WO2008065315A1 - Methode d'immunisation contre les 4 serotypes de la dengue - Google Patents

Methode d'immunisation contre les 4 serotypes de la dengue Download PDF

Info

Publication number
WO2008065315A1
WO2008065315A1 PCT/FR2007/052431 FR2007052431W WO2008065315A1 WO 2008065315 A1 WO2008065315 A1 WO 2008065315A1 FR 2007052431 W FR2007052431 W FR 2007052431W WO 2008065315 A1 WO2008065315 A1 WO 2008065315A1
Authority
WO
WIPO (PCT)
Prior art keywords
vaccine
dengue
virus
den
administration
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/FR2007/052431
Other languages
English (en)
French (fr)
Inventor
Bruno Guy
Véronique BARBAN
Rémi FORRAT
Jean Lang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sanofi Pasteur Inc
Original Assignee
Sanofi Pasteur Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sanofi Pasteur Inc filed Critical Sanofi Pasteur Inc
Priority to AU2007327367A priority Critical patent/AU2007327367B2/en
Priority to MX2009004223A priority patent/MX2009004223A/es
Priority to CA002668570A priority patent/CA2668570A1/en
Priority to EP07866551.0A priority patent/EP2099483B1/fr
Priority to JP2009538758A priority patent/JP5269803B2/ja
Priority to BRPI0718927-3A2A priority patent/BRPI0718927A2/pt
Publication of WO2008065315A1 publication Critical patent/WO2008065315A1/fr
Priority to IL198466A priority patent/IL198466A/en
Anticipated expiration legal-status Critical
Priority to IL230052A priority patent/IL230052A0/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/02Non-specific cardiovascular stimulants, e.g. drugs for syncope, antihypotensives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5254Virus avirulent or attenuated
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525Virus
    • A61K2039/5256Virus expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/545Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/70Multivalent vaccine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/24011Flaviviridae
    • C12N2770/24111Flavivirus, e.g. yellow fever virus, dengue, JEV
    • C12N2770/24134Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the invention relates to a method for inducing protection against the four serotypes of dengue in a patient, comprising: (a) a first administration of a monovalent vaccine comprising a dengue vaccine virus of a first serotype
  • Dengue diseases are caused by four closely related, but antigenically distinct, flavivirus-like viruses of the serotype type (G ⁇ bler et al., 1988 In: Epidemiology of arthropod-terminal viral disease.) Monath TPM, editor, Boca Raton (FL) ): CRC Press: 223-60, Kautner et al., 1997, J. of Pediatrics, 131: 516-524, Rigau-Pérez et al., 1998, Lancet, 352: 971-977, Vaughn et al., 1997 J Infect Dis; 176: 322-30). Infection with a dengue serotype can produce a spectrum of clinical illness ranging from nonspecific viral syndrome to fatal severe haemorrhagic disease.
  • the incubation period of dengue fever after mosquito bite is about 4 days (ranging from 3 to 14 days).
  • Dengue fever is characterized by biphasic fever, headache, pain in various parts of the body, prostration, rash, and lymphadenopathy (Kautner et al., 1997, J. of Pediatrics, 131: 516- Rigau-Pérez et al., 1998, Lancet, 352: 971-977).
  • the viremic period is the same as the febrile period (Vaughn et al., 1997, J. Infect Dis 176: 322-30).
  • the cure of dengue fever is acquired after 7 to 10 days, but prolonged asthenia is usual. Decreases in leukocyte and platelet count are common.
  • Dengue haemorrhagic fever is a severe febrile illness characterized by abnormalities of homeostasis and an increase in vascular permeability that can lead to hypovolemia and hypotension (dengue with shock syndrome) often complicated by severe internal bleeding.
  • the mortality rate of dengue haemorrhagic fever can reach up to 10% without therapy, but is ⁇ 1% in most centers with Therapeutic experience (WHO technical guide, 1986. Dengue haemorrhagic fever: diagnosis, treatment and control, pp. 1-2, World Health Organization, Geneva, Switzerland).
  • Routine laboratory diagnosis of dengue fever is based on virus isolation and / or detection of dengue virus specific antibodies.
  • Dengue fever is the second most important tropical infectious disease after malaria, with more than half of the world's population living in areas at risk of epidemic transmission. Each year, dengue cases are estimated at 50-100 million, cases of patients hospitalized for dengue haemorrhagic at 500 000, and the number of deaths at 25 000. Dengue is endemic in Asia, the Pacific, Africa , in Latin America and the Caribbean. More than 100 tropical countries are endemic for dengue virus and dengue haemorrhagic infections have been documented in 60 of these countries (Gubler, 2002, TRENDS in Microbiology, 10: 100-103, Monath, 1994, Proc Natl Acad Sci 91: 2395-2400).
  • Dengue fever has been a leading cause of febrile illness in US troops during deployments in tropical areas endemic for dengue fever (DeFraites et al., 1994, MMWR 1994; 43: 845-848).
  • the viruses are maintained in a cycle that involves humans and Aedes aegypti, a domestic mosquito bites the day, which prefers to feed on humans.
  • Infection in humans is initiated by injecting the virus during the blood meal of an infected Aedes aegypti mosquito.
  • the salivary virus is deposited mainly in extravascular tissues.
  • the first category of infected cells after inoculation are dendritic cells, which migrate then to the lymph nodes (Wu et al., 2000, Nature Med., 7: 816-820). After initial replication in the skin and in the lymph nodes, the virus appears in the blood during the acute febrile phase, usually for 3-5 days.
  • Monocytes and macrophages are, along with dendritic cells, among the first targets of the dengue virus. Protection against homotypic reinfection is complete and probably lasts a lifetime, but cross-protection between different types of dengue lasts less than a few weeks to a few months (Sabin, 1952, Am. J. Trop., Med Hyg .; : 30-50). As a result, a subject may be infected with a different serotype. A second dengue infection is theoretically a risk factor for developing severe dengue fever. However, dengue haemorrhagic fever is multifactorial: these factors include the strain of the virus involved, as well as the age, immune status, and genetic predisposition of the patient.
  • dengue haemorrhagic fever Two factors play a major role in the occurrence of dengue haemorrhagic fever: rapid viral replication with high viremia (the severity of the disease being associated with the level of viremia, Vaughn et al., 2000, J. Dis. 181: 2-9) and a significant inflammatory response with the release of high levels of inflammatory mediators (Rothman and Ennis, 1999, Virology, 257: 1-6).
  • the treatment of dengue fever is symptomatic with bed rest, fever and pain control with antipyretics and analgesics, and adequate drinking.
  • Treatment of dengue haemorrhagic fever requires the balancing of fluid loss, replacement of clotting factors and heparin infusion.
  • the inventors have demonstrated that it is possible to generate an immune response comprising antibodies neutralizing the 4 serotypes, when the vaccine formulation to induce a response against the 4 serotypes is administered after a primary immunization with a live attenuated vaccine. one serotype only, the second immunization being carried out 30 days to 12 months after the first administration.
  • DEN-1 2,3,4 following monovalent immunization DEN-2 induces responses against all four serotypes in all immunized monkeys.
  • tetravalent immunization alone only led to a satisfactory response against two out of four serotypes, even after a booster.
  • the present invention thus relates to a method for inducing a neutralizing antibody response against the four serotypes of dengue in a patient, comprising:
  • said vaccine virus used during the first administration (a) is selected from the group consisting of vaccine viruses of dengue serotype 1 or 2.
  • said vaccine virus used during the first administration (a) is selected from the group consisting of VDV1 and VDV2 strains.
  • said vaccine viruses used in the tetravalent vaccine are selected from the group consisting of Chimerivax TM DEN-1, 2, 3 and 4.
  • the amount of dengue vaccine viruses of serotypes 1, 2, 3 and 4 is in a range from 10 3 to 10 6 DICC 50 .
  • the monovalent vaccine comprises 10 4 DICC 50 of VDV1 or VDV2 and the tetravalent vaccine comprises 10 5 DICC 5 O of Chimerivax TM DEN-1, 2, 3 and 10 3 DICC 50 from Chimerivax TM DEN-4.
  • the second administration (b) is carried out 30 to 60 days after the first administration (a).
  • the present invention also relates to a dengue virus immunization kit comprising a housing containing at least (a) a first container containing a monovalent composition or vaccine comprising a vaccine virus of a first serotype of dengue, ( b) a second container containing a tetravalent composition or vaccine comprising vaccine viruses of the four serotypes of dengue ,.
  • the kit according to the invention comprises at least: (a) a first container containing a monovalent vaccine comprising a vaccine virus VDV1 or VDV2
  • the kit according to the invention comprises a monovalent vaccine comprising 10 4 DICC 50 of VDV1 or VDV2 and a tetravalent vaccine comprising 10 5 DICC 50 of Chimerivax TM DEN-1, 2, 3 and 10 3 DICC 50 of Chimerivax TM DEN-4.
  • the present invention thus also relates to the use of dengue vaccine viruses for the manufacture of a monovalent vaccine and a tetravalent vaccine for immunization against dengue virus in which the monovalent vaccine comprises a dengue vaccine virus.
  • the tetravalent vaccine comprises vaccine viruses from the four serotypes of dengue and in which the tetravalent vaccine is administered at least 30 days to at most 12 months after administration of the monovalent vaccine.
  • DEN Single-stranded, positive-strand RNA viruses belonging to the genus Flavivirus of the flaviviridae family.
  • the genomic RNA contains a type I cap at the 5 'end but lacks a poly-A tail at the 3' end.
  • the genomic organization consists of the following: 5 'non-coding region (NCR), structural proteins (capsid (C), pre-membrane / membrane (prM / M), envelope (E)) and non-structural proteins (NS1- NS2A-NS2B-NS3-NS4A-NS4B-NS5) and NCR 3 '.
  • the genomic viral RNA is associated with the capsid proteins to form a nucleocapsid.
  • the DEN viral genome encodes an uninterrupted coding region that is translated into a single polyprotein.
  • dengue vaccine virus in the context of the present invention, any viral form of the dengue virus capable of inducing a specific immune response comprising neutralizing antibodies, preferably any viral form of the dengue virus usable as part of a human immunization program against dengue virus infection.
  • the term “dengue vaccine virus” is thus understood to mean inactivated viruses, attenuated viruses, or recombinant proteins such as the dengue virus envelope protein. A vaccine virus is considered “inactivated” if it does not replicate on permissive cells.
  • a vaccine virus is considered “attenuated” if after growth at 37 ° C or 39 ° C on a Huh-7, VERO and / or C6 / 36 hepatic cell, said virus
  • the vaccine has a maximum titre at least 10-fold lower than the maximum titre obtained with the wild-type parental strain under the same culture conditions and as measured using the same titration method.
  • a vaccine virus that shows diminished growth on at least one of the three cell types identified above is therefore considered “attenuated” in the context of the present invention.
  • a vaccine virus that can be used in humans has a positive benefit / risk ratio, which generally meets the regulatory requirements for obtaining a marketing authorization.
  • a dengue vaccine virus used in the context of the present invention is preferably a virus attenuated so that it does not induce the disease in humans.
  • said vaccine virus only leads to side effects of more moderate intensity (i.e. average to low, or even zero) in the majority of vaccinated subjects while retaining its ability to induce a neutralizing antibody response.
  • Non-limiting examples of dengue vaccine viruses that may be used in the context of the present invention are: inactivated vaccine viruses, attenuated vaccine viruses such as the attenuated VDV-1, VDV-2, strains and the like. described for example in the applications: WO02 / 66621, WO0057904, WO0057908, WO0057909; WO0057910, WO02 / 0950075 and WO02 / 102828, or the chimeras.
  • the chimeric viruses have the particularity of presenting the characteristics of the attenuated viruses as defined above.
  • Any chimeric virus expressing the envelope protein of a dengue virus and inducing an immune response comprising antibodies neutralizing the serotype from which the envelope protein is derived can therefore be used within the scope of the present invention.
  • Nonlimiting examples include: dengue chimerivax TM as described for example in patent application WO 98/37911, dengue / dengue chimeras as described for example in patent applications WO9640933 and WO0160847.
  • Dengue vaccine virus of serotype 1 may for example be the VDV1 vaccine strain or a Chimerivax TM DEN-1, in particular a YF17D / DEN-1 virus, or a DEN-1 16007 / PDK13 strain.
  • the vaccine virus of dengue serotype 2 may for example be the vaccine strain VDV2 or a Chimerivax TM DEN-2, in particularly a virus YF17D / DEN-2, or a strain DEN-2 16681 / PDK53.
  • the vaccine virus of dengue serotype 3 may be a Chimerivax TM DEN-3, in particular a YF17D / DEN-3 virus.
  • the vaccinal dengue serotype 4 virus may be a Chimerivax TM DEN-4, in particular a YF17D / DEN-4 virus. Reference may be made to the applications identified here for a precise description of the strains mentioned and their method of treatment. obtaining.
  • VDV or "Vero Dengue Vaccine” means a live attenuated live viral dengue strain adapted to Vero cells (ie capable of reproducible replication at a significant level on Vero cells) and capable of inducing a specific humoral response, including induction of neutralizing antibodies in primates and in particular in humans.
  • VDV-1 is a strain obtained from a DEN-1 16007 wild-type strain which has undergone 11 passages on PDK cells (DEN-1 16007 / PDK11) which was then amplified on Vero cells at 32 ° C., and RNA was purified and transfected into Vero cells.
  • the strain VDV-1 has 14 additional mutations compared to the vaccine strain DEN-1 16007 / PDK13 (13 passages on PDK-Primary Dog Kidney cells).
  • the strain DEN-1 16007 / PDK13 also called "LAV1”
  • LAV1 has been described in patent application EP1159968 in the name of Mahidol University and has been deposited with the National Collection of Microorganism Cultures (CNCM) under number I- 2480.
  • VDV-1 strain The complete sequence of the VDV-1 strain is given to the sequence SEQ ID NO: 1. Said strain can be easily reproduced from said sequence.
  • a process for the preparation and characterization of the VDV-1 strain has been described in the international patent application filed in the name of Sanofi-Pasteur and the Center for Disease Control and Prevention under the number WO 2006/134433.
  • VDV-2 is a strain obtained from a wild-type strain DEN-2 16681 which has undergone 50 passages on PDK cells (DEN-2 16681 / PDK50), purified by plate and whose RNA has been extracted and purified before to be transfected into Vero cells. The VDV-2 strain was then obtained by plaque purification and amplification on Vero cells. The strain VDV-2 has 10 additional mutations compared to the DEN-2 16681 / PDK53 vaccine strain (53 passages on PDK cells), including 4 silent mutations.
  • the strain DEN-2 16681 / PDK53 also called “LAV2”
  • LAV2 has been described in the patent application EP1159968 in the name of Mahidol University and has been deposited with the National Collection of Cultures of Microorganisms (CNCM) under the number 1- 2481.
  • the complete sequence of the VDV-2 strain is shown in the sequence SEQ ID NO: 2.
  • the VDV-2 strain can be easily reproduced from said sequence.
  • a process for the preparation and characterization of the VDV-2 strain has been described in the international patent application filed in the name of Sanofi-Pasteur and the Center for Disease Control and Prevention under the number WO 2006/134433.
  • Strains VDV 1 and 2 are prepared by amplification on cells
  • Vero Viruses produced are harvested and clarified from cellular debris by filtration. L 1 DNA is digested by enzymatic treatment. The impurities are removed by ultrafiltration. Infectious titres may be increased by a concentration method. After addition of a stabilizer, the strains are stored in freeze-dried or frozen form before use and then reconstituted extemporaneously.
  • CYD ChimeriVax TM dengue
  • CYD refers to a chimeric yellow fever (YF) virus which comprises the backbone of a YF virus in which the coding sequences for the pre-membrane and envelope proteins have been replaced by those of a DEN virus.
  • CYD-1 or CYD DEN1 is a chimeric YF virus containing the prM and E sequences of a dengue serotype 1 (DEN-I) strain.
  • CYD-2 or CYD DEN2 refers to a chimeric YF virus containing the prM and E sequences of a DEN-2 strain.
  • CYD-3 or CYD DEN3 is a chimeric YF virus containing the prM and E sequences of a DEN-3 strain.
  • CYD-4 or CYD DEN4 refers to a chimeric YF virus containing the prM and E sequences of a DEN-4 strain.
  • the preparation of these ChimeriVax TM dengue has been described in detail in international patent applications WO 98/37911 and WO 03/101397 to which reference can be made for a precise description of their preparation process.
  • the chimeras described in the examples were generated using the prM and E sequences derived from the DEN 1 PUO359 (TYP1140), DEN2 PUO218, DEN3 PaH881 / 88 and DEN41228 (TVP980) strains. Any strain of the dengue virus could be used in the context of the present invention for the construction of the chimeras.
  • the chimeric YF virus comprises the backbone of an attenuated yellow fever strain YF17D (Theiler M, and Smith HH (1937) J Exp. Med 65, p767-786.) (YF17D / DEN-1 virus, YF17D / DEN-2, YF17D / DEN-3, YF17D / DEN-4).
  • YF17D strains that may be used include YF17D204 (YF-Vax®, Sanofi-Pasteur, Swifwater, PA, USA, Stamaril®, Sanofi-Pasteur, Marcy l'Etoile, France, ARILVAX TM, Chiron, Speke, Liverpool).
  • the vaccine viruses are, for each serotype used in the different administrations, present in the vaccine at a quantity of 10 3 to 10 5 DICC 5 O According to one particular embodiment, the vaccine viruses VDV1 or
  • VDV2 are present in the monovalent vaccine at 10 4 DICC 5 O
  • Chimerivax TM DEN-1, 2, 3 are present in the tetravalent vaccine at 10 5 DICC 5 O and Chimerivax TM DEN-4 is present in the tetravalent vaccine at a rate of 10 3 DICC 50 .
  • Each ChimeriVax TM monovalent dengue vaccine virus (serotypes 1, 2, 3 and 4) was prepared by amplification of each serotype on Vero cells. More specifically, the four viruses are produced separately on adherent Vero cells in serum-free medium. The viral harvest, clarified of cell debris by filtration, is then concentrated and purified by chromatography and ultrafiltration to remove I 1 DNA host cells. After addition of a stabilizer, the vaccine strains are stored in frozen form or lyophilized before use and then reconstituted extemporaneously. The same process is applied for the four chimeras.
  • a dose, composition or vaccine is "monovalent” when it contains in addition to a pharmaceutically acceptable excipient a vaccine virus of a single serotype of dengue fever.
  • a dose, composition or vaccine is "tetravalent” when it contains vaccine viruses from all four dengue serotypes.
  • the multivalent compositions are obtained by simple mixing of the monovalent compositions.
  • Patient refers to a person (child or adult) who may be infected with dengue fever, particularly a person at risk of infection, such as a person traveling to areas where dengue fever is present or an inhabitant of dengue fever. these regions. This term includes na ⁇ ve people as well as non-naive people for the dengue virus.
  • the subject of the present invention is therefore a method of immunization against the dengue virus.
  • the inventors have in fact shown in particular that the administration of the four serotypes 30 days to 12 months after the first administration of a monovalent vaccine makes it possible to obtain an effective protection against the four serotypes.
  • the method according to the present invention is therefore of particular interest in the context of a dengue immunization strategy.
  • the first immunization can be performed with a monovalent composition or vaccine comprising a vaccinia virus of any one of the four serotypes of dengue, the second administration being carried out with all four vaccine serotypes.
  • a dengue vaccine virus of serotype 1 or 2, preferably of serotype 2 is used in the first administration.
  • the dengue vaccine virus used in the first administration is an attenuated dengue virus and is not constituted by a chimeric virus.
  • the strain VDV1 or VDV2, preferably strain VDV2 is used as a vaccine virus in the first administration.
  • Live attenuated vaccine viruses are used in the second administration, preferably chimeric viruses expressing antigens of the four serotypes of dengue virus, in particular Chimerivax TM DEN1, 2, 3, and 4.
  • the present invention therefore covers the following diagrams:
  • VDV1 (b) CYD DEN-1, 2, 3 and 4 - (ia VDV2 (b) CYD DEN-1, 2, 3 and 4.
  • vaccine or composition in the context of the present invention means a composition comprising an "immunoefficient amount" of the dengue vaccine virus, that is to say a sufficient amount of dengue vaccine virus to induce a response.
  • specific immune system comprising neutralizing antibodies, which can be demonstrated for example by the seroneutralization test as described below in Example 1.
  • a serum is considered positive for the presence of neutralizing antibodies when the titre of Neutralizing antibody thus determined is greater than or equal to 1: 10 (unit: 1 / dilution).
  • Vaccine strain amounts are commonly expressed in terms of plaque forming unit (PFU) or infective dose 50% of tissue culture or 50% of cell culture infective dose (DICC50).
  • the compositions according to the invention may contain from 10 to 10 6 DICC50, in particular from 10 3 to 10 5 DICC50 dengue vaccine virus of serotype 1, 2, 3 or 4 for a monovalent or tetravalent composition.
  • the vaccine virus doses of dengue serotype 1, 2, 3 and 4 are preferably each in a range from 10 to 10 6 DICC50, such as 10, 10 2 , 3 , 10 4 , 10 5 or 10 6 DICC 50, in particular in a range from 10 3 to 10 5 DICC 50,
  • the vaccine viruses can be used in identical or different doses, which can be adjusted according to the nature of the vaccine virus used and the intensity of the immune response obtained.
  • the amounts of live vaccine virus attenuated in the monovalent and tetravalent compositions or vaccines are from 10 3 to 10 5 DICC50
  • the monovalent vaccine comprises 10 4 DICC50 VDV1 or VDV2, preferably VDV2.
  • the tetravalent vaccine includes 10 5 CCID 50 Chimerivax TM DEN-1, 2, 3 and 4.
  • the tetravalent vaccine includes 10 5 CCID 50 Chimerivax TM DEN-1, 2 and 3 and 10 3 DICC 50 of Chimerivax TM DEN-4.
  • the second administration (b) is carried out 30 days to at most 12 months after the administration (a).
  • the second administration is carried out from 30 days to 60 days after the first administration (a).
  • the neutralizing antibody response is advantageously durable, i.e., it can be detected in the serum for at least 6 months after the second administration.
  • the vaccine viruses are administered in the form of compositions or vaccines which can be prepared according to any method known to those skilled in the art.
  • viruses generally in freeze-dried form, are mixed with a pharmaceutically acceptable excipient, such as water or phosphate buffered saline, wetting or stabilizing agents.
  • pharmaceutically acceptable excipient is meant any solvent, dispersion medium, charge etc, which does not produce a side reaction, for example allergic, in humans or animals.
  • the excipient is selected according to the chosen dosage form, method and route of administration. Suitable excipients, as well as pharmaceutical formulation requirements, are described in "Remington: The Science & Practice of Pharmacy", which is a reference work in the field.
  • the vaccine compositions are prepared in injectable form, and may correspond to liquid solutions, suspensions or emulsions.
  • the compositions may in particular comprise a aqueous solution buffered to maintain a pH of between about 6 and 9 (as determined with a pH meter at room temperature).
  • compositions may nevertheless comprise such a compound, that is to say a substance that increases, stimulates or strengthens the cellular or humoral immune response induced by the vaccine virus. administered simultaneously.
  • an adjuvant that may be appropriate in the context of the present invention.
  • the compositions or vaccines according to the invention may be administered according to any route usually used for vaccination, for example the parenteral route (especially intradermal, subcutaneous, or intramuscular), advantageously subcutaneously.
  • the compositions or vaccine are injectable compositions administered subcutaneously, advantageously in the region of the left deltoid or right deltoid.
  • the volume of composition or vaccine administered depends on the route of administration. For subcutaneous injections, the volume is generally between 0.1 and 1.0 ml, preferably about 0.5 ml.
  • the vaccines can be administered as a prophylactic treatment for dengue virus infection in adults and children.
  • Target populations therefore include people who may be naive (ie, not previously immunized) or non-naive with respect to the dengue virus.
  • dengue vaccine viruses of serotypes 1 to 4 may also be implemented for example between 6 months and 10 years, for example 6 months, 1 year, 3 years, 5 years or 10 years after administration of the second administration (b) according to the invention.
  • the booster administrations will be implemented advantageously using the same compositions or vaccines (ie the same vaccine virus) and preferably in the same conditions of administration (anatomical sites and routes of administration) as used for the 2nd s administration (b).
  • the interference phenomena can be explained by the dominance of one or more serotypes compared to others and are therefore independent of the technology used to manufacture the candidate vaccine (eg VDV or
  • Chimerivax TM The method according to the present invention can therefore generally be applied to any dengue vaccine virus.
  • the present invention therefore also covers the use of dengue vaccine viruses for the manufacture of a monovalent vaccine and a tetravalent vaccine for immunization against the dengue virus in which the monovalent vaccine comprises a vaccine virus of the dengue of a first serotype, the tetravalent vaccine comprises vaccine viruses of the four serotypes of dengue and in which the tetravalent vaccine is administered at least 30 days to at most 12 months after administration of the monovalent vaccine.
  • the subject of the present invention is an immunization kit against the four serotypes of the dengue virus.
  • the kit according to the present invention comprises the compositions or vaccines as defined above in relation to the proposed immunization method.
  • the kit according to the invention therefore comprises a box containing the different containers containing the compositions or vaccines and advantageously an explanatory booklet containing the information useful for the administration of said compositions or vaccines.
  • the subject of the present invention is therefore a dengue virus immunization kit comprising a housing containing at least (a) a first container containing a monovalent vaccine comprising a vaccine virus of a first serotype of the dengue, and (b) a second container containing a tetravalent vaccine comprising vaccine viruses of the four serotypes of dengue ,.
  • compositions or vaccine viruses of dengue that can be used in the kit according to the invention, reference may be made to the description which is given above in connection with the method of immunization according to the invention.
  • the kit according to the invention comprises at least: (a) a first container containing a monovalent vaccine comprising a vaccine virus VDV1 or VDV2 and
  • the kit according to the invention comprises at least one monovalent vaccine comprising 10 4 DICC 50 of VDV1 or VDV2 and a tetravalent vaccine comprising 10 5 DICC50 of Chimerivax TM DEN-1, 2, 3 and 10 3 DICC 50 of Chimerivax TM DEN-4.
  • kits according to the invention may contain a single or multiple copies of the containers as described above. If the vaccines used are in freeze-dried form, the kit will advantageously comprise at least one additional container containing the diluent for reconstituting an injectable vaccine dose. Any pharmaceutically acceptable diluent can be used for this purpose, conventionally, water or a phosphate buffered aqueous solution.
  • the invention is illustrated by the following example.
  • Example 1 Immunization against the 4 serotypes of the dengue virus by successive injection of a monovalent composition followed by a tetravalent composition in the monkey
  • Viremia and immunogenicity were tested in a monkey model.
  • Viremia in particular, has been identified as one of the factors associated with virulence and severity of illness in men and is therefore an important parameter to consider. Immunogenicity is a key parameter in the assessment of protection conferred.
  • Mauritania The monkeys were quarantined for six weeks before immunization.
  • the monkeys were immunized subcutaneously in the arms with 0.5 ml of vaccine composition. After mild anesthesia with ketamine (Imalgene, Merial), blood was collected by puncture at the inguinal or saphenous veins. At days 0 and 28 following each immunization, 5 ml of blood was sampled to evaluate the antibody responses, while between days 2 and 10, 1 ml of blood was sampled to assess the viremia. Blood was collected on ice and kept on ice until serum was separated. To do this, the blood was centrifuged for 20 minutes at 4 ° C. and the collected serum stored at -80 ° C. until testing.
  • Post-vaccination viremia was followed by real-time quantitative RT-PCT (qRT-PCR).
  • Two sets of primers and probes located in the NS5 gene of DEN1 and DEN2 strains were used to quantify VDV-1 and VDV-2 RNA respectively.
  • a third set of 2 primers and 1 probe located in the NS5 gene of YF virus was used to quantify CYD RNA.
  • RNAs Seven plasmids containing, under the control of the T7 promoter, the region targeted by each PCR, were transcribed in vitro to generate a series of synthetic RNAs that were included as internal reference in each RT-PCT assay. These synthetic RNAs were determined by spectrophotometry, the amount of RNA obtained was converted into RNA copy number and expressed in GEQ (genomic equivalents).
  • RNA 0.140 ml of monkey serum was extracted using Macherey Nagel's "Nucleospin 96 virus TM" RNA extraction kit, according to the manufacturer's instructions, and the purified RNA was eluted with 0.140 ml (0.090 ml). ml, then 0.05 ml) RNase free water. To avoid repeated freeze / thaw cycles, a first quantification was performed immediately after the extraction of 5 ⁇ l of said RNA preparation. The remaining volume was frozen at 70 ° C.
  • the reaction mixtures contained, in addition to the components of the "Qiagen Qauntitect TM probes" RT-PCR quantification kit (Qiagen), 10 picomoles of each primer, 4 picomoles of each probe, and 5 picomoles of each primer.
  • ⁇ l of RNA in a total volume of 25 ⁇ l.
  • 5 .mu.l of the purified preparation was directly introduced into the reaction mixture, without a prior dilution step.
  • the synthetic RNAs were diluted 1/10 in RNAse-free water, and 7 dilutions containing approximately 10 to 10 6 GEQ in 5 ⁇ l were quantified in parallel to generate the standard curve.
  • Quantification reactions were performed by the Applied Biosystem ABIPrism 700 TM instrument, using the following program: 50 ° C / 30 min, 95 ° C / 15 min, followed by 40 cycles of 95 ° C / 15 sec. 60 ° C / 60 sec.
  • the limit of quantification of the viral RNA in this test is 2.9 to 3.3 logioGEQ / ml (800 to 2000 GEQ / ml, 4 to 10 GEQ / reaction), according to the PCR targets (standard deviation: + / -0.3 logio)
  • the correlation between the infectious titer and the quantification of viral RNA was established parallel to the tests, by analysis of 0.140 ml of samples of negative monkey sera (OD) in which a known quantity was added. infectious particles of viruses used for immunization (CYD or VDV). Said control sera were prepared at two dilutions containing about 1 PFU and about 100 PFU in 5 ⁇ l (2.3 and 4.3 log 10 PFU / ml, respectively).
  • Ratio GEQ / PFU of 2.5 logio (ie: 1 PFU 320 GEQ) for the will be positive in VDV1 or VDV2.
  • the limits of quantification being ⁇ 3.3 logi 0 GEQ / ml (ie ⁇ 4 PFU / ml) for qRT-PCR YF and CYDs and ⁇ 2.9 logi 0 GEQ / ml (ie ⁇ 2.5 PFU / ml) for qRT- PCR VDV1 and VDV2.
  • the primers and probes used are given in Table 1 below, in which the sense and antisense primers and the probe are listed in order for each test. Table 1 sequence
  • YF-NS5 sense 5 1 GCACGGATGTAACAGACTGAAGA (23 bases)
  • V DV2-NS5 direction May 1 AAT GAC AGA CAC GAC TCC (IS b)
  • V DV2-NS5 5 1 Fam-TGG AAG TCG GCA CGT GA-M GB / NFO (17b)
  • d represents the dilution leading to 100% neutralization (ie 6 negative replicates that is to say having no sign of infection)
  • X total number of wells showing no signs of infection, except dilution d.
  • the viral detection limit is 10 SN50 (i.e. 1.0 logi 0 SN50).
  • Viral strains which have been used for the neutralization are the strains DEN1 16007, DEN2 16681, DEN3 16562 or DEN4 1036.
  • the administration scheme according to the present invention makes it possible to increase qualitatively and quantitatively the neutralizing antibody response which is obtained with a scheme comprising two identical immunizations of tetravalent vaccine.
  • VDV2 induces high level responses against the four serotypes in all monkeys, in contrast to a pattern comprising 2 tetravalent vaccine immunizations.
  • the primary immunization conducted with VDV2 induces, as expected, a response directed almost exclusively against serotype 2, presenting a low intensity cross-reactivity against serotypes 1 and 4 in certain animals.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Rheumatology (AREA)
  • Dermatology (AREA)
  • Molecular Biology (AREA)
  • Pain & Pain Management (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/FR2007/052431 2006-12-01 2007-11-30 Methode d'immunisation contre les 4 serotypes de la dengue Ceased WO2008065315A1 (fr)

Priority Applications (8)

Application Number Priority Date Filing Date Title
AU2007327367A AU2007327367B2 (en) 2006-12-01 2007-11-30 Immunization protocol against the 4 dengue serotypes
MX2009004223A MX2009004223A (es) 2006-12-01 2007-11-30 Protocolo de inmunizacion contra los 4 serotipos del dengue.
CA002668570A CA2668570A1 (en) 2006-12-01 2007-11-30 Immunization protocol against the 4 dengue serotypes
EP07866551.0A EP2099483B1 (fr) 2006-12-01 2007-11-30 Methode d'immunisation contre les 4 serotypes de la dengue
JP2009538758A JP5269803B2 (ja) 2006-12-01 2007-11-30 デング熱の4種の血清型に対する免疫付与のプロトコル
BRPI0718927-3A2A BRPI0718927A2 (pt) 2006-12-01 2007-11-30 Método de imunização contra os quatro sorotipos da dengue.
IL198466A IL198466A (en) 2006-12-01 2009-04-30 Use of dengue fever vaccines to produce a single-value vaccine and four-value vaccine to vaccinate against dengue fever virus and vaccine kits against dengue fever containing these vaccines
IL230052A IL230052A0 (en) 2006-12-01 2013-12-19 A method for vaccination against 4 serotypes of dengue

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR0655255 2006-12-01
FR0655255A FR2909286B1 (fr) 2006-12-01 2006-12-01 Methode d'immunisation contre les 4 serotypes de la dengue

Publications (1)

Publication Number Publication Date
WO2008065315A1 true WO2008065315A1 (fr) 2008-06-05

Family

ID=38198298

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FR2007/052431 Ceased WO2008065315A1 (fr) 2006-12-01 2007-11-30 Methode d'immunisation contre les 4 serotypes de la dengue

Country Status (16)

Country Link
US (2) US7718359B2 (https=)
EP (1) EP2099483B1 (https=)
JP (1) JP5269803B2 (https=)
KR (1) KR20090087890A (https=)
CN (1) CN101541344A (https=)
AR (1) AR064009A1 (https=)
AU (1) AU2007327367B2 (https=)
BR (1) BRPI0718927A2 (https=)
CA (1) CA2668570A1 (https=)
FR (1) FR2909286B1 (https=)
IL (2) IL198466A (https=)
MX (1) MX2009004223A (https=)
MY (1) MY180698A (https=)
TW (1) TWI400249B (https=)
WO (1) WO2008065315A1 (https=)
ZA (1) ZA200902540B (https=)

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2353609A1 (en) * 2010-02-04 2011-08-10 Sanofi Pasteur Immunization compositions and methods
WO2014016362A1 (en) 2012-07-24 2014-01-30 Sanofi Pasteur Vaccine compositions for prevention against dengue virus infection
WO2014016360A1 (en) 2012-07-24 2014-01-30 Sanofi Pasteur Vaccine compositions
WO2014083194A1 (en) 2012-11-30 2014-06-05 Sanofi Pasteur Methods for inducing antibodies
US8999675B2 (en) 2009-08-31 2015-04-07 Gen-Probe Incorporated Dengue virus assay
PH12016502431A1 (en) * 2009-06-01 2019-02-11 Takeda Vaccines Inc Composition and methods for administration of vaccines against dengue virus
WO2019069130A1 (en) 2017-10-05 2019-04-11 Sanofi Pasteur COMPOSITIONS FOR RECALL VACCINATION AGAINST DENGUE
EP3620174A1 (en) 2018-09-05 2020-03-11 Takeda Vaccines, Inc. Dengue vaccine unit dose and administration thereof
WO2021034349A1 (en) 2019-08-16 2021-02-25 Takeda Vaccines, Inc. Methods for preventing dengue and hepatitis a
WO2021174059A1 (en) 2020-02-27 2021-09-02 Takeda Vaccines, Inc. Method for removing host cell dna from virus preparation
WO2023147342A2 (en) 2022-01-25 2023-08-03 Takeda Vaccines, Inc. Large-scale flaviviral vaccine production and manufacture
WO2023158989A1 (en) 2022-02-15 2023-08-24 Takeda Vaccines, Inc. Dengue vaccine batch mixing process
WO2023215383A1 (en) 2022-05-04 2023-11-09 Takeda Vaccines, Inc. Computer-based determination of flavivirus infectivity
WO2024108087A1 (en) 2022-11-18 2024-05-23 Takeda Vaccines, Inc. A method for determining the proportion of a live, attenuated flavivirus having a nucleotide sequence comprising at least one attenuation locus in a formulation
WO2024118740A1 (en) 2022-11-29 2024-06-06 Takeda Vaccines, Inc. Large-scale flaviviral vaccine production and manufacture
WO2025072259A1 (en) 2023-09-25 2025-04-03 Takeda Vaccines, Inc. Coadministration of tetravalent dengue vaccine with hpv vaccine
WO2025122855A1 (en) 2023-12-08 2025-06-12 Takeda Vaccines, Inc. A method for determining the concentration of residual vero cell genomic dna in a sample containing virus obtained from production in vero cells

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080193477A1 (en) * 2005-08-10 2008-08-14 Acambis Inc. Vaccination Against Dengue Virus Infection
FR2903605A1 (fr) * 2006-07-12 2008-01-18 Sanofi Pasteur Sa Methode d'immunisation contre les quatres serotypes de la dengue
FR2906724B1 (fr) * 2006-10-04 2009-03-20 Sanofi Pasteur Sa Methode d'immunisation contre les 4 serotypes de la dengue.
ES2615390T3 (es) 2008-03-05 2017-06-06 Sanofi Pasteur Proceso para estabilizar una composición de vacuna que contiene adyuvante
EP2143440A1 (fr) * 2008-07-09 2010-01-13 Sanofi Pasteur Agent stabilisant et composition vaccinale comprenant un ou plusieurs flavivirus vivants atténués
WO2012088041A1 (en) 2010-12-20 2012-06-28 Genvec, Inc. Adenoviral vector-based dengue fever vaccine
BR112015031226A2 (pt) * 2013-06-21 2017-08-29 Merck Sharp & Dohme Composição de vacina, e, uso da composição de vacina
TWI852899B (zh) 2014-09-02 2024-08-21 法商賽諾菲巴斯德公司 疫苗組合物
KR20230154072A (ko) 2014-09-26 2023-11-07 세퀴러스 유케이 리미티드 면역손상된 대상체의 백신 접종
BR112017028212A2 (pt) 2015-07-03 2018-09-11 Sanofi Pasteur vacinação concomitante contra dengue e febre amarela
US10004795B2 (en) * 2015-09-08 2018-06-26 Fundacao Butantan Process for preparing an attenuated tetravalent dengue vaccine
KR20230147098A (ko) * 2021-01-28 2023-10-20 백신벤트 게엠베하 B 세포 매개 면역 반응을 조절하기 위한 방법 및 수단(method and means for modulating b-cell mediated immune responses)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001060847A2 (en) * 2000-02-16 2001-08-23 The Government Of The United States Of America As Represented By The Secretary, Department Of Health And Human Services Avirulent, immunogenic flavivirus chimeras
EP1159968A1 (fr) * 2000-05-30 2001-12-05 Mahidol University Souches atténuées du virus de la Dengue et leur utilisation dans une composition vaccinale
WO2003101397A2 (en) * 2002-05-31 2003-12-11 Acambis, Inc. Tetravalent dengue vaccines

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU4224499A (en) 1998-05-29 1999-12-13 Epimmune, Inc. Identification of broadly reactive dr restricted epitopes
JP2002540168A (ja) * 1999-03-26 2002-11-26 ウォルター リード アーミー インスティテュート オブ リサーチ 多価デングウイルスワクチン
US6537557B1 (en) 1999-03-26 2003-03-25 The United States Of America As Represented By The Secretary Of The Army Attenuated dengue-4 virus vaccine
US6632663B1 (en) 1999-09-22 2003-10-14 Aventis Pasteur Limited DNA immunization against chlamydia infection
EP1159969A1 (fr) 2000-05-30 2001-12-05 Aventis Pasteur Vaccine composition
DE602004027902D1 (de) * 2003-03-24 2010-08-12 Scripps Research Inst Dna-vakzine gegen tumorwachstum und anwendungsverfahren dafür
CN101238144B (zh) * 2005-06-17 2012-09-05 赛诺菲巴斯德有限公司 登革血清型1减毒株
BRPI0613287A2 (pt) * 2005-06-17 2010-12-28 Sanofi Pasteur cepa do vìrus da dengue-2 vivo atenuada, composição imunogênica, composição de vacina, ácido nucléico isolado, poliproteìna isolada codificadas pela seq id n .1 ou fragmentos desta e fragmento da poliproteìna
US20080193477A1 (en) * 2005-08-10 2008-08-14 Acambis Inc. Vaccination Against Dengue Virus Infection
US7968102B2 (en) * 2006-01-13 2011-06-28 Sanofi Pasteur S.A. Dengue chimeric viruses
AR061197A1 (es) * 2006-06-07 2008-08-13 Sanofi Pasteur Cepas del virus 3 del dengue vivas atenuadas
FR2903605A1 (fr) * 2006-07-12 2008-01-18 Sanofi Pasteur Sa Methode d'immunisation contre les quatres serotypes de la dengue
FR2906724B1 (fr) * 2006-10-04 2009-03-20 Sanofi Pasteur Sa Methode d'immunisation contre les 4 serotypes de la dengue.

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001060847A2 (en) * 2000-02-16 2001-08-23 The Government Of The United States Of America As Represented By The Secretary, Department Of Health And Human Services Avirulent, immunogenic flavivirus chimeras
EP1159968A1 (fr) * 2000-05-30 2001-12-05 Mahidol University Souches atténuées du virus de la Dengue et leur utilisation dans une composition vaccinale
WO2003101397A2 (en) * 2002-05-31 2003-12-11 Acambis, Inc. Tetravalent dengue vaccines

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BLANEY J E ET AL: "DEVELOPMENT OF A LIVE ATTENUATED DENGUE VIRUS VACCINE USING REVERSE GENETICS", VIRAL IMMUNOLOGY, MARY ANN LIEBERT, INC., NEW YORK, US, vol. 19, no. 1, April 2006 (2006-04-01), pages 10 - 32, XP008068928, ISSN: 0882-8245 *
GUIRAKHOO F ET AL: "CONSTRUCTION,SAFETY,AND IMMUNOGENICITY IN NONHUMAN PRIMATES OF A CHIMERIC YELLOW FEVER-DENGUE VIRUS TETRAVALENT VACCINE", JOURNAL OF VIROLOGY, THE AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 75, no. 10, August 2001 (2001-08-01), pages 7290 - 7304, XP002961663, ISSN: 0022-538X *
GUIRAKHOO F ET AL: "Viremia and Immunogenicity in Nonhuman Primates of a Tetravalent Yellow Fever-Dengue Chimeric Vaccine: Genetic Reconstructions, Dose Adjustment, and Antibody Responses against Wild-type Dengue Virus Isolates", VIROLOGY, ACADEMIC PRESS,ORLANDO, US, vol. 298, no. 1, 20 June 2002 (2002-06-20), pages 146 - 159, XP004469478, ISSN: 0042-6822 *
SABCHAREON ARUNEE ET AL: "Safety and immunogenicity of tetravalent live-attenuated dengue vaccines in Thai adult volunteers: Role of serotype concentration, ratio, and multiple doses.", AMERICAN JOURNAL OF TROPICAL MEDICINE AND HYGIENE, vol. 66, no. 3, March 2002 (2002-03-01), pages 264 - 272, XP002441733, ISSN: 0002-9637 *

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PH12016502431A1 (en) * 2009-06-01 2019-02-11 Takeda Vaccines Inc Composition and methods for administration of vaccines against dengue virus
US8999675B2 (en) 2009-08-31 2015-04-07 Gen-Probe Incorporated Dengue virus assay
WO2011095402A1 (en) * 2010-02-04 2011-08-11 Sanofi Pasteur Immunization compositions and methods
EP2353609A1 (en) * 2010-02-04 2011-08-10 Sanofi Pasteur Immunization compositions and methods
US8697353B2 (en) 2010-02-04 2014-04-15 Sanofi Pasteur Sa Immunization compositions and methods
US10143741B2 (en) 2010-02-04 2018-12-04 Sanofi Pasteur Sa Immunization compositions and methods
WO2014016360A1 (en) 2012-07-24 2014-01-30 Sanofi Pasteur Vaccine compositions
EP3932422A1 (en) 2012-07-24 2022-01-05 Sanofi Pasteur Vaccine compositions for the prevention of dengue virus infection
WO2014016362A1 (en) 2012-07-24 2014-01-30 Sanofi Pasteur Vaccine compositions for prevention against dengue virus infection
WO2014083194A1 (en) 2012-11-30 2014-06-05 Sanofi Pasteur Methods for inducing antibodies
WO2019069130A1 (en) 2017-10-05 2019-04-11 Sanofi Pasteur COMPOSITIONS FOR RECALL VACCINATION AGAINST DENGUE
EP3620174A1 (en) 2018-09-05 2020-03-11 Takeda Vaccines, Inc. Dengue vaccine unit dose and administration thereof
WO2020051334A1 (en) 2018-09-05 2020-03-12 Takeda Vaccines, Inc. Dengue vaccine unit dose and administration thereof
EP4082568A1 (en) 2018-09-05 2022-11-02 Takeda Vaccines, Inc. Dengue vaccine unit dose and administration thereof
WO2021034349A1 (en) 2019-08-16 2021-02-25 Takeda Vaccines, Inc. Methods for preventing dengue and hepatitis a
WO2021174059A1 (en) 2020-02-27 2021-09-02 Takeda Vaccines, Inc. Method for removing host cell dna from virus preparation
WO2023147342A2 (en) 2022-01-25 2023-08-03 Takeda Vaccines, Inc. Large-scale flaviviral vaccine production and manufacture
WO2023147337A2 (en) 2022-01-25 2023-08-03 Takeda Vaccines, Inc. Large-scale flaviviral vaccine production and manufacture
WO2023158989A1 (en) 2022-02-15 2023-08-24 Takeda Vaccines, Inc. Dengue vaccine batch mixing process
WO2023215383A1 (en) 2022-05-04 2023-11-09 Takeda Vaccines, Inc. Computer-based determination of flavivirus infectivity
WO2024108087A1 (en) 2022-11-18 2024-05-23 Takeda Vaccines, Inc. A method for determining the proportion of a live, attenuated flavivirus having a nucleotide sequence comprising at least one attenuation locus in a formulation
EP4375381A1 (en) 2022-11-18 2024-05-29 Takeda Vaccines, Inc. A method for determining the proportion of a live, attenuated flavivirus having a nucleotide sequence comprising at least one attenuation locus in a formulation
WO2024118740A1 (en) 2022-11-29 2024-06-06 Takeda Vaccines, Inc. Large-scale flaviviral vaccine production and manufacture
WO2025072259A1 (en) 2023-09-25 2025-04-03 Takeda Vaccines, Inc. Coadministration of tetravalent dengue vaccine with hpv vaccine
WO2025122855A1 (en) 2023-12-08 2025-06-12 Takeda Vaccines, Inc. A method for determining the concentration of residual vero cell genomic dna in a sample containing virus obtained from production in vero cells

Also Published As

Publication number Publication date
JP2010511022A (ja) 2010-04-08
TWI400249B (zh) 2013-07-01
US20100239612A1 (en) 2010-09-23
KR20090087890A (ko) 2009-08-18
CN101541344A (zh) 2009-09-23
AR064009A1 (es) 2009-03-04
MY180698A (en) 2020-12-07
IL230052A0 (en) 2014-01-30
AU2007327367B2 (en) 2013-05-09
BRPI0718927A2 (pt) 2014-04-08
US7718359B2 (en) 2010-05-18
IL198466A0 (en) 2011-08-01
US20080131460A1 (en) 2008-06-05
FR2909286B1 (fr) 2012-06-08
MX2009004223A (es) 2009-04-30
IL198466A (en) 2014-01-30
JP5269803B2 (ja) 2013-08-21
EP2099483A1 (fr) 2009-09-16
TW200829599A (en) 2008-07-16
CA2668570A1 (en) 2008-06-05
EP2099483B1 (fr) 2013-12-25
ZA200902540B (en) 2010-07-28
AU2007327367A1 (en) 2008-06-05
FR2909286A1 (fr) 2008-06-06

Similar Documents

Publication Publication Date Title
EP2099483B1 (fr) Methode d'immunisation contre les 4 serotypes de la dengue
EP2077857B1 (fr) Methode d'immunisation contre les 4 serotypes de la dengue
WO2008007021A1 (fr) Methode d'immunisation contre les 4 serotypes de la dengue

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200780043955.3

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07866551

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2007327367

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: MX/A/2009/004223

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 198466

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 2668570

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2007327367

Country of ref document: AU

Date of ref document: 20071130

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020097010676

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2988/CHENP/2009

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2009538758

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2007866551

Country of ref document: EP

ENP Entry into the national phase

Ref document number: PI0718927

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20090529