, MAKF1 (serum ): 5,-GAATCTTCTCGTTGATGCAGATCAGGTC-3 '(SEQ ID NO: 5), and MAKR2 (antisense): 5, — CTGACTCCGTAGTGTTCTGCCAGTTC-3' (SEQ ID NO: 6), and KOD— plus— (Toyobo) as the polymerase As a reaction condition, annealing was performed after denaturation of the truncated DNA at 94 ° C for 2 minutes. C30 was less, ίSung chi was responsive 68 ⁰ C 1 minute 50 less, fifty 30 cyclists.

[0086] After the PCR product was treated with phenol / chloroform and ethanol precipitated, it was mixed with pUC18 (about 2 · 7kbp; Takara Bio) digested at 30 ° C for 2 hours using Sma I, and Ligation high was used. I ligated. The resulting ligation product was transformed into E. coli DH5 a using Competent high, and the resulting transformed E. coli was treated with 30 a L of 0.1 M IPTG and 30 μL of a 90 mm diameter petri dish. Plated on LB agar medium coated with 4% X-gal and containing 100 g / mL kanamycin and left at 30 ° C for 60 hours.

[0087] Among the appearing colonies, white colonies were selected and cultured with shaking in an LB liquid medium containing 100 g / mL ampicillin at 30 ° C for 60 hours. From the obtained culture broth, vector DNA was purified using Labo Pass (trademark) Mini. This vector was confirmed by subjecting it to 0.8% agarose gel electrophoresis.

[0088] Next, PCR was further performed using the expression vector obtained above as a saddle type. As primers, MAKPstF (sense): 5,-GACCACTGCAGATCAATCAACTCTG ATGAGGTCC-3 '(SEQ ID NO: 7), and MAKHisBglllR (antisense): 5, — C GCTTAGATCTCAGTTCGCCGAGCGCC-3' (SEQ ID NO: 8) as a polymerase Uses KOD-plus-, denaturation of the truncated DNA at 94 ° C for 2 minutes, followed by 30 cycles of annealing at 68 ° C for 30 seconds and extension reaction at 68 ° C for 1 minute 50 seconds It was.

[0089] The obtained DNA fragment was digested with Bgl II at 37 ° C for 2 hours, then subjected to 1.5% agarose gel electrophoresis and purified using GFX ™ PCR DNA and Gel Band Purification Kit (Approx. 0.8kbp). This DNA fragment and pQE70 (Qiagen) were digested with Sph I at 37 ° C for 2 hours, then blunted with Blunting high, and further digested with Bgl II at 37 ° C for 2 hours. Obtained by subjecting to 8% agarose gel electrophoresis and purifying using G FX ™ PCR DNA and Gel Band Purification Kit The obtained DNA fragment was ligated using Ligation high.

[0090] The obtained ligation product was transformed into Escherichia coli DH5α using Competent high. The obtained transformed E. coli was plated on LB agar medium containing lOO ^ g / mL ampicillin and allowed to stand at 30 ° C for 60 hours.

[0091] The formed colonies were cultured with shaking in LB liquid medium containing 100 µg / mL ampicillin at 30 ° C for 60 hours. The vector DNA was purified from the culture solution using Labo Pass (trademark) Mini. The resulting vector DNA was digested with Bgl II at 37 ° C for 2 hours, and confirmed by subjecting to 0.8% agarose gel electrophoresis. The total length was about 4.2 kbp, and the desired multicloning of pQE70 was performed. It was confirmed that the expression vector had the mak gene inserted into the site. At this time, as the size markers, Loading Quick DNA size Marker λ / EcoRI + HindIII double digest and pQE70 were used. This expression vector was named PMAK8417-2.

[0092] In addition, pRET1204 was of a saddle type, and a part of the sequence derived from pRET1200 was amplified by PCR. Primers include P1204rep—Ec2958 (sense): 5, 1 CGCGGAATTC GACCACCACGCACGCACACCGCA—3 ′ (SEQ ID NO: 9) and P 1200rep—Ps

Using CCATTG-3 '(SEQ ID NO: 10) and KOD-plus- as the polymerase, denaturation of the truncated DNA at 94 ° C for 2 minutes, followed by annealing at 60 ° C for 30 seconds 30 cycles at 68 ° C for 50 seconds.

[0093] After the PCR reaction, the DNA fragment was purified using GFX ™ PCR DNA and Gel Band Purification Kit, digested with restriction enzymes EcoR I and Pst I for 2 hours, and then subjected to 1.6% agarose gel electrophoresis. The DNA fragment was purified using the GFX ™ PCR DNA and Gel Band Purification Kit. The obtained DNA fragment (approx. 0.6kbp) and ρ MAK8417-2 were digested with EcoR I and Pst I at 37 ° C for 2 hours, and then subjected to 0.8% agarose gel electrophoresis. ) A DNA fragment (about 4.2 Kbp) purified using PCR DNA and Gel Band Purification Kit was ligated using Ligation high.

[0094] The ligation product was transformed into E. coli DH5 α using Competent high. It was. The obtained transformed E. coli was plated on an LB agar medium containing 100 g / mL ampicillin and left at 30 ° C. for 60 hours.

[0095] The formed colonies were cultured with shaking in LB liquid medium containing 100 µg / mL ampicillin at 30 ° C for 60 hours. The culture solution was purified with Labo Pass ™ Mini, digested with EcoR I at 37 ° C for 2 hours, and confirmed by 0.8% agarose gel electrophoresis. It was an expression vector (approximately 4 · 8kbp) in which the mak gene was inserted downstream of the promoter.

[0096] The obtained vector was made into a saddle type, and a promoter derived from pRET1200 and a portion of the mak gene downstream thereof were amplified by PCR. PQE70Fl (sense): 5 and pQE70R1135Bm (antisense): 5, —GGTTGGATCCGTCATCACCGA AACGCGCGAGGCAG-3 ′ (SEQ ID NO: 12) is used as a primer, and KOD—plus— is used as a polymerase at 94 ° C. for 2 minutes. After denaturation of the cage DNA at 30 ° C., 30 cycles were performed with annealing at 60 ° C. for 30 seconds and extension reaction at 68 ° C. for 3 minutes.

[0097] The obtained PCR product was purified using GFX ™ PCR DNA and Gel Band Purification Kit, the product was digested with EcoR I and BamH I for 2 hours, and then subjected to 0.8% agarose gel electrophoresis. The DNA fragment was purified using the GFX ™ PCR DNA and Gel Band Purification Kit. This DNA fragment (approximately 2.4 kbp) and a DNA fragment (approximately 5.3 kbp) obtained by digesting pRET 1132 with EcoR I and BamHI for 2 hours were subjected to 0.8% agarose gel electrophoresis, and GFX ™ PCR DNA The DNA fragment purified using the Gel Band Purification Kit was ligated using Ligation high.

[0098] The E. coli JM109 was transformed with the ligation product using Competent high, and the obtained transformed E. coli was plated on an LB agar medium containing 100 g / mL kanamycin and left at 30 ° C for 60 hours. did.

[0099] The obtained colonies were cultured in an LB liquid medium containing 100 µg / mL kanamycin, and then the vector DNA was purified using Labo Pass (trademark) Mini, and confirmed by 0.8% agarose gel electrophoresis. At that time, the size marker is Loading Quick DNA size Marke rλ / EcoR I + Hind III double digest was used. The obtained vector DNA was digested with EcoR I at 37 ° C for 2 hours, and confirmed by 0.8% agarose gel electrophoresis. The target pRET1200-derived promoter and the mak gene located downstream It was confirmed that the vector (about 7.7 kbp) has This vector was named pRE Ti 38.

[0100] (Example 4) Construction of an expression vector inserted with an aminoketone asymmetric reductase gene 2

Synthetic oligonucleotide PTRtF: 5,-CAATAAGTCACTCACGCTTCA

ACAATTATT

-3 '(SEQ ID NO: 13) and PTRtR: 5,

GTGTATCGG '

Using TGACGATACTTAAAGTATCG-3 '(SEQ ID NO: 14), denaturation of the truncated DNA at 94 ° C for 2 minutes using KOD-plus-, followed by annealing at 50 ° C for 30 seconds and extension reaction PCR reaction was performed in 5 cycles at 68 ° C for 10 seconds.

[0101] A portion of the PCR reaction solution was shaped into a bowl and further PCR was performed. As a primer, PTRRP SEQ ID NO: 15) and PTRREco—R: 5′-TGG AG AATTCTTAATGG ATATT ATATGTATCAGTA-3 ′ (SEQ ID NO: 16) were used, and KOD—pi us was used as a polymerase at 94 ° C., After denaturation of the truncated DNA in 2 minutes, PCR reaction was performed in 30 cycles of annealing at 50 ° C for 30 seconds and extension reaction at 68 ° C for 10 seconds.

[0102] The PCR product was subjected to 2.0% agarose gel electrophoresis, and the DNA fragment was purified using GFX ™ PCR DNA and Gel Band Purification Kit. The purified DNA fragment was digested with EcoR I and Pst I for 2 hours, then subjected to 2.0% agarose gel electrophoresis, and the approximately 0.2 kbp DNA fragment was obtained using the GFX ™ PCR DNA and Gel Band Purification Kit. Purified. At this time, lOObp DNA Ladder (Toyobo) was used as a size marker.

[0103] The obtained DNA fragment and pMAK8417-2 were treated with EcoR I and Pst I at 37 ° C for 2 hours. After digestion, it was subjected to 0.8% agarose gel electrophoresis and ligated with a DNA fragment (about 4.2 kbp) purified using GFX ™ PCR DNA and Gel Band Purification Kit using Ligation high. .

[0104] The ligation product was transformed into E. coli DH5α using Competent high. The transformed E. coli was plated on LB agar medium containing 100 g / mL ampicillin and left at 30 ° C for 60 hours.

[0105] The formed colonies were cultured with shaking in LB liquid medium containing 100 µg / mL ampicillin at 30 ° C for 60 hours. The culture solution was purified by vector DNA using Labo Pass ™ Mini (Hokkaido System Science) and confirmed by 0.8% agarose gel electrophoresis (about 4.4 kbp). Further, the purified vector DNA was digested with EcoR I and Pst I for 2 hours, and a DNA fragment of about 0.2 kbp was confirmed by 2% agarose gel electrophoresis. As a result of analyzing the gene arrangement IJ of this DNA fragment, The base sequence described in No. 1 was obtained. This expression vector was named pM AK8417-17.

[0106] Using pMAK8417—17 as a saddle, pQE70F l: 5′-GGCGTATCACGAGGCCCT TTCGTCTTCACC-3 ′ (SEQ ID NO: 15) and pQE70R1 135Bm: 5′—GGTTGGmer, using KOD—plus—, 94 ° C. After denaturation of the truncated DNA in 2 minutes, PCR was performed in 30 cycles of annealing at 60 ° C for 30 seconds and extension reaction at 68 ° C for 3 minutes.

[0107] The PCR reaction solution was purified using GFX ™ PCR DNA and Gel Band Purification Kit, the purified PCR product was digested with EcoRI and BamHI for 2 hours, and then subjected to 0.8% agarose gel electrophoresis. The DNA fragment was purified using GFX ™ PCR DNA and Ge 1 Band Purification Kit. This DNA fragment (about 2 kbp) and a DNA fragment obtained by digesting pRET 1 132 with EcoR I and BamH I for 2 hours were subjected to 0.8% agarose gel electrophoresis, and using GFX ™ PCR DNA and Gel Band Purification Kit. The purified DNA fragment (approximately 5.3 kbp) is mixed and ligated using Ligation high, then E. coli JM109 is transformed using Competent high and plated on LB agar medium containing 100 〃g / mL kanamycin. did. 1 colony obtained After culturing in an LB liquid medium containing 00 μg / mL kanamycin, the vector DNA was purified using Labo Pass (trademark) Mini, and the nucleotide sequence described in SEQ ID NO: 1 was obtained by 0.8% agarose gel electrophoresis. The vector was confirmed to have a mak gene located downstream of it. At that time, as the size markers, Loading Quick DNA size Marker λ / EcoRI + HindIII double digest and pRETl 132 were used. The vector obtained here was named pRETl137 (about 7.3 kbp).

(Example 5) Construction of an expression vector inserted with an aminoketone asymmetric reductase gene 3

Synthetic oligonucleotide PTRtF: 5,-CAATAAGTCACTCACGCTTCA

ACAATTATT

-3 '(SEQ ID NO: 13) and PTRtR: 5,

GTGTATCGG '

[0109] A portion of the PCR reaction solution is made into a bowl, PTRLEco— F (sense): 5, 1 AGACGAATTCA ATAAGTCGCTC ACGCTTC ATTTTT-3 ′ (SEQ ID NO: 17), and PTRLPst—

Using GOD-3 '(SEQ ID NO: 18) as a primer, KOD-plus was used, and PCR was performed in 30 cycles at 50 ° C for 30 seconds and elongation at 68 ° C for 10 seconds.

[0110] The PCR product was subjected to 2.0% agarose gel electrophoresis, and the DNA fragment was purified using GFX (trademark) PCR DNA and Gel Band Purification Kit. The purified PCR product was digested with EcoR I and Pst I for 2 hours, and then subjected to 2.0% agarose gel electrophoresis, and an approximately 0.2 kbp DNA fragment was obtained using GFX ™ PCR DNA and Gel Band Purification Kit. Purified. At this time, lOObp DNA Ladder was used as a size marker.

[0111] Obtained DNA fragment and pMAK8417-2 using EcoR I and Pst I at 37 ° C for 2 hours After digestion, it was subjected to 0 · 8% agarose gel electrophoresis and ligated with a DNA fragment (about 0 · 2kbp) purified using GFX ™ PCR DNA and Gel Band Purification Kit using Ligation high. .

[0112] The ligation product was transformed into E. coli DH5α using Competent high. The transformed E. coli was plated on LB agar medium containing 100 g / mL ampicillin and left at 30 ° C for 60 hours. The formed colonies were cultured with shaking in LB liquid medium containing 100 g / mL ampicillin at 30 ° C for 60 hours.

[0113] The culture solution was DNA purified using Labo Pass (trademark) Mini, and confirmed by 0.8% agarose gel electrophoresis. Further, the purified vector DNA was digested with EcoR I and Pst I at 37 ° C for 2 hours, and a DNA fragment of about 0.2 kbp was confirmed by 2% agarose gel electrophoresis, and the gene sequence of this DNA fragment was analyzed. It was confirmed to contain the base sequence described in SEQ ID NO: 2. This expression vector was named pMAK8417-18.

[0114] After digesting and purifying pMAK8417-18 with EcoR I at 37 ° C for 2 hours and then digesting with Hind III at 37 ° C for 2 hours, the DNA fragment was subjected to 1 · 0% agarose gel electrophoresis and approximately 1. Okbp DNA fragment Was purified using the GFX ™ PCR DNA and Gel Band Purification Kit. At that time, as a size marker, Loading Quick DNA size Marker λ / EcoRI + HindIII double digest was used.

[0115] The purified DNA fragment was blunt-ended at Blunting high, and this DNA fragment and pRETl 102 were digested with Hinc II at 37 ° C for 2 hours, and then purified using the GFX ™ PCR DNA and Gel Band Purification Kit The DNA fragment (about 8 · lkbp) was mixed and ligated using Ligation high.

[0116] The ligation product was transformed into E. coli JM109 using Competent high, and the resulting transformed E. coli was plated on an LB agar medium containing 100 g / mL kanamycin. The obtained colonies were cultured in an LB liquid medium containing 100 g / mL kanamycin, and then vector DNA was purified using Labo Pass (trademark) Mini. When this vector DNA was confirmed by 0.8% agarose gel electrophoresis, it was confirmed that it was an expression vector having the target nucleotide sequence of SEQ ID NO: 2 and the mak gene located downstream thereof. At that time, the size marker is Loading Quick DNA size Marker λ / EcoR I + Hind III double digest and pRETl 102 were used. This vector was named pRET1122 (approximately 9. lkbp).

[0117] (Example 6) Measurement of activity of a predetermined promoter in E. coli

The activity of the promoter was measured by measuring the activity of the aminoketone asymmetric reductase. The pRETl 137 and pRETl 138 obtained above were transformed into B. coli JM109 using Competent high, and the resulting transformed Escherichia coli was plated on an LB agar medium containing 100 Hg / mL kanamycin. After standing at 30 ° C for 24 hours, the obtained colonies were inoculated into 5 mL of LB liquid medium containing 100 11 g / mL kanamycin and cultured at 30 ° C for 24 hours. The culture solution was transferred to a lOOmL LB liquid medium containing 100 g / mL kanamycin and cultured at 30 ° C for 24 hours. The obtained culture solution was centrifuged at 12,000 rpm for 5 minutes at 4 ° C., the supernatant was removed, and the obtained bacterial cells were used for the measurement of reductase activity.

[0118] The activity was determined by measuring the amount of bacteria with OD = 5 and containing 3% ΕΑΜ (2-Ethylamino-1-phenyl-propan-1-containing 2% glucose and 0.2M sodium phosphate buffer (ρΗ6 · 0). one). The synthesis of EAM was performed by the method described in the literature of rj. Am. Chem. Soc., (1928) 50, P2287-2292. After the reaction solution was shaken at 30 ° C for 16 hours, the bacterial cell reaction solution was centrifuged at 12, OOOrpm for 5 minutes, and the supernatant was transferred to HPLC (High Performance Liquid Chromatography LC—2010C; Shimadzu Corporation). Provided. The analytical column is Inertsil Ph—3 3 · 0 X 75mm (Genore Science), and the column temperature is 40. C, the eluent was a 7% acetonitrile solution containing 0.05M sodium phosphate buffer (pH 6.0), and the detection wavelength was 22 Onm.

[0119] As a result of measuring the reductase activity, E. coli JM109 carrying pRETl137 showed an activity of 60 g / h / OD, and E. coli JM109 carrying pRET1138 could not be detected. It was found that pRET1138 contains a promoter region derived from Rhodococcus actinomycetes and does not function in E. coli.

[0120] (Example 7) Measurement of activity of a predetermined promoter in Rhodococcus ellispolis

R. erythropolis MAK-34 strain was inoculated into 5 mL of GPY medium and cultured with shaking at 30 ° C for 36 hours. The culture solution (lmL) was transferred to lOOmL LB medium and cultured at 30 ° C for 10 hours at 200 rpm. The cultured cells are collected by centrifugation (12 krpm, 5 minutes, 4 ° C). The collected cells were washed twice with ultrapure water (milliQ; Nihon Millipore). The washed cells were collected by centrifugation (12 krpm, 5 minutes, 4 ° C) and suspended in 2.4 mL of 10% glycerol solution. The suspension was dispensed in 300 L aliquots and frozen at −80 ° C. to obtain a competent cell.

[0121] 90 L of the prepared competent cell and 5 L of plasmid DNA of pRETl102, pRET1122, pRET1137 or pRET1138 prepared with Labo Pass (trademark) Mini were mixed on ice. The mixed solution was poured into a 0.1 lcm cuvette (Nippon Bio Rad Laboratories) cooled on ice, and set in a Gene Pulser II Electroporation System (Nippon Bio Rad Laboratories). It was knocked at 20 kV / cm, 400 Ω, 25 ° F., 300 L of LB medium was immediately added, and the mixture was allowed to stand at 25 ° C. for 3 hours. A part of the suspension was plated on LB agar medium containing 100 g / mL kanamycin and left at 30 ° C for 72 hours.

Yes

[0122] The formed colonies were inoculated into 5 mL of LB liquid medium and cultured at 30 ° C for 72 hours. The culture solution was centrifuged at 12,000 rpm for 5 minutes at 4 ° C, the supernatant was removed, and the resulting cells were used for the measurement of reductase activity.

[0123] The activity was measured in a 3% EAM reaction solution containing 2% glucose and 0.2 M sodium phosphate buffer (pH 6.0) at a bacterial mass of O. D. = 5. After the reaction solution was shaken at 30 ° C for 16 hours, the bacterial cell reaction solution was centrifuged at 12, OOOrpm for 5 minutes, and the supernatant was subjected to HPLC. The analytical column is Inertsil Ph— 3 3.0 X 75 mm, the column temperature is 40 ° C, the eluent is a 7% acetonitrile solution containing 0.05 M sodium phosphate buffer (pH 6.0), and the detection wavelength is 220 ηm. Ττ.

[0124] As a result of measuring ΕΑΜ reaction, R. erythropolis MAK— 3 4 holding pRET1102 is 0.2; ^ / 1ι / θ. D. R. erythropolis M AK- 34¾20 ag / / OD active with pRET1137 and R. erythro polis MAK- 34 with pRETl 138 active with 20 g / h / OD It was. Although pRETl 122 and pRETl 137 contain a promoter derived from lactic acid bacteria, it has been confirmed that R. erythropolis highly expresses an aminoketone asymmetric reductase. In addition, the activity of the promoter was equivalent to that of pRETl 138 containing a promoter derived from Rhodococcus actinomycetes. (Example 8) Measurement of activity of a predetermined promoter in actinomycetes other than Rhodococcus erythpolis

Amycolatopsis methanolica NBRC 15065, Dietzi a maris NBRC 15801, Rhodococcus globerulus NBRC 14531, Rhodococcus rhodochrous NBRC 15564, Rhodococcus ruber NBRC 1559 1, Mycobacterium diernhoferi NBRC3707 (the above 6 Biotechnology Headquarters, Biotechnology Headquarters, National Institute for Evaluation Technology, Sold from Chiba Prefecture Kisarazu Kazusa Kamasa 2-5-8), Rhodococcus kore ensis JCM 10743, Rhodococcus kroppenstedtii JCM 130 丄 1, Rhodoco ecus yunnanensis JCM 13366, Rhodococcus corynebacterioides JCM

3376, Rhodococcus zopfii JCM 9919, Rhodococcus tukisamuensis J CM 11308, Rhodococcus percolatus JCM 10087, Rhodococcus imte chensis JCM 13270, Gordonia bronchialis JCM 3231, Rhodococcus maanshanensis JCM 11374, Gordonia rubripertincta Joc 3396 And Rhodococcus opacus JCM 9703 (the above 14 strains were inoculated from JCM (independent administrative agency, BioResource Center, Microbial Materials Development Office, 2-1 hirosawa, Wako-shi, Saitama 351-0101)) at 25 ° C. Shake culture. Using a Shimadzu UV-Visible spectrophotometer UV-160A (Shimadzu Corporation), the culture solution was measured at a wavelength of 610 nm and cultured with shaking until the absorbance reached 0.8. 3 mL of the culture solution was inoculated into lOOmL of LB medium and cultured with shaking at 25 ° C for 12 hours. The cultured cells were collected by centrifugation (12 krpm, 5 minutes, 4 ° C), and the collected cells were washed twice with ultrapure water. The washed cells were collected by centrifugation (12 krpm, 5 minutes, 4 ° C) and suspended in 2.4 mL of 10% glycerol solution. 300 L aliquots of the suspension were dispensed and frozen at −80 ° C. to obtain a competent cell.

[0126] Each of the produced competent cells 90 a L and plasmid DNA 5 L of pRE T1102 or pRET1137 prepared with Labo Pass ™ Mini were mixed on ice. Gently pour the mixture into a 0.1 cm cuvette chilled on ice, Gene Pulser II Electrop oration System ^ This set. Remove the LB medium at 20 kV / cm, 400 Ω, and 25 μF, and immediately remove the LB medium and leave it at 25 ° C for 3 hours. A part of the suspension was plated on LB agar medium containing 100 g / mL kanamycin and left at 25 ° C for 7 days. The formed colonies were inoculated into 5 mL of LB liquid medium and cultured with shaking at 25 ° C for 7 days. The culture solution was centrifuged at 4 ° C and 12 krpm for 5 minutes, the supernatant was removed, and the obtained cells were used for the measurement of reductase activity.

[0127] The activity was measured in a 3% EAM reaction solution containing 2% glucose and 0.2 M sodium phosphate buffer (pH 6.0) at a bacterial mass of O. D. = 5. After the reaction solution was shaken at 30 ° C for 16 hours, the bacterial cell reaction solution was centrifuged at 12 krpm for 5 minutes, and the supernatant was subjected to HPLC. Analytical power Ram is Inertsil Ph—33 x 75 mm, column temperature is 40 ° C, eluent is 7% acetonitrile solution containing 0.05M sodium phosphate buffer (ρΗ6.0), detection wavelength is 220nm It was.

[0128] The results of activity measurement are summarized in Table 1. For all actinomycetes shown in Table 1, the actinomycetes carrying pRETl137 showed higher activity than the actinomycetes carrying pRET102.

[0129] [Table 1]

PRET1102 activity PRET1137 activity Actinomycetes

(/ ig / ml -hr / 0D) (/ ig / ml -hr / 0D)

Mycobacterium diernhoferi NBRC 3707 0.1 6

Gordon i a bronchial is JCM 3231 0.2 22

Rhodococcus globerulus NBRC 14531 0.1 12

Rhodococcus kroppenstedti i JCM 13011 0.2 14

Rhodococcus maanshanens i s JCM 11374 0.1 4

Rhodococcus rhodochrous NBRC 15564 0.3 73

Gordon i a rubr ipertincta JCM 3199 0.1 12

Rhodococcus tr iatomae JCM 13396 0.1 4

Dietzia maris NBRC 15801 0.6 65

Rhodococcus imtechensis JCM 13270 0.7 69

Rhodococcus yunnanensis JCM 13366 1.2 66

Rhodococcus corynebacter ioides JCM 3376 0.4 52

Rhodococcus koreensis JCM 10743 0.8 72

Amyco I atops i s methanol ica NBRC 15065 0.2 44

Rhodococcus zopf i i JCM 9919 0.3 40

Rhodococcus tuki samuens i s JCM 11308 0.2 70

Rhodococcus ruber NBRC 15591 0.2 55

Rhodococcus percolatus JCM 10087 0.6 51

Rhodococcus rhodni i JCM 3203 0.7 52

Rhodococcus opacus JCM 9703 0.3 49 Industrial applicability

According to the promoter, expression vector or transformant of the present invention, high expression of a target gene or target protein can be realized in actinomycetes, and various useful proteins can be efficiently mass-produced depending on the purpose. it can. Such proteins also contribute to various industrial production. For example, in an enzyme, oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase and the like can be efficiently produced in large quantities. When the target protein is an aminoketone asymmetric reductase, it enables high-yield and highly selective production of optically active / 3-amino alcohol. Also, the method for producing the target protein of the present invention According to the method, the target protein can be efficiently mass-produced in actinomycetes.

Claims

The scope of the claims

[1] A promoter for actinomycetes having the base sequence set forth in SEQ ID NO: 1.

[2] A promoter for actinomycetes having the base sequence set forth in SEQ ID NO: 2.

[3] A promoter for actinomycetes having the base sequence set forth in SEQ ID NO: 3.

[4] A promoter for actinomycetes having the base sequence set forth in SEQ ID NO: 4.

[5] The actinomycetes are one or more actinomycetes selected from Rhodococcus actinomycetes, Mycobacteria actinomycetes, Gordonia actinomycetes, Dieza actinomycetes, and Amycolatopsis actinomycetes, The promoter according to claim 1.

[6] Claims; An expression vector for actinomycetes, comprising the promoter according to any one of! To 5.

[7] Actinomycetes transformed with the expression vector according to claim 6.

[8] A method for producing a target protein using the transformant according to claim 7.

[9] A gene encoding the target protein is inserted into an expression vector having the promoter according to any one of claims;! To 5 so that the target protein can be expressed downstream of the promoter, and the target protein is inserted. Obtaining an expression vector capable of expression;

Transforming actinomycetes with the obtained expression vector, obtaining a transformant, culturing the obtained transformant in a medium capable of growth, and

A step of purifying the target protein from the transformant obtained in the culturing step;

A method for producing a target protein comprising: