JP5155880B2 - Actinomycetes promoter and expression vector - Google Patents

Description

  The present invention relates to a promoter for actinomycetes, an expression vector for actinomycetes having the promoter, and actinomycetes transformed with the expression vector. The present invention also relates to a method for producing a target protein in actinomycetes using these promoters, vectors or transformants.

  Rhodococcus genus actinomycetes are known to produce enzymes involved in the metabolism of nitriles and enzymes that asymmetrically reduce aminoketones (aminoketone asymmetric reductases). In particular, Rhodococcus erythropolis is known to have extremely high aminoketone asymmetric reduction activity. Such actinomycetes and enzymes act on α-aminoketone to produce optically active β-aminoalcohol with high yield and high selectivity (for example, Patent Documents 1 and 2). Therefore, the development of recombinant DNA technology for the purpose of mass production of useful enzymes in actinomycetes, particularly the development of host-vector systems, has been expected for some time.

  However, Escherichia coli, yeast, Bacillus subtilis, etc. are generally used as host microorganisms in the production of recombinants and transformants using recombinant DNA technology, and many expression vectors have been developed. Development of expression vectors and promoters using bacteria as a host has been delayed.

  The present inventors have already developed a novel shuttle vector aimed at high expression of a protein using Rhodococcus actinomycetes as a host (Patent Document 3). These shuttle vectors were derived from Rhodococcus actinomycetes and Escherichia coli, and were confirmed to function in both Rhodococcus actinomycetes and Escherichia coli. However, development of vectors and promoters for high expression of target proteins in actinomycetes including Rhodococcus is still expected.

On the other hand, Non-Patent Document 1 discloses promoters derived from the lactic acid bacteria Lactobacillus plantarum, and these promoters are known to function in lactic acid bacteria and Escherichia coli. However, the use and function of these promoters in actinomycetes are not known.
International Publication WO01 / 73100 Pamphlet International Publication WO02 / 070714 Pamphlet International Publication WO05 / 042739 Pamphlet M.M. Kakikawa et al., Gene, 215, 371-379 (1998)

  The present invention provides a promoter capable of highly expressing a target protein by promoting gene expression in actinomycetes, an expression vector having the promoter, and a transformant introduced with the vector. With the goal. Another object of the present invention is to provide a method for producing a target protein capable of mass-producing the target protein using the above promoter, vector or transformant.

  In order to solve the above-mentioned problems, the present inventors diligently screened a promoter that functions in actinomycetes. As a result, promoters pR and pL derived from lactic acid bacteria Lactobacillus plantarum disclosed in Non-Patent Document 1 function in actinomycetes. And it discovered that it has activity as high as a promoter derived from actinomycetes, and came to complete this invention.

  That is, according to the present invention, there is provided a promoter for actinomycetes having the base sequence described in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4. The base sequences described in SEQ ID NOs: 1 and 2 are complementary to each other, and contain promoters pR and pL regions derived from lactic acid bacteria Lactobacillus plantarum, respectively. The base sequence described in base sequence 3 is a pR promoter region derived from lactic acid bacteria Lactobacillus plantarum, and the base sequence described in base sequence 4 is a pL promoter region derived from lactic acid bacteria Lactobacillus plantarum. A base sequence containing these base sequences can function as a promoter in actinomycetes. According to the promoter of the present invention, a target gene and a target protein can be highly expressed in actinomycetes.

  The promoter for actinomycetes is preferably used as a promoter for Rhodococcus actinomycetes, Mycobacterium actinomycetes, Gordonia actinomycetes, Dietha actinomycetes or Amycolatopsis actinomycetes.

  Moreover, according to the present invention, an expression vector for actinomycetes having any of the above promoters is provided. According to the expression vector of the present invention, a target gene and a target protein can be highly expressed in actinomycetes.

  In addition, according to the present invention, actinomycetes transformed with the above expression vector are provided. According to the transformed actinomycetes (transformant) of the present invention, the target gene and the target protein can be highly expressed in the transformant.

  Moreover, according to this invention, the manufacturing method of the target protein using said transformant is provided. According to the method for producing a target protein of the present invention, the target protein can be efficiently mass-produced in the transformant.

  In addition, according to the present invention, a gene encoding a target protein is inserted into an expression vector having any one of the above promoters so that it can be expressed downstream of the promoter to obtain an expression vector capable of expressing the target protein. Obtained by transforming actinomycetes with the obtained expression vector, obtaining a transformant, culturing the obtained transformant in a medium capable of growth, and culturing the above. And a step of purifying the target protein from the transformant. According to the method for producing a target protein of the present invention, the target protein can be efficiently mass-produced in actinomycetes.

  According to the promoter, expression vector or transformant of the present invention, high expression of a target gene or target protein can be realized in actinomycetes, and various useful proteins can be efficiently mass-produced according to the purpose. Such proteins also contribute to various industrial productions. For example, in an enzyme, oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase and the like can be efficiently produced in large quantities. When the target protein is an aminoketone asymmetric reductase, the optically active β-aminoalcohol can be produced with high yield and high selectivity. Moreover, according to the method for producing a target protein of the present invention, the target protein can be efficiently mass-produced in actinomycetes.

  Hereinafter, the present invention will be described according to preferred embodiments.

  In this specification, “for actinomycetes” means functioning in actinomycetes. That is, in the case of a promoter for actinomycetes, when the promoter is introduced into actinomycetes in some form (for example, incorporated into a vector), it promotes the expression of genes located downstream of the promoter in actinomycetes and It means that the protein can be produced. In the case of an actinomycetes expression vector, when the vector is introduced into actinomycetes, it can self-replicate in actinomycetes or be inserted into the actinomycetes genome, and is included in the expression vector. Also means that it can work.

  Here, gene expression refers to both transcription into mRNA and translation of protein from the mRNA. Here, protein expression means that a protein is synthesized as a result of transcription and translation of a gene.

  The 1st promoter of this invention has the base sequence of sequence number 1, It is characterized by the above-mentioned. The base sequence described in SEQ ID NO: 1 is a sequence contained in a phage isolated from lactic acid bacteria Lactobacillus plantarum, and includes a base sequence corresponding to a pR promoter region, a transcription initiation site and a GATAC box that are lactic acid bacteria promoters, respectively. Yes. The present inventors have proved for the first time that a nucleic acid comprising this base sequence functions as a promoter in actinomycetes.

  The first promoter of the present invention is a translation initiation site, translation termination site, transcription initiation site, ribosome binding site, transcription regulatory gene region (repressor, enhancer, etc.) upstream or / and downstream of the base sequence shown in SEQ ID NO: 1. ), A terminator, or a restriction enzyme site for genetic recombination or any other nucleotide sequence that does not inhibit the promoter function. The length of the first promoter of the present invention is 173 bp or more, preferably 173 bp to 500 bp, more preferably 173 bp to 300 bp.

  The first promoter of the present invention may be a synthetic oligonucleotide, or PCR (Polymerase Chain Reaction) using two partially complementary oligonucleotides such as those shown in SEQ ID NOs: 13 and 14, for example. Can be amplified by PCR, or can be amplified by PCR using appropriate templates and primers. Examples of such a template include lactic acid bacteria Lactobacillus plantarum template phage φgle and a plasmid, vector or genome having the base sequence described in SEQ ID NO: 1. Such primers are not particularly limited as long as they can amplify the first promoter, but those skilled in the art can design them as necessary.

  The 2nd promoter of this invention has the base sequence of sequence number 2, It is characterized by the above-mentioned. The base sequence described in SEQ ID NO: 2 is a sequence contained in a phage isolated from the lactic acid bacterium Lactobacillus plantarum, and includes a pL promoter region that is a lactic acid bacterium promoter and a base sequence corresponding to the GATAC box. The present inventors have proved for the first time that a nucleic acid comprising this base sequence functions as a promoter in actinomycetes.

  The second promoter of the present invention is a translation initiation site, translation termination site, transcription initiation site, ribosome binding site, transcription regulatory gene region (repressor, enhancer, etc.) upstream or / and downstream of the base sequence shown in SEQ ID NO: 2. ), A terminator, or a restriction enzyme site for genetic recombination or any other nucleotide sequence that does not inhibit the promoter function. The length of the second promoter of the present invention is 172 bp or more, preferably 172 bp to 500 bp, more preferably 172 bp to 300 bp.

  The second promoter of the present invention may be a synthetic oligonucleotide and amplified by PCR using two partially complementary oligonucleotides such as those shown in SEQ ID NOs: 13 and 14, for example. Alternatively, it can be amplified by PCR using an appropriate template and primer. Examples of such a template include lactic acid bacteria Lactobacillus plantarum template phage φgle, and a plasmid, vector or genome having the base sequence described in SEQ ID NO: 2. Such primers are not particularly limited as long as they can amplify the second promoter, but can be designed by those skilled in the art as needed.

  The third promoter of the present invention has the base sequence set forth in SEQ ID NO: 3. The base sequence described in SEQ ID NO: 3 is a base sequence corresponding to the pR promoter region contained in a phage isolated from the lactic acid bacterium Lactobacillus plantarum.

  The third promoter of the present invention is a translation initiation site, translation termination site, transcription initiation site, ribosome binding site, transcription regulatory gene region (repressor, enhancer, etc.) upstream or / and downstream of the base sequence shown in SEQ ID NO: 3. ), A terminator, or a restriction enzyme site for genetic recombination or any other nucleotide sequence that does not inhibit the promoter function. Furthermore, the third promoter of the present invention may have one or more bases deleted, substituted or added in the base sequence other than the pR region of the first promoter of the present invention. The length of the third promoter of the present invention is 32 bp or more, preferably 32 bp to 500 bp, more preferably 32 bp to 300 bp.

  The third promoter of the present invention may be a synthetic oligonucleotide, or may be amplified by PCR using appropriate templates and primers as required. Furthermore, the third promoter of the present invention can be obtained by substitution, deletion or addition of one or more bases in the base sequence other than the pR region of the first promoter of the present invention.

  The 4th promoter of this invention has the base sequence of sequence number 4, It is characterized by the above-mentioned. The base sequence described in SEQ ID NO: 4 is a base sequence corresponding to the pL promoter region contained in a phage isolated from the lactic acid bacterium Lactobacillus plantarum.

  The fourth promoter of the present invention is a translation initiation site, translation termination site, transcription initiation site, ribosome binding site, transcription regulatory gene region (repressor, enhancer, etc.) upstream or / and downstream of the base sequence shown in SEQ ID NO: 4. ), A terminator, or a restriction enzyme site for genetic recombination or any other nucleotide sequence that does not inhibit the promoter function. Furthermore, the fourth promoter of the present invention may have one or more bases deleted, substituted or added in the base sequence other than the pL region of the second promoter of the present invention. The length of the fourth promoter of the present invention is 27 bp or more, preferably 27 bp to 500 bp, more preferably 27 bp to 300 bp.

  The fourth promoter of the present invention may be a synthetic oligonucleotide or may be amplified by PCR using appropriate templates and primers as required. Further, the fourth promoter of the present invention can be obtained by substitution, deletion or addition of one or more bases in the base sequence other than the pL region of the second promoter of the present invention.

  The expression vector of the present invention is characterized by having the first, second, third or fourth promoter of the present invention, and can function in a host cell when introduced into an actinomycete host. Here, functioning means that a foreign gene inserted downstream of the promoter can be expressed. In addition, introduction into an actinomycete host means insertion into a host cell genomic gene or presence as a plasmid capable of self-replication outside the host cell chromosome, and the foreign gene persists in the host cell. Resulting in static expression or transient expression.

  When the expression vector of the present invention is inserted into the genome gene of the host cell, the full length of the expression vector may be inserted into the genome gene of the host cell, and for example, at least the promoter region of the present invention and its downstream objective A gene region encoding a protein may be inserted, and a marker region such as a reporter gene may be inserted as necessary. The insertion may be random recombination or homologous recombination targeting a specific position on the genome. In the case of homologous recombination, a sequence having homology with the DNA sequence before, after, or both of the target specific position is introduced before, after, or both of the target region to be inserted into the host genome in the expression vector. It is preferable to do.

  On the other hand, when the expression vector of the present invention is introduced into a host cell and exists as a plasmid capable of self-replication outside the host cell chromosome, the expression vector of the present invention is preferably a self-replicating vector having self-replicating ability. In this case, the number of expression increases by self-replication, and the expression level of the foreign gene can be increased in the host. In order for the expression vector of the present invention to self-replicate in actinomycetes, it comprises at least one DNA replication region and at least one region encoding a protein involved in DNA replication (hereinafter referred to as a DNA replication-related protein coding region). It is preferable.

  Such a DNA replication region and a coding region of a DNA replication-related protein vary depending on the plasmid or the microorganism, but may be any generally known one. For example, in the case of Rhodococcus erythropolis IAM1400-derived pRET1100, the nucleotide sequence of SEQ ID NOs: 19 to 21 has been identified as the DNA replication region, and the coding region of the DNA replication-related protein has been identified as SEQ ID NO: (22-24). ), The base sequence (orf2) described in SEQ ID NO: 25, the base sequence (orf3) described in SEQ ID NOs: 26-37, the base sequence (orf4) described in SEQ ID NOs: 38-42, The base sequence (orf5) described in SEQ ID NOs: 43 to 47, the base sequence (orf6) described in SEQ ID NO: 48 or 49, the base sequence (orf7) described in base sequence 50 or 51, the sequence described in SEQ ID NO: 52 or 53 The base sequence (orf8) is the same as the base sequence (orf9) described in SEQ ID NO: 54 or 55. It has been determined.

  In addition, in the case of pRET1000 derived from Rhodococcus rhodini JCM3203, the DNA replication region has been identified by the nucleotide sequence described in SEQ ID NOs: 56-58, and the DNA replication-related protein coding region is described by SEQ ID NOs: 59-62. Base sequence (orf10), base sequence (orf11) described in SEQ ID NO: 63 or 64, base sequence (orf12) described in SEQ ID NO: 65, base sequence (orf13) described in SEQ ID NO: 66 or 67, SEQ ID NO: 68 To 70, base sequence (orf15) described in SEQ ID NO: 71 or 72, base sequence (orf16) described in SEQ ID NO: 73 or 74, base sequence (orf17) described in SEQ ID NO: 75 , SEQ ID NO: 76-80, nucleotide sequence (orf18), SEQ ID NO: 8 The base sequence (orf19) described in No. 1, the base sequence (orf20) described in SEQ ID NO: 82, and the base sequence (orf21) described in SEQ ID NOs: 83 to 89 have been identified.

  Therefore, when the vector of the present invention is a self-replicating vector, for example, at least one DNA replication region derived from pRET1100 or pRET1000 and at least one coding region (orf) of a DNA replication-related protein derived from pRET1100 or pRET1000. It is preferable to provide.

  The expression vector of the present invention further comprises a gene region (open reading site) encoding a multicloning site necessary for gene recombination, a drug resistance marker gene or reporter gene for selecting a transformant, and other proteins as necessary. Orf), a translation initiation site, a translation termination site, a transcription initiation site, a ribosome binding site, a transcription regulatory gene region (such as a reblessor or enhancer), a terminator, and the like. These are all known in the art. For example, the drug resistance marker gene includes a neomycin resistance gene, a kanamycin resistance gene, and a hygromycin resistance gene. In addition, the reporter gene includes a lacZ gene.

  The expression vector of the present invention can be constructed using a conventional DNA recombination technique based on a known plasmid or vector. For example, by inserting any of the first to fourth promoters of the present invention into a plasmid derived from Rhodococcus actinomycetes such as pRET1000, pRET1100, pRET1200, pRET1300, pRET1400, pRET1500, pRET1600, pRET1700, pRET1800 and pRET0500 can get. These plasmids can be isolated from Rhodococcus erythropolis (IAM1400, IAM1503, JCM2893, JCM2894 and JCM2895), and Rhodococcus rhodini (JCM3203). R.A. erythropolis IAM1400 and IAM1503 are described in “IAM Catalog of Strains, Third Edition, 2004” published by the Institute for Molecular Cell Biology, the University of Tokyo, and can be obtained from the institute. In addition, R.A. erythropolis JCM2893, JCM2894 and JCM2895; rhodini JCM3203 is described in “JCM Catalog of Strains, Eighth Edition 2002” published by RIKEN, and can be obtained from the institute.

  In addition, the expression vector of the present invention includes, for example, a part of a vector for E. coli (preferably a DNA replication region for E. coli and a coding region for a DNA replication-related protein so that the vector can be replicated in E. coli. ) Is preferably included. For example, a shuttle vector of a plasmid derived from actinomycetes and a plasmid or vector for E. coli is preferably used. In this case, sequences that are not related to self-replication and sequences of other unnecessary genes can be cleaved and removed by restriction enzyme treatment or the like. Furthermore, the expression vector of the present invention can be inserted into a host chromosome to produce the target protein.

  The expression vector of the present invention is preferably about 2 kbp or more, more preferably 2 kbp to 20 kbp, and particularly preferably 3 kbp to 10 kbp.

  The transformed actinomycetes (transformants) of the present invention are characterized by being transformed with the expression vector of the present invention. As used herein, “actinomycetes” refers to all microorganisms belonging to actinomycetes, and representative actinomycetes include Rhodococcus, Mycobacterium, Gordonia, Dietzia, or Amycolatopsis microorganisms. It is done.

  Representative genus Rhodococcus (Rhodococcus) actinomycetes, Rhodococcus baikonurensis, Rhodococcus coprophilus, Rhodococcus corynebacterioides, Rhodococcus equi, Rhodococcus erythropolis, Rhodococcus fascians, Rhodococcus globerulus, Rhodococcus gordoniae, Rhodococcus imtechensis, Rhodococcus jostii, Rhodococcus koreensis, Rhodococcus kroppenstedtii, Rhodococcus maanshanensi , Rhodococcus marinonascens, Rhodococcus opacus, Rhodococcus percolatus, Rhodococcus pyridinivorans, Rhodococcus rhodnii, Rhodococcus rhodochrous, Rhodococcus ruber, Rhodococcus triatomae, Rhodococcus tukisamuensis, Rhodococcus wratislaviensis, Rhodococcus yunnanensis, like Rhodococcus zopfii.

  Representative Mycobacterium (Mycobacterium) actinomycetes, Mycobacterium acapulcensis, Mycobacterium agreste, Mycobacterium agri, Mycobacterium aichiense, Mycobacterium alvei, Mycobacterium asiaticum, Mycobacterium aurum, Mycobacterium austroafricanum, Mycobacterium bohemicum, Mycobacterium branderi, Mycobacterium brumae, Mycobacterium celatum , Mycobacterium chelonae, M cobacterium chimaera, Mycobacterium chitae, Mycobacterium chlorophenolicum, Mycobacterium chubuense, Mycobacterium confluentis, Mycobacterium conspicuum, Mycobacterium convolutum, Mycobacterium cookii, Mycobacterium cosmeticum, Mycobacterium diernhoferi, Mycobacterium doricum, Mycobacterium duvalii, Mycobacterium elephantis, Mycobacterium fallax, My obacterium flavescens, Mycobacterium florentinum, Mycobacterium xenopi, Mycobacterium fluoranthenivorans, Mycobacterium fortuitum subsp. acetamidolyticum, Mycobacterium fortuitum subsp. fortuitum, Mycobacterium gadium, Mycobacterium piscium, Mycobacterium gallinarum, Mycobacterium gastri, Mycobacterium gilvum, Mycobacterium goodii, Mycobacterium gordonae, Mycobacterium hassiacum, Mycobacterium hiberniae, Mycobacterium hodleri, Mycobacterium holsaticum, Mycobacterium immunogenum, Mycobacterium intermedium, Mycobacterium intracellular e, Mycobacterium kansasii, Mycobacterium kubicae, Mycobacterium kumamotonense, Mycobacterium lentiflavum, Mycobacterium madagascariense, Mycobacterium mageritense, Mycobacterium malmoense, Mycobacterium marinum, Mycobacterium moriokaense, Mycobacterium mucogenicum, Mycobacterium murale, Mycobacterium neoaurum, Mycobacterium nonchromogenicum, Mycobac erium novum, Mycobacterium obuense, Mycobacterium parafortuitum, Mycobacterium parascrofulaceum, Mycobacterium triviale, Mycobacterium parmense, Mycobacterium peregrinum, Mycobacterium phlei, Mycobacterium porcinum, Mycobacterium poriferae, Mycobacterium psychrotolerans, Mycobacterium pulveris, Mycobacterium rhodesiae, Mycobacterium rhodochrous, Myc bacterium runyonii, Mycobacterium saskatchewanense, Mycobacterium scrofulaceum, Mycobacterium septicum, Mycobacterium shimoidei, Mycobacterium shottsii, Mycobacterium simiae, Mycobacterium smegmatis, Mycobacterium szulgai, Mycobacterium terrae, Mycobacterium thermoresistibile, Mycobacterium tokaiense, Mycobacterium triplex, Mycobacterium tusciae, My obacterium vaccae, Mycobacterium vanbaalenii, Mycobacterium wolinskyi, Mycobacterium abscessus, Mycobacterium avium subsp. avium, Mycobacterium avium subsp. Parabacterculosis, Mycobacterium bovis, Mycobacterium chelonae chemovar niacinogens, Mycobacterium microaffinium, Mycobacterium parafficum, Mycobacterium et al.

  Representative genus Gordonia (Gordonia) actinomycetes, Gordonia aichiensis, Gordonia alkanivorans, Gordonia amarae, Gordonia amicalis, Gordonia araii, Gordonia bronchialis, Gordonia desulfuricans, Gordonia effusa, Gordonia hirsuta, Gordonia hydrophobica, Gordonia jacobaea, Gordonia namibiensis, Gordonia Nitida, Gordonia otitidis, Gordonia paraaffinivorans, Gordonia polyisopreniv rans, Gordonia rhizosphera, Gordonia rubripertincta, ordonia rubropertinctus, Gordonia shandongensis, Gordonia sihwensis, Gordonia sinesedis, Gordonia soli, Gordonia sputi, Gordonia terrae, Gordonia westfalica, Gordonia wrightpattersonensis and the like.

  Representative Dietzia actinomycetes include Dietzia cinnamea, Dietzia kunjamensis, Dietzia mariris, Dietzia natronoliminnaea, Dietzia natronolinomina, Dietzia natronolinomino, etc.

  Representative genus Amycolatopsis (Amycolatopsis) actinomycete, Amycolatopsis alba, Amycolatopsis albidoflavus, Amycolatopsis azurea, Amycolatopsis benzoatilytica, Amycolatopsis coloradensis, Amycolatopsis echigonensis, Amycolatopsis eurytherma, Amycolatopsis fastidiosa, Amycolatopsis halotolerans, Amycolatopsis japonica, Amycolatopsis jejuensis, Amycolatopsis kentuckyensis Amycolatopsis keratiniphila subsp. keratinifila, Amycolatopsis keratinophila subsp. nogabecina, Amycolatopsis lexingtonensis, Amycolatopsis lurida, Amycolatopsis mediterranei, Amycolatopsis methanolica, Amycolatopsis minnesotensis, Amycolatopsis nigrescens, Amycolatopsis niigatensis, Amycolatopsis orientalis, Amycolatopsis orientalis subsp. lurida, Amycolatopsis palatopharyngis, Amycolatopsis plumensis, Amycolatopsis pretoriensis, Amycolatopsis rifamycinica, Amycolatopsis rubida, Amycolatopsis rugosa, Amycolatopsis sacchari, Amycolatopsis sulphurea, Amycolatopsis thermoflava, Amycolatopsis tolypomycina, Amycolatopsis taiwanensis, Amycolatopsis tolypophorus and the like.

  The expression vector can be introduced by a known method such as a calcium phosphate method, a lipofection method, an electroporation method, a microinjection method, or the like.

  The first method for producing a protein of the present invention is characterized by using the above-described transformant of the present invention. First, a vector having a gene encoding a target protein inserted downstream of the promoter of the present invention is introduced into the transformant. Next, by culturing the transformant, the target protein is expressed by the function of the promoter of the present invention, and the target protein can be produced by purifying the protein.

  In the second method for producing a target protein of the present invention, a gene encoding the target protein is inserted into an expression vector having any one of the first to fourth promoters of the present invention so that the gene can be expressed downstream of the promoter. And obtaining an expression vector capable of expressing the target protein, transforming actinomycetes with the obtained expression vector, obtaining a transformant, and culturing the obtained transformant in a medium capable of growth. And a step of purifying the target protein from the transformant obtained in the culturing step.

  The target protein is not particularly limited as long as it can be synthesized in actinomycetes, and examples thereof include various useful enzymes and proteins and peptides having physiological functions. Examples of enzymes include oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase and the like. As described above, the aminoketone asymmetric reductase produced by Rhodococcus erythropolis is particularly preferable because it is very useful for the production of optically active amino alcohols.

  The gene encoding the target protein may be a gene containing an open reading frame (ORF) from the start codon to the stop codon encoding all the amino acid sequences of the target protein, and is a cDNA consisting only of the exon region of the gene. There may be. The length of the gene is not particularly limited, but is preferably 100 bp to 10 kbp, more preferably 300 bp to 4 kbp.

  Insertion so that it can be expressed downstream of a promoter means that a gene encoding a target protein is inserted on the downstream (3 ') side of the promoter and under the control of the promoter.

  In order to obtain an expression vector capable of expressing the target protein, for example, a promoter is first inserted into the vector and then a gene encoding the target protein is further inserted downstream of the promoter so that it can be expressed. There is a method, or a method in which a DNA fragment gene having both a promoter and a gene encoding a target protein is prepared in advance so that it can be expressed, and then inserted into a vector.

  In the former case, for example, a promoter is first amplified by PCR with a primer to which a restriction enzyme site is added, the promoter and vector are treated with restriction enzyme, ligated by a known ligation method, and then a gene encoding the target protein in the same manner. Is inserted. At this time, the insertion position should be designed in advance so as not to shift the gene frame. Moreover, you may perform the process which smooth | blunts the terminal of DNA after a restriction enzyme process depending on the case.

  In the latter case, for example, a gene encoding a target protein is amplified by PCR with a primer containing a base sequence corresponding to a restriction enzyme site and a promoter, and after ligation to a vector by a known ligation method after restriction enzyme treatment. Also at this time, primers should be designed in advance so that the frame of the gene does not shift. Moreover, you may perform the process which smooth | blunts the terminal of DNA after a restriction enzyme process depending on the case.

  Any of the above-mentioned methods such as restriction enzyme treatment, PCR, and ligation can be performed according to the instruction manual using commercially available reagents and kits. If the original vector does not have an appropriate restriction enzyme site, it can be inserted into another vector first, and a necessary portion can be cut out with an appropriate restriction enzyme and then inserted into the target vector. . Such techniques are well known in the art. Moreover, since the expression vector obtained in this step is the same as the expression vector of the present invention described above, the description regarding the vector is omitted here.

  Next is a step of transforming actinomycetes with the obtained expression vector to obtain a transformant. The transformation technique and transformant are as described above.

  The next is a step of culturing the obtained transformant in a medium capable of growth. The medium for culturing the transformant is not particularly limited as long as the microorganism to be used can grow, and a known method can be used. Usually, a liquid medium containing a carbon source, a nitrogen source, and other nutrients is used. . As the carbon source for the medium, any of the above microorganisms can be used. Specifically, sugars such as glucose, fructose, sucrose, dextrin, starch and sorbitol, alcohols such as methanol, ethanol and glycerol, organic acids such as fumaric acid, citric acid, acetic acid and propionic acid and salts thereof, paraffin And the like, or a mixture thereof. As the nitrogen source, any of the above microorganisms can be used. Specifically, ammonium salts of inorganic acids such as ammonium chloride, ammonium sulfate, and ammonium phosphate; ammonium salts of organic acids such as ammonium fumarate and ammonium citrate; nitrates such as sodium nitrate and potassium nitrate; meat extracts, yeast extracts, Inorganic or organic nitrogen-containing compounds such as malt extract and peptone, or a mixture thereof can be used. Moreover, you may add suitably the nutrient sources used for normal culture | cultivation, such as an inorganic salt, trace metal salt, and vitamins, to a culture medium. If necessary, a substance that promotes the growth of microorganisms, a buffer substance that is effective for maintaining the pH of the medium, and the like may be added to the medium.

  The transformant can be cultured under conditions suitable for growth. Specifically, it can be performed at a pH of 3 to 10, preferably 4 to 9, and a temperature of 0 to 50 ° C, preferably 20 to 40 ° C. Microbial culture can be performed under aerobic or anaerobic conditions. The culture time is preferably 10 to 150 hours, but should be appropriately determined according to each microorganism.

  The last is a step of purifying the target protein from the transformant obtained in the culturing step. Although it will not specifically limit as a purification method if the target protein can be acquired, For example, there exist the following methods. First, when the target protein is synthesized and remains in the microbial cell, it is necessary to disrupt the cell. For example, the culture solution of the microbial cells cultured as described above is filtered or centrifuged, and the cells are thoroughly washed with water or a buffer solution. The washed cells are suspended in an appropriate amount of buffer, and the cells are disrupted. Although there is no restriction | limiting in particular as a crushing method, For example, mechanical crushing methods, such as a mortar, a dynomill, a French press, an ultrasonic crusher, are mentioned. Solids are removed by filtration or centrifugation from the resulting microbial disruption solution to obtain a cell-free extract, and the target protein is collected from the extract by a conventional method for protein isolation. Further, when the target protein is synthesized and secreted outside the microbial cell, it is not necessary to disrupt the cell. For example, the culture solution of the microbial cells cultured as described above is filtered or centrifuged to obtain a cell-free culture solution, and the target protein is collected from this culture solution by a conventional method for protein isolation.

  The protein isolation method is not particularly limited, and a known method can be used. For example, salting out such as ammonium sulfate precipitation method; gel filtration method using Sephadex, etc .; having diethylaminoethyl group or carboxymethyl group Ion exchange chromatography using a carrier, etc .; Hydrophobic chromatography using a carrier having a hydrophobic group such as butyl, octyl, phenyl, etc .; Dye gel chromatography; Electrophoresis; Dialysis; It can be purified by filtration method; affinity chromatography method; high performance liquid chromatography method and the like.

  Furthermore, the protein can also be used as an immobilized enzyme. Such a method is not particularly limited, and a known method can be used. Examples include a method in which a protein or a protein-producing cell is immobilized, and includes a carrier binding method such as a covalent bonding method and an adsorption method, a crosslinking method, and a comprehensive method. Can be fixed by law. Moreover, you may use condensing agents, such as glutaraldehyde, hexamethylene diisocyanate, and hexamethylene diisothiocyanate, as needed. Other immobilization methods include, for example, a monomer method in which a monomer is gelled by a polymerization reaction; a prepolymer method in which a molecule larger than a normal monomer is polymerized; a polymer method in which a polymer is gelled; Examples include immobilization using acrylamide; immobilization using a natural polymer such as alginic acid, collagen, gelatin, agar, and κ-carrageenan; and immobilization using a synthetic polymer such as a photocurable resin and a urethane polymer.

  The target protein thus purified is judged to be sufficiently purified if a single band is confirmed by electrophoresis (SDS-PAGE or the like).

  EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, but these examples do not limit the technical scope of the present invention. The restriction enzymes used in all Examples are products of “Toyobo Co., Ltd.” unless otherwise specified. Reagents other than restriction enzymes are those of “Wako Pure Chemical Industries, Ltd.” unless otherwise specified. It is a product.

(Example 1) Construction of a shuttle vector of a part of a plasmid derived from Rhodococcus actinomycetes and a part of pHSG299 A plasmid derived from Rhodococcus erythropolis IAM1400 was purified. Rhodococcus erythropolis IAM1400 (distributed from Cell Function Information Center, the University of Tokyo) is inoculated into 5 mL of GPY (containing 1% glucose, 0.5% bactopeptone and 0.3% yeast extract). And cultured with shaking at 25 ° C. In the logarithmic growth phase, 250 μL of a 100 mg / mL ampicillin solution was added, and further cultured with shaking at 25 ° C. for 2 hours.

  The culture solution is centrifuged at 12,000 rpm for 5 minutes, the supernatant is removed, the bacteria are suspended in 1 mL of 50 mM Tris.HCl (pH 7.5), and the supernatant is centrifuged at 12,000 rpm for 5 minutes. Removed. 250 μL of 10 mg / mL lysozyme solution dissolved in TE (containing 10 mM Tris.HCl (pH 7.5) and 1 mM EDTA (Dojindo Laboratories)) was added and suspended, and the mixture was allowed to stand at 37 ° C. for 30 minutes. After standing, 100 μL of 3M NaCl and 25 μL of 10% SDS were added and left at −20 ° C. overnight.

  Thereafter, the mixture was centrifuged at 12,000 rpm for 5 minutes, 0.5 μL each of 50 μg / mL Proteinase K (Qiagen) and 50 μg / mL RNase A (Qiagen) was added to the supernatant, and the mixture was allowed to stand at 37 ° C. for 15 minutes. A phenol / chloroform / isoamyl alcohol solution was added. After centrifuging at 12,000 rpm for 5 minutes, 300 μL of the supernatant was taken, 750 μL of ethanol was added, centrifuged at 12,000 rpm for 5 minutes, and the precipitate was dissolved in 50 μL of sterile water.

  Plasmid DNA was purified from this solution using GFX ™ PCR DNA and Gel Band Purification Kit (GE Healthcare Bioscience). The obtained plasmid DNA was a mixture of pRET1100 (5444 bp) and pRET1200 (5421 bp) disclosed in International Publication WO05 / 042739.

  The plasmid DNA mixture obtained above was digested with Alw44 I at 37 ° C. for 2 hours, and then blunt-ended using Blunting high (Toyobo) to obtain a DNA fragment derived from pRET1100. DNA obtained by digesting this DNA fragment and pHSG299 (Takara Bio) with Hinc II at 37 ° C. for 2 hours, adding a phenol / chloroform / isoamyl alcohol solution as described above, and precipitating with ethanol The fragments were ligated using Ligation high (Toyobo).

  Thereafter, the ligation product was transformed into E. coli using Competent high (Toyobo). E. coli DH5α was transformed. The obtained transformed Escherichia coli was treated with 30 μL of 0.1 M IPTG (isopropyl-β-galactoside) and 30 μL of 4% X-gal (5-bromo-4-chloro-3-intol-β) on a petri dish having a diameter of 90 mm. -LB (1% tryptone, 0.5% yeast extract and 1% sodium chloride; pH 7.2) coated with D-galactopyranoside) and containing 100 μg / mL kanamycin And left at 30 ° C. for 60 hours.

  Among the appearing colonies, a white colony was inoculated into an LB liquid medium containing 100 μg / mL kanamycin, and cultured with shaking at 30 ° C. for 60 hours. Vector DNA was refine | purified using Labo Pass (trademark) Mini (Hokkaido system science) for the obtained culture solution. The obtained vector DNA was confirmed by 0.8% agarose gel electrophoresis (Nacalai Tesque). This vector was named pRET1102.

  Separately from the above, plasmid DNA isolated and purified from Rhodococcus erythropolis IAM1400 was digested with BspLU 11I (Roche Diagnostics) at 48 ° C. for 2 hours, and then blunt-ended using Blunting high to obtain DNA derived from pRET1200. A fragment was obtained. This DNA fragment and a DNA fragment obtained by digesting pHSG299 with Hinc II at 37 ° C. for 2 hours were ligated using Ligation high.

  The ligation product was transformed into E. coli using Competent high. E. coli DH5α was transformed. The obtained transformed Escherichia coli was plated on an LB agar medium coated with 30 μL of 0.1 M IPTG and 30 μL of 4% X-gal on a petri dish having a diameter of 90 mm and containing 100 μg / mL kanamycin. It was left at 60 ° C. for 60 hours.

  Among the appearing colonies, a white colony was inoculated into an LB liquid medium containing 100 μg / mL kanamycin, and cultured with shaking at 30 ° C. for 60 hours. Vector DNA was refine | purified using Labo Pass (trademark) Mini for the obtained culture solution. The obtained vector DNA was confirmed by subjecting to 0.8% agarose gel electrophoresis. This vector was named pRET1202.

(Example 2) Size reduction of pRET1102 and pRET1202 After digesting pRET1102 obtained in Example 1 with BamHI and HincII at 37 ° C for 2 hours, it was subjected to 0.8% agarose gel electrophoresis, and GFX ( (Trademark) It refine | purified using PCR DNA and Gel Band Purification Kit, The DNA fragment of about 2.7 kbp was obtained. At this time, as a size marker, Loading Quick DNA size Markerλ / EcoR I + Hind III double digest (Toyobo) was used.

  This DNA fragment and pHSG299 were digested with BamH I and Hinc II at 37 ° C. for 2 hours, then subjected to 0.8% agarose gel electrophoresis and purified using GFX ™ PCR DNA and Gel Band Purification Kit. The DNA fragment of .7 kbp was ligated using Ligation high.

  The ligation product was transformed into E. coli using Competent high. E. coli JM109 was transformed. The obtained transformed Escherichia coli was plated on an LB agar medium coated with 30 μL of 0.1 M IPTG and 30 μL of 4% X-gal on a petri dish having a diameter of 90 mm and containing 100 μg / mL kanamycin. It was left at 60 ° C. for 60 hours.

  Among the formed colonies, white colonies were inoculated into an LB liquid medium containing 100 μg / mL kanamycin and cultured with shaking at 30 ° C. for 60 hours. Vector DNA was refine | purified using Labo Pass (trademark) Mini for the obtained culture solution. The obtained vector DNA was subjected to 0.8% agarose gel electrophoresis and confirmed.

  This vector was digested with Pst I for 2 hours, blunt-ended using Blunting high, and ligated using Ligation high. The ligation product was transformed into E. coli using Competent high. E. coli JM109 was transformed, plated on LB agar medium containing 100 μg / mL kanamycin, and allowed to stand at 30 ° C. for 36 hours.

  The formed colonies were inoculated into an LB liquid medium containing 100 μg / mL kanamycin and cultured at 30 ° C. for 24 hours, and then the vector DNA was purified using Labo Pass ™ Mini. The obtained vector DNA was subjected to 0.8% agarose gel electrophoresis and confirmed. This vector was named pRET1132. The pRET1132 was digested with PstI for 1 hour and then subjected to 0.8% agarose gel electrophoresis. As a result, it was confirmed that pRET1132 was not cleaved by PstI.

  In addition, pRET1202 obtained in Example 1 was digested with EcoR I and Dra III (Roche Diagnostics) for 2 hours, then blunted using Blunting high, and subjected to 0.8% agarose gel electrophoresis. Then, purification was performed using GFX ™ PCR DNA and Gel Band Purification Kit to obtain a DNA fragment of about 3.7 kbp. At this time, as a size marker, Loading Quick DNA size Markerλ / EcoR I + Hind III double digest was used.

  This DNA fragment and pHSG299 were digested with BamH I and Hinc II for 2 hours, then subjected to 0.8% agarose gel electrophoresis and purified using GFX ™ PCR DNA and Gel Band Purification Kit. The DNA fragment of 7 kbp was ligated using Ligation high.

  The ligation product was transformed into E. coli using Competent high. The gene was introduced into E. coli JM109. The obtained transformed Escherichia coli was plated on an LB agar medium coated with 30 μL of 0.1 M IPTG and 30 μL of 4% X-gal on a petri dish having a diameter of 90 mm and containing 100 μg / mL kanamycin. It was left at 60 ° C. for 60 hours.

  Among the appearing colonies, white colonies were inoculated into an LB liquid medium containing 100 μg / mL kanamycin, and cultured with shaking at 30 ° C. for 60 hours. Vector DNA was refine | purified using Labo Pass (trademark) Mini for the obtained culture solution. When this vector was digested with Sac I, BamH I, Pst I or EcoR I for 2 hours to confirm the vector, it was found that the region derived from Rhodococcus sp. This vector was named pRET1204 (approximately 5.9 kbp).

(Example 3) Construction of an expression vector into which an aminoketone asymmetric reductase gene is inserted-1
Rhodococcus erythropolis MAK-34 (National Institute of Advanced Industrial Science and Technology, National Institute of Advanced Industrial Science and Technology (now the National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center (IPOD)); No. 1 Center No. 6) Accession number: FERM BP-7451; consigned on February 15, 2001) was inoculated into 5 mL of GPY medium and cultured with shaking at 30 ° C. for 48 hours, and then the culture solution was added with 100 mL of GPY The medium was transplanted and cultured at 30 ° C. for 10 hours at 200 rpm. The culture solution was purified using Genomic DNA Buffer set (Qiagen) and Genomic-tip 500 / g (Qiagen) to obtain genomic DNA.

  Using the obtained genomic DNA as a template, a base sequence corresponding to an aminoketone asymmetric reductase gene (mak gene) was amplified by PCR. MAKF1 (sense): 5′-GAATCTCTCCGTTGATGCAGACATCAGGTC-3 ′ (SEQ ID NO: 5) and MAKR2 (antisense): 5′-CTGACTCCGTTAGTTCTGCCCAGTTC-3 ′ (SEQ ID NO: 6) were used as primers, and KOD- Plus- (Toyobo Co., Ltd.) reaction conditions were as follows: denaturation of template DNA at 94 ° C for 2 minutes, annealing at 68 ° C for 30 seconds, extension reaction at 68 ° C for 1 minute 50 seconds, 30 cycles Went.

  The PCR product was treated with phenol / chloroform and precipitated with ethanol, mixed with pUC18 (about 2.7 kbp; Takara Bio) digested with Sma I at 30 ° C. for 2 hours, and ligated using Ligation high. The obtained ligation product was transformed into E. coli using Competent high. E. coli DH5α was transformed, and the resulting transformed Escherichia coli was coated with 30 μL of 0.1 M IPTG and 30 μL of 4% X-gal on a petri dish having a diameter of 90 mm, and LB agar containing 100 μg / mL kanamycin The plate was plated on the medium and left at 30 ° C. for 60 hours.

  White colonies were selected from the appearing colonies, and cultured with shaking in an LB liquid medium containing 100 μg / mL ampicillin at 30 ° C. for 60 hours. Vector DNA was refine | purified using Labo Pass (trademark) Mini for the obtained culture solution. This vector was confirmed by subjecting it to 0.8% agarose gel electrophoresis.

  Next, PCR was further performed using the expression vector obtained above as a template. MAKPstF (sense): 5′-GACCACTGCAGATCAATCAACTCTGATGGAGTCC-3 ′ (SEQ ID NO: 7) and MAKHisBglIIR (antisense): 5′-CGCTTAGATCTCAGTTCGCCGGACGCC-3 ′ (SEQ ID NO: 8) are used as the primers, and OD is s. -Was used for denaturation of template DNA at 94 ° C for 2 minutes, and 30 cycles were performed at 68 ° C for 30 seconds and annealing at 68 ° C for 1 minute 50 seconds.

  The obtained DNA fragment was digested with Bgl II at 37 ° C. for 2 hours, then subjected to 1.5% agarose gel electrophoresis, and purified using GFX ™ PCR DNA and Gel Band Purification Kit (about 0 .8 kbp). This DNA fragment and pQE70 (Qiagen) were digested with Sph I at 37 ° C. for 2 hours, then blunted with Blunting high, and further digested with Bgl II at 37 ° C. for 2 hours and then 0.8% The DNA fragment obtained by agarose gel electrophoresis and purified using GFX ™ PCR DNA and Gel Band Purification Kit was ligated using Ligation high.

  The ligation product obtained was E. coli using Competent high. E. coli DH5α was transformed. The obtained transformed Escherichia coli was plated on an LB agar medium containing 100 μg / mL ampicillin and allowed to stand at 30 ° C. for 60 hours.

  The formed colonies were cultured with shaking in an LB liquid medium containing 100 μg / mL ampicillin at 30 ° C. for 60 hours. The vector DNA was purified from the culture solution using Labo Pass (trademark) Mini. The obtained vector DNA was digested with Bgl II at 37 ° C. for 2 hours and subjected to 0.8% agarose gel electrophoresis. As a result, the total length was about 4.2 kbp, and the target multicloning site of pQE70 was obtained. It was confirmed that the expression vector had the mak gene inserted therein. At this time, as a size marker, Loading Quick DNA size Markerλ / EcoR I + Hind III double digest and pQE70 were used. This expression vector was named pMAK8417-2.

  In addition, a part of the sequence derived from pRET1200 was amplified by PCR using pRET1204 as a template. P1204rep-Ec2958 (sense): 5′-CGCGGAATTCGACACCACCACGCACGCACACCCGCA-3 ′ (SEQ ID NO: 9) and P1200rep-Pst5195 (antisense): 5′-AGCCGCTGCAGAAGCAACACCGCCATCCGCCCATTG-3 ′ (polymerase number 10) The template DNA was denatured using KOD-plus- at 94 ° C. for 2 minutes, followed by 30 cycles of annealing at 60 ° C. for 30 seconds and extension reaction at 68 ° C. for 50 seconds.

  After the PCR reaction, the DNA fragment was purified using GFX ™ PCR DNA and Gel Band Purification Kit, digested with restriction enzymes EcoR I and Pst I for 2 hours, and then subjected to 1.6% agarose gel electrophoresis. Was purified using GFX ™ PCR DNA and Gel Band Purification Kit. The obtained DNA fragment (about 0.6 kbp) and pMAK8417-2 were digested with EcoR I and Pst I at 37 ° C. for 2 hours, then subjected to 0.8% agarose gel electrophoresis, and GFX ™ PCR A DNA fragment (about 4.2 kbp) purified using DNA and Gel Band Purification Kit was ligated using Ligation high.

  The ligation product was transformed into E. coli using Competent high. E. coli DH5α was transformed. The obtained transformed Escherichia coli was plated on an LB agar medium containing 100 μg / mL ampicillin and left at 30 ° C. for 60 hours.

  The formed colonies were cultured with shaking in an LB liquid medium containing 100 μg / mL ampicillin at 30 ° C. for 60 hours. The culture solution was DNA purified using Labo Pass ™ Mini, digested with EcoR I at 37 ° C. for 2 hours, and confirmed by 0.8% agarose gel electrophoresis. As a result, the promoter derived from the target pRET1200 was obtained. It was an expression vector (about 4.8 kbp) in which the mak gene was inserted downstream.

  Using the obtained vector as a template, a promoter derived from pRET1200 and a portion of the downstream mak gene were amplified by PCR. As primers, pQE70F1 (sense): 5′-GGCGTATCACGAGGCCCTTTCGTCTCACCACC-3 ′ (SEQ ID NO: 11), and pQE70R1135Bm (antisense): 5′-GGTTGGATCCGTCATCACCGAAACGCGCGAGGCs-3 ′ (sequence number: p) -Was used to denature the template DNA at 94 ° C. for 2 minutes, and then 30 cycles were performed at 60 ° C. for 30 seconds and annealing at 68 ° C. for 3 minutes.

  The obtained PCR product was purified using GFX ™ PCR DNA and Gel Band Purification Kit, the product was digested with EcoR I and BamHI for 2 hours, and then subjected to 0.8% agarose gel electrophoresis to obtain a DNA fragment. Was purified using GFX ™ PCR DNA and Gel Band Purification Kit. This DNA fragment (about 2.4 kbp) and a DNA fragment (about 5.3 kbp) obtained by digesting pRET1132 with EcoR I and BamH I for 2 hours were subjected to 0.8% agarose gel electrophoresis, and GFX ™ PCR DNA and The DNA fragment purified using Gel Band Purification Kit was ligated using Ligation high.

  The ligation product was transformed into E. coli using Competent high. E. coli JM109 was transformed, and the resulting transformed Escherichia coli was plated on an LB agar medium containing 100 μg / mL kanamycin and left at 30 ° C. for 60 hours.

  The obtained colonies were cultured in an LB liquid medium containing 100 μg / mL kanamycin, and then the vector DNA was purified using Labo Pass ™ Mini and confirmed by 0.8% agarose gel electrophoresis. At that time, as a size marker, Loading Quick DNA size Markerλ / EcoR I + Hind III double digest was used. The obtained vector DNA was digested with EcoR I at 37 ° C. for 2 hours and then confirmed by 0.8% agarose gel electrophoresis. As a result, the promoter derived from pRET1200 and the mak gene located downstream thereof were obtained. It was confirmed to be a vector (about 7.7 kbp). This vector was named pRET1138.

(Example 4) Construction of an expression vector into which an aminoketone asymmetric reductase gene is inserted-2
A synthetic oligonucleotide PTRtF: 5'-CAATAAGTCACTCACGCTTCATTTTTGCACCTCCAATTCCGATACATATCGTATCAACAATTATTATAATAAACGATACTTTAAGTATCGTCAAGTGTTT-3: Use '(SEQ ID NO: 13), and PTRtR 5'-TTAATGGATATTATATGTATCAGTATAGATACATTGTGTATCGGTTTCAATCAATGATACAAAAAGTTTCTAAAAACACTTGACGATACTTAAAGTATCG-3' (SEQ ID NO: 14), using KOD-plus-, 94 ° C. After denaturation of template DNA in 2 minutes, annealing is performed at 50 ° C. for 30 seconds, extension reaction is performed at 68 ° C. for 10 seconds, and 5 cycles of PCR. Reaction was performed.

  PCR was further performed using a part of the PCR reaction solution as a template. As a primer, PTRRPst-F: 5′-TGATCTGCAGCAATAAAGTCACTCACGCTTCATTTT-3 ′ (SEQ ID NO: 15) and PTRREco-R: 5′-TGGAGAATTCTTAATGAMATATTATATGTATCAGTA-3 ′ (SEQ ID NO: 16) were used, and s-KODp was used as the polymerase. Then, after denaturation of the template DNA at 94 ° C. for 2 minutes, PCR reaction was carried out at 30 cycles of annealing at 50 ° C. for 30 seconds and extension reaction at 68 ° C. for 10 seconds.

  The PCR product was subjected to 2.0% agarose gel electrophoresis, and the DNA fragment was purified using GFX ™ PCR DNA and Gel Band Purification Kit. The purified DNA fragment was digested with EcoR I and Pst I for 2 hours and then subjected to 2.0% agarose gel electrophoresis, and the approximately 0.2 kbp DNA fragment was purified using GFX ™ PCR DNA and Gel Band Purification Kit. did. At this time, 100 bp DNA Ladder (Toyobo) was used as a size marker.

  The obtained DNA fragment and pMAK8417-2 were digested with EcoR I and Pst I at 37 ° C. for 2 hours, then subjected to 0.8% agarose gel electrophoresis, and GFX ™ PCR DNA and Gel Band Purification Kit. The DNA fragment (about 4.2 kbp) purified using was ligated using Ligation high.

  The ligation product was transformed into E. coli using Competent high. E. coli DH5α was transformed. The transformed E. coli was plated on an LB agar medium containing 100 μg / mL ampicillin and left at 30 ° C. for 60 hours.

  The formed colonies were cultured with shaking in LB liquid medium containing 100 μg / mL ampicillin at 30 ° C. for 60 hours. The culture broth was purified by vector DNA using Labo Pass (trademark) Mini (Hokkaido System Science) and confirmed by 0.8% agarose gel electrophoresis (about 4.4 kbp). Further, the purified vector DNA was digested with EcoR I and Pst I for 2 hours, and a DNA fragment of about 0.2 kbp was confirmed by 2% agarose gel electrophoresis. As a result of analyzing the gene sequence of this DNA fragment, SEQ ID NO: 1 It was the base sequence described in. This expression vector was named pMAK8417-17.

  Using pMAK8417-17 as a template, pQE70F1: 5′-GGCGTATCACGAGGCCCTTTCGTCTTTCACC-3 ′ (SEQ ID NO: 15) and pQE70R1135Bm: 5′-GGTTGGATCCGTCATCACCGAAACGCGCGAGGCAG-3 ′ (SEQ ID NO: 16) After denaturation of the template DNA at 2 ° C. for 2 minutes, the PCR reaction was performed in 30 cycles of annealing at 60 ° C. for 30 seconds and extension reaction at 68 ° C. for 3 minutes.

  The PCR reaction solution was purified using GFX ™ PCR DNA and Gel Band Purification Kit, the purified PCR product was digested with EcoR I and BamHI for 2 hours, and then subjected to 0.8% agarose gel electrophoresis to obtain a DNA fragment. Was purified using GFX ™ PCR DNA and Gel Band Purification Kit. This DNA fragment (about 2 kbp) and a DNA fragment obtained by digesting pRET1132 with EcoR I and BamHI for 2 hours were subjected to 0.8% agarose gel electrophoresis and purified using GFX ™ PCR DNA and Gel Band Purification Kit. The DNA fragment (about 5.3 kbp) was mixed and ligated using Ligation high, and then E. coli using Competent high. E. coli JM109 was transformed and plated on LB agar medium containing 100 μg / mL kanamycin. The obtained colony was cultured in an LB liquid medium containing 100 μg / mL kanamycin, and then the vector DNA was purified using Labo Pass (trademark) Mini, and described in SEQ ID NO: 1 intended for 0.8% agarose gel electrophoresis. And a vector having a mak gene located downstream thereof. At that time, as a size marker, Loading Quick DNA size Markerλ / EcoR I + Hind III double digest and pRET1132 were used. The vector obtained here was named pRET1137 (about 7.3 kbp).

(Example 5) Construction of an expression vector into which an aminoketone asymmetric reductase gene is inserted-3
A synthetic oligonucleotide PTRtF: 5'-CAATAAGTCACTCACGCTTCATTTTTGCACCTCCAATTCCGATACATATCGTATCAACAATTATTATAATAAACGATACTTTAAGTATCGTCAAGTGTTT-3: Use '(SEQ ID NO: 13), and PTRtR 5'-TTAATGGATATTATATGTATCAGTATAGATACATTGTGTATCGGTTTCAATCAATGATACAAAAAGTTTCTAAAAACACTTGACGATACTTAAAGTATCG-3' (SEQ ID NO: 14), using KOD-plus-, 94 ° C. After denaturation of the template DNA in 2 minutes, annealing was performed at 50 ° C. for 30 seconds, and extension reaction was performed at 68 ° C. for 10 seconds in 5 cycles. R reaction was performed.

  PTRLEco-F (sense): 5'-AGACGAATTCAATAAGTCCGCTCAGCCTTCATTTTTT-3 '(SEQ ID NO: 17) and PTRLPst-R (antisense): 5'-AGACTGCAGTATATGATATTATAGTTATCAGTA-3' (sequence number) ) As a primer, PCR reaction was performed in 30 cycles using KOD-plus-, annealing at 50 ° C. for 30 seconds and extension reaction at 68 ° C. for 10 seconds.

  The PCR product was subjected to 2.0% agarose gel electrophoresis, and the DNA fragment was purified using GFX ™ PCR DNA and Gel Band Purification Kit. The purified PCR product was digested with EcoR I and Pst I for 2 hours, then subjected to 2.0% agarose gel electrophoresis, and a DNA fragment of about 0.2 kbp was purified using GFX ™ PCR DNA and Gel Band Purification Kit. did. At this time, 100 bp DNA Ladder was used as a size marker.

  The obtained DNA fragment and pMAK8417-2 were digested with EcoR I and Pst I at 37 ° C. for 2 hours, then subjected to 0.8% agarose gel electrophoresis, and GFX ™ PCR DNA and Gel Band Purification Kit. The DNA fragment (about 0.2 kbp) purified using was ligated using Ligation high.

  The ligation product was transformed into E. coli using Competent high. E. coli DH5α was transformed. The transformed E. coli was plated on an LB agar medium containing 100 μg / mL ampicillin and left at 30 ° C. for 60 hours. The formed colonies were cultured with shaking in LB liquid medium containing 100 μg / mL ampicillin at 30 ° C. for 60 hours.

  The culture solution was DNA purified using Labo Pass ™ Mini and confirmed by 0.8% agarose gel electrophoresis. Furthermore, the purified vector DNA was digested with EcoR I and Pst I at 37 ° C. for 2 hours, and a DNA fragment of about 0.2 kbp was confirmed by 2% agarose gel electrophoresis, and the gene sequence of this DNA fragment was analyzed. It was confirmed that the base sequence described in No. 2 was included. This expression vector was named pMAK8417-18.

  After digesting and purifying pMAK8417-18 with EcoR I at 37 ° C. for 2 hours and then digesting with Hind III at 37 ° C. for 2 hours, the DNA fragment was subjected to 1.0% agarose gel electrophoresis, and the DNA fragment of about 1.0 kbp was converted into GFX (trademark). ) Purified using PCR DNA and Gel Band Purification Kit. At that time, as a size marker, Loading Quick DNA size Markerλ / EcoR I + Hind III double digest was used.

  The purified DNA fragment was made blunt with Blunting high, and this DNA fragment and pRET1102 were digested with Hinc II at 37 ° C. for 2 hours, and then purified using GFX ™ PCR DNA and Gel Band Purification Kit (about 8 0.1 kbp) and ligated using Ligation high.

  The ligation product was transformed into E. coli using Competent high. E. coli JM109 was transformed, and the resulting transformed Escherichia coli was plated on an LB agar medium containing 100 μg / mL kanamycin. The obtained colony was cultured in an LB liquid medium containing 100 μg / mL kanamycin, and then the vector DNA was purified using Labo Pass ™ Mini. When this vector DNA was confirmed by 0.8% agarose gel electrophoresis, it was confirmed that it was an expression vector having the intended base sequence of SEQ ID NO: 2 and the mak gene located downstream thereof. At that time, as a size marker, Loading Quick DNA size Markerλ / EcoR I + Hind III double digest and pRET1102 were used. This vector was named pRET1122 (approximately 9.1 kbp).

Example 6 Measurement of activity of a predetermined promoter in E. coli The activity of a promoter was measured by measuring the activity of an aminoketone asymmetric reductase. The pRET1137 and pRET1138 obtained above were transformed into E. coli using Competent high. E. coli JM109 was transformed, and the resulting transformed Escherichia coli was plated on an LB agar medium containing 100 μg / mL kanamycin. After standing at 30 ° C. for 24 hours, the obtained colonies were inoculated into 5 mL of LB liquid medium containing 100 μg / mL kanamycin and cultured at 30 ° C. for 24 hours. The culture solution was inoculated into 100 mL of LB liquid medium containing 100 μg / mL kanamycin and cultured at 30 ° C. for 24 hours. The obtained culture solution was centrifuged at 12,000 rpm for 5 minutes at 4 ° C., the supernatant was removed, and the obtained bacterial cells were used for the measurement of reductase activity.

  Activity measurement is performed according to O.D. D. = 5 in a reaction solution containing 3% EAM (2-Ethylamino-1-phenyl-propan-1-one) containing 2% glucose and 0.2 M sodium phosphate buffer (pH 6.0) It was. In addition, the synthesis | combination of EAM was performed by the method described in the literature of "J.Am.Chem.Soc., (1928) 50, P2287-2292". After the reaction solution was shaken at 30 ° C. for 16 hours to react, the bacterial cell reaction solution was centrifuged at 12,000 rpm for 5 minutes, and the supernatant was subjected to HPLC (High Performance Liquid Chromatography LC-2010C; Shimadzu Corporation). The analytical column is Inertsil Ph-3 3.0 × 75 mm (GL Science), the column temperature is 40 ° C., the eluent is a 7% acetonitrile solution containing 0.05 M sodium phosphate buffer (pH 6.0), and the detection wavelength is 220 nm. I went there.

  As a result of measuring the reductase activity, E. coli containing pRET1137 E. coli JM109 is 60 μg / h / O. D. That retains pRET1138. E. coli JM109 could not detect activity. pRET1138 contains a promoter region from Rhodococcus actinomycetes but was found not to function in E. coli.

(Example 7) Measurement of activity of a predetermined promoter in Rhodococcus erythpolis The erythropolis MAK-34 strain was inoculated and cultured with shaking at 30 ° C. for 36 hours. 1 mL of the culture solution was inoculated into 100 mL of LB medium and cultured at 30 ° C. for 10 hours at 200 rpm. The cultured cells were collected by centrifugation (12 krpm, 5 minutes, 4 ° C.), and the collected cells were washed twice with ultrapure water (millQ; Nihon Millipore). The washed cells were collected by centrifugation (12 krpm, 5 minutes, 4 ° C.) and suspended in 2.4 mL of 10% glycerol solution. 300 μL of the suspension was dispensed and frozen at −80 ° C. to obtain competent cells.

  90 μL of the prepared competent cell and 5 μL of plasmid DNA of pRET1102, pRET1122, pRET1137 or pRET1138 prepared with Labo Pass ™ Mini were mixed on ice. The mixed solution was gently poured into a 0.1 cm cuvette (Nippon Bio-Rad Laboratories) cooled on ice and set in a Gene Pulser II Electrophoresis System (Nippon Bio-Rad Laboratories). Pulsed at 20 kV / cm, 400Ω, 25 μF, immediately added 300 μL of LB medium, and left at 25 ° C. for 3 hours. A part of the suspension was plated on an LB agar medium containing 100 μg / mL kanamycin and left at 30 ° C. for 72 hours.

  The formed colonies were inoculated into 5 mL of LB liquid medium and cultured at 30 ° C. for 72 hours. The culture solution was centrifuged at 12,000 rpm for 5 minutes at 4 ° C., the supernatant was removed, and the obtained bacterial cells were used for measurement of reductase activity.

  Activity measurement is performed according to O.D. D. = 5 The amount of bacteria was 5%, and the reaction was performed in a 3% EAM reaction solution containing 0.2M sodium phosphate buffer (pH 6.0). After the reaction solution was shaken at 30 ° C. for 16 hours, the bacterial cell reaction solution was centrifuged at 12,000 rpm for 5 minutes, and the supernatant was subjected to HPLC. The analytical column was Inertsil Ph-3 3.0 × 75 mm, the column temperature was 40 ° C., the eluent was a 7% acetonitrile solution containing 0.05 M sodium phosphate buffer (pH 6.0), and the detection wavelength was 220 nm.

  As a result of measuring the EAM reaction, R. erythropolis MAK-34 is 0.2 μg / h / O. D. R. holding pRET1122. erythropolis MAK-34 is 10 μg / h / O. D. Which retains pRET1137. erythropolis MAK-34 is 20 μg / h / O. D. Which retains pRET1138 activity. erythropolis MAK-34 is 20 μg / h / O. D. Activity. pRET1122 and pRET1137 contain a promoter derived from lactic acid bacteria. It was confirmed that the aminoketone asymmetric reductase was highly expressed in erythropolis. The activity of the promoter was equivalent to that of pRET1138 containing a promoter derived from Rhodococcus actinomycetes.

(Example 8) Amycolatopsis LB liquid medium activity measurement 5mL given promoter in actinomycetes non Rhodococcus erythropolis methanolica NBRC 15065, Dietzia maris NBRC 15801, Rhodococcus globerulus NBRC 14531, Rhodococcus rhodochrous NBRC 15564, Rhodococcus ruber NBRC 15591, Mycobacterium diernhoferi NBRC3707 (the above 6 strains are from NBRC (Biotechnology Division, Biotechnology Headquarters, National Institute of Technology and Evaluation, Independent Administrative Institution) nsis JCM 10743, Rhodococcus kroppenstedtii JCM 13011, Rhodococcus yunnanensis JCM 13366, Rhodococcus corynebacterioides JCM 3376, Rhodococcus zopfii JCM 9919, Rhodococcus tukisamuensis JCM 11308, Rhodococcus percolatus JCM 10087, Rhodococcus imtechensis JCM 13270, Gordonia bronchialis JCM 3231, Rhodococcus maanshanensis JCM 11374, Gordonia rubripertincta JCM 319 9, Rhodococcus triatomae JCM 13396, Rhodococcus rhodini JCM 3203, and Rhodococcus opacus JCM 9703 More inoculated) was inoculated and cultured at 25 ° C. with shaking. Using a Shimadzu UV-visible spectrophotometer UV-160A (Shimadzu Corporation), the culture solution was measured at a wavelength of 610 nm and cultured with shaking until the absorbance reached 0.8. 3 mL of the culture solution was transplanted to 100 mL of LB medium, and cultured with shaking at 25 ° C. for 12 hours. The cultured cells were collected by centrifugation (12 krpm, 5 minutes, 4 ° C.), and the collected cells were washed twice with ultrapure water. The washed cells were collected by centrifugation (12 krpm, 5 minutes, 4 ° C.) and suspended in 2.4 mL of 10% glycerol solution. 300 μL of the suspension was dispensed and frozen at −80 ° C. to obtain competent cells.

  90 μL of each of the prepared competent cells and 5 μL of plasmid DNA of pRET1102 or pRET1137 prepared with Labo Pass ™ Mini were mixed on ice. The mixed solution was gently poured into a 0.1 cm cuvette cooled on ice and set in a Gene Pulser II Electrophoresis System. Pulsed at 20 kV / cm, 400Ω, 25 μF, immediately added 300 μL of LB medium, and left at 25 ° C. for 3 hours. A part of the suspension was plated on an LB agar medium containing 100 μg / mL kanamycin and left at 25 ° C. for 7 days. The formed colonies were inoculated into 5 mL of LB liquid medium and cultured with shaking at 25 ° C. for 7 days. The culture solution was centrifuged at 4 kC at 12 krpm for 5 minutes, the supernatant was removed, and the obtained bacterial cells were used for the measurement of reductase activity.

  Activity measurement is performed according to O.D. D. = 5 The amount of bacteria was 5%, and the reaction was performed in a 3% EAM reaction solution containing 0.2M sodium phosphate buffer (pH 6.0). After the reaction solution was shaken at 30 ° C. for 16 hours, the bacterial cell reaction solution was centrifuged at 12 krpm for 5 minutes, and the supernatant was subjected to HPLC. The analytical column was Inertsil Ph-3 3.0 × 75 mm, the column temperature was 40 ° C., the eluent was a 7% acetonitrile solution containing 0.05 M sodium phosphate buffer (pH 6.0), and the detection wavelength was 220 nm.

  The results of activity measurement are summarized in Table 1. For all actinomycetes shown in Table 1, the actinomycetes retaining pRET1137 showed higher activity than the actinomycetes retaining pRET1102.

  According to the promoter, expression vector or transformant of the present invention, high expression of a target gene or target protein can be realized in actinomycetes, and various useful proteins can be efficiently mass-produced according to the purpose. Such proteins also contribute to various industrial productions. For example, in an enzyme, oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase and the like can be efficiently produced in large quantities. When the target protein is an aminoketone asymmetric reductase, the optically active β-aminoalcohol can be produced with high yield and high selectivity. Moreover, according to the method for producing a target protein of the present invention, the target protein can be efficiently mass-produced in actinomycetes.

Claims (6)

Actinomycetes into which a promoter having the base sequence described in any of SEQ ID NOs: 1 to 4 has been introduced. Actinomycetes transformed with an expression vector comprising a promoter having the base sequence of any one of SEQ ID NOs: 1 to 4 . 2. The actinomycetes are one or more actinomycetes selected from Rhodococcus actinomycetes, Mycobacterium actinomycetes, Gordonia actinomycetes, Dietha actinomycetes and Amycolatopsis actinomycetes Actinomycetes according to 2. The manufacturing method of the target protein using the actinomycete as described in any one of Claims 1-3 . An expression vector capable of expressing a target protein by inserting a gene encoding the target protein into an expression vector containing a promoter having the nucleotide sequence of any one of SEQ ID NOs: 1 to 4 so that the gene can be expressed downstream of the promoter And getting the steps
Transforming actinomycetes with the obtained expression vector to obtain a transformant;
Culturing the resulting transformant in a medium capable of growth;
And a step of purifying the target protein from the transformant obtained in the culturing step. 6. The actinomycetes are one or more actinomycetes selected from Rhodococcus actinomycetes, Mycobacterium actinomycetes, Gordonia actinomycetes, Dietha actinomycetes, and Amycolatopsis actinomycetes The method described.