WO2008056361A1 - Marqueur biologique du psoriasis - Google Patents

Marqueur biologique du psoriasis Download PDF

Info

Publication number
WO2008056361A1
WO2008056361A1 PCT/IL2007/001365 IL2007001365W WO2008056361A1 WO 2008056361 A1 WO2008056361 A1 WO 2008056361A1 IL 2007001365 W IL2007001365 W IL 2007001365W WO 2008056361 A1 WO2008056361 A1 WO 2008056361A1
Authority
WO
WIPO (PCT)
Prior art keywords
level
psoriasis
expression
subject
treatment
Prior art date
Application number
PCT/IL2007/001365
Other languages
English (en)
Inventor
Pnina Fishman
Ilan Cohn
Original Assignee
Can-Fite Biopharma Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Can-Fite Biopharma Ltd. filed Critical Can-Fite Biopharma Ltd.
Publication of WO2008056361A1 publication Critical patent/WO2008056361A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/20—Dermatological disorders
    • G01N2800/205—Scaling palpular diseases, e.g. psoriasis, pytiriasis

Definitions

  • This invention is in the fields of diagnosis of psoriasis and determining the effectiveness of treatment of psoriasis, and in particular to use of biological markers associated with psoriasis therefore.
  • the A 3 adenosine receptor a Gi protein-associated cell surface receptor
  • the receptor is highly expressed in various tumor cell types while expression in adjacent normal tissues is relatively low.
  • Activation of the receptor by a specific synthetic agonist induces modulation of downstream signal transduction pathways which include the Wnt and the NF-kB, resulting in tumor growth inhibition (1-5).
  • a 3 adenosine receptor (A 3 AR) agonists inhibit tihe development of colon, prostate and pancreatic carcinomas as well as melanoma and hepatoma.
  • a 3 AR agonists were also been shown to act as anti-inflammatory agents by ameliorating the inflammatory process in different experimental autoimmune models such as rheumatoid arthritis, Crohn's disease and multiple sclerosis (6-10).
  • a 3 adenosine receptor (A 3 AR) expression levels are elevated in cancer cells as compared to normal cells (11). Thus, the A 3 AR expression level has been described as a means for the diagnosis of cancer (12). In addition, A 3 AR expression levels have also been described to be elevated in peripheral blood cells of patients with colorectal cancer (13).
  • the A 3 AR was found to be highly expressed in inflammatory tissues (synovia and paw) derived from adjuvant (AIA) and collagen induced arthritis experimental models (14). This over expression was reflected in the PBMNC of the animals. Treatment of ALA rats with an A 3 AR agonist resulted in disease amelioration and receptor down-regulation. hi patients with Rheumatoid arthritis (RA) 5 the receptor was found to be highly expressed in peripheral blood mononuclear cells (PBMNC) (14). Moreover, in a group of RA patients that was treated with an A 3 AR agonist, a direct correlation was found between A 3 AR expression at baseline and response of the patients to the drug (15). Psoriasis is a chronic condition.
  • psoriasis There are several forms of psoriasis, and each form has unique characteristics that allow dermatologists to visually identify psoriasis to determine what type, or types, of psoriasis is present. Sometimes a skin biopsy will be performed to confirm the diagnosis.
  • the main types of psoriasis include the following: ⁇ Plaque Psoriasis (reddened areas a few inches across covered by silvery scales)
  • Guttate Psoriasis small, red spots on the skin
  • Inverse or Flexural Psoriasis small, red patches in areas of friction such as in the folds of skin in the groin, the armpits or under the breasts
  • Erythroderma Psoriasis (reddening and scaling of most of the skin). Treatment depends on the severity and type of psoriasis. Some psoriasis is so mild that the person is unaware of the condition. A few develop such severe psoriasis that lesions cover most of the body and hospitalization is required. These represent the extremes. Most cases of psoriasis fall somewhere in between. Psoriasis treatments fall into 3 categories:
  • the present invention is based on the finding that there is an increase in the level of A 3 adenosine receptor expression in the peripheral blood mononuclear cells (PBMNC) of subjects suffering from psoriasis as compared to the PBMNC of a healthy subject.
  • PBMNC peripheral blood mononuclear cells
  • the A 3 AR level of expression in PBMNC may be used for determining the state or severity of psoriasis, e.g. for determining the presence or absence of a psoriasis state.
  • the A3 AR level of expression may be used for quantitative determination of the degree of severity of the psoriasis state.
  • the term "determining” or “determination” as used herein encompasses both quantitative and qualitative determination.
  • a method of determining a psoriasis state in a subject that comprises determining the level of expression of A 3 adenosine receptor (A 3 AR) in PBMNC from the subject.
  • a high level of expression of A 3 AR is indicative of a psoriasis state in the subject.
  • the value of a parameter indicative of said level of expression OfA 3 AR is determined.
  • the sample comprising PBMNC may be whole blood or may be a blood fraction that contains PBMNC.
  • a PBMNC-comprising sample may also at times be obtained from the lymphatic system, e.g. from lymph nodes.
  • Determining the level of expression may be carried out through determination of the level of A 3 AR mRNA as well or the level of A 3 AR protein.
  • the term "level of expression" as used herein thus includes the level of A 3 AR mRNA as well as the level ofA 3 AR protein or A 3 AR protein fragments in the sampled cells.
  • the level of the A 3 AR expression in the PBMNC is compared to a control level, the control level being the level of A 3 AR expression in normal PBMNC of a healthy subject, or being a standard reference level for the A 3 AR expression which is indicative of a normal state. It was found that medication may influence the level of the cellular A 3 AR expression.
  • a method for determining the severity of a psoriasis state in a subject comprising deterrnining the level of expression of A 3 AR in PBMNC of the subject, comparing the level of expression of A 3 AR in the cells with the level of prior determined standards that correlate A 3 AR expression level with severity of psoriasis disease, and optionally displaying the corresponding level of prior determined standards, said value being indicative of the severity of the psoriasis state in the subject.
  • the value of a parameter indicative of the level of expression of A 3 AR is determined, and compared to the value of a corresponding parameter of prior determined standards, the value of a corresponding parameter being indicative of the severity of the psoriasis state in the subject.
  • the prior determined standards may include, for example, a set of values, which may be a list of discrete values or a continuous curve, correlating results to a measure of severity of psoriasis; or it may be a set of descriptors, such as a qualitative list of possible results and their meanings in respect of severity of psoriasis, e.g.
  • the descriptors may list the range of possible color or color intensity outcomes and their meaning in respect of severity of psoriasis; or it may included graphical or pictorial representations of expected assay outcomes for different severities of psoriasis or different psoriasis states; or a set of reference standards, which may be run in parallel with the sample for calibration and evaluation of the data.
  • the standards may typically be obtained by assaying the expression level of A 3 AR in a plurality of samples from each of a number of psoriasis disease states to obtain a statistical measure of the correlation between expression level and the disease state.
  • the classification into disease states may for example be binary: light psoriasis and severe psoriasis.
  • the classification may also include a plurality of different states, such as, for example, light, moderate and severe psoriasis.
  • the classification may also be by the use of a numerical value, according to the. level of expression, e.g. a number between 1 and 10, for corresponding light through severe psoriasis, etc.
  • a method for determining the effectiveness of a psoriasis therapeutic treatment of a subject comprising administering an A 3 AR agonist to the subject.
  • the treatment may be a monotherapy with an A 3 AR or a combination therapy of an A 3 AR with another drug, such as a combination of an A 3 AR with methotrexate or cyclosporin:
  • the method in accordance with this aspect of the invention comprises determining the expression level of A 3 AR in PBMNCs from the subject at two or more successive time points, at least one of which is during the psoriasis treatment of said subject, and optionally displaying a value corresponding to a difference in the expression level from the two or more time points, wherein a statistically significant difference in the level is indicative of effectiveness of the drug treatment.
  • the successive time points may, for example, be one or more taken before a psoriasis treatment and one or more during the treatment, or one or more taken during the treatment and one or more taken during a
  • a high level of expression of A 3 AR is employed as an indicator of a psoriasis state in the subject.
  • the term "high level” is to be understood as meaning a significantly higher level of expression than in normal cells. A significantly higher level is determined according to statistical tests and considerations as known to those versed in statistical analyses.
  • the level of the A 3 AR expression in the PBMNC may be compared to a control level, the control level being the level of A 3 AR expression in normal PBMNC of a healthy subject.
  • it may be useful to determine the expression level by testing an assayed sample from an individual in parallel to one or more reference standards, e.g. one reference standard indicative of a normal state and another indicative of a psoriasis state; or one reference standard indicative of a normal state and two or more of different disease states.
  • the determined expression level is compared to standards.
  • the standards may be based on previously determined levels from healthy individuals and from individuals with a psoriasis state or with different psoriasis states.
  • the standards may be provided, for example, in the form of discrete numeric values or, in case the assay method is colorimetric, in the form of a chart with different colors or shadings for healthy and psoriasis states; or they may be provided in the form of a comparative curve prepared on the basis of such standards.
  • Such standards may be prepared by determining the level of A 3 AR expression (which may be the level of A 3 AR protein, protein fragment, or mRNA level etc., as discussed above) present in PBMNC cells obtained from a plurality of patients positively diagnosed (by other means, for example by a physician, by histological techniques etc.) as having psoriasis at varying levels of severity.
  • the severity of the disease for the preparation of the standards may also be determined by various conventional methods such as by pathological techniques.
  • the assay is carried out in parallel to a number of standards of healthy subjects and subjects of different psoriasis states and the level determined in the assayed sample is then compared to such standards.
  • a protein content level of between X 1 to X 2 per 1,000,000 cells may be defined as being indicative of grade 1 psoriasis
  • a higher protein content of Y 1 to Y 2 per 1,000,000 cells may be defined as being indicative of grade 2 psoriasis, etc.
  • the effectiveness of a psoriasis therapeutic treatment of a subject may be assessed by taking samples of PBMNC at various time points before, during and after the treatment. For example, a first sample may be taken at a time point prior to initiation of the treatment and a second sample may be taken at a time point during the treatment. A decrease in the level of the A 3 AR expression in the second sample as compared to the first sample would be indicative that the treatment is effective. The degree of decrease could be indicative of the degree of effectiveness of the treatment, i.e. the correlation would be quantitative. In another example, a first sample may be taken at a time point during the treatment and a second sample may be taken at a time point during the treatment subsequent to the time point of the first sample.
  • a decrease in the level of the A 3 AR expression in the second sample as compared to the first sample would be indicative that the treatment is effective.
  • a first sample may be taken at a time point during the treatment and a second sample may be taken at a time point after the treatment has been discontinued. In this case, an increase in the level of the A 3 AR expression in the second sample as compared to the first sample would be indicative that the treatment is effective.
  • the invention also provided a method for selecting a subject suffering from a psoriasis disease type, to receive a psoriasis therapeutic treatment that comprises administering to the subject an A 3 AR agonist, the method comprising determining the level of expression of A 3 AR in the PBMNCs of the subject and selecting the subject to receive the psoriasis therapeutic treatment if the level is above a predetermined level.
  • Said predetermined level may be a certain threshold level for all subjects.
  • Said predetermined level may also be a range of levels for different patient groups, for example: for different age groups; for different disease states; for different disease histories - histories of past medication (for example, methotrexate was found to induce an increase in the level of A 3 AR), number of years having the disease, etc.
  • Said predetermined level may be determined through clinical studies that look for correlation between receptor expression and drug response according to one of the acceptable response criteria.
  • Selection of subjects suitable for psoriasis treatment may be executed by determining the level of expression of A 3 AR in a sample of PBMNC withdrawn from said subject before treatment. The subject is selected if the determined level of A 3 AR is above a predefined threshold.
  • the threshold is a certain multiple of the level of A 3 AR expression in PBMNC of a healthy subject.
  • the threshold is determined on the basis of the average expression level in psoriasis patients, and may be said average or a certain multiple or fraction thereof.
  • the threshold is determined on the basis of clinical studies in human patients that are designed to determine the correlation between the level of expression and the response of the patients to said therapeutic treatment.
  • the threshold may be different for different psoriasis disease types.
  • selection criteria may not be completely predictive as to response and there may also be a certain fraction of patients selected in this was who will not respond to the treatment.
  • the selection method may also apply for selecting candidates for participating in clinical studies to test the efficacy of psoriasis treatments comprising administering to patients an A 3 AR agonist, either alone or in combination with other drugs such as methotrexate or cyclosporin.
  • an A 3 AR agonist such as methotrexate or cyclosporin.
  • a clinical study also known by the terms 'clinical trial' or 'clinical protocol'
  • Interventional trials determine whether experimental treatments or new ways of using known therapies are safe and effective under controlled environments. It is through clinical studies that physicians find new and better ways to prevent, detect, diagnose, control, and treat illnesses.
  • the clinical studies for which patients are selected, in accordance with the invention, based on the A 3 AR level may be Phase I, Phase II, Phase III, Phase IV or any other type of clinical study.
  • Fig. 1 depicts a bar graph and corresponding Western blots showing A 3 AR protein expression level in PBMNC from 8 psoriasis patients as compared to control;
  • Fig. 2 shows an agarose gel electrophoresis of mRNA from psoriasis biopsies, stained with ethidium bromide and visualized with UV illumination.
  • Rabbit polyclonal antibodies against human A 3 AR, goat polyclonal antibodies against rabbit and goat polyclonal antibodies against ⁇ -actin were all obtained from Santa Cruz Biotechnology Inc., Ca, USA, Cat. No. 13938, and stored at 4°C. Human blood sample collection
  • Blood samples were withdrawn from healthy subjects and from severe psoriasis patients, which did not respond to topical agents, and were prior to treatment with systemic drugs. The study was approved by the hospital ethical committee and the patients signed an informed consent prior to blood withdrawal. As a control we used a pool of PBMNC from 5 healthy subjects. A new pool was prepared each month.
  • the PBMNC layer was collected and suspended with PBS and then centrifuged at 800 rpm for 10' min at room temperature in order to get rid of platelets. Then the pellet was washed twice, dried by a gentle tapping of the tube on a towel paper and frozen at -80°C until use.
  • Proteins were extracted by utilizing TNN lysis buffer. The cell debris was removed by centrifugation for 10 min at 14,000 rpm. The supernatant was utilized for
  • Equal amounts of each sample were separated by SDS-PAGE, using 12% polyacrylamide gels. Eight lanes of each gel were loaded with protein samples of patients, one lane was loaded with the pool of control and the last lane was loaded with the Marker (for protein size determination). The resolved proteins were then electroblotted onto nitrocellulose membranes. The membranes were blocked with 5% non-fat milk in TBST buffer, incubated with the relevant primary antibody (dilution 1 :1000) for 24h at 4°C. Blots were then washed and incubated with the secondary antibody for Ih at room temperature. Bands were recorded using color development kit
  • a 3 AR expression level was evaluated by measuring the optical density of each relevant band utilizing an image analysis system and normalized against ⁇ -actin. The number of pixels for the pooled control sample was designated as one unit and the rest of the sample values were calculated against the control.
  • Paraffin embedded slides from lesions of a patient with psoriasis and from normal skin biopsies were de-paraffinized in xylen. The samples were then re-hydrated by washing in serial dilutions of ethanol. After re-hydration, 20 ⁇ l of solution A [1.25XPCR buffer (200 Mm Tris-HCl, 500 mM KCl), 6.25 mM MgCl 2 , 5 U RNasin (Promega, Madison, WI), 2mM DTT, 1 U RQl RNase-free DNase (Promega)] was directly applied on the tissue sections and then scraped off the slide and collected.
  • 1.25XPCR buffer 200 Mm Tris-HCl, 500 mM KCl
  • 6.25 mM MgCl 2 5 U RNasin (Promega, Madison, WI)
  • 2mM DTT 1 U RQl RNase-free DNase (Promega)
  • ATACCGCGGGATGGCAGACC was performed.
  • the products were electrophoresed on 2% agarose gels, stained with ethidium bromide and visualized with UV illumination.
  • the specificity of the RT-PCR reaction was confirmed by size determination on agarose gels in comparison to a negative control, from RNA extracted using standard techniques and by sequencing the RT-PCR product and comparing the sequences to that of the known sequences (ADORA3-L77729, L77730).
  • the optical density of the bands (Et-Br) was quantified using an image analysis system.
  • Fig. 1 The level of A 3 AR protein expression level in PBMNC from 8 psoriasis patients is shown in Fig. 1. It can be seen that the A3 AR protein was highly expressed in comparison to that of healthy subjects. Remarkably, an increase of 16.06 ⁇ 6.4 fold in A3 AR expression in the psoriasis vs, healthy subjects was noted.
  • the level of A 3 AR mRNA expression in PBMNC from psoriasis patients is shown in Fig. 2. Analysis of mRNA in the paraffin embedded slides from psoriasis biopsies revealed up-regulation of mRNA expression vs. lower expression in the normal skin lesions.
  • a statistically significant increase in A 3 AR protein expression level was recorded in the PBMNC of patients with psoriasis.
  • the highest receptor level was recorded in patients with psoriasis.
  • Direct correlation was found between protein and mRNA expression level, the latter being up-regulated in skin biopsy from psoriasis vs. those from healthy subjects.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Une méthode de déterminer l'état d'un psoriasis chez un sujet. La méthode consiste à déterminer le niveau d'expression du récepteur de l'adénosine A3 (A3AR) dans le sang périphérique des cellules mononucléaires (PBMNC) du sujet, un haut niveau d'expression d'A3AR étant indicatif d'un état de psoriasis chez le sujet. L'invention porte également sur une méthode de détermination de la sévérité d'un état de psoriasis chez un sujet et sur une méthode de détermination de l'efficacité d'un traitement du psoriasis chez un sujet.
PCT/IL2007/001365 2006-11-09 2007-11-08 Marqueur biologique du psoriasis WO2008056361A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US85780606P 2006-11-09 2006-11-09
US60/857,806 2006-11-09

Publications (1)

Publication Number Publication Date
WO2008056361A1 true WO2008056361A1 (fr) 2008-05-15

Family

ID=39184682

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IL2007/001365 WO2008056361A1 (fr) 2006-11-09 2007-11-08 Marqueur biologique du psoriasis

Country Status (1)

Country Link
WO (1) WO2008056361A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011027348A1 (fr) 2009-09-06 2011-03-10 Can-Fite Biopharma Ltd. Composition pharmaceutique contenant un agoniste du récepteur de l'adénosine a3 (ib-meca/cf-101) pour le traitement du psoriasis
US8735407B2 (en) 2008-03-31 2014-05-27 The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Purine derivatives as A3 adenosine receptor-selective agonists
US8796291B2 (en) 2008-08-01 2014-08-05 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services A3 adenosine receptor antagonists and partial agonists
US8916570B2 (en) 2008-03-31 2014-12-23 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services A3 adenosine receptor agonists and antagonists
US9181253B2 (en) 2008-08-01 2015-11-10 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Adenosine receptor agonists, partial agonists, and antagonists

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004038419A1 (fr) * 2002-10-22 2004-05-06 Can-Fite Biopharma Ltd. Utilisation du recepteur de l'adenosine a3 en tant que marqueur d'un etat pathologique
US20040229246A1 (en) * 2002-10-21 2004-11-18 Can-Fite Biopharam Ltd. Diagnostic markers for therapeutic treatment
WO2006059327A1 (fr) * 2004-12-02 2006-06-08 Can-Fite Biopharma Ltd. Marqueur biologique d'etat inflammatoire

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040229246A1 (en) * 2002-10-21 2004-11-18 Can-Fite Biopharam Ltd. Diagnostic markers for therapeutic treatment
WO2004038419A1 (fr) * 2002-10-22 2004-05-06 Can-Fite Biopharma Ltd. Utilisation du recepteur de l'adenosine a3 en tant que marqueur d'un etat pathologique
WO2006059327A1 (fr) * 2004-12-02 2006-06-08 Can-Fite Biopharma Ltd. Marqueur biologique d'etat inflammatoire

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8735407B2 (en) 2008-03-31 2014-05-27 The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Purine derivatives as A3 adenosine receptor-selective agonists
US8916570B2 (en) 2008-03-31 2014-12-23 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services A3 adenosine receptor agonists and antagonists
US8796291B2 (en) 2008-08-01 2014-08-05 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services A3 adenosine receptor antagonists and partial agonists
US9181253B2 (en) 2008-08-01 2015-11-10 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Adenosine receptor agonists, partial agonists, and antagonists
WO2011027348A1 (fr) 2009-09-06 2011-03-10 Can-Fite Biopharma Ltd. Composition pharmaceutique contenant un agoniste du récepteur de l'adénosine a3 (ib-meca/cf-101) pour le traitement du psoriasis
US20120165284A1 (en) * 2009-09-06 2012-06-28 Can-Fite Biopharma Ltd. Pharmaceutical composition comprising a3 adenosine receptor agonist (ib-meca/cf-101) for treatment of psoriasis
EP2475371A1 (fr) * 2009-09-06 2012-07-18 Can-Fite Biopharma Ltd. Composition pharmaceutique contenant un agoniste du récepteur de l'adénosine a3 (ib-meca/cf-101) pour le traitement du psoriasis
JP2013503851A (ja) * 2009-09-06 2013-02-04 キャン−ファイト バイオファーマ リミテッド 乾癬治療のためのａ３アデノシン受容体アゴニスト（ｉｂ−ｍｅｃａ／ｃｆ−１０１）を含む医薬組成物
US8987228B2 (en) 2009-09-06 2015-03-24 Can-Fite Biopharma Ltd. Pharmaceutical composition including an A3 adenosine receptor agonist 1-deooxy-1-[N6-(3-idobenzyl)-adenin-9-yl]-N-methyl-β-D-ribofuronamide(IB-MECA/CF-101) for treatment of psoriasis
EP2475371B1 (fr) * 2009-09-06 2016-11-23 Can-Fite Biopharma Ltd. Composition pharmaceutique comprenant un agonist du recepteur a3 adenosine (ib-meca/cf-101) pour le traitement du psoriasis
KR101741281B1 (ko) 2009-09-06 2017-06-15 캔-파이트 바이오파마 리미티드 건선 치료를 위한 ａ3 아데노신 수용체 작동약 (ｉｂ-ｍｅｃａ/ｃｆ-101)을 포함하는 제약학적 조성물

Similar Documents

Publication Publication Date Title
Caviglia et al. Serum zonulin in patients with inflammatory bowel disease: a pilot study
Hessam et al. Correlation of inflammatory serum markers with disease severity in patients with hidradenitis suppurativa (HS)
Kontic et al. Aberrant Promoter Methylation of CDH13 and MGMT Genes is Associated With Clinicopathologic Characteristics of Primary Non–Small-Cell Lung Carcinoma
US8541182B2 (en) Biological marker for inflammation
US9316651B2 (en) Methods and compositions for biomarkers of fatigue
JP2012526544A5 (fr)
WO2008056361A1 (fr) Marqueur biologique du psoriasis
Villacorta et al. Prognostic value of plasma neutrophil gelatinase-associated lipocalin in patients with heart failure
KR20190039089A (ko) 결장직장암에 대한 복합 테스트
CN108450000A (zh) 痰液样本中无细胞的核小体作为生物标记的用途
Gong et al. Nuclear factor κB activity in patients with acute severe cholangitis
Jin et al. Plasma heat shock protein 27 is associated with coronary artery disease, abdominal aortic aneurysm and peripheral artery disease
TW201930881A (zh) 大腸直腸腺瘤之檢測及治療方法
US20040229246A1 (en) Diagnostic markers for therapeutic treatment
EP2962112A1 (fr) Procédé pour la prédiction d'efficacité de thérapies mettant en uvre des biomarqueurs de structure de nucléosomes
KR102253304B1 (ko) 위암 재발 예측용 바이오 마커
WO2019242741A1 (fr) Biomarqueurs pour le carcinome urothélial et leurs applications
Ahrens et al. Evaluation of YB-1 levels in patients with endometriosis
JP2006503564A (ja) 治療学的処置のための診断マーカー
WO2023022200A1 (fr) Biomarqueur de prédiction de la réponse à un inhibiteur de point de contrôle immunitaire
KR20190023708A (ko) 폐 편평상피세포암 바이오마커 및 이를 이용한 폐 편평상피세포암 진단방법
WO2022255782A1 (fr) Biomarqueurs pour prédire la réponse au traitement de la polyarthrite rhumatoïde
Souza Pinhel et al. Comparación del perfil de expresión génica entre células de la sangre y el tejido adiposo blanco de pacientes con obesidad
Souza et al. Comparison of gene expression profile between blood cells and white adipose tissue of patients with obesity
CN115537465A (zh) Sctag在胃癌癌前预警和靶向药物中的应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07827338

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07827338

Country of ref document: EP

Kind code of ref document: A1