JP4563789B2 - D-aminoacylase gene - Google Patents

Description

  The present invention relates to a novel D-aminoacylase gene and a method for producing D-aminoacylase using the gene.

  Enzymes are proteins with catalytic activity, and amino acids are the main constituents of proteins. In order for a protein to exert its function, it is necessary to maintain a complicated and exact three-dimensional structure.

  Optically active amino acids are used in various applications as seasonings, food additives, feed additives, or synthetic raw materials for pharmaceuticals and agricultural chemicals. In particular, L-amino acids are used for seasonings, pharmaceutical transportation and the like, and their utility value is high. The production of L-amino acids is diverse, including protein hydrolysis, fermentation, and enzymatic methods. Most of L-amino acids are produced by fermentation using microorganisms, but some amino acids are produced from chemically synthesized substrates using enzymatic methods.

  On the other hand, D-amino acids were known to exist in peptidoglycans and peptidic antibiotics on the bacterial cell wall, but because they are non-protein amino acids, they have received little attention. However, it was reported in 1981 that the peptide dermorphin containing morphine-like analgesic activity containing D-alanine was present in the skin of South American amphibian frogs. Recently, L-amino acids in human tooth enamel, eye lens, and brain proteins undergo racemization and change to D-type with aging. Also, blood, cerebellum, pituitary gland, adrenal gland, testicles In addition, it has been clarified that D-amino acid is present in the spleen as a free form, and that aspartate and serine residues in β-amyloid protein accumulated in the brain in Alzheimer's disease are changed to D-form. Yes. Since a lot of knowledge about D-amino acids has been obtained, the demand for D-amino acids as synthetic raw materials for pharmaceuticals and agricultural chemicals is expected to increase in the future, and an efficient method for producing D-amino acids is required. .

  As a method for producing D-amino acid by an enzymatic method, a method for producing D-p-hydroxyglycine using D-hydantoinase is known. Other methods include the action of D-aminoacylase or L-aminoacylase on N-acyl-DL-amino acids. Since this method requires complicated operations, a more efficient D-amino acid production method has been developed. In this improved method, N-acylamino acid racemase and D-aminoacylase are used in combination, and at the same time as hydrolysis of N-acyl-D-amino acid by D-aminoacylase, the optical isomer remaining in the reaction system is converted to N- It is converted to D-amino acid in one step by racemization with acylamino acid racemase (Non-patent Documents 1-5). Thus, D-aminoacylase plays an important role in the production of D-amino acids.

  D-aminoacylase is an enzyme that hydrolyzes N-acyl-D-amino acids and catalyzes the production of D-amino acids. About D-aminoacylase, Streptomyces genus (Streptomyces olivaceus 62-3, Streptomyces tuirus IFO13418) has been used for actinomycetes, and Pseudomonas genus (Pseudomonas sp. KT83, Pseudomonas sp. AAA6029, Pseudomonas sp. 1158) and Alcaligenes genus (Alcaligenes denitrificans DA181, Alcaligenes faecalis DA1, Alcaligenes xylosoxydans A-6, Alcaligenes xylosoxydans MI-4). These enzymes have been purified except for Pseudomonas sp. KT83, Pseudomonas sp. AAA6029, and Streptomyces, and their properties have been investigated. As a result, this enzyme is an inducing enzyme. In Alcaligenes xylosoxydans A-6, three kinds of D-aminoacylases having different substrate specificities by changing the inducing substance have been reported. All three enzymes derived from Alcaligenes xylosoxydans A-6 have been cloned, and D-aminoacylase has been successfully expressed in E. coli. In addition, in Alcaligenes denitrificans DA181, L-aminoacylase produced at the same time has also been purified and its properties have been investigated. Furthermore, with respect to D-aminoacylase derived from Alcaligenes xylosoxydans A-6, amino acid residues involved in activity and metal binding sites are presumed. Recently, the group of Tsai et al. Succeeded in crystallization of D-aminoacylase derived from Alcaligenes faecalis DA1, and reported details of X-ray crystallography in 2003. The report identified amino acids related to metal binding and catalysis of D-aminoacylase. From these detailed analyses, it is considered that D-aminoacylase belongs to the superfamily of hydrolases having metal-dependent domains to which urease, cytosine deaminase and the like belong.

  However, all of the above-mentioned D-aminoacylases have temperature stability of 50 ° C. or less and optimum temperature of 50 ° C. or less, and cannot be said to have excellent heat resistance. If thermostable D-aminoacylase is present, the durability of the enzyme is improved according to the heat resistance, which is economically advantageous. In addition, when thermostable D-aminoacylase is applied to D-amino acid production, since the reaction temperature can be set high, the concentration of raw materials and the like can be increased from the solubility, and there is also an economic merit.

As such a thermostable D-aminoacylase, Streptomyces thermonitrificans CS5-9 strain D-aminoacylase has been reported. This enzyme was previously discovered by the inventors. The present inventors screened for the purpose of obtaining practical D-aminoacylase, found D-aminoacylase activity in Streptomyces thermonitrificans CS5-9 strain that can grow at 50 ° C., and derived from Streptomyces thermonitrificans CS5-9 strain D-aminoacylase was purified and confirmed to be a thermostable enzyme (Patent Document 1). Many thermostable enzymes do not collapse even at high temperatures and show catalytic activity, but some of them are denatured and inactive at high temperatures, but some regenerate to show catalytic activity at room temperature. . This heat-resistant property improves the disadvantage of general enzymes that are poor in stability and easily inactivated by cell extraction and long-term storage. A large amount of enzyme is required for industrial use of the enzyme. If the enzyme gene can be isolated, mass production of useful thermostable D-aminoacylase can be achieved. However, there has been no report on the isolation of the D-aminoacylase gene derived from Streptomyces thermonitrificans CS5-9 so far.
JP2002-45179 S. Tokuyama, K. Hatano, and T. Takahashi: Discovery of a novel enzyme, N-Acylamino acid racemase in an Actinomycete: screening, isolation, and identification., Biosci. Biotech. Biochem., 58, 24 (1994) S. Tokuyama, K. Hatano: Purification and properties of a novel enzyme, N-acylamino acid racemase, from Streptomyces atrarus Y-53., Appl. Microbiol. Biotechnol., 40, 835 (1994) S. Tokuyama, K. Hatano: Purification and properties of thermostable N-acylamino acid racemase from Amycolatopsis sp. TS1-60., Appl. Microbiol. Biotechnol., 42, 853 (1995) S. Tokuyama, K. Hatano: Cloning, DNA sequencing and heterologous expression of the gene for thermostable N-acylamino acid racemase from Amycolatopsis sp. TS-1-60 in Escherichia coli., Appl. Microbiol. Biotechnol., 42, 884 (1995) S. Tokuyama, K. Hatano: Overexpression of the gene for N-acylamino acid racemase from Amycolatopsis sp. TS-1-60 in Escherichia coli and continuous production of optically active methionine by a bioreactor., Appl. Microbiol. Biotechnol., 44,774 (1996)

  The problem to be solved by the present invention is to isolate a D-aminoacylase gene derived from Streptomyces thermonitrificans CS5-9 strain and to construct a method for producing D-aminoacylase using the gene.

  In order to solve the above-mentioned problems, the present inventors have conducted extensive research for the purpose of isolating a D-aminoacylase gene derived from Streptomyces thermonitrificans CS5-9. Initially, since D-aminoacylase derived from Streptomyces thermonitrificans CS5-9 strain has already been isolated, it was considered to determine the amino acid sequence of the D-aminoacylase and to perform cloning by PCR. However, in order to determine the amino acid sequence described above, it is difficult to obtain a large amount of purified enzyme due to the small amount of D-aminoacylase produced by Streptomyces thermonitrificans CS5-9, and the N-terminus of the enzyme protein is blocked. I abandoned this because of the difficulty. Next, we sought to synthesize PCR primers from the sequence of the already cloned Alcaligenes bacterium-derived D-aminoacylase gene. However, since the GC content of actinomycetes genes is extremely high compared to the GC content of general bacterial genes, it was difficult to design PCR primers based on the gene sequences.

  In this way, the present inventors focused on the Streptomyces coelicolor gene: SCO4986 (name on the database), which has caused difficulties in cloning the target gene. Streptomyces coelicolor is one of the actinomycetes for which genome analysis has already been completed, and the DNA sequence of SCO4986 is known. However, the function of SCO4986 is unknown, and it was not known at all to have D-aminoacylase activity. Furthermore, the similarity between SCO4986 and the known Alcaligenes xylosoxydans-derived D-aminoacylase gene is as low as 34% in amino acid sequence. In spite of this situation, the inventors cloned the SCO4986 gene of Streptomyces coelicolor as a D-aminoacylase-like gene (Scdaa) and confirmed that Scdaa actually has D-aminoacylase activity. did. Subsequently, a part having high similarity was searched for among the Scdaa, Alcaligenes xylosoxydans D-aminoacylase gene, and Streptomyces avermitilis, and primers were designed based on the highly similar sequence. Using this synthesized primer, PCR was performed using the total DNA of Streptomyces thermonitrificans CS5-9 as a template, and the present inventors finally succeeded in amplifying the D-aminoacylase gene of Streptomyces thermonitrificans for the first time. Furthermore, the present inventors performed Southern hybridization using a part of the amplified fragment, succeeded in obtaining a complete gene of the gene, and completed the present invention.

That is, the present invention relates to a novel D-aminoacylase gene and use thereof, and specifically provides the following inventions.
(1) the isolated DNA according to any one of (a) to (d) below,
(A) DNA encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 2
(B) DNA containing the coding region of the base sequence described in SEQ ID NO: 1
(C) a DNA encoding a protein having an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence shown in SEQ ID NO: 2 and having D-aminoacylase activity
(D) a DNA that hybridizes with a DNA comprising the nucleotide sequence of SEQ ID NO: 1 under stringent conditions and encodes a protein having D-aminoacylase activity
(2) a vector into which the DNA according to (1) is inserted,
(3) A transformed cell carrying the DNA according to (1) above or the vector according to (2) above,
(4) A method for producing a thermostable D-aminoacylase, comprising a step of culturing the transformed cell according to (3) above.

  The gene of the present invention encodes a thermostable D-aminoacylase. The D-aminoacylase expressed by the gene of the present invention has the property of producing D-amino acids by acting on various N-acyl-D-amino acids in a higher temperature range than before. That is, if a heat-stable D-aminoacylase is produced using the gene of the present invention and a D-amino acid is produced using the D-aminoacylase, the solubility of raw materials and substrates can be increased, and the feed concentration can be set high. Industrially advantageous production is possible. For example, a D-amino acid is specifically produced by allowing a thermostable D-aminoacylase produced using the gene of the present invention to act on N-acetyl-DL-amino acid, which is a mixture of D and L forms. Can do.

  The present invention relates to a novel D-aminoacylase gene. As a novel D-aminoacylase gene, the DNA sequence of Streptomyces thermonitrificans (hereinafter sometimes abbreviated as S. thermonitrificans) CS5-9 strain D-aminoacylase is shown in SEQ ID NO: 1. In addition, the deduced amino acid sequence of D-aminoacylase derived from S. thermonitrificans CS5-9 strain is shown in SEQ ID NO: 2. As described above, the present inventors succeeded in isolating the D-aminoacylase gene of S. thermonitrificans through a complicated process. In the present specification, “isolation” refers to an artificial treatment so as to exist in a state different from the originally existing state.

  The D-aminoacylase gene of the present invention can be prepared by methods well known to those skilled in the art. For example, toal DNA is extracted from S. thermonitrificans, a genomic library is prepared using vectors such as plasmids, phages, cosmids, YACs, etc., and part of the base sequence encoding S. thermonitrificans D-aminoacylase, for example, the sequence It can be prepared by colony hybridization or plaque hybridization using a part of the DNA of No. 1 as a probe. Alternatively, it may be prepared by synthesizing a single-stranded DNA of the sequence shown in SEQ ID NO: 1 and a single-stranded DNA of a complementary sequence with a commercially available DNA synthesizer and annealing them.

  The present invention also contains a gene that is similar to S. thermonitrificans D-aminoacylase and encodes a protein having D-aminoacylase activity (hereinafter sometimes abbreviated as “S. thermonitrificans D-aminoacylase-like gene”). To do. As such a gene, a naturally occurring or artificially produced mutant of S. thermonitrificans D-aminoacylase-like gene, a D-aminoacylase gene derived from another organism, 1 in the amino acid sequence described in SEQ ID NO: 2 Or a DNA encoding a protein having a D-aminoacylase activity having an amino acid sequence in which a plurality of amino acids are substituted, deleted, inserted and / or added, and a DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1 and stringent And DNA encoding a protein that hybridizes under various conditions and has D-aminoacylase activity. In the DNA, the number and location of the amino acid “one or more amino acids are substituted, deleted, inserted and / or added” is not limited as long as the protein encoded by the DNA has D-aminoacylase activity. . If the number of mutations is enumerated, it is typically within 10% of all amino acids, preferably within 5% of all amino acids, and more preferably within 1% of all amino acids.

  Those skilled in the art can appropriately select stringent hybridization conditions for isolating the S. thermonitrificans D-aminoacylase-like gene. An example is 25% formamide, 50% formamide under more severe conditions, 4 × SSC, 50 mM Hepes pH 7.0, 10 × Denhardt's solution, 20 μg / ml denatured in a hybridization solution containing denatured salmon sperm DNA at 42 ° C. After overnight prehybridization, a labeled probe is added and hybridization is performed by incubating overnight at 42 ° C. The cleaning solution and temperature conditions for the subsequent cleaning are about 1xSSC, 0.1% SDS, 37 ° C, more severe conditions are about 0.5xSSC, 0.1% SDS, 42 ° C, and more severe conditions are about 0.2xSSC. , 0.1% SDS, about 65 ° C. ”. Thus, isolation of DNA having high homology with the probe sequence can be expected as the conditions for washing hybridization are more severe. However, combinations of the above SSC, SDS, and temperature conditions are exemplary, and those skilled in the art will recognize the above or other factors that determine the stringency of hybridization (eg, probe concentration, probe length, hybridization reaction). It is possible to achieve the same stringency as above by appropriately combining the time and the like.

  A polypeptide encoded by DNA isolated using such a hybridization technique usually has high homology in amino acid sequence with the polypeptide identified by the present inventors. High homology means at least 40% or more, preferably 60% or more, more preferably 80% or more, more preferably 90% or more, more preferably at least 95% or more, more preferably at least 97% or more (for example, 98% or more). To 99%) sequence homology. The identity of the amino acid sequence is determined, for example, by the algorithm BLAST by Karlin and Altschul (Proc. Natl. Acad. Sci. USA 87: 2264-2268, 1990, Proc. Natl. Acad. Sci. USA 90: 5873-5877, 1993). Can be determined by. Based on this algorithm, a program called BLASTX has been developed (Altschul et al. J. Mol. Biol. 215: 403-410, 1990). When the amino acid sequence is analyzed by BLASTX, the parameters are, for example, score = 50 and wordlength = 3. When using BLAST and Gapped BLAST programs, the default parameters of each program are used. Specific techniques for these analysis methods are known (http://www.ncbi.nlm.nih.gov.).

  The above S. thermonitrificans D-aminoacylase-like gene can be prepared by methods well known to those skilled in the art. It is possible to prepare a naturally occurring mutant or homolog by hybridization using a part of the base sequence encoding S. thermonitrificans D-aminoacylase, for example, a part of the DNA sequence shown in SEQ ID NO: 1 as a probe. For example, preparation from microorganisms that can grow at temperatures of 55 ° C. or higher, thermophilic bacteria, thermophilic bacteria, and the like can be considered. As thermophilic bacteria (thermophilic bacteria), bacteria of the genus Bacillus (B. thermophilus, B. megaterium, B. coagulans, B. stearothermophilus, etc.), bacteria of the genus Clostridium (C. kluyveri, etc.), In addition to bacteria from the genus Desulfotomaculum, bacteria from the genus Thermus (T. flavus, T. thermophilus, T. aguaticus, T. celer, etc.), methane bacteria (genus Methanobacterium, Methanococcus, Methanosarcina) Genus etc.), lactic acid bacteria (Lactobacillus lactis, L. acidphilus, L. bulgaricus, L. delbrueckii etc.), hydrogen bacteria, photosynthetic bacteria and the like. Moreover, Pyrococcus furisus, Pyrococcus sp., Aeropyrum pernix, etc. which are hyperthermophilic bacteria are also mentioned. Alternatively, S. thermonitrificans D-aminoacylase gene sequence, for example, a DNA mutation shown in SEQ ID NO: 1, such as a mutation method using an oligonucleotide, a mutation method by PCR, a cassette mutation method, etc. It can also be prepared artificially by the method. Furthermore, it is also possible to synthesize with a commercially available DNA synthesizer.

  Whether the gene prepared as described above encodes a protein having D-aminoacylase activity can be confirmed by a known method. For example, as described in the examples described later, if the prepared gene is expressed, and D-methionine production when the obtained protein is contacted with N-acetyl D-methionine is used as an index, D-aminoacylase You can know if there is activity.

  The S. thermonitrificans D-aminoacylase gene or the S. thermonitrificans D-aminoacylase-like gene of the present invention can be used for the production of a protein having thermostable D-aminoacylase activity. As described above, the production amount of D-aminoacylase of Streptomyces thermonitrificans CS5-9 strain is small, but mass production of thermostable D-aminoacylase can be achieved by using the above gene for the production of D-aminoacylase. When expressing the gene, an appropriate expression vector can be used. It is desirable that the expression vector to be used is appropriately selected depending on the expression system. The expression system may be a cell system or a cell-free system. The procedure for producing transformants and the construction of a recombinant vector suitable for the host can be performed according to techniques commonly used in the fields of molecular biology, biotechnology, and genetic engineering (for example, Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratories, 1989). In order to express the DNA encoding the D-aminoacylase of the present invention in a microorganism or the like, the DNA is first introduced into a plasmid vector or a phage vector stably present in the microorganism, and the genetic information is transcribed and transferred. Need to translate. For that purpose, a promoter corresponding to a unit controlling transcription / translation may be incorporated upstream of the 5′-side of the DNA strand encoding D-aminoacylase, and more preferably a terminator downstream of the 3′-side. As the promoter and terminator, it is necessary to use a promoter and terminator known to function in a microorganism used as a host. Examples of such promoters and terminators include the PLD promoter and PLD terminator used in the examples. In addition, promoters such as tipAp, glyCABp, mcrABp, ermEp, and terminators thereof can be preferably used. Regarding the vectors, promoters, terminators, etc. that can be used in these various microorganisms, “Microbiology Basic Course 8 Genetic Engineering / Kyoritsu Shuppan”, especially regarding yeast, Adv. Biochem. Eng. 43, 75-102 (1990), Yeast 8, 423-488 (1992).

  For example, in the case of actinomycetes expression system, pIJ8600, pIJ459, pIJ4090, pMT3206, pANT850, pIJ6021 and the like can be used in addition to pUC plasmids such as pUC19 used in Examples described later. In addition, in the genus Streptomyces, a plasmid can be constructed according to the method described in Hopwood et al., Genetic Manipulation of Streptomyces: A Laboratory Manual Cold Spring Harbor Laboratories (1985). In particular, in Streptomyces lividans, pIJ486 (Mol. Gen. Genet. 203, 468-478, 1986), pKC1064 (Gene 103,97-99 (1991)), pUWL-KS (Gene 165,149 -150 (1995)) can be used. The same plasmid can also be used in Streptomyces virginiae (Actinomycetol. 11, 46-53 (1997)).

  In the case of an E. coli expression system, particularly in Escherichia coli, pBR and pUC plasmids can be used as plasmid vectors, and lac (β-galactosidase), trp (tryptophan operon), tac, trc (lac , Trp fusion), promoters derived from λ phage PL, PR, and the like. In addition, as a terminator, a terminator derived from trpA, phage, or rrnB ribosomal RNA can be used.

  In the genus Bacillus, pUB110 series plasmids, pC194 series plasmids and the like can be used as vectors, and can be integrated into chromosomes. Further, apr (alkaline protease), npr (neutral protease), amy (α-amylase) and the like can be used as promoters and terminators.

  In the genus Pseudomonas, host vector systems have been developed for Pseudomonas putida, Pseudomonas cepacia, and the like. A broad host range vector (including genes necessary for autonomous replication derived from RSF1010) pKT240 based on the plasmid TOL plasmid, which is involved in the degradation of toluene compounds, can be used, and lipase (specialized as a promoter and terminator) can be used. Kaihei 5-284973) Genes can be used.

  In the genus Brevibacterium, particularly in Brevibacterium lactofermentum, plasmid vectors such as pAJ43 (Gene 39, 281 (1985)) can be used. As the promoter and terminator, promoters and terminators used in Escherichia coli can be used as they are.

  In the genus Corynebacterium, particularly Corynebacterium glutamicum, plasmid vectors such as pCS11 (Japanese Patent Laid-Open No. 57-183799) and pCB101 (Mol. Gen. Genet. 196,175 (1984)) can be used.

  In the genus Streptococcus, pHV1301 (FEMS Microbiol. Lett. 26, 239 (1985), pGK1 (Appl. Environ. Microbiol. 50, 94 (1985)), etc. can be used as a plasmid vector.

  In the genus Lactobacillus, pAMβ1 (J. Bacteriol. 137, 614 (1979)) developed for Streptococcus can be used, and those used in Escherichia coli as promoters can be used. .

  In the genus Rhodococcus, plasmid vectors isolated from Rhodococcus rhodochrous can be used (J. Gen. Microbiol. 138, 1003 (1992)).

  In the genus Saccharomyces (especially Saccharomyces cerevisiae), YRp, YEp, YCp, and YIp plasmids can be used and use homologous recombination with ribosomal DNA present in multiple copies in the chromosome. Such integration vectors (such as EP 537456) are extremely useful because they can introduce genes in multiple copies and can stably hold genes. ADH (alcohol dehydrogenase), GAPDH (glyceraldehyde-3-phosphate dehydrogenase), PHO (acid phosphatase), GAL (β-galactosidase), PGK (phosphoglycerate kinase), ENO (enolase) Promoters and terminators such as can be used.

  In the genus Klyberomyces, especially Kluyveromyceslactis, 2 μm plasmid derived from Saccharomyces cerevisiae, pKD1 plasmid (J. Bacteriol. 145, 382-390 (1981)), involved in killer activity A plasmid derived from pGKl1, an autonomously proliferating gene KARS system plasmid in the genus Kleberomyces, a vector plasmid (such as EP 537456) that can be integrated into the chromosome by homologous recombination with ribosomal DNA, and the like can be used. In addition, promoters and terminators derived from ADH, PGK and the like can be used.

  In the genus Schizosaccharomyces, plasmid vectors containing selectable markers that complement ARS (genes involved in autonomous replication) from Schizosaccharomyces pombe and auxotrophy from Saccharomyces cerevisiae are available ( Mol. Cell. Biol. 6, 80 (1986)). Moreover, the ADH promoter derived from Schizosaccharomyces pombe can be used (EMBO J. 6, 729 (1987)). In particular, pAUR224 is commercially available from Takara Shuzo and can be easily used.

  In the genus Zygosaccharomyces, plasmid vectors derived from pSB3 (Nucleic Acids Res. 13,4267 (1985)) derived from Zygosaccharomyces rouxii are available, and the PHO5 promoter derived from Saccharomyces cerevisiae In addition, the promoter of GAP-Zr (glyceraldehyde-3-phosphate dehydrogenase) derived from Tigosaccharomyces rouxi (Agri. Biol. Chem. 54, 2521 (1990)) can be used.

  In the genus Hansenula, a host vector system has been developed in Hansenula polymorpha. As a vector, genes involved in autonomous replication derived from Hansenula polymorpha (HARS1, HARS2) can be used, but since they are relatively unstable, multicopy integration into the chromosome is effective (Yeast 7, 431- 443 (1991)). In addition, AOX (alcohol oxidase) and FDH (formate dehydrogenase) promoters induced by methanol and the like can be used.

  In the Pichia genus, a host vector system utilizing Pichia pastoris and other genes involved in Pichia-derived autonomous replication (PARS1, PARS2) has been developed (Mol. Cell. Biol. 5 , 3376 (1985)), strong promoters such as high concentration culture and methanol-inducible AOX can be used (Nucleic Acids Res. 15, 3859 (1987)).

  In the genus Candida, host vector systems are used in Candida albicans, Candida albicans, Candida tropicalis, and Candida utilis. Has been developed. In Candida maltosa, ARS derived from Candida maltosa has been cloned (Agri. Biol. Chem. 51, 51, 1587 (1987)), and vectors using this have been developed. In Candida utilis, a strong promoter has been developed for the chromosome integration type vector (Japanese Patent Laid-Open No. 08-173170).

  In the genus Aspergillus, Aspergillus niger and Aspergillus oryzae are the most well-studied molds, and integration into plasmids and chromosomes is available. Promoters derived from external proteases or amylases are available (Trends in Biotechnology 7, 283-287 (1989)).

  In the genus Trichoderma, a host vector system using Trichodermareesei has been developed, and a promoter derived from an extracellular cellulase gene can be used (Biotechnology 7, 596-603 (1989)).

  In addition, baculovirus can be used when producing proteins using insect cells or mammalian cells. An example of a baculovirus vector in mammalian cells is pAcCAGMCS1 (Edited by Masami Muramatsu, Lab Manual Genetic Engineering 3rd Edition, Maruzen Co., Ltd., 1996, pp. 242-246).

  By introducing the D-aminoacylase gene of the present invention or a vector into which the gene is inserted into a host cell, a transformed cell producing D-aminoacylase can be obtained. There is no particular limitation on the type of host cell into which the gene or vector of the present invention is introduced, and it can be selected according to the purpose. The vector can be introduced into a host cell by a method known to those skilled in the art. For example, it can be performed by a method such as a calcium phosphate precipitation method, an electric pulse perforation method, a lipofectamine method, or a microinjection method.

  D-aminoacylase expressed in the host cell can be recovered by methods well known to those skilled in the art. When D-aminoacylase accumulates in microorganisms, after culturing, the microorganisms are collected by filtration, centrifugation, etc., washed with buffer solution, physiological saline, etc. , Physical treatment such as sonication, pressure treatment, osmotic pressure differential treatment, grinding treatment, or chemical treatment such as biochemical treatment such as cell wall lytic enzyme treatment such as lysozyme or contact treatment with surfactant. By performing alone or in combination, microorganisms can be disrupted and D-aminoacylase can be extracted. The crude D-aminoacylase thus obtained is used for salting out, fractional precipitation with organic solvents, salting out chromatography, ion exchange chromatography, gel filtration chromatography, hydrophobic chromatography, dye chromatography, hydroxyapatite chromatography, affinity. Separation by various types of chromatography such as chromatography by open column, medium pressure chromatography, high performance liquid chromatography (HPLC) and separation by electrophoresis such as isoelectric focusing, native-electrophoresis, etc. It can refine | purify by using in combination.

  Specifically, for example, a shaking culture is performed using a medium such as 231 liquid medium (0.1% yeast extract, 0.1% meat extract, 1.0% maltose, 0.2% NZ amine type A, pH 7.0), and collected by centrifugation. Fungus. The obtained bacterial cells are sonicated with a sonicator, centrifuged, and the supernatant is recovered to obtain a crude enzyme solution of D-aminoacylase. Then, salting out using ammonium sulfate, desalting by gel filtration, Butyl-Toyopearl 650M hydrophobic chromatography, DEAE-Toyopearl 650M ion exchange chromatography, Sephacryl S200 gel filtration chromatography, Mono Q ion exchange chromatography, It can be purified by SDS-polyacrylamide gel electrophoresis into a single band.

  The D-aminoacylase obtained by using the gene of the present invention can be used for the production of D-amino acids. In addition, the culture can be used for the production of D-amino acid as it is or as a crude product obtained by crushing bacterial cells. That is, microbial cells cultured on a liquid medium or a flat medium are collected, and if necessary, processed microbial cells such as immobilized microbial cells, crude enzymes, and immobilized enzymes are prepared. By contacting this with N-acyl-DL-amino acid as a raw material, a D-amino acid production reaction system can be constructed.

  EXAMPLES The present invention will be described below with reference to examples, but the present invention is not limited to these examples.

[Example 1] Design of primers for cloning D-aminoacylase gene
Primer design was examined to isolate the D-aminoacylase gene of S. thermonitrificans by PCR. The D-aminoacylase of thermostable actinomycetes S. thermonitrificans CS5-9 has already been isolated (Patent Document 1). However, it is difficult to obtain a large amount of purified enzyme due to the small amount of D-aminoacylase produced by Streptomyces thermonitrificans CS5-9, and the N-terminus of the enzyme protein is blocked. It was difficult. Therefore, the PCR primer design from the S. thermonitrificans CS5-9 strain D-aminoacylase amino acid sequence was abandoned.

  Next, an attempt was made to design a primer for isolating the D-aminoacylase gene of S. thermonitrificans based on the sequence of the D-aminoacylase gene of another microorganism. The synthesis of primers for PCR was examined from the sequence of D-aminoacylase gene derived from Alcaligenes genus bacteria that had been successfully cloned. However, since the GC content of actinomycetes genes is very high compared to the GC content of general bacterial genes, it can be as high as 70%, making it difficult to design PCR primers based on the gene sequences.

  Therefore, the present inventors examined the design of primers from actinomycetes sequences for which genome analysis has already been completed. In the genus Streptomyces, Hopwood et al. Reported completion of S. coelicolor A3 (2) in 2002, and Ikeda et al. Completed completion of S. avermitilis genome-wide analysis in 2003. S. coelicolor has a gene (Scdaa) presumed to be a D-aminoacylase gene. When the sequence of the D-aminoacylase-like gene found from S. coelicolor and the D-aminoacylase-like gene found from S. avermitilis was compared, both genes showed 78% similarity in amino acid sequence. (Table 1).

In addition, the nucleotide sequence of the putative D-aminoacylase gene of S. coelicolor and S. avermitilis and surrounding region genes were analyzed and compared. In both actinomycetes, not only the D-aminoacylase-like gene but also the surrounding region were highly conserved (FIG. 1). In addition, there are genes such as D-amino deaminase and aminotransferase that are thought to be related to D-amino acids around the D-aminoacylase-like gene, and the base sequence and direction of the gene are highly conserved.

  S. thermonitrificans CS5-9 strain belongs to the same genus Streptomyces as the above two strains. Therefore, it can be inferred that the D-aminoacylase gene of S. thermonitrificans is highly similar to the D-aminoacylase-like gene of S. coelicolor and S. avermitilis. An attempt was made to search for a conserved region between D-aminoacylase-like genes. Since the amino acid sequence similarity is high in the genes of S. coelicolor and S. avermitilis, D-aminoacylase derived from Alcaligenes xylosoxydans A-6 was also added, and the amino acid sequence was compared (Fig. 2). Several places were recognized.

However, the similarity between this Scdaa and the D-aminoacylase gene derived from Alcaligenes bacteria was as low as 34% in amino acid sequence. Therefore, it was decided to confirm the D-aminoacylase activity of the Scdaa expressed protein. PCR was performed using primers: SCDAA-F1 and SCDAA-R1, and S. coelicolor total DNA as a template. The sequences of SCDAA-F1 and SCDAA-R1 are shown.
SCDAA-F1 (for creating SphI site): d (TCAGGCATGCAAGAGCTGGTCATCAGGG) (SEQ ID NO: 3)
SCDAA-R1 (for HindIII site creation): d (CCGCAAGCTTCGCCCTCGACAACAAGCT) (SEQ ID NO: 4)
An amplified fragment of about 1.7 kbp was recovered by gel extraction and then treated with SphI and HindIII to create a SphI site at the start codon site and a HindIII site downstream of the stop codon. This fragment was inserted into the SphI and HindIII sites of the plasmid pUC702Pro in which the PLD promoter was linked to the KpnI-SphI site of pUC702, and the constructed plasmid was designated as plasmid CD1 for actinomycetes expression (FIG. 3). CD1 was introduced into S. lividans TK21 and expressed to measure D-aminoacylase activity. Scdaa was confirmed to have D-aminoacylase activity in 23KU / I culture (Table 2).

As a result of genome analysis, the genes and gene orientations around the D-aminoacylase genes of S. coelicolor and S. avermitilis are highly conserved, and the amino acid sequences of the surrounding genes are nearly 80% similar. Therefore, two sites were selected from the above-mentioned regions having high conservability around the D-aminoacylase-like gene of S. coelicolor, S. avermitilis, and Alcaligenes xylosoxydans A-6 to prepare primers STDAA-F1 and STDAA-R1. The sequence of the prepared primer is shown below.
STDAA-F1: d (CCCGGCTTCATCGACATGCAC) (SEQ ID NO: 5)
STDAA-R1: d (GTCGAASAGSACCAGGTCGGC) (SEQ ID NO: 6)
S = G or C

[Example 2] Amplification of D-aminoacylase gene by PCR
PCR was performed using the above primers STDAA-F1 and STDAA-R1, using the total DNA of S. thermonitrificans as a template, and the obtained amplified fragment was subjected to agarose gel electrophoresis.

  Preparation of total DNA used as a template was performed as follows. 5 ml of TSB medium was taken into a test tube containing a spring, 1 platinum loop of actinomycetes S. thermonitrificans CS5-9 cultured in TSB slant medium was inoculated, and cultured with shaking at 50 ° C. for 1 day. 2 ml of this culture solution was inoculated into 100 ml of TSB medium taken in a 500 ml Sakaguchi flask containing several springs, and cultured with shaking until the middle phase of logarithmic growth (50 ° C., 112 spm, 5 hours). The culture solution was taken in a 50 ml conical tube, centrifuged (3,000 rpm, 1,500 × g, 15 minutes, 4 ° C .: himac SCR20B, rotor RPRS4, manufactured by Hitachi) and collected. The suspension was suspended in 20 ml of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0), and centrifuged (5,000 rpm, 4,000 × g, 20 minutes, 4 ° C.) for washing. The supernatant was removed by decantation to obtain wet cells. Suspend about 2 g of wet cells in 5 ml of TE buffer, add 10 mg of lysozyme and 2 mg of pronase while crushing the pellet, and gently agitate every 5 minutes while crushing the pellet. Incubate at 30 ° C for up to 1 hour until it started to become viscous. After 1.2 ml of 0.5 M EDTA was added and gently stirred, 0.13 ml of 10 mg / ml pronase was added and stirred, and incubated at 30 ° C. for 5 minutes. 0.7 ml of 10% SDS was added and incubated at 37 ° C., gently agitated every 5 minutes, and incubated for up to 2 hours until the cells were completely lysed and the solution was clear. Then 6 ml of phenol was added and gently stirred for 10 minutes, then 6 ml of chloroform was added and stirred for 5 minutes. Centrifugation (3,000 rpm, 1,500 × g, 20 minutes, room temperature: himac SCR20B, rotor RPRS4, manufactured by Hitachi) was performed, and the aqueous layer was transferred to a new tube. To the remaining chloroform layer, 5 ml of TNE buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA (pH 8.0), 100 mM NaCl) was added and stirred for 5 minutes. Centrifugation (3,000 rpm, 1,500 × g, 10 minutes, room temperature: himac SCR20B, rotor RPRS4, manufactured by Hitachi) was performed, and the aqueous layer was recovered and combined with the previously recovered aqueous layer. 6 ml of chloroform was added to the collected aqueous layer and stirred for 5 minutes. Centrifugation (3,000 rpm, 1500 × g, 10 minutes, room temperature: himac SCR20B, rotor RPRS4, manufactured by Hitachi) was performed, and the aqueous layer was collected in a new tube. This operation was repeated once more. RNase was added at 40 μg / g based on the weight of the solution, and incubated at 37 ° C. for 1 hour. Then, 1/4 volume of 5 M NaCl was added and gently stirred, 30% PEG6,000 was added to a final concentration of 10%, and gently stirred until the solution was completely mixed. The DNA was taken up with a Pasteur pipette so that PEG would not follow, and washed with 5 ml of TE buffer. After dissolution in 5 ml of TE buffer, the mixture was gently stirred overnight at 4 ° C. 0.6 ml of 3 M sodium acetate and 12 ml of ethanol were added and stirred well until a lint-like DNA precipitate was observed. The DNA was wound up with a Pasteur pipette, washed with 2 ml of 70% ethanol, air-dried, and dissolved in 1 ml of TE.

PCR was performed using Hot Star Taq DNA polymerase (QIAGEN). When PCR is carried out using actinomycetes DNA, the GC content of DNA and the fidelity of DNA polymerase become problems. Actinomycetes generally have a GC content of 70%, and there are concerns about the introduction of mutations during PCR reactions. However, DNA polymerases with high fidelity have been developed and are now on sale from reagent manufacturers. Hot Star Taq DNA polymerase (QIAGEN) used this time has high fidelity and is considered suitable for amplification of actinomycetes genes with high GC content. PCR was carried out as follows by examining PCR conditions for actinomycetes based on the standard cycle of Hot Star Taq DNA polymerase.
Reaction solution composition
Hot Star Taq DNA polymerase (5 unit / μl) 0 μl (2.5 unit)
10 × buffer 10 μl
dNTP Mixture (2 mM each) 10 μl (0.2 mM)
Templete (10 ng / μl) 10 μl
Primer-F (25 pmol / μl) 2 μl (50 pmol / μl)
Primer-R (25 pmol / μl) 2 μl (50 pmol / μl)
Sterile distilled water 65.5 μl

100 μl total
PCR cycle
1, 96 ℃ 5 minutes 1 cycle
2, 97 ℃ 45 seconds → 55 ℃ 30 seconds → 74 ℃ 1 minute 5 cycles
3, 96 ℃ 45 seconds → 55 ℃ 30 seconds → 74 ℃ 1 minute 25 cycles

  The amplified fragment obtained by the PCR was subjected to agarose gel electrophoresis using 1 × TAE buffer (40 mM Tris base, 0.4 mM acetic acid, 1 mM EDTA). The agarose gel has a gel concentration that matches the length of the DNA fragment to be separated in 1 × TAE buffer (100 to 2,000 bp → 2%, 200 to 3,000 bp → 1.5%, 500 to 7,000 bp → 1%, 800 to 10,000 bp) (→ 0.7%) Agarose S (Nippon Gene) was added, and the gel was completely melted in a microwave oven. After cooling to 50 ° C., ethidium bromide was added to a final concentration of 50 μg / μl to make it uniform and poured into a gel former. Electrophoresis was performed using Mupid-2 (manufactured by Advance) of a submarine type electrophoresis tank, and the electrophoresis was performed at a constant voltage of 50 V or 100 V. As the DNA molecular weight marker, λDNA digested with HindIII was used. The migrated DNA was confirmed on a UV lamp (302 nm).

  The results are shown in FIG. The chain lengths of the amplified fragments determined from agarose gel electrophoresis were about 1.5 kbp and 1.8 kbp, respectively.

  Subsequently, the obtained PCR amplification product was subjected to sequence analysis. As a result of sequence analysis, the PCR product showed 80% homology with a D-aminoacylase-like gene of S. coelicolor.

[Example 3] Genomic Southern hybridization
Although the putative D-aminoacylase gene could be amplified by PCR, it is possible that another base or the like was incorporated at the PCR reaction stage and the correct gene sequence was not amplified. Therefore, Southern hybridization was attempted to clone the D-aminoacylase gene from the genomic DNA of S. thermonitrificans.

A fragment amplified with primers of a combination of STDAA-F2 and R2 was subcloned into a T vector prepared from pUC19, and the resulting plasmid was designated as pUC (T) STDAA (FIG. 5). A DNA fragment of about 400 bp obtained by treating the pUC (T) STDAA plasmid with BamHI and SmaI was labeled by a random prime method using a DIG system to obtain a probe N1 (FIG. 6A). The sequence of probe N1 is shown below and in SEQ ID NO: 7.
Probe N1:
cccgggatgtacgccagtgacgccgaactgaccgagctgtgccgggtggtggccgcccacggcggctactggtgcccgcaccaccgcagttacggggccggggcgctgaaggcgtacgaggaggtggtgaccctcgcgcgcgaggcgggctgcccgctgcacctggcgcacgccaccttgaacttcgcccccaacaagggccgcgcgcccgagctgctggcgctgctggacgacgcgctcgccgccggcgccgacatcaccttcgacacctatccctacacccccggctgcaccaccctggccgcgttgctgccgagctgggcgggcgagggcggcccggacgcccttctcgcccggctcgccgacgagaccgtcgccgagcggatcc (SEQ ID NO: 7).

  Prepare total DNA of S. thermonitrificans, digest with 3 kinds of restriction enzymes KpnI, PstI, and SacI to 10 μg of total DNA, and then perform agarose electrophoresis (Mupid-2, 50V, 30 minutes), and probe N1 Southern hybridization was performed. Southern hybridization was performed using DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche Diagnostics), which is a non-radioactive system.

  The results are shown in FIG. As a result of Southern hybridization, bands were detected around 11 kbp in the KpnI fragment, around 10 kbp in the PstI fragment, and around 7 kbp in the SacI fragment (FIG. 6C).

[Example 4] Cloning of SacI fragment (6.5 kbp to 8 kbp)
In order to recover the SacI fragment of S. thermonitrificans CS5-9 hybridized with the probe N1, restriction enzyme SacI40 U was added to 10 μg of genomic DNA and allowed to react for 1 hour in a 200 μl reaction system. The reaction solution was subjected to agarose electrophoresis (Mupid-2, 50V, 2 hours), and the portion corresponding to the 6.5 kbp band and the 9.4 kbp band of the λ / HindIII marker was divided into three parts and excised from this gel. Extracted.

  A part was again subjected to agarose electrophoresis, and Southern hybridization was performed. As a result, the band of 6.4-7 kbp most strongly hybridized with the probe N1 among the three divisions (FIG. 7B).

  The gel extract corresponding to the portion that hybridized most strongly with the probe was treated with the restriction enzyme SacI, and then ligated with the pUC19 vector dephosphorylated at the 5 ′ end with BAP. For ligation, 100 ng of pUC19 vector was used for 250 ng of SacI fragment. This reaction solution was transformed into E. coli JM109.

[Example 5] Colony hybridization
1000 transformants obtained in Example 4 were subjected to colony hybridization. Colony hybridization was performed using DIG-High Prime DNA Labeling and Detection Starter Kit II. The probe N1 described above was used as the probe.

  As a result of colony hybridization, one positive clone was obtained (FIG. 8). A SacI fragment (6.5 kbp) was found in the obtained plasmid. When this DNA fragment was subjected to Southern hybridization, it was strongly hybridized with the probe N1 (FIG. 9).

  If the length of the existing D-aminoacylase gene is 1.0 to 1.5 kbp and the DNA fragment hybridized with the probe N1 is a D-aminoacylase gene derived from S. thermonitrificans, the D-aminoacylase gene is included in this DNA fragment. It was considered that some or all of these were included. The plasmid containing this DNA fragment was used for future experiments as pSAC4 (FIG. 10).

  The DIG system used has a complicated detection operation. However, the temperature at the time of hybridization and washing conditions can be variously changed as in the case of using the RI system. For this reason, it is considered to be suitable when various conditions are set, such as when the GC content is high or the family gene is used as a probe, such as a gene derived from actinomycetes.

[Example 6] Construction of restriction enzyme map of SacI fragment (6.5 kbp)
An attempt was made to create a restriction enzyme map of the 6.5 kbp SacI fragment from S. thermonitrificans CS5-9. The plasmid pSAC4 was cleaved with each restriction enzyme, and then Southern hybridization was performed. From this result, it was estimated that there were 1 PstI recognition site, 2 BamHI recognition sites, and 3 SmaI recognition sites in the 6.5 kbp insert. Next, the 6.5 kbp insert fragment was treated with restriction enzymes PstI, BamHI and SmaI in combination, and the fragment length was estimated from the results of agarose gel electrophoresis. These were subjected to Southern hybridization, and the restriction enzyme map of the 6.5 kbp SacI-treated fragment and the location where the probe N1 hybridized were estimated (FIG. 11).

[Example 7] Determination and analysis of base sequence of D-aminoacylase gene
After dividing the putative region considered to contain the gene into 5 regions of SacI-BamHI, BamHI-SmaI, SmaI-BamHI, BamHI-PstI, PstI-SacI, and subcloning each fragment into pUC19 vector, The entire nucleotide sequence of the D-aminoacylase gene derived from S. thermonitrificans CS5-9 strain was determined (FIG. 12, SEQ ID NO: 1). As a result of sequence analysis, the sequence of the obtained gene was found to be a putative start codon (ATG), a stop codon (TGA), and a sequence considered to be an SD sequence (GGAGA) upstream of the putative start codon (FIG. 12). ). The sequence from the putative start codon to the stop codon showed about 81% similarity to the putative D-aminoacylase gene of S. coelicolor, and 79% similarity to the putative amino acid sequence (FIG. 13). This gene consists of 1665 bp and was estimated to encode 554 amino acids.

  D-aminoacylases belong to the superfamily of hydrolases having metal-dependent domains to which urease, cytosine deaminase and the like belong. The reaction mechanism of D-aminoacylase can also be estimated with reference to the reaction mechanism of urease. Tsai et al. Reported details of X-ray crystallographic analysis of D-aminoacylase derived from Alcaligenes faecalis DA1 in 2003. According to this report, D-aminoacylase is bound to two zinc ions at the active center. , 220, 250th histidine, 96th cysteine is associated with one zinc ion, 67th, 69th histidine and 96th cysteine are associated with another zinc ion. It is also speculated that the direct catalytic reaction involves the 366th aspartic acid. On the other hand, in this gene, it was speculated that the 75, 77, 238, and 268th histidines corresponded to the 67, 69, 220, and 250th, and the 432rd aspartic acid corresponded to the 366th aspartic acid (Fig. 13). As a result of alignment of the amino acid sequences, it was speculated that the amino acid corresponding to the 96th cysteine was aspartic acid in this gene and the D-aminoacylase genes of S. coelicolor and S. avermitilis. It is not clear whether this is characteristic of Streptomyces D-aminoacylase. Furthermore, it was speculated that arginine corresponds to the 96th cysteine in S. benihana's D-aminoacylase. S. benihana's D-aminoacylase is characterized by the fact that it does not exhibit metal requirement only among the cloned ones. The relationship that there is no metal requirement without the presence of amino acids that are related to metal bonds is very interesting. In the future, it is expected that more detailed functions will be elucidated by conducting site-specific mutations and crystal analysis of actinomycete D-aminoacylase and comparing it with Alcaligenes D-aminoacylase.

[Example 8] Comparison of amino acid sequence with known D-aminoacylase gene
The obtained base sequence was compared with D-aminoacylase (Alcaligenes xylosoxydans A-6, Alcaligenes xylosoxydans DA1) reported to date (Table 1). In addition, it was compared with the putative D-aminoacylase-like gene Streptomyces coelicolor A3 (2), Streptomyces avermitilis MA-4680) and the D-aminoacylase gene of Sebekia benihana IFO14309 cloned by the present inventors. As a result, this gene showed high similarity of 79% and 75% with the genes of Streptomyces coelicolor and Streptomyces avermitilis, which are the same genus of Streptomyces, but low similarity of 34% with the gene from Alcaligenes genus. Met. It showed the lowest similarity of 27% compared with the gene derived from the same actinomycete, Sebekia benihana.

[Example 9] Expression of D-aminoacylase gene in actinomycetes
In order to confirm that this gene is a D-aminoacylase gene, the gene was expressed in Streptomyces lividans TK21 and the productivity of D-aminoacylase was examined.

For expression of this gene, an expression plasmid TD2 was constructed as follows. The actinomycete Phospholipase D gene has a terminator region in addition to the promoter region. When a heterologous gene is expressed using a PLD promoter, it is known that the expression level increases when a terminator is added. Therefore, an attempt was made to link a PLD terminator downstream of this gene. First, the PLD promoter was linked to the KpnI-SphI site of the pUC19 vector, and then this gene amplified by PCR was linked downstream of the promoter at the SphI-HindIII site. Subsequently, a terminator amplification primer was prepared. The terminator amplification primer contains a restriction enzyme HindIII site in both Forward and Reverse. The Reverse primer also contains a KpnI site, so it can be treated with KpnI. The sequences of the terminator amplification primers PTF-H and PTF-R are shown below.
PTF-H (for HindIII site creation): d (AGACAAGCTTCGCTCTGAGACGACTGAGCG) (SEQ ID NO: 8)
PTR-H (for creating HindIII and KpnI): d (AAAGAAGCTTGGTACCCCCTTGGCCGCGA) (SEQ ID NO: 9)
A terminator region of about 300 bp amplified using this primer was ligated downstream of the gene at the HindIII site, and the constructed plasmid was designated as pUCTD2. Next, pUCTD2 was treated with KpnI, the approximately 3.4 kbp promoter to terminator portion was excised, inserted into the KpnI-treated pUC702 vector, and the constructed plasmid was designated as TD2 (FIG. 14). Expression vector TD2 or control vector pUC702 was transformed into Streptomyces lividans TK21 according to the method of Hopwood et al. (DAHopwood, MJBibb, KFChater: Genetic manupulation of Streptomyces., The John Innes Foundation.).

  Centrifugation (8,000 rpm, 1 minute, 4 ° C.) of 1.5 ml of the culture solution of actinomycetes transformants was performed, and the obtained cells were suspended in 0.5 ml of 50 mM Tris-HCl (pH 7.5). After centrifugation again (8,000 × g, 1 minute, 4 ° C), the obtained cells were suspended in 0.5 ml of 50 mM Tris-HCl (pH 7.5) and ultrasonicated with a hand sonicator (Tomy Seiko). Crushing (3 minutes) was performed. The ultrasonic disruption solution was centrifuged (16,000 × g, 10 minutes, 4 ° C.), and the supernatant was used as a crude enzyme solution. The enzyme solution was added to the reaction solution containing N-acetyl-D-methionine, and the produced methionine was quantified by the TNBS method. Enzyme activity was defined as 1 unit (U) as the amount of enzyme that produces 1 μmol of D-methionine per minute from N-acetyl D-methionine.

  The results are shown in Table 2. The amount of D-aminoacylase produced per medium of the enzyme is 55.9 U / L for the transformant having TD2, compared to 2.9 U / L for the D-aminoacylase produced by the parent strain S. thermonitrificans CS5-9. The value was about 19 times (Table 2). From this result, it was confirmed that this gene was a D-aminoacylase gene. No D-aminoacylase activity was observed with pUC702.

It is the figure which compared the position and figure of the gene which exist in the D-aminoacylase gene vicinity from S. coelicolor and S. avermitilis. It is a figure which compares the gene sequence and amino acid sequence of various D-aminoacylases (Alcaligens xylosoxydans A-6, Streptomyces coelicolor, Streptomyces avermitilis). Arrows indicate PCR primer positions. It is a figure which shows the structure of expression plasmid CD1. It is an agarose electrophoresis photograph of the PCR amplification product. It is a figure which shows the construction method of plasmid pUC (T) STDAA. It is a figure regarding Southern hybridization of total DNA of Streptomyces thermonitrificans. (A) It is a figure which shows the DNA fragment part used as a probe with a double-sided arrow. (B) A photograph of a DNA preparation (10 μg) electrophoresed on a 1% agarose gel after cleaving with a restriction enzyme. Lane 1: cut with KpnI, lane 2: cut with PstI, lane 3: cut with SacI, lane M: lambda DNA cut with HindIII (size marker). (C) Further, a photograph of hybridization using a probe labeled with a Sma I-BamH I fragment (0.4 kbp) encoding D-aminoacylase. It is the photograph which carried out the Southern hybridization of the genomic library with the SacI fragment. (A) Agarose electrophoresis, (B) Southern hybridization. Lane 1: 7.8-8.8 kbp, Lane 2: 7.0-8.2 kbp, Lane 3: 6.4-7.0 kbp, Lane M: Lambda DNA (size marker) cut with HindIII. It is a photograph showing colony hybridization of a transformant carrying D-aminoacylase of Streptomyces thermonitrificans CS5-9 strain. It is a photograph of Southern hybridization of the SAC I fragment of plasmid pSAC4. (A): Agarose electrophoresis, (B): Southern hybridization. Lane 1: lambda DNA (size marker) cut with SacI and lane M: HindIII. It is a figure which shows construction of plasmid pSAC4. It is a restriction map of plasmid pSAC4. It is a figure which shows the base sequence and deduced amino acid sequence of D-aminoacylase derived from Streptomyces thermonitrificans CS5-9 strain. It is a figure which compares the amino acid sequence of D-aminoacylase. S. coelicolor A3 (2) (upper), S. thermonitrificans CS5-9 (lower). It is a figure which shows construction of expression plasmid TD2.

Claims (4)

The isolated DNA according to any one of (a) to (d) below.
(A) DNA encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 2
(B) DNA containing the coding region from position 184 to position 1845 of the base sequence set forth in SEQ ID NO: 1
(C) a DNA encoding a protein having an amino acid sequence in which one or more amino acids are substituted, deleted, inserted and / or added in the amino acid sequence shown in SEQ ID NO: 2 and having D-aminoacylase activity
(D) DNA encoding a protein having a sequence identity of 90% or more with the amino acid sequence shown in SEQ ID NO: 2 and having D-aminoacylase activity A vector into which the DNA according to claim 1 is inserted. A transformed cell carrying the DNA according to claim 1 or the vector according to claim 2. A method for producing a thermostable D-aminoacylase, comprising a step of culturing the transformed cell according to claim 3.