WO2008051306A1 - Récepteurs de tnf solubles et leur utilisation pour le traitement de maladies - Google Patents

Récepteurs de tnf solubles et leur utilisation pour le traitement de maladies Download PDF

Info

Publication number
WO2008051306A1
WO2008051306A1 PCT/US2007/010556 US2007010556W WO2008051306A1 WO 2008051306 A1 WO2008051306 A1 WO 2008051306A1 US 2007010556 W US2007010556 W US 2007010556W WO 2008051306 A1 WO2008051306 A1 WO 2008051306A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
seq
exon
tnfr2
protein
Prior art date
Application number
PCT/US2007/010556
Other languages
English (en)
Other versions
WO2008051306A8 (fr
Inventor
Peter L. Sazani
Maria Graziewicz
Ryszard Kole
Original Assignee
Ercole Biotech, Inc.
The University Of North Carolina At Chapel Hill
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US2006/043651 external-priority patent/WO2007058894A2/fr
Application filed by Ercole Biotech, Inc., The University Of North Carolina At Chapel Hill filed Critical Ercole Biotech, Inc.
Priority to CA002666981A priority Critical patent/CA2666981A1/fr
Priority to AU2007309650A priority patent/AU2007309650A1/en
Priority to EP07776571A priority patent/EP2089521A1/fr
Priority to CN200780053595.5A priority patent/CN101889086B/zh
Priority to PCT/EP2007/061211 priority patent/WO2008131807A2/fr
Priority to CA3072221A priority patent/CA3072221A1/fr
Priority to EP07821575.3A priority patent/EP2147103B1/fr
Priority to KR1020187020209A priority patent/KR20180082646A/ko
Priority to MX2012008375A priority patent/MX346434B/es
Priority to KR1020157006381A priority patent/KR20150036814A/ko
Priority to MX2009011856A priority patent/MX2009011856A/es
Priority to CN201410244615.9A priority patent/CN104278033A/zh
Priority to CA3165250A priority patent/CA3165250A1/fr
Priority to CA2991580A priority patent/CA2991580A1/fr
Priority to KR1020097025067A priority patent/KR101531934B1/ko
Priority to AU2007352163A priority patent/AU2007352163A1/en
Priority to KR1020157033784A priority patent/KR101738655B1/ko
Priority to KR1020177013046A priority patent/KR20170056032A/ko
Priority to JP2010504466A priority patent/JP2010524476A/ja
Priority to CA002684724A priority patent/CA2684724A1/fr
Publication of WO2008051306A1 publication Critical patent/WO2008051306A1/fr
Publication of WO2008051306A8 publication Critical patent/WO2008051306A8/fr
Priority to US12/960,296 priority patent/US20120040917A1/en
Priority to HK11104796.5A priority patent/HK1150850A1/xx
Priority to JP2013222417A priority patent/JP2014050400A/ja
Priority to HK15105622.8A priority patent/HK1205184A1/xx

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7151—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for tumor necrosis factor [TNF], for lymphotoxin [LT]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA

Definitions

  • the present invention relates to tumor necrosis factor (TNF) antagonists and corresponding nucleic acids derived from TNF receptors and their use in the treatment of inflammatory diseases.
  • TNF tumor necrosis factor
  • These proteins are soluble secreted decoy receptors that bind to TNF- ⁇ and prevent TNF- ⁇ from signaling to cells.
  • TNF- ⁇ is a pro-inflammatory cytokine that exists as a membrane -bound homotrimer and is released as a homotrimer into the circulation by the protease TNF- ⁇ converting enzyme (TACE).
  • TNF- ⁇ is introduced into the circulation as a mediator of the inflammatory response to injury and infection.
  • TNF- ⁇ activity is implicated in the progression of inflammatory diseases such as rheumatoid arthritis, Crohn's disease, ulcerative colitis, psoriasis and psoriatic arthritis (Palladino, M.A., et al., 2003, Nat. Rev. Drug Discov. 2:736-46).
  • TNF- ⁇ Acute exposure to high TNF- ⁇ levels, as experienced during a massive infection, results in sepsis. Its symptoms include shock, hypoxia, multiple organ failure, and death. Chronic low-level release of TNF- ⁇ is associated with malignancies and leads to cachexia, a disease characterized by weight loss, dehydration and fat loss.
  • TNF- ⁇ activity is mediated primarily through two receptors coded by two different genes, TNF- ⁇ receptor type I (hereafter "TNFRl”, exemplified by GenBank accession number X55313 for human TNFRl) and TNF- ⁇ receptor type II (hereafter "TNFR2", exemplified by GenBank accession number NMJ)01066 for human TNFR2).
  • TNFRl is a membrane-bound protein with a molecular weight of approximately 55 kilodaltons (kDal)
  • TNFR2 is a membrane-bound protein with a molecular weight of approximately 75 kDal.
  • TNFRl and TNFR2 belong to a family of receptors known as the TNF receptor (TNFR) superfamily.
  • the TNFR superfamily is a group of type I transmembrane proteins, with a carboxy-terminal intracellular domain and an amino-terminal extracellular domain characterized by a common cysteine rich domain (CRD).
  • CCD cysteine rich domain
  • TNFRl and TNFR2 have a unique domain in common, called the pre-ligand-bind ⁇ ng assembly domain (PLAD) that is required for assembly of multiple receptor subunits and subsequent binding to TNF- ⁇ .
  • PAD pre-ligand-bind ⁇ ng assembly domain
  • TNFRl and TNFR2 also share a common gene structure, in which the coding sequence of each extends over 10 exons separated by 9 introns (Fuchs, et al., 1992, Genomics 13:219; Santee, et al., 1996, J. Biol. Chem. 35:21151). Most of the transmembrane domain sequence is encoded by the seventh exon ("exon 7") (See FIG. 1).
  • TNFR2 knockout mice but not TNFRl knockout mice, were resistant to experimentally-induced cerebral malaria (Lucas, R., et al., 1997, Eur. J. Immunol. 27: 1719); whereas TNFRl knockout mice were resistant to autoimmune encephalomyelitis (Suvannavejh, G.C., et al., 2000, Cell. Immunol., 205:24). These knockout mice are models for human cerebral malaria and multiple sclerosis, respectively.
  • TNFR2 is present at high density on T cells of patients with interstitial lung disease, suggesting a role for TNFR2 in the immune responses that lead to alveolitis (Agostini, C, et al., 1996, Am. J. Respir. Crit. Care Med., 153:1359). TNFR2 is also implicated in human disorders of lipid metabolism. TNFR2 polymorphism is associated with obesity and insulin resistance (Fernandez-Real, et al., 2000, Diabetes Care, 23:831), familial combined hyperlipidemia (Geurts, et al., 2000, Hum. MoI. Genet.
  • TNFR2 polymorphism is associated with susceptibility to human narcolepsy (Hohjoh, H., et al., 2000, Tissue Antigens, 56:446) and to systemic lupus erythematosus (Komata, T., et al., 1999, Tissue Antigens, 53:527).
  • Amino acid 1 is the first amino acid of the full length protein human TNFR2, which includes the signal sequence.
  • Amino acid 23 located in exon 1 is the first amino acid of the mature protein, which is the protein after cleavage of the signal sequence.
  • the transmembrane region spans amino acids 258-287.
  • the exon 6/7 junction is located within the codon that encodes residue 263, while the exon 7/8 junction is located within the codon that encodes residue 289.
  • TNFRl and TNFR2 Physiological, soluble fragments of both TNFRl and TNFR2 have been identified. For example, soluble extracellular domains of these receptors are shed to some extent from the cell membrane by the action of metalloproteases (Palladino, M.A., et al., 2003, Nat. Rev. Drug Discov. 2:736-46). Additionally, the pre-mRNA of TNFR2 undergoes alternative splicing, creating either a full length, active membrane-bound receptor, or a secreted receptor that lacks exons 7 and 8 (Lainez et al., 2004, Int. Immunol., 16: 169) ("Lainez").
  • the secreted protein binds TNF- ⁇ but does not elicit a physiological response, hence reducing overall TNF- ⁇ activity.
  • an endogenous, secreted splice variant of TNFRl has not yet been identified, the similar genomic structure of the two receptors suggests that a TNFRl splice variant can be produced.
  • the cDNA for the splice variant identified by Lainez contains the 113 bp deletion of exons 7 and 8. This deletion gives rise to a stop codon 17 bp after the end of exon 6. Consequently, the protein has the sequence encoded by the first six exons of the TNFR2 gene (residues 1-262) followed by a 6 amino acid tail of Ala-Ser-Leu-Ala-Cys-Arg.
  • Additional soluble fragments of recombinantly-engineered TNF receptors are known. In particular, truncated forms of TNFRl or TNFR2 have been produced which have (1) all or part of the extracellular domain or (2) a TNFR extracellular domain fused to another protein.
  • TNFR2s include a protein with residues 23- 257, which terminates immediately before the transmembrane region, and a protein with residues 23-185 (U.S. Pat. No. 5,945,397). Both TNFR2 fragments are soluble and capable of binding TNF- ⁇ .
  • TNFRtFc is an FDA-approved treatment for certain forms of arthritis, ankylosing spondylitis, and psoriasis and is sold under the name etanercept (Enbrel®).
  • TNF- ⁇ antagonists and methods for their use in the treatment of inflammatory diseases there is a need for TNF- ⁇ antagonists and methods for their use in the treatment of inflammatory diseases.
  • TNFR2 protein lacking only exon 7 surprisingly showed that it is a particularly stable, soluble decoy receptor that binds to and inactivates extracellular TNF- ⁇ .
  • This protein unexpectedly has anti-TNF- ⁇ activity that is at least equivalent to TNFR:Fc.
  • One embodiment of the invention is a protein, either full length or mature, which can bind TNF, is encoded by a cDNA derived from a mammalian TNFR gene, and in the cDNA exon 6 is followed directly by exon 8 and as a result lacks exon 7 ("TNFR ⁇ 7").
  • the invention is a pharmaceutical composition comprising a TNFR ⁇ 7.
  • the invention is a method of treating an inflammatory disease or condition by administering a pharmaceutical composition comprising a TNFR ⁇ 7.
  • the invention is a nucleic acid that encodes a TNFR ⁇ 7.
  • the invention is a pharmaceutical composition comprising a nucleic acid that encodes a TNFR ⁇ 7.
  • the invention is an expression vector comprising a nucleic acid that encodes a TNFR ⁇ 7.
  • the invention is a method of increasing the level of a soluble TNFR in the serum of a mammal by transforming cells of the mammal with an expression vector comprising a nucleic acid that encodes a TNFR ⁇ 7.
  • the invention is a cell transformed with an expression vector comprising a nucleic acid that encodes a TNFR ⁇ 7.
  • the invention is a method of producing a TNFR ⁇ 7 by culturing, under conditions suitable to express the TNFR ⁇ 7, a cell transformed with an expression vector comprising a nucleic acid that encodes a TNFR ⁇ 7.
  • the invention is a method of treating an inflammatory disease or condition by administering an expression vector comprising a nucleic acid that encodes a TNFR ⁇ 7.
  • splice-switching oligomers that alter the splicing of a mammalian TNFR2 pre-mRNA to produce a mammalian TNFR2 protein, which can bind TNF and where exon 6 is followed directly by exon 8 and as a result lacks exon 7 ("TNFR2 ⁇ 7").
  • One embodiment of the invention is a method of treating an inflammatory disease or condition by administering SSOs to a patient or a live subject.
  • the SSOs that are administered alter the splicing of a mammalian TNFR2 pre-mRNA to produce a TNFR2 ⁇ 7.
  • the invention is a method of producing a TNFR2 ⁇ 7 in a cell by administering SSOs to the cell.
  • FIG. 1 schematically depicts the human TNFR2 structure. Relevant exons and introns are represented by boxes and lines, respectively. The signal sequence and the transmembrane region are shaded. Residues that form the boundaries of the signal sequence, the transmembrane region, and the final residue are indicated below the diagram. Exon boundaries are indicated above the diagram; if the 3' end of an exon and the 5' end of the following exon have the same residue number, then the splice junction is located within the codon encoding that residue.
  • FIG. 2A graphically illustrates the amount of soluble TNFR2 from SSO treated primary human hepatocytes.
  • the indicated SSO was transfected into primary human hepatocytes at 50 nM. After —48 hrs, the extracellular media was analyzed by enzyme linked immunosorbant assay (ELISA) for soluble TNFR2 using the Quantikine® Human sTNF RII ELISA kit from R&D Systems (Minneapolis, MN). Error bars represent the standard deviation for 3 independent experiments.
  • ELISA enzyme linked immunosorbant assay
  • FIG. 2B Total RNA was analyzed for TNFR2 splice switching by RT-PCR using primers specific for human TNFR2. SSOs targeted to exon seven led to shifting from full length TNFR2 mRNA (FL) to TNFR2 ⁇ 7 mRNA ( ⁇ 7). SSO 3083 is a control SSO with no TNFR2 splice switching ability.
  • FIG. 3 shows the splicing products of L929 cells treated with SSO 10-mers targeted to mouse TNFR2 exon 7.
  • L929 cells were transfected with the indicated SSO concentration (50 or 10OnM), and evaluated for splice switching of TNFR2 by RT-PCR 24 hrs later.
  • PCR primers were used to amplify from Exon 5 to Exon 9, so that "Full Length" (FL) TNFR2 is represented by a 486 bp band.
  • Transcripts lacking exon 7 ( ⁇ 7) is represented by a 408 bp band.
  • FIGs. 4 A and 4B show the splicing products of mice treated with SSO 10-mers targeted to mouse TNFR2 exon 7.
  • the indicated SSOs were resuspended in saline, and injected i.p. into mice at 25mg/kg/day for 5 days. Mice were prebled before SSO injection, and 10 days after the final SSO injection and sacrificed. At the time of sacrifice, total RNA from livers was analyzed for TNFR2 splice switching by RT-PCR. FL - full length TNFR2; ⁇ 7 - TNFR2 ⁇ 7 (FIG. 4A).
  • the concentration of TNFR2 ⁇ 7 in the serum taken before (Pre) and after (Post) SSO injection was determined by ELISA using the Quantikine® Mouse sTNF RII ELISA kit from R&D Systems (Minneapolis, MN) (FIG. 4B). Error bars represent the standard error from 3 independent readings of the same sample.
  • FlG. 5 depicts the splice switching ability of SSOs of different lengths.
  • Primary human hepatocytes were transfected with the indicated SSO and TNFR2 expression analyzed by RT-PCR (top panel) and ELISA (bottom panel) as in Figure 2. Error bars represent the standard deviation from 2 independent experiments.
  • FIGs. 6A and 6B illustrate TNFR2 ⁇ 7 mRNA induction in the livers of SSO treated mice.
  • FIG. 6A Total RNA from the livers of SSO 3274 treated mice were subjected to RT-PCR, and the products visualized on a 1.5% agarose gel. The sequence of the exon 6 — exon 8 junction is shown in FIG. 6B.
  • FIGs. 7A and 7B illustrate TNFR2 ⁇ 7 mRNA induction in SSO treated primary human hepatocytes.
  • FIG. 7A Total RNA from SSO 3379 treated cells were subjected to RT- PCR, and the products visualized on a 1.5% agarose gel. The sequence of the exon 6 - exon 8 junction is shown in FIG. 7B.
  • FIGs. 8 A and 8B illustrate the dose dependence of TNFR2 pre-mRNA splicing shifting by SSO 3378, 3379 and 3384.
  • Primary human hepatocytes were transfected with 1- 15OnM of the indicated SSO. After ⁇ 48 hrs, the cells were harvested for total RNA, and the extracellular media was collected.
  • FIG. 8A Total RNA was analyzed for TNFR2 splice switching by RT-PCR using primers specific for human TNFR2. For each SSO 5 amount of splice switching is plotted as a function of SSO concentration.
  • FIG. 8B The concentration of soluble TNFR2 in the extracellular media was determined by ELISA and plotted as a function of SSO.
  • FIG. 9 graphically illustrates detection of secreted TNFR2 splice variants from L929 cells.
  • Cells were transfected with the indicated SSOs. After 72 hrs, the extracellular media was removed and analyzed by ELISA. The data are expressed as pg soluble TNFR2 per mL.
  • FIG. 10 shows the splicing products for intraperitoneal (i.p.) injection of SSO 3274 (top) and 3305 (bottom) in mice.
  • SSO 3274 was injected i.p. at 25 mg/kg/day for either 4 days (4/1 and 4/10) or 10 days (10/1).
  • Mice were sacrificed either 1 day (4/1 and 10/1) or 10 days (4/10) after the last injection and total RNA from liver was analyzed by RT-PCR for TNFR2 splice switching as described in Figure 3.
  • SSO 3305 was injected at the indicated dose per day for 4 days. Mice were sacrificed the next day and the livers analyzed as with 3274 treated animals.
  • FIG. 1 IA graphically illustrates the amount of soluble TNFR2 in mouse serum 10 days after SSO treatment.
  • FIG. 12A graphically illustrates the amount of soluble TNFR2 in mouse serum 27 days after SSO treatment. Mice were treated as described in Figure 11, except that serum samples were collected until day 27 after the last injection. SSOs 3083 and 3272 are control SSOs with no TNFR2 splice switching ability. At day 27, mice were sacrificed and livers were analyzed for TNFR2 splice switching by RT-PCR (FIG. 12B) as described in Figure 11.
  • FIGs. 13A and 13B graphically depict the anti-TNF- ⁇ activity in a cell-based assay using serum from SSO treated mice, where serum samples were collected 5 days (FIG. 6A) and 27 days (FIG. 6B) after SSO treatment. L929 cells were treated with either 0.1 ng/mL TNF- ⁇ , or TNF- ⁇ plus 10% serum from mice treated with the indicated SSO. Cell viability was measured 24 hrs later and normalized to untreated cells.
  • FIG. 14 graphically compares the anti-TNF- ⁇ activity of serum from the indicated SSO oligonucleotide-treated mice to recombinant soluble TNFR2 (rsTNFR2) extracellular domain from Sigma® and to Enbrel® using the cell survival assay described in Figure 13.
  • FIG. 16 plots TNFR2 ⁇ 7 protein (dashed line) and mRNA (solid line) levels over time, as a percentage of the amount of protein or mRNA 3 respectively, 10 days after the last injection.
  • FIG. 17 graphically illustrates the dose dependant anti-TNF- ⁇ activity of TNFR2 ⁇ 7 expressed in HeLa cells after transfection with TNFR2 ⁇ 7 mammalian expression plasmids.
  • HeLa cells were transfected with the indicated mouse or human TNFR2 ⁇ 7 plasmid and extracellular media was collected after 48 hrs.
  • the TNFR2 ⁇ 7 concentration in the media was determined by ELISA and serial dilutions were prepared. These dilutions were assayed for anti-TNF- ⁇ activity by the L929 cytoxicity assay as in FIG. 14.
  • FIG. 17 graphically illustrates the dose dependant anti-TNF- ⁇ activity of TNFR2 ⁇ 7 expressed in HeLa cells after transfection with TNFR2 ⁇ 7 mammalian expression plasmids.
  • HeLa cells were transfected with the indicated mouse or human TNFR2 ⁇ 7 plasmid and extracellular media was collected after 48 hrs.
  • FIG. 18 shows expressed mouse (A) and human (B) TNFR2 ⁇ 7 protein isolated by polyacrylamide gel electrophoresis (PAGE).
  • HeLa cells were transfected with the indicated plasmid. After ⁇ 48 hrs, the extracellular media was collected and concentrated, and cells were collected in RIPA lysis buffer. The proteins in the samples were separated by PAGE and a western blot was performed using a C-terminal TNFR2 primary antibody (Abeam) that recognizes both the human and mouse TNFR2 ⁇ 7 proteins.
  • Media extracellular media samples from HeLa cells transfected with the indicated plasmid; Lysate, cell lysate from HeIa cells transfected with the indicated plasmid.
  • CM control media from untransfected HeLa cells;
  • CL control cell lysates from untransfected HeLa cells. +, molecular weight markers (kDal).
  • FIG. 19 shows purified His-tagged human and mouse TNFR2 ⁇ 7.
  • Unconcentrated extracellular media containing the indicated TNFR2 ⁇ 7 protein was prepared as in Figure 18.
  • Approximately 32 mL of the media was applied to a 1 mL HisPur cobalt spin column (Pierce), and bound proteins were eluted in 1 mL buffer containing 150 mM imidazole.
  • Samples of each were analyzed by PAGE and western blot was performed as hi Figure 18.
  • the multiple bands in lanes 1144-4 and 1319-1 represent variably glycosylated forms of TNFR2 ⁇ 7.
  • tumor necrosis factor receptor As used herein, the terms “tumor necrosis factor receptor”, “TNF receptor”, and “TNFR” refer to proteins having amino acid sequences of or which are substantially similar to native mammalian TNF receptor sequences, and which are capable of binding TNF molecules.
  • a "native" receptor or gene for such a receptor means a receptor or gene that occurs in nature, as well as the naturally-occurring allelic variations of such receptors and genes.
  • mature as used in connection with a TNFR means a protein expressed in a form lacking a leader or signal sequence as may be present in full-length transcripts of a native gene.
  • TNFR proteins as used herein follows the convention of naming the protein (e.g., TNFR2) preceded by a species designation, e.g., hu (for human) or mu (for murine), followed by a ⁇ (to designate a deletion) and the number of the exon(s) deleted.
  • a species designation e.g., hu (for human) or mu (for murine)
  • ⁇ to designate a deletion
  • huTNFR2 ⁇ 7 refers to human TNFR2 lacking exon 7.
  • TNFR refers generically to mammalian TNFR.
  • secreted means that the protein is soluble, i.e., that it is not bound to the cell membrane.
  • a form will be soluble if using conventional assays known to one of skill in the art most of this form can be detected in fractions that are not associated with the membrane, e.g., in cellular supernatants or serum.
  • stable means that the secreted TNFR form is detectable using conventional assays by one of skill in the art, such as, western blots, ELISA assays in harvested cells, cellular supernatants, or serum.
  • TNF tumor necrosis factor
  • TNF tumor necrosis factor
  • an inflammatory disease or condition refers to a disease, disorder, or other medical condition that at least in part results from or is aggravated by the binding of TNF to its receptor.
  • diseases or conditions include, but are not limited to, those associated with increased levels of TNF, increased levels of TNF receptor, or increased sensitization or deregulation of the corresponding signaling pathway.
  • the term also encompasses diseases and conditions for which known TNF antagonists have been shown useful.
  • inflammatory diseases or conditions include, but are not limited to, rheumatoid arthritis, juvenile rheumatoid arthritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, inflammatory bowel disease (including Crohn's disease and ulcerative colitis), hepatitis, sepsis, alcoholic liver disease, and non-alcoholic steatosis.
  • hepatitis refers to a gastroenterological disease, condition, or disorder that is characterized, at least in part, by inflammation of the liver.
  • hepatitis examples include, but are not limited to, hepatitis associated with hepatitis A virus, hepatitis B virus, hepatitis C virus, or liver inflammation associated with ischemia/reperfusion.
  • TNF antagonist means that the protein is capable of measurable inhibition of TNF-mediated cytotoxicity using standard assays as are well known in the art . (See, e.g., Example 1 below, L929 cytotoxicity assay).
  • binds TNF means that the protein can bind detectable levels of TNF, preferably TNF- ⁇ , as measured by standard binding assays as are well known in the art (See, e.g., U.S. Pat. No. 5,945,397 to Smith, cols. 16-17).
  • receptors of the present invention are capable of binding greater than 0.1 nmoles TNF- ⁇ /nmole receptor, and more preferably, greater than 0.5 nmoles TNF- ⁇ /nmole receptor using standard binding assays.
  • regulatory element refers to a nucleotide sequence involved in an interaction of molecules that contributes to the functional regulation of a nucleic acid, including but not limited to, replication, duplication, transcription, splicing, translation, or degradation of the nucleic acid.
  • the regulation may be enhancing or inhibitory in nature.
  • Regulatory elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers.
  • a promoter is a DNA region that is capable under certain conditions of aiding the initiation of transcription of a coding region usually located downstream (in the 3' direction) from the promoter.
  • operably linked refers to a juxtaposition of genetic elements, wherein the elements are in a relationship permitting them to operate in the expected manner.
  • a promoter is operably linked to a coding region if the promoter helps initiate transcription of the coding sequence. As long as this functional relationship is maintained, there can be intervening residues between the promoter and the coding region.
  • the terms "transformation” or “transfection” refer to the insertion of an exogenous nucleic acid into a cell, irrespective of the method used for the insertion, for example, lipofection, transduction, infection or electroporation.
  • the exogenous nucleic acid can be maintained as a non-integrated vector, for example, a plasmid, or alternatively, can be integrated into the cell's genome.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • plasmid refers to a circular double stranded DNA loop into which additional DNA segments can be ligated.
  • viral vector Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome.
  • Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
  • vectors e.g., non- episomal mammalian vectors
  • Other vectors are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
  • certain vectors, expression vectors are capable of directing the expression of genes to which they are operably linked.
  • expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. or viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses).
  • isolated protein refers to a protein or polypeptide that is not naturally-occurring and/or is separated from one or more components that are naturally associated with it.
  • isolated nucleic acid refers to a nucleic acid that is not naturally-occurring and/or is in the form of a separate fragment or as a component of a larger construct, which has been derived from a nucleic acid isolated at least once in substantially pure form, i.e., free of contaminating endogenous materials, and in a quantity or concentration enabling identification and manipulation by standard biochemical methods, for example, using a cloning vector.
  • purified protein refers to a protein that is present in the substantial absence of other protein. However, such purified proteins can contain other proteins added as stabilizers, carriers, excipients, or co-therapeutics.
  • purified as used herein preferably means at least 80% by dry weight, more preferably in the range of 95- 99% by weight, and most preferably at least 99.8% by weight, of protein present, excluding proteins added as stabilizers, carriers, excipients, or co-therapeutics.
  • altering the splicing of a pre-mRNA refers to altering the splicing of a cellular pre-mRNA target resulting in an altered ratio of splice products.
  • alteration of splicing can be detected by a variety of techniques well known to one of skill in the art. For example, RT-PCR on total cellular RNA can be used to detect the ratio of splice products in the presence and the absence of an SSO.
  • the term "complementary" is used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between an oligonucleotide and a DNA or RNA containing the target sequence. It is understood in the art that the sequence of an oligonucleotide need not be 100% complementary to that of its target. For example, for an SSO there is a sufficient degree of complementarity when, under conditions which permit splicing, binding to the target will occur and non-specific binding will be avoided.
  • One embodiment of the present invention is a protein, either full length or mature, which is encoded by a cDNA derived from a mammalian TNFR gene, and in the cDNA exon 6 is followed directly by exon 8 and as a result lacks exon 7. Furthermore the protein can bind TNF, preferably TNF- ⁇ , and can act as a TNF, preferably TNF- ⁇ , antagonist.
  • TNFR of the present invention is capable of inhibition of TNF-mediated cytotoxicity to a greater extent than the soluble extracellular domain alone, and more preferably, to an extent comparable to or greater than TNFR:Fc.
  • Mammalian TNFR according to the present disclosure includes, but is not limited to, human, primate, murine, canine, feline, bovine, ovine, equine, and porcine TNFR. Furthermore, mammalian TNFR according to the present disclosure includes, but is not limited to, a protein sequence that results from one or more single nucleotide polymorphisms, such as for example those disclosed in EP Pat. Appl. 1,172,444, as long as the protein retains a comparable biological activity to the reference sequence with which it is being compared.
  • the mammalian TNFR is a mammalian TNFRl, preferably a human TNFRl.
  • human TNFRl two non-limiting examples of this embodiment are given by huTNFRl ⁇ 7 which includes the signal sequence as shown in SEQ ID No: 6 and mature huTNFRl ⁇ 7 (amino acids 30-417 of SEQ ID No: 6) which lacks the signal sequence.
  • the sequences of these huTNFRl ⁇ 7 proteins are either amino acids 1-208 of wild type human TNFRl (SEQ ID No: 2) which includes the signal sequence or 30-208 of wild type human TNFRl for mature huTNFRl ⁇ 7 which lacks the signal sequence, and in either case is followed immediately by amino acids 247-455 of wild type human TNFRl .
  • the mammalian TNFR is a mammalian TNFR2, most preferably a human TNFR2.
  • huTNFR2 ⁇ 7 which includes the signal sequence as shown in SEQ ID No: 10 or mature huTNFR2 ⁇ 7 (amino acids 23-435 of SEQ ID No: 10) which lacks the signal sequence.
  • the sequences of these huTNFR2 ⁇ 7 proteins are either amino acids 1-262 of wild type human TNFR2 (SEQ ID No: 4) which includes the signal sequence or 23-262 of wild type human TNFR2 for mature huTNFR2 ⁇ 7 which lacks the signal sequence, followed in either case by the amino acid glutamate, because of the creation of a unique codon at the exon 6-8 junction, which is followed by amino acids 290-461 of wild type human TNFR2.
  • the proteins of the present invention also include those proteins that are chemically modified. Chemical modification of a protein refers to a protein where at least one of its amino acid residues is modified by either natural processes, such as processing or other post-translational modifications, or by chemical modification techniques known in the art.
  • One embodiment of the present invention is a nucleic acid that encodes a protein, either full length or mature, which is encoded by a cDNA derived from a mammalian TNFR gene, and in the cDNA exon 6 is followed directly by exon 8 and as a result lacks exon 7.
  • Such sequences are preferably provided in the form of an open reading frame uninterrupted by internal nontranslated sequences, or introns, which are typically present in eukaryotic genes. Genomic DNA containing the relevant sequences can also be used.
  • the nucleic acid is either an mRNA or a cDNA. In another embodiment, it is genomic DNA.
  • the mammalian TNFR is a mammalian TNFRl .
  • the mammalian TNFRl is preferably a human TNFRl .
  • human TNFRl two non-limiting examples of this embodiment are nucleic acids which encode the huTNFRl ⁇ 7 which includes the signal sequence as shown in SEQ ID No: 6 and mature huTNFRl ⁇ 7 (amino acids 30-417 of SEQ ID No: 6) which lacks the signal sequence.
  • sequences of these huTNFRl ⁇ 7 nucleic acids are nucleotides 1-1251 of SEQ ID No: 5, which includes the signal sequence and nucleotides 88-1251 of SEQ ID No: 5 which lacks the signal sequence.
  • the sequences of these huTNFRl ⁇ 7 nucleic acids are either nucleotides 1-625 of wild type human TNFRl (SEQ ID No: 1) which includes the signal sequence or 88-625 of wild type human TNFRl for mature huTNFR2 ⁇ 7 which lacks the signal sequence, and in either case is followed immediately by amino acids 740-1368 of wild type human TNFRl .
  • the mammalian TNFR is a mammalian TNFR2, most preferably a human TNFR2.
  • human TNFR2 two non-limiting examples of this embodiment are nucleic acids which encode the huTNFR2 ⁇ 7 which includes the signal sequence as shown in SEQ ID No: 10 or mature huTNFR2 ⁇ 7 (amino acids 23-435 of SEQ ID No: 10) which lacks the signal sequence.
  • the sequences of these huTNFR2 ⁇ 7 nucleic acids are nucleotides 1-1305 of SEQ ID No: 9 which includes the signal sequence and nucleotides 67-1305 of SEQ ID No: 9 which lacks the signal sequence.
  • the sequences of these huTNFR2 ⁇ 7 nucleic acids are either nucleotides 1-787 of wild type human TNFR2 (SEQ ID No: 3) which includes the signal sequence or 67-787 of wild type human TNFR2 for mature huTNFR2 ⁇ 7 which lacks the signal sequence, and in either case is followed immediately by amino acids 866-1386 of wild type human TNFR2.
  • the bases of the nucleic acids of the present invention can be the conventional bases cytosine, guanine, adenine and uracil or thymidine. Alternatively, modified bases can be used.
  • suitable bases include, but are not limited to, 5-methylcytosine ( M ⁇ C), isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 5-propyny-6, 5- methylthiazoleuracil, 6-aminopurine, 2-aminopurine, inosine, 2,6-diaminopurine, 7-propyne- 7-deazaadenine, 7-propyne-7-deazaguanine, 2-chloro-6-aminopurine and 9- (aminoethoxy)phenoxazine.
  • 5-methylcytosine M ⁇ C
  • isocytosine pseudoisocytosine
  • 5-bromouracil 5-propynyluracil
  • 5-propyny-6 5- methylthiazoleuracil
  • 6-aminopurine 2-aminopurine
  • 2-aminopurine 2-aminopurine
  • inosine 2,6-diamino
  • Suitable nucleic acids of the present invention include numerous alternative chemistries.
  • suitable nucleic acids of the present invention include, but are not limited to, those wherein at least one of the internucleotide bridging phosphate residues is a modified phosphate, such as phosphorothioate, methyl phosphonate, methyl phosphonothioate, phosphoromorpholidate, phosphoropiperazidate, and phosphoroamidate.
  • suitable nucleic acids of the present invention include those wherein at least one of the nucleotides contain a 2' lower alkyl moiety (e.g., C)-C 4 , linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl).
  • a 2' lower alkyl moiety e.g., C)-C 4 , linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl.
  • Nucleic acids of the present invention also include, but are not limited to, those wherein at least one, of the nucleotides is a nucleic acid analogue.
  • examples of such analogues include, but are not limited to, hexitol (HNA) nucleotides, 2'O-4'C-linked bicyclic ribofuranosyl (LNA) nucleotides, peptide nucleic acid (PNA) analogues, N3'— »P5' phosphoramidate analogues, phosphorodiamidate morpholino nucleotide analogues, and combinations thereof.
  • HNA hexitol
  • LNA bicyclic ribofuranosyl
  • PNA peptide nucleic acid
  • N3'— »P5' phosphoramidate analogues phosphorodiamidate morpholino nucleotide analogues, and combinations thereof.
  • Nucleic acids of the present invention include, but are not limited to, modifications of the nucleic acids involving chemically linking to the nucleic acids one or more moieties or conjugates.
  • moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g.
  • hexyl-S-tritylthiol a thiocholesterol
  • an aliphatic chain e.g., dodecandiol or undecyl residues
  • a phospholipids e.g., di-hexadecyl-rac-glycerol or triethylammonium l,2-di-O-hexadecyl-rac-glycero-3-H- phosphonate
  • a polyamine or a polyethylene glycol chain an adamantane acetic acid, a palmityl moiety, an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.
  • compositions comprising the foregoing proteins and nucleic acids.
  • nucleic acids and proteins of the present invention may be admixed, encapsulated, conjugated, or otherwise associated with other molecules, molecule structures, or mixtures of compounds, as for example liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution, and/or absorption.
  • Formulations of the present invention comprise nucleic acids and proteins in a physiologically or pharmaceutically acceptable carrier, such as an aqueous carrier.
  • formulations for use in the present invention include, but are not limited to, those suitable for parenteral administration including intra-articular, intraperitoneal, intravenous, intraarterial, subcutaneous, or intramuscular injection or infusion, as well as those suitable for topical, ophthalmic, vaginal, oral, rectal or pulmonary administration (including inhalation or insufflation of powders or aerosols, including by nebulizer, intratracheal, and intranasal delivery).
  • parenteral administration including intra-articular, intraperitoneal, intravenous, intraarterial, subcutaneous, or intramuscular injection or infusion
  • topical ophthalmic, vaginal, oral, rectal or pulmonary administration
  • the formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art. The most suitable route of administration in any given case may depend upon the subject, the nature and severity of the condition being treated, and the particular active compound which is being used.
  • compositions of the present invention include, but are not limited to, physiologically and pharmaceutically acceptable salts, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological properties.
  • salts are (a) salts formed with cations such as sodium, potassium, NH 4 + , magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; and (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, napthalenesulfonic
  • the present invention provides for the use of proteins and nucleic acids as set forth above for the preparation of a medicament for treating a patient afflicted with an inflammatory disorder involving excessive activity of TNF, as discussed below.
  • the nucleic acids and proteins of the present invention are typically admixed with, inter alia, an acceptable carrier.
  • the carrier must, of course, be acceptable in the sense of being compatible with other ingredients in the formulation and must not be deleterious to the patient.
  • the carrier may be a solid or liquid.
  • Nucleic acids and proteins of the present invention are incorporated in formulations, which may be prepared by any of the well known techniques of pharmacy consisting essentially of admixing the components, optionally including one or more accessory therapeutic ingredients.
  • Formulations of the present invention may comprise sterile aqueous and nonaqueous injection solutions of the active compounds, which preparations are preferably isotonic with the blood of the intended recipient and essentially pyrogen free. These preparations may contain anti-oxidants, buffers, bacteriostats, and solutes which render the formulation isotonic with the blood of the intended recipient.
  • Aqueous and non-aqueous sterile suspensions can include, but are not limited to, suspending agents and thickening agents.
  • the formulations may be presented in unit dose or multi-dose containers, for example, sealed ampoules and vials, and may be stored in freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline or water- for-injection immediately prior to use.
  • sterile liquid carrier for example, saline or water- for-injection immediately prior to use.
  • the nucleic acids and proteins of the present invention may be contained within a particle or vesicle, such as a liposome or microcrystal, which may be suitable for parenteral administration.
  • the particles may be of any suitable structure, such as unilamellar or plurilameller, so long as the nucleic acids and proteins of the present invention are contained therein.
  • Positively charged lipids such as N-[l-(2,3-dioleoyloxy)propyl]- N,N,N-trimethyl-ammoniummethylsulfate, or "DOTAP," are particularly preferred for such particles and vesicles.
  • DOTAP N-[l-(2,3-dioleoyloxy)propyl]- N,N,N-trimethyl-ammoniummethylsulfate
  • the preparation of such lipid particles is well known (See references in U.S. Pat. No. 5,976,879 col. 6).
  • the present invention provides expression vectors to amplify or express DNA encoding mammalian TNFR of the current invention.
  • the present invention also provides host cells transformed with the foregoing expression vectors.
  • Expression vectors are replicable DNA constructs which have synthetic or cDNA-derived DNA fragments encoding mammalian TNFR or bioequivalent analogues operably linked to suitable transcriptional or translational regulatory elements derived from mammalian, microbial, viral, or insect genes.
  • a transcriptional unit generally comprises an assembly of (a) a genetic element or elements having a regulatory role in gene expression, such as, transcriptional promoters or enhancers, (b) a structural or coding sequence which is transcribed into mRNA and translated into protein, and (c) appropriate transcription and translation initiation and termination sequences.
  • a genetic element or elements having a regulatory role in gene expression such as, transcriptional promoters or enhancers
  • a structural or coding sequence which is transcribed into mRNA and translated into protein
  • appropriate transcription and translation initiation and termination sequences can include an operator sequence to control transcription, and a sequence encoding suitable mRNA ribosomal binding sites.
  • the ability to replicate in a host usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants, can additionally be incorporated.
  • DNA regions are operably linked when they are functionally related to each other.
  • DNA for a signal peptide secretory leader
  • DNA for a polypeptide if it is expressed as a precursor which participates in the secretion of the polypeptide
  • a promoter is operably linked to a coding sequence if it controls the transcription of the sequence
  • a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation.
  • operably linked means contiguous and, in the case of secretory leaders, contiguous and in reading frame.
  • Structural elements intended for use in yeast expression systems preferably include a leader sequence enabling extracellular secretion of translated protein by a host cell.
  • recombinant protein is expressed without a leader or transport sequence, it may include an N-terminal methionine residue. This residue may optionally be subsequently cleaved from the expressed protein to provide a final product.
  • Mammalian TNFR DNA is expressed or amplified in a recombinant expression system comprising a substantially homogeneous monoculture of suitable host microorganisms, for example, bacteria such as E. coli or yeast such as S. cerevisiae, which have stably integrated (by transformation or transfection) a recombinant transcriptional unit into chromosomal DNA or carry the recombinant transcriptional unit as a component of a resident plasmid.
  • suitable host microorganisms for example, bacteria such as E. coli or yeast such as S. cerevisiae, which have stably integrated (by transformation or transfection) a recombinant transcriptional unit into chromosomal DNA or carry the recombinant transcriptional unit as a component of a resident plasmid.
  • Recombinant expression systems as defined herein will express heterologous protein either constitutively or upon induction of the regulatory elements linked to the DNA sequence or synthetic gene to be expressed.
  • Transformed host cells are cells which have been transformed or transfected with mammalian TNFR vectors constructed using recombinant DNA techniques.
  • Transformed host cells ordinarily express TNFR, but host cells transformed for purposes of cloning or amplifying TNFR DNA do not need to express TNFR.
  • Suitable host cells for expression of mammalian TNFR include prokaryotes, yeast, fungi, or higher eukaryotic cells.
  • Prokaryotes include gram negative or gram positive organisms, for example E. coli or bacilli.
  • Higher eukaryotic cells Include, but are not limited to, established insect and mammalian cell lines.
  • Cell-free translation systems can also be employed to produce mammalian TNFR using RNAs derived from the DNA constructs of the present invention.
  • Appropriate cloning and expression vectors for use with bacterial, fungal, yeast, and mammalian cellular hosts are well known in the art.
  • Prokaryotic expression hosts may be used for expression of TNFR that do not require extensive proteolytic and disulfide processing.
  • Prokaryotic expression vectors generally comprise one or more phenotypic selectable markers, for example a gene encoding proteins conferring antibiotic resistance or supplying an autotrophic requirement, and an origin of replication recognized by the host to ensure amplification within the host.
  • Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, Salmonella typhimurium, and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others can also be employed as a matter of choice.
  • Useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017). These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed. pBR322 contains genes for ampicillin and tetracycline resistance and thus provides simple means for identifying transformed cells.
  • Such commercial vectors include, for example, the series of Novagen® pET vectors (EMD Biosciences, Inc., Madison, Wis.).
  • Promoters commonly used in recombinant microbial expression vectors include the lactose promoter system, and the ⁇ PL promoter, the T7 promoter, and the T7 lac promoter.
  • a particularly useful bacterial expression system Novagen® pET system (EMD Biosciences, Inc., Madison, Wis.) employs a T7 or T7 lac promoter and E. coli strain, such as BL21(DE3) which contain a chromosomal copy of the T7 RNA polymerase gene.
  • TNFR proteins can also be expressed in yeast and fungal hosts, preferably from the genus Saccharomyces, such as S. cerevisiae.
  • Yeast of other genera such as Pichia or Kluyveromyces can also be employed.
  • Yeast vectors will generally contain an origin of replication from the 2 ⁇ yeast plasmid or an autonomously replicating sequence (ARS), promoter, DNA encoding TNFR, sequences for polyadenylation and transcription termination and a selection gene.
  • yeast vectors will include an origin of replication and selectable marker permitting transformation of both yeast and E. coli, e.g., the ampicillin resistance gene of E. coli and S.
  • TRPl or URA3 gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan or uracil, respectively, and a promoter derived from a highly expressed yeast gene to induce transcription of a structural sequence downstream.
  • the presence of the TRPl or URA3 lesion in the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan or uracil, respectively.
  • Suitable promoter sequences in yeast vectors include the promoters for metallothionein, 3-phosphoglycerate kinase or other glycolytic enzymes , such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate rnutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.
  • Suitable vectors and promoters for use in yeast expression are well known in the art.
  • Preferred yeast vectors can be assembled using DNA sequences from pUC 18 for selection and replication in E. coli (Amp r gene and origin of replication) and yeast DNA sequences including a glucose-repressible ADH2 promoter and ⁇ -factor secretion leader.
  • the yeast ⁇ -factor leader which directs secretion of heterologous proteins, can be inserted between the promoter and the structural gene to be expressed.
  • the leader sequence can be modified to contain, near its 3' end, one or more useful restriction sites to facilitate fusion of the leader sequence to foreign genes. Suitable yeast transformation protocols are known to those of skill in the art.
  • Host strains transformed by vectors comprising the ADH2 promoter may be grown for expression in a rich medium consisting of 1% yeast extract, 2% peptone, and 1% or 4% glucose supplemented with 80 ⁇ g/ml adenine and 80 ⁇ g/ml uracil. Derepression of the ADH2 promoter occurs upon exhaustion of medium glucose. Crude yeast supernatants are harvested by filtration and held at 4 0 C. prior to further purification. [0097] Various mammalian or insect cell culture systems are also advantageously employed to express TNFR protein. Expression of recombinant proteins in mammalian cells is particularly preferred because such proteins are generally correctly folded, appropriately modified and completely functional.
  • suitable mammalian host cell lines include the COS-7 lines of monkey kidney cells, and other cell lines capable of expressing an appropriate vector including, for example, L cells, such as L929, C 127, 3T3, Chinese hamster ovary (CHO), HeLa and BHK cell lines.
  • L cells such as L929, C 127, 3T3, Chinese hamster ovary (CHO), HeLa and BHK cell lines.
  • Mammalian expression vectors can comprise nontranscribed elements such as an origin of replication, a suitable promoter, for example, the CMVie promoter, the chicken beta-actin promoter, or the composite hEFl-HTLV promoter, and enhancer linked to the gene to be expressed, and other 5' or 3' flanking nontranscribed sequences, and 5' or 3' nontranslated sequences, such as necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, and transcriptional termination sequences.
  • a suitable promoter for example, the CMVie promoter, the chicken beta-actin promoter, or the composite hEFl-HTLV promoter, and enhancer linked to the gene to be expressed
  • other 5' or 3' flanking nontranscribed sequences such as necessary ribosome binding sites, a polyadenylation site, splice donor and acceptor sites, and transcriptional termination sequences.
  • Baculovirus systems for production of heterologous proteins in insect cells are known to
  • the transcriptional and translational control sequences in expression vectors to be used in transforming vertebrate cells can be provided by viral sources.
  • viral sources for example, commonly used promoters and enhancers are derived from Polyoma, Adenovirus 2, Simian
  • Virus 40 human cytomegalovirus, such as the CMVie promoter, HTLV, such as the composite hEFl-HTLV promoter.
  • DNA sequences derived from the SV40 viral genome for example, SV40 origin, early and late promoter, enhancer, splice, and polyadenylation sites can be used to provide the other genetic elements required for expression of a heterologous viruses.
  • mammalian genomic TNFR promoter such as control and/or signal sequences can be utilized, provided such control sequences are compatible with the host cell chosen.
  • recombinant expression vectors comprising TNFR cDNAs are stably integrated into a host cell's DNA.
  • one embodiment of the invention is a method of treating an inflammatory disease or condition by administering a stable, secreted, ligand-binding form of a TNF receptor, thereby decreasing the activity of TNF for the receptor.
  • the invention is a method of treating an inflammatory disease or condition by administering an oligonucleotide that encodes a stable, secreted, ligand-binding form of a
  • the invention is a method of producing a stable, secreted, ligand-binding form of a TNF receptor.
  • nucleic acids, proteins, and formulations of the present invention are also useful as in vitro or in vivo tools.
  • Embodiments of the invention can be used to treat any condition in which the medical practitioner intends to limit the effect of TNF or a signalling pathway activated by it.
  • the invention can be used to treat an inflammatory disease.
  • the condition is an inflammatory systemic disease, e.g., rheumatoid arthritis or psoriatic arthritis.
  • the disease is an inflammatory liver disease.
  • inflammatory liver diseases include, but are not limited to, hepatitis associated with the hepatitis A, B, or C viruses, alcoholic liver disease, and non-alcoholic steatosis.
  • the inflammatory disease is a skin condition such as psoriasis.
  • the uses of the present invention include, but are not limited to, treatment of diseases for which known TNF antagonists have been shown useful. Three specific TNF antagonists are currently FDA-approved.
  • the drugs are etanercept (Enbrel®), infliximab (Remicade®) and adalimumab (Humira®).
  • Enbrel® etanercept
  • Remicade® infliximab
  • Humira® adalimumab
  • One or more of these drugs is approved for the treatment of rheumatoid arthritis, juvenile rheumatoid arthritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, and inflammatory bowel disease (Crohn's disease or ulcerative colitis).
  • TNFR protein When mammalian or insect cells are used, properly expressed TNFR protein will be secreted into the extracellular media. The protein is recovered from the media, and is concentrated and is purified using standard biochemical techniques. After expression in mammalian cells by lentiviral or AAV transduction, plasmid transfection, or any similar procedure, or in insect cells after baculoviral transduction, the extracellular media of these cells is concentrated using concentration filters with an appropriate molecular weight cutoff, such as Amicon® filtration units. To avoid loss of TNFR protein, the filter should allow proteins to flow through that are at or below 50 kDal.
  • TNFR protein When TNFR protein is expressed in bacterial culture it can be purified by standard biochemical techniques. Bacteria are lysed, and the cellular extract containing the TNFR is desalted and is concentrated.
  • the TNFR protein is preferably purified by affinity chromatography.
  • affinity purification tag can be added to either the N- or the C-terminus of the TNFR protein.
  • a polyhistidine-tag (His-tag)., which is an amino acid motif with at least six histidines, can be used for this purpose (Hengen, P., 1995, Trends Biochem. Sci. 20:285-86).
  • His-tag polyhistidine-tag
  • the addition of a His-tag can be achieved by the in-frame addition of a nucleotide sequence encoding the His-tag directly to either the 5' or 3' end of the TNFR open reading frame in an expression vector.
  • a His-tag is incorporated into the protein
  • a nickel or cobalt affinity column is employed to purify the tagged TNFR, and the His-tag can optionally then be cleaved.
  • Other suitable affinity purification tags and methods of purification of proteins with those tags are well known in the art.
  • a non-affinity based purification scheme can be used, involving fractionation of the TNFR extracts on a series of columns that separate the protein based on size (size exclusion chromatography), charge (anion and cation exchange chromatography) and hydrophobicity (reverse phase chromatography). High performance liquid chromatography can be used to facilitate these steps.
  • TNFR proteins are administered to a patient, preferably a human, for treating TNF-dependent inflammatory diseases, such as arthritis.
  • TNF-dependent inflammatory diseases such as arthritis.
  • the use of huTNFRs is preferred.
  • the TNFR proteins of the present invention can be administered by bolus injection, continuous infusion, sustained release from implants, or other suitable techniques.
  • TNFR therapeutic proteins will be administered in the form of a composition comprising purified ' protein in conjunction with physiologically acceptable carriers, excipients or diluents.
  • physiologically acceptable carriers such as pharmaceutically acceptable carriers, excipients or diluents.
  • Such carriers will be nontoxic to recipients at the dosages and concentrations employed.
  • the preparation of such compositions entails combining the TNFR with buffers, antioxidants such as ascorbic acid, polypeptides, proteins, amino acids, carbohydrates including glucose, sucrose or dextrins, chelating agents such as EDTA, glutathione and other stabilizers and excipients.
  • Neutral buffered saline or saline mixed with conspecific serum albumin are exemplary appropriate diluents.
  • product is formulated as a lyophilizate using appropriate excipient solutions, for example, sucrose, as diluents.
  • appropriate excipient solutions for example, sucrose, as diluents.
  • Preservatives such as benzyl alcohol may also be added.
  • the amount and frequency of administration will depend of course, on such factors as the nature and the severity of the indication being treated, the desired response, the condition of the patient and so forth.
  • TNFR proteins of the present invention are administered systemically in therapeutically effective amounts preferably ranging from about 0.1 mg/kg/week to about 100 mg/kg/week. In preferred embodiments, TNFR is administered in amounts ranging from about 0.5 mg/kg/week to about 50 mg/kg/week.
  • dosages preferably range from about 0.01 mg/kg to about 1.0 mg/kg per injection.
  • Use of expression vectors to increase the levels of a TNF antagonist in a mammal includes the step of transforming cells of the mammal with an expression vector described herein, which drives expression of a TNFR as described herein.
  • the process is particularly useful in large mammals such as domestic pets, those used for food production, and primates.
  • exemplary large mammals are dogs, cats, horses cows, sheep, deer, and pigs.
  • exemplary primates are monkeys, apes, and humans.
  • the mammalian cells can be transformed either in vivo or ex vivo. When transformed in vivo, the expression vector are administered directly to the mammal, such as by injection. Means for transforming cells in vivo are well known in the art. When transformed ex vivo, cells are removed from the mammal, transformed ex vivo, and the transformed cells are reimplanted into the mammal. [0119] Splice-switching oligomers CSSOs):
  • the present invention employs splice switching oligonucleotides or splice switching oligomers (SSOs) to control the alternative splicing of TNFR2 so that the amount of a soluble, ligand-binding form that lacks exon 7 is increased and the amount of the integral membrane form is decreased.
  • SSOs splice switching oligonucleotides or splice switching oligomers
  • the methods and compositions of the present invention can be used in the treatment of diseases associated with excessive TNF activity.
  • one embodiment of the invention is a method of treating an inflammatory disease or condition by administering SSOs to a patient.
  • the SSOs that are administered alter the splicing of a pre-mRNA to produce a mammalian TNFR2 protein that lacks exon 7.
  • the invention is a method of producing a mammalian TNFR2 protein that lacks exon 7 in a cell by administering SSOs to the cell.
  • the length of the SSO i.e. the number of monomers in the oligomer
  • ASON antisense oligonucleotide
  • the SSO will be between about 10 to 16 nucleotides.
  • the invention can be practiced with SSOs of several chemistries that hybridize to RNA, but that do not activate the destruction of the RNA by RNase H, as do conventional antisense 2'-deoxy oligonucleotides.
  • the invention can be practiced using 2'O modified nucleic acid oligomers, such as where the 2'O is replaced with -O-CH 3 , -0-CH 2 -CH 2 -O-CH 3 , -0-CH 2 -CH 2 -CH 2 - NH 2 , -O-CH 2 -CH 2 -CH 2 -OH or -F, where 2'0-methyl or 2'O-methyloxyethyl is preferred.
  • the nucleobases do not need to be linked to sugars; so-called peptide nucleic acid oligomers or morpholine-based oligomers can be used. A comparison of these different linking chemistries is found in Sazani, P.
  • Gapmers are ASON that contain an RNase H activating region (typically a 2'-deoxyribonucleoside phosphorothioate) which is flanked by non-activating nuclease resistant oligomers.
  • RNase H activating region typically a 2'-deoxyribonucleoside phosphorothioate
  • any chemistry suitable for the flanking sequences in a gapmer ASON can be used in an SSO.
  • the SSOs of this invention may be made through the well-known technique of solid phase synthesis. Any other means for such synthesis known in the art may additionally or alternatively be used. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives.
  • the bases of the SSO may be the conventional cytosine, guanine, adenine and uracil or thymidine. Alternatively, modified bases can be used. Of particular interest are modified bases that increase binding affinity.
  • modified bases are the so-called G-clamp or 9-(aminoethoxy)phenoxazine nucleotides, cytosine analogues that form 4 hydrogen bonds with guanosine. (Flanagan, W.M., et al., 1999, Proc. Natl. Acad. Sci. 96:3513; Holmes, S.C., 2003, Nucleic Acids Res. 31:2759).
  • bases include, but are not limited to, 5-methylcytosine ( Me C), isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 5-propyny-6, 5- methylthiazoleuracil, 6-aminopurine, 2-aminopurine, inosine, 2,6-diaminopurine, 7-propyne- 7-deazaadenine, 7-propyne-7-deazaguanine and 2-chloro-6-aminopurine.
  • LNA locked nucleic acids
  • LNA units and methods of their synthesis are described in inter alia WO 99/14226, WO 00/56746, WO 00/56748, WO 01/25248, WO 02/28875, WO 03/006475 and WO 03/095467.
  • the LNA unit may also be defined with respect to its chemical formula.
  • an "LNA unit" as used herein, has the chemical structure shown in Formula 1 below: Formula 1
  • X is selected from the group consisting of O, S and NRH, where R is H or Ci-C 4 - alkyl;
  • Y is (-CH2)r, where r is an integer of 1-4;
  • B is a base of natural or non-natural origin as described above.
  • r is 1 or 2, and in a more preferred embodiment r is 1.
  • LNA nucleotides When LNA nucleotides are employed in an SSO it is preferred that non-LNA nucleotides also be present. LNA nucleotides have such high affinities of hybridization that there can be significant non-specific binding, which may reduce the effective concentration of the free-SSO. When LNA nucleotides are used they may be alternated conveniently with
  • 2'-deoxynucleotides The pattern of alternation is not critical. Alternating nucleotides, alternating dinucleotides or mixed patterns, e.g., LDLDLD or LLDLLD or LDDLDD can be used. For example in one embodiment, contains a sequence of nucleotides selected from the group consisting of: LdLddLLddLdLdLL, LdLdLLLddLLLdLL, LMLMMLLMMLMLMLL,
  • LMLMLLLMMLLLMLL LFLFFLLFFLFLFLL, LFLFLLLFFLLLFLL, LddLddLddL, dLddLddd, ddLddLddLd, LMMLMMLMML, MLMMLMMLMM, MMLMMLMMLM,
  • LFFLFFLFFL FLFFLFFLFF
  • FFLFFLFFLF dLdLdLdLdL, LdLdLdLdL,
  • L is a LNA unit
  • d is a DNA unit
  • M is 2'MOE 5
  • F is 2'Fluoro.
  • affinity-enhancing modifications including but not limited to LNA or G- clamp nucleotides, the skilled person recognizes it can be necessary to increase the proportion of such affinity-enhancing modifications.
  • suitable SSOs can be oligonucleotides wherein at least one of the internucleotide bridging phosphate residues is a modified phosphate, such as methyl phosphonate, methyl phosphonothioate, phosphoromorpholidate, phosphoropiperazidate, and phosphoroamidate.
  • a modified phosphate such as methyl phosphonate, methyl phosphonothioate, phosphoromorpholidate, phosphoropiperazidate, and phosphoroamidate.
  • every other one of the internucleotide bridging phosphate residues may be modified as described.
  • such SSO are oligonucleotides wherein at least one of the nucleotides contains a 2' lower alkyl moiety (e.g., C1-C4, linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl).
  • a 2' lower alkyl moiety e.g., C1-C4, linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl.
  • every other one of the nucleotides may be modified as described. (See references in U.S. Pat. 5,976,879 col. 4).
  • phosphorothioate linkages are preferred.
  • the length of the SSO will be from about 8 to about 30 bases in length. Those skilled in the art appreciate that when affinity-increasing chemical modifications are used, the SSO can be shorter and still retain specificity. Those skilled in the art will further appreciate that an upper limit on the size of the SSO is imposed by the need to maintain specific recognition of the target sequence, and to avoid secondary-structure forming self hybridization of the SSO and by the limitations of gaining cell entry. These limitations imply that an SSO of increasing length (above and beyond a certain length which will depend on the affinity of the SSO) will be more frequently found to be less specific, inactive or poorly active.
  • SSOs of the invention include, but are not limited to, modifications of the SSO involving chemically linking to the SSO one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the SSO.
  • moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g.
  • hexyl- S-tritylthiol a thiocholesterol
  • an aliphatic chain e.g., dodecandiol or undecyl residues
  • a phospholipids e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hex.adecyl-rac- glycero-3-H-phosphonate
  • a polyamine or a polyethylene glycol chain an adamantane acetic acid, a pahnityl moiety, an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.
  • the SSOs may be admixed, encapsulated, conjugated, or otherwise associated with other molecules, molecule structures, or mixtures of compounds, as for example liposomes, receptor targeted molecules, oral, rectal, topical or other formulation, for assisting in uptake, distribution, and/or absorption.
  • cellular differentiation includes, but is not limited to, differentiation of the spliceosome. Accordingly, the activity of any particular SSO can depend upon the cell type into which they are introduced. For example, SSOs which are effective in one cell type may be ineffective in another cell type.
  • oligonucleotides, and formulations of the present invention are also useful as in vitro or in vivo tools to examine splicing in human or animal genes. Such methods can be carried out by the procedures described herein, or modifications thereof which will be apparent to skilled persons.
  • the SSOs disclosed herein can be used to treat any condition in which the medical practitioner intends to limit the effect of TNF or the signalling pathway activated by TNF.
  • the invention can be used to treat an inflammatory disease.
  • the condition is an inflammatory systemic disease, e.g., rheumatoid arthritis or psoriatic arthritis.
  • the disease is an inflammatory liver disease. Examples of inflammatory liver diseases include, but are not limited to, hepatitis associated with the hepatitis A, B, or C viruses, alcoholic liver disease, and non-alcoholic steatosis.
  • the inflammatory disease is a skin condition such as psoriasis.
  • the uses of the present invention include, but are not limited to, treatment of diseases for which known TNF antagonists have been shown useful.
  • Three specific TNF antagonists are currently FDA-approved.
  • the drugs are etanercept (Enbrel®), infliximab (Remicade®) and adalimumab (Humira®).
  • One or more of these drugs is approved for the treatment of rheumatoid arthritis, juvenile rheumatoid arthritis, psoriasis, psoriatic arthritis, ankylosing spondylitis, and inflammatory bowel disease (Crohn's disease or ulcerative colitis).
  • ASON ASON have been successfully administered to experimental animals and human subjects by intravenous administration in saline in doses as high as 6 mg/kg three times a week (Yacysyhn, B.R., et al., 2002, Gut 51:30 (anti-ICAM-1 ASON for treatment of Crohn's disease); Stevenson, J., et al., 1999, J. Clinical Oncology 17:2227 (anti-RAF-1 ASON targeted to PBMC)).
  • any method of administration that is useful in conventional antisense treatments can be used to administer the SSO of the invention.
  • any of the techniques that have been developed to test ASON or SSO may be used.
  • Formulations of the present invention comprise SSOs in a physiologically or pharmaceutically acceptable carrier, such as an aqueous carrier.
  • a physiologically or pharmaceutically acceptable carrier such as an aqueous carrier.
  • formulations for use in the present invention include, but are not limited to, those suitable for parenteral administration including intraperitoneal, intraarticular, intravenous, intraarterial, subcutaneous, or intramuscular injection or infusion, as well as those suitable for topical, ophthalmic, vaginal, oral, rectal or pulmonary (including inhalation or insufflation of powders or aerosols, including by nebulizer, intratracheal, intranasal delivery) administration.
  • the formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art. The most suitable route of administration in any given case may depend upon the subject, the nature and severity of the condition being treated, and the particular active compound which is being used.
  • compositions of the present invention include, but are not limited to, physiologically and pharmaceutically acceptable salts ,i.e, salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological properties.
  • physiologically and pharmaceutically acceptable salts i.e, salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological properties.
  • salts are (a) salts formed with cations such as sodium, potassium, NH 4 + , magnesium, calcium, polyamines such as spermine and spermidine, etc.; (b) acid addition salts formed with inorganic acids, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; and (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic
  • the present invention provides for the use of SSOs having the characteristics set forth above for the preparation of a medicament for increasing the ratio of a mammalian TNFR2 protein that lacks exon 7 to its corresponding membrane bound form, in a patient afflicted with an inflammatory disorder involving TNF- ⁇ , as discussed above.
  • the SSOs are typically admixed with, inter alia, an acceptable carrier.
  • the carrier must, of course, be acceptable in the sense of being compatible with any other ingredients in the formulation and must not be deleterious to the patient.
  • the carrier may be a solid or liquid.
  • SSOs are incorporated in the formulations of the invention, which may be prepared by any of the well known techniques of pharmacy consisting essentially of admixing the components, optionally including one or more accessory therapeutic ingredients.
  • Formulations of the present invention may comprise sterile aqueous and nonaqueous injection solutions of the active compounds, which preparations are preferably isotonic with the blood of the intended recipient and essentially pyrogen free. These preparations may contain anti-oxidants, buffers, bacteriostats, and solutes which render the formulation isotonic with the blood of the intended recipient.
  • Aqueous and non-aqueous sterile suspensions can include, but are not limited to, suspending agents and thickening agents.
  • the formulations may be presented in unit dose or multi-dose containers, for example, sealed ampoules and vials, and may be stored in freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline or water- for-injection immediately prior to use.
  • sterile liquid carrier for example, saline or water- for-injection immediately prior to use.
  • the SSOs may be contained within a particle or vesicle, such as a liposome, or microcrystal, which may be suitable for parenteral administration.
  • the particles may be of any suitable structure, such as unilamellar or plurilameller, so long as the SSOs are contained therein.
  • Positively charged lipids such as N-[l-(2,3-dioleoyloxy)propyl]- N,N,N-trimethyl-ammoniummethylsulfate, or "DOTAP,” are particularly preferred for such particles and vesicles.
  • DOTAP N-[l-(2,3-dioleoyloxy)propyl]- N,N,N-trimethyl-ammoniummethylsulfate
  • the preparation of such lipid particles is well known. [See references in U.S. Pat. 5,976,879 col. 6]
  • the SSO can be targeted to any element or combination of elements that regulate splicing, including the 3 'splice site, the 5' splice site, the branchpoint, the polypyrimidine tract, exonic splicing ehancers, exonic splicing silencers, intronic splicing enhancers, and intronic splicing silencers.
  • SSO having a sequence that is complementary to at least 8, to at least 9, to at least 10, to at least 11, to at least 12, to at least 13, to at least 14, to at least 15, preferably between 10 and 16 nucleotides of the portions of the TNFR2 gene comprising exons 7 and its adjacent introns.
  • SEQ ID No: 13 contains the sequence of exon 7 of TNFR2 and 50 adjacent nucleotides of the flanking introns.
  • SSO targeted to human TNFR2 can have a sequence selected from the sequences listed in Table 1.
  • affinity- enhancing modifications including but not limited to LNA or G-clamp nucleotides
  • the skilled person recognizes the length of the SSO can be correspondingly reduced.
  • the pattern of alternation of LNA and conventional nucleotides is not important.
  • an SSO sequence that can target a human and at least one other species.
  • SSOs can be used to test and to optimize the invention in said other species before being used in humans, thereby being useful for regulatory approval and drug development purposes.
  • SSOs with sequences selected from SEQ ID Nos: 14, 30, 46, 70 and 71 which target human TNFR2 are also 100% complementary to the corresponding Macaca Mullata sequences. As a result these sequences can be used to test treatments in monkeys, before being used in humans.
  • Oligonucleotides Table 3 lists chimeric locked nucleic acid (LNA) SSOs with alternating 2'deoxy- and 2'O-4'-(methylene)-bicyclic-ribonucleoside phosphorothioates and having sequences as described in U.S. Appl. No. 11/595,485. These were synthesized by Santaris Pharma, Denmark. For each SSO, the 5'-terminaI nucleoside was a 2O-4'- methylene-ribonucleoside and the 3'-terminal nucleoside was a 2'deoxy-ribonucleoside.
  • LNA locked nucleic acid
  • Table 4 shows the sequences of chimeric LNA SSOs with alternating 2'-O-methyl- ribonucleoside-phosphorothioates (2'-0Me) and 2'O-4'-(methylene)-bicyclic-ribonucleoside phosphorothioates. These were synthesized by Santaris Pharma, Denmark. The LNA is shown in capital letters and the 2'-OME is shown in lower case letters. [0156] Cell culture and transfections. L929 cells were maintained in minimal essential media supplemented with 10% fetal bovine serum and antibiotic (37°C, 5% CO 2 ). For transfection, L929 cells were seeded in 24-well plates at 10 5 cells per well and transfected 24 hrs later.
  • Oligonucleotides were complexed, at the indicated concentrations, with 2 ⁇ L of LipofectamineTM 2000 transfection reagent (Invitrogen) as per the manufacturer's directions. The nucleotide/lipid complexes were then applied to the cells and incubated for 24 hrs. The media was then aspirated and cells harvested with TRI-ReagentTM (MRC, Cincinnati, OH). [0157] RT-PCR. Total RNA was isolated with TRI-Reagent (MRC, Cincinnati, OH) and TNFRl or TNFR2 mRNA was amplified by GeneAmp® RT-PCR using xTth polymerase (Applied Biosystems) following supplier directions. Approximately 200 ng of RNA was used per reaction.
  • PCR PCR was performed with Platinum® Tag DNA Polymerase (Invitrogen) according to the manufacturer's directions. For each 50 ⁇ L reaction, approximately 30 pmol of both forward and reverse primers were used. Primers used in the examples described herein are included in Table 2. The thermocycling reaction proceeded, unless otherwise stated, as follows: 94°C, 3 minutes; then 30-40 cycles of 94°C, 30 sec; 55°C, 30 sec; and 72°C, 105 sec; followed by 72°C, 3 minutes. The PCR products were analyzed on 1.5% agarose gels and visualized with ethidium bromide.
  • Human hepatocyte cultures Human hepatocytes were obtained in suspension either from ADMET technologies, or from The UNC Cellular Metabolism and Transport Core at UNC-Chapel Hill. Cells were washed and suspended in RPMI 1640 supplemented with 10% FBS, 1 ⁇ g/mL human insulin, and 13 nM Dexamethasone. Hepatocytes were plated in 6-well plates at 0.5 x 10 6 cells per plate in 3 mL media. After 1-1.5 his, nonadherent cells were removed, and the media was replaced with RPMI 1640 without FBS, supplemented with 1 ⁇ g/mL human insulin, and 130 nM Dexamethasone.
  • ELISA To determine the levels of soluble TNFR2 in cell culture media or sera, the Quantikine® Mouse sTNF RII ELISA kit from R&D Systems (Minneapolis, MN) or Quantikine® Human sTNF RII ELISA kit from R&D Systems (Minneapolis, MN) were used. The antibodies used for detection also detect the protease cleavage forms of the receptor. ELISA plates were read using a microplate reader set at 450 nm, with wavelength correction set at 570 nm.
  • L929 cytotoxicity assay L929 cells plated in 96-well plates at 10 4 cells per well were treated with 0.1 ng/mL TNF- ⁇ and 1 ⁇ g/mL actinomycin D in the presence of 10% serum from mice treated with the indicated oligonucleotide in 100 ⁇ L total of complete MEM media (containing 10% regular FBS) and allowed to grow for -24 hrs at 37°C. Control lanes were plated in 10% serum from untreated mice. Cell viability was measured 24 hrs later by adding 20 ⁇ L CellTiter 96® AQ ueous One Solution Reagent (Promega) and measuring absorbance at 490 nm with a microplate reader. Cell viability was normalized to untreated cells.
  • the membrane was incubated for 3 hrs at room temperature with a rabbit polyclonal antibody that recognizes the C-terminus of human and mouse TNFR2 (Abeam), Following three washes in PBS-T buffer (1 xPBS, 0.1% Tween-20), the membrane was incubated for one hour at room temperature with secondary goat anti-rabbit antibody (Abeam) and again washed three times with PBS-T buffer. The protein was then detected with ECL PlusTM (GE Healthcare), according to the manufacturer's recommendations and then photographed.
  • Table 3 shows the splice switching activities of SSOs having sequences as described in U.S. Appl. No. 11/595,485 and targeted to mouse and human TNFRs.
  • SSO 3312, 3274 and 3305 induced at least 50% skipping of exon 1; SSO 3305 treatment resulted in almost complete skipping.
  • SSOs transfected into primary human hepatocytes, and targeted to human TNFR2 exon 1 at least 7 SSOs generated some huTNFR2 ⁇ 7 mRNA.
  • SSOs 3378, 3379, 3384 and 3459 induced at least 75% skipping of exon 7 (FIG. 2B), and significant induction of huTNFR2 ⁇ 7 into the extracellular media (FIG. 2A).
  • Table 4 contains the sequences of 10 nucleotide chimeric SSOs with alternating 2'-0-methyl-ribonucleoside-phosphorothioates (2'-OMe) and 2'0-4'-(methylene)-bicyclic- ribonucleoside phosphorothioates. These SSOs are targeted to exon 7 of mouse TNFR2.
  • Table 4 LNAy2'-OMe-ribonucIeoside hos horothioate chimeric mouse targeted SSO
  • L929 cells were cultured and seeded as described in Example 1.
  • SSOs were diluted into 50 ⁇ L of OPTI-MEMTM, and then 50 ⁇ L LipofectamineTM 2000 mix (1 part LipofectamineTM 2000 to 25 parts OPTI-MEMTM) was added and incubated for 20 minutes. Then 400 ⁇ L of serum free media was added to the SSOs and applied to the cells in the 24-well plates. The final SSO concentration was either 50 or 100 nM. After 24 hrs, cells were harvested in 800 ⁇ L TRI-ReagentTM. Total RNA was isolated per the manufacturer's directions and analyzed by RT-PCR (FIG.
  • mice were injected with the SSOs listed in Table 4 intraperitoneal (i.p.) at 25 mg/kg/day for 5 days. Mice were bled before injection and again 1, 5 and 10 days after the last injection. The concentration of soluble TNFR2 ⁇ 7 in the sera taken before the first injection and 10 days after the last injection were measured by ELISA (FIG. 4B). The mice were sacrificed on day 10 and total RNA from 5-10 mg of the liver was analyzed by RT-PCR (FIG.
  • the 5 '-terminal nucleoside was a 2O-4'- methylene-ribonucleoside and the 3 '-terminal nucleoside was a 2'deoxy- ribonucleoside.
  • These SSOs were either 10-, 12-, 14- or 16-mers.
  • the concentration of soluble TNFR2 ⁇ 7 was measured by ELISA (FIG. 5, top panel).
  • Total RNA was analyzed by RT-PCR for splice switching activity (FIG. 5, bottom panel).
  • mice were injected with SSO 3274 intraperitoneal (i.p.) at 25 mg/kg/day for 10 days. The mice were then sacrificed and total RNA from the liver was analyzed by RT-PCR using the forward primer TR045 (SEQ ID No: 112) and the reverse primer TR046 (SEQ ID No: 113).
  • the products were analyzed on a 1.5% agarose gel (FIG. 6A) and the product for the TNFR2 ⁇ 7 was isolated using standard molecular biology techniques.
  • the isolated TNFR2 ⁇ 7 product was amplified by PCR using the same primers and then sequenced (FIG. 6B).
  • the sequence data contained the sequence
  • CTCTCTTCCAATTGAGAAGCCCTCCTGC (nucleotides 777-804 of SEQ ID No: 11), which confirms that the SSO-induced TNFR2 ⁇ 7 mRNA lacks exon 7 and that exon 6 is joined directly to exon 8.
  • sequence data contained the sequence CGCTCTTCCAGTTGAGAAGCCCTTGTGC (nucleotides 774-801 of SEQ ID No: 9), which confirms that the SSO-induced TNFR2 ⁇ 7 mRNA lacks exon 7 and that exon 6 is joined directly to exon 8.
  • SSOs were diluted into 50 ⁇ L of OPTI-MEMTM, and then 50 ⁇ L LipofectamineTM 2000 mix (1 part LipofectamineTM 2000 to 25 parts OPTI-MEMTM) was added and incubated for 20 minutes. The SSOs were then applied to the cells in the 24-well plates. The final SSO concentration ranged from 1 to 150 nM. After 48 hrs, cells were harvested in 800 ⁇ L TRI-ReagentTM.
  • RNA from the cells was analyzed by RT-PCR using the forward primer v,
  • TR047 SEQ ID No: 84
  • reverse primer TR048 SEQ ID No: 85
  • the concentration of soluble TNFR2 ⁇ 7 in the serum was measured by ELISA (FIG. 8B). Both huTNFR2 ⁇ 7 mRNA (FIG. 8A) and secreted huTNFR2 ⁇ 7 protein (FIG. 8B) displayed dose dependent increases.
  • TNFR2 Splice Variants from Murine Cells [0178] The ability of SSOs to induce soluble TNFR2 protein production and secretion into the extracellular media was tested. L929 cells were treated with SSOs as described in Example 1, and extracellular media samples were collected ⁇ 48 hrs after transfection. The concentration of soluble TNFR2 in the samples was measured by ELISA (FIG. 9). SSOs that best induced shifts in RNA splicing, also secreted the most protein into the extracellular media. In particular, SSOs 3305, 3312, and 3274 increased soluble TNFR2 at least 3.5-fold over background. Consequently, induction of the splice variant mRNA correlated with production and secretion of the soluble TNFR2.
  • SSO 3305 in saline was injected intraperitoneal (i.p.) daily for 4 days into mice at doses from 3 mg/kg to 25 mg/kg. The mice were sacrificed on day 5 and total RNA from the liver was analyzed by RT-PCR. The data show splice switching efficacy similar to that found in cell culture. At the maximum dose of 25 mg/kg, SSO 3305 treatment induced almost full conversion to ⁇ 7 mRNA (FIG. 10, bottom panel).
  • Circulatory TNFR2 ⁇ 7 [0181] Mice were injected with SSO 3274, 3305, or the control 3083 intraperitoneal (i.p.) at 25 mg/kg/day for 10 days. Mice were bled before injection and again 1, 5 and 10 days after the last injection. The concentration of soluble TNFR2 ⁇ 7 in the serum was measured. SSO treatment induced soluble TNFR2 ⁇ 7 protein levels over background for at least 10 days (FIG. 11).
  • L929 cytotoxicity assay In this assay, serum is assessed for its ability to protect cultured L929 cells from the cytotoxic effects of a fixed concentration of TNF- ⁇ as described in Example 1. Serum from mice treated with SSO 3274 but not control SSOs (3083 or 3272) increased viability of the L929 cells exposed to 0.1 ng/mL TNF- ⁇ (FIG. 13). Hence, the SSO 3274 serum contained TNF- ⁇ antagonist sufficient to bind and to inactivate TNF- ⁇ , and thereby protect the cells from the cytotoxic effects of . TNF- ⁇ . This anti-TNF- ⁇ activity was present in the serum of animals 5 and 27 days after the last injection of SSO 3274.
  • L929 cells were seeded as in Example 8. Samples were prepared containing 90 ⁇ L of serum-free MEM, 0.1 ng/ml TNF- ⁇ and 1 ⁇ g/ml of actinomycin D, with either (i) recombinant soluble protein (0.01-3 ⁇ g/mL)) from Sigma® having the 236 amino acid residue extracellular domain of mouse TNFR2, (ii) serum from SSO 3274 or SSO 3305 treated mice (1.25-10%, diluted in serum from untreated mice; the concentration of TNFR2 ⁇ 7 was determined by ELISA) or (iii) Enbrel® (0.45-150 pg/ml) to a final volume of 100 ⁇ l with a final mouse serum concentration of 10%.
  • Example 10 The samples were incubated at room temperature for 30 minutes. Subsequently, the samples were applied to the plated cells and incubated for -24 hrs at 37°C in a 5% CO 2 humidified atmosphere. Cell viability was measured by adding 20 ⁇ L CellTiter 96® AQ UCOus One Solution Reagent (Promega) and measuring absorbance at 490 nm with a microplate reader. Cell viability was normalized to untreated cells and plotted as a function of TNF antagonist concentration (FIG. 14).
  • Example 10 Example 10
  • TNFR2 ⁇ 7 mRNA in vivo decays at a rate approximately 4 times faster than that of TNFR2 ⁇ 7 protein in serum.
  • TNFR2 ⁇ 7 mRNA was only detectable in trace amounts, whereas TNFR2 ⁇ 7 protein had only decreased by 20% from its peak concentration.
  • a plasmid containing the full length human TNFR2 cDNA was obtained commercially from OriGene (Cat. No: TCl 19459, NM_001066.2).
  • the cDNA was obtained by performing PCR on the plasmid using reverse primer TROOl (SEQ ID No: 74) and forward primer TR002 (SEQ ID No: 75).
  • the PCR product was isolated and was purified using standard molecular biology techniques, and contains the 1383 bp TNFR2 open reading frame without a stop codon.
  • full length human TNFR2 cDNA is obtained by performing RT- PCR on total RNA from human mononuclear cells using the TROOl reverse primer and the TR002 forward primer.
  • the PCR product is isolated and is purified using standard molecular biology techniques.
  • the PCR product was isolated and was purified using standard molecular biology techniques, and was expected to contain the 1308 bp TNFR2 ⁇ 7 open reading frame with a stop codon (SEQ ID No: 9).
  • the TROOl reverse primer instead of the TR004 reverse primer in these PCR reactions the 1305 bp human TNFR2 ⁇ 7 open reading frame without a stop c ⁇ don was generated. This allows for the addition of in-frame C-terminal affinity purification tags, such as His-tag, when the final PCR product is inserted into an appropriate vector.
  • a plasmid containing the full length human TNFR2 cDNA is obtained commercially from OriGene (Cat. No: TC127913, NM_001065.2).
  • the cDNA is obtained by performing PCR on the plasmid using the TR006 reverse primer (SEQ ID No: 88) and the TR007 forward primer (SEQ ID No: 89).
  • the full length human TNFRl cDNA PCR product is isolated and is purified using standard molecular biology techniques.
  • full length human TNFRl cDNA is obtained by performing RT- PCR on total RNA from human mononuclear cells using the TR006 reverse primer and the TR007 forward primer.
  • the full length human TNFRl cDNA PCR product is isolated and is purified using standard molecular biology techniques.
  • PCR is performed on full length TNFRl cDNA using the TR008 forward primer (SEQ ID No: 90) and the TR006 reverse primer.
  • PCR is performed on full length TNFRl cDNA using the TR009 reverse primer (SEQ ID No: 91) and the TROlO forward primer (SEQ ID No: 92).
  • the 2 overlapping segments are combined, and PCR is performed using the TROlO forward primer and the TR006 reverse primer.
  • the PCR product is isolated and is purified using standard molecular biology techniques, and contains the 1254 bp human TNFRl ⁇ 7 open reading frame with a stop codon (SEQ ID No: 5).
  • Murine TNFR2 ⁇ 7 cDNA was generated using the commercially available FirstChoiceTM PCR-Ready Mouse Liver cDNA (Ambion, Cat. No: AM3300) using the TR012 reverse primer (SEQ ID No: 98) and the TR013 forward primer (SEQ ID No: 99).
  • the full length murine TNFR2 cDNA PCR product is isolated and is purified using standard molecular biology techniques. Then by performing PCR on the resulting product using the TRO 14 forward primer (SEQ ID No: 100) and the TRO 12 reverse primer the proper Kozak sequence was introduced.
  • full length murine TNFR2 cDNA is obtained by performing RT- PCR on total RNA from mouse mononuclear cells or mouse hepatocytes using the TRO 15 reverse primer (SEQ ID No: 101) and the TR016 forward primer (SEQ ID No: 102).
  • the full length murine TNFR2 cDNA PCR product is isolated and is purified using standard molecular biology techniques.
  • PCR was performed on full length TNFR2 cDNA using the TR017 forward primer (SEQ ID No: 103) and the TR015 reverse primer.
  • PCR was performed on full length TNFR2 cDNA using the TROl 8 reverse primer (SEQ ID No: 104) and the TRO 16 forward primer.
  • the 2 overlapping segments were combined, and PCR was performed using the TRO 16 forward primer and the TRO 15 reverse primer.
  • the PCR product was isolated and was purified using standard molecular biology techniques, and was expected to contain the 1348 bp murine TNFR2 ⁇ 7 open reading frame with a stop codon (SEQ ID No: 11).
  • Murine TNFRl ⁇ 7 cDNA is generated using the commercially available FirstChoiceTM PCR-Ready Mouse Liver cDNA (Ambion, Cat. No: AM3300) using the TR020 reverse primer (SEQ ID No: 114) and the TR021 forward primer (SEQ ID No: 115).
  • the full length murine TNFRl cDNA PCR product is isolated and is purified using standard molecular biology techniques.
  • full length murine TNFRl cDNA is obtained by performing RT- PCR on total RNA from mouse mononuclear cells using the TR020 reverse primer and the TR021 forward primer.
  • the full length murine TNFRl cDNA PCR product is isolated and is purified using standard molecular biology techniques.
  • PCR is performed on full length TNFRl cDNA using the TR022 forward primer (SEQ ID No: 116) and the TR020 reverse primer.
  • PCR is performed on full length TNFRl cDNA using the TR023 reverse primer (SEQ ID No: 117) and the TR024 forward primer (SEQ ID No: 118).
  • TR024 forward primer SEQ ID No: 118
  • the 1259 bp PCR product is isolated and is purified using standard molecular biology techniques, and contains the 1251 bp murine TNFRl ⁇ 7 open reading frame with a stop codon (SEQ ID No: 7).
  • TNFR2 ⁇ 7 cDNA PCR product from Example 11 was incorporated into an appropriate mammalian expression vector.
  • the TNFR2 ⁇ 7 cDNA PCR product from Example 11, both with and without a stop codon, and the pcDNATM3.1D/V5-His TOPO® expression vector (Invitrogen) were blunt-end ligated and isolated according to the manufacturer's directions. Plasmids containing inserts encoding human TNFR2 ⁇ 7 were transformed into OneShot ® Top 10 competent cells (Invitrogen), according to the supplier's directions. Fifty ⁇ L of the transformation mix were plated on LB media with 100 ⁇ g/mL of ampicillin and incubated overnight at 37°C.
  • Clone 1319-1 contains the human TNFR2 ⁇ 7 open reading frame without a stop codon followed directly by an in-frame His-tag from the plasmid; while clones 1138-5 and 1230-1 contain the TNFR2 ⁇ 7 open reading frame followed immediately by a stop codon.
  • the sequence of the His-tag from the plasmid is given in SEQ ID No: 126.
  • the sequences of the TNFR2 ⁇ 7 open reading frames of clones 1230-1 and 1319-1 were identical to SEQ ID No: 9 with and without the stop codon, respectively.
  • sequence (SEQ ID No: 125) of the TNFR2 ⁇ 7 open reading frames of clone 1138-5 differed by a single nucleotide at position 1055 in exon 10, with an A in the former and a G in the later.
  • This single nucleotide change causes the amino acid 352 to change from a glutamine to an arginine.
  • a human TNFR2 ⁇ 7 cDNA from Example 11 is incorporated into an appropriate expression vector, such as a pET Directional TOPO® expression vector (Invitrogen). PCR is performed on the PCR fragment from Example 11 using forward (TR002) (SEQ ID No: 75) and reverse (TR026) (SEQ ID No: 79) primers to incorporate a homologous recombination site for the vector.
  • TR002 forward (SEQ ID No: 75)
  • TR026 reverse primers to incorporate a homologous recombination site for the vector.
  • the resulting PCR fragment is incubated with the pET101/D-TOPO® vector (Invitrogen) according to the manufacturer's directions, to create the human TNFR2 ⁇ 7 bacterial expression vector.
  • the resulting vector is transformed into the E. coli strain BL21(DE3).
  • the human TNFR2 ⁇ 7 is then expressed from the bacterial cells according to the manufacturer's instructions.
  • Human TNFR2 ⁇ 7 in insect cells, a human TNFR2
  • ⁇ 7 cDNA from Example 11 is incorporated into a baculoviral vector.
  • PCR is performed on a human TNFR2 ⁇ 7 cDNA from Example 11 using forward (TR027) (SEQ ID No: 80) and reverse (TR028) (SEQ ID No: 81) primers.
  • the resulting PCR product is digested with the restriction enzymes EcoRI and Xhol.
  • the digested PCR product is ligated with a EcoRI and Xhol digested pENTRTM Vector (Invitrogen), such as any one of the pENTRTMl A, pENTRTM2B, pENTRTM3C, pENTRTM4, or pENTRTMl 1 Vectors, to yield an entry vector.
  • the product is then isolated, amplified, and purified using standard molecular biology techniques.
  • a baculoviral vector containing the human TNFR2 ⁇ 7 cDNA is generated by homologous recombination of the entry vector with BaculoDirectTM Linear DNA (Invitrogen) using LR ClonaseTM (Invitrogen) according to the manufacturer's directions. The reaction mixture is then used to infect Sf9 cells to generate recombinant baculovirus. After harvesting the recombinant baculovirus, expression of human TNFR2 ⁇ 7 is confirmed. Amplification of the recombinant baculovirus yields a high-titer viral stock. The high-titer viral stock is used to infect Sf9 cells, thereby expressing human TNFR2 ⁇ 7 protein.
  • a recombinant adeno-associated virus (rAAV) vector is generated using a three plasmid transfection system as described in Grieger, J., et al., 2006, Nature Protocols 1 : 1412. PCR is performed on a purified human TNFR2 ⁇ 7 PCR product of Example 11 5 using forward (TR029) (SEQ ID No: 82) and reverse (TR030) (SEQ ID No: 83) primers to introduce unique flanking Notl restriction sites.
  • the resulting PCR product is digested with the Notl restriction enzyme, and isolated by standard molecular biology techniques.
  • the Notl-digested fragment is then ligated to Notl-digested pTR-UF2 (University of North Carolina (UNC) Vector Core Facility), to create a plasmid that contains the human TNFR2 ⁇ 7 open reading frame, operably linked to the CMVie promoter, flanked by inverted terminal repeats.
  • Notl-digested pTR-UF2 Universality of North Carolina (UNC) Vector Core Facility
  • the resulting plasmid is then transfected with the plasmids pXX680 and pHelper (UNC Vector Core Facility) into HEK-293 cells, as described in Grieger, J., et al., to produce rAAV particles containing the human TNFR2 ⁇ 7 gene where expression is driven by the strong constitutive CMVie promoter.
  • the virus particles are harvested and purified, as described in Grieger, J., et al., to provide an rAAV stock suitable for transducing mammalian cells.
  • Example 12 is incorporated into an appropriate expression vector, such as a pET Directional TOPO® expression vector (Invitrogen).
  • PCR is performed on the cDNA from Example 12 using forward (TROlO) (SEQ ID No: 92) and reverse (TR006) (SEQ ID No: 88) primers to incorporate a homologous recombination site for the vector.
  • the resulting PCR fragment is incubated with the pET101/D-TOPO® vector (Invitrogen) according to the manufacturer's directions, to create the human TNFRl ⁇ 7 bacterial expression vector.
  • the resulting vector is transformed into the E. coli strain BL21(DE3).
  • the human TNFRl ⁇ 7 is then expressed from the bacterial cells according to the manufacturer's instructions.
  • Example 20 Example 20
  • TNFRl ⁇ 7 cDNA PCR product from Example 12 is incorporated into an appropriate mammalian expression vector, human TNFRl ⁇ 7 cDNA PCR product from Example 12 and the pcDNATM3.1D/V5-His TOPO® expression vector (Invitrogen) are blunt-end ligated according to the manufacturer's directions.
  • the product is then isolated, amplified, and purified using standard molecular biology techniques to yield the mammalian expression vector.
  • the vector is then transfected into a mammalian cell, where expression of the human TNFRl ⁇ 7 protein is driven by the strong constitutive CMVie promoter.
  • Example 12 is incorporated into a baculoviral vector.
  • PCR is performed on the cDNA from Example 12 using forward (TR031) (SEQ ID No: 94) and reverse (TR032) (SEQ ID No: 95) primers.
  • the resulting PCR product is digested with the restriction enzymes EcoRI and Xhol.
  • the digested PCR product is ligated with a EcoRI and Xhol digested pENTRTM Vector (Invitrogen), such as any one of the pENTRTMl A, pENTRTM2B, pENTRTM3C, pENTRTM4, or pENTRTMl 1 Vectors, to yield an entry vector.
  • the product is then isolated, amplified, and purified using standard molecular biology techniques.
  • a baculoviral vector containing the human TNFRl ⁇ 7 cDNA is generated by homologous recombination of the entry vector with BaculoDirectTM Linear DNA (Invitrogen) using LR ClonaseTM (Invitrogen) according to the manufacturer's directions. The reaction mixture is then used to infect Sf9 cells to generate recombinant baculovirus. After harvesting the recombinant baculovirus, expression of human TNFRl ⁇ 7 is confirmed. Amplification of the recombinant baculovirus yields a high-titer viral stock. The high-titer viral stock is used to infect Sf9 cells, thereby expressing human TNFRl ⁇ 7 protein.
  • a recombinant adeno-associated virus (rAAV) vector is generated using a three plasmid transfect ⁇ on system as described in Grieger, J., et al., 2006, Nature Protocols 1 : 1412.
  • PCR is performed on the purified human TNFRl ⁇ 7 PCR product of Example 12, using forward (TR033) (SEQ ID No: 96) and reverse (TR034) (SEQ ID No: 97) primers to introduce unique flanking Notl restriction sites.
  • the resulting PCR product is digested with the Notl restriction enzyme, and isolated by standard molecular biology techniques.
  • the Notl-digested fragment is then ligated to Notl-digested pTR-UF2 (University of North Carolina (UNC) Vector Core Facility), to create a plasmid that contains the human TNFRl ⁇ 7 open reading frame, operably linked to the CMVie promoter, flanked by inverted terminal repeats.
  • the resulting plasmid is then transfected with the plasmids pXX680 and pHelper (UNC Vector Core Facility) into HEK-293 cells, as described in Grieger, J., et al., to produce rAAV particles containing the human TNFRl ⁇ 7 gene where expression is driven by the strong constitutive CMVie promoter.
  • the virus particles are harvested and purified, as described in Grieger, J., et al., to provide an rAAV stock suitable for transducing mammalian cells.
  • TNFR2 ⁇ 7 cDNA PCR product from Example 13 was incorporated into an appropriate mammalian expression vector.
  • the TNFR2 ⁇ 7 cDNA PCR product from Example 13, both with and without a stop codon, and the pcDNATM3.1D/V5-His TOPO® expression vector (Invitrogen) was blunt-end ligated and isolated according to the manufacturer's directions. Plasmids containing inserts encoding murine ⁇ 7 TNFR2 were transformed into OneShot ® ToplO competent cells (Invitrogen), according to the supplier's directions. Fifty ⁇ L of the transformation mix were plated on LB media with 100 ⁇ g/mL of ampicillin and incubated overnight at 37°C.
  • Single colonies were used to inoculate 5 mL cultures of LB media with 100 ⁇ g/mL ampicillin and incubated overnight at 37°C. The cultures were then used to inoculate 200 mL of LB media with 100 ⁇ g/mL of ampicillin and grown overnight at 37°C.
  • the plasmids were isolated using GenEluteTM Plasmid Maxiprep kit (Sigma) according to manufacturer's directions. Purification efficiency ranged from 0.5 to 1.5 mg of plasmid per preparation.
  • Murine TNFR2 ⁇ 7 in E. coli
  • a murine TNFR2 ⁇ 7 cDNA from Example 13 is incorporated into an appropriate expression vector, such as a pET Directional TOPO® expression vector (Invitrogen).
  • PCR is performed on the PCR fragment from Example 13 using forward (TR035) (SEQ ID No: 106) and reverse (TR036) (SEQ ID No: 107) primers to incorporate a homologous recombination site for the vector.
  • the resulting PCR fragment is incubated with the pET101/D-TOPO® vector (Invitrogen) according to the manufacturer's directions, to create the murine TNFR2 ⁇ 7 bacterial expression vector.
  • the resulting vector is transformed into the E. coli strain BL21 (DE3).
  • the murine TNFR2 ⁇ 7 is then expressed from the bacterial cells according to the manufacturer's instructions.
  • Example 13 is incorporated into a baculoviral vector.
  • PCR is performed on the cDNA from Example 13 using forward (TR037) (SEQ ID No: 108) and reverse (TRO38) (SEQ ID No: 109) primers.
  • the resulting PCR product is digested with the restriction enzymes EcoRI and Xhol.
  • the digested PCR product is ligated with a EcoRI and Xhol digested pENTRTM Vector (Invitrogen), such as any one of the pENTRTMlA, pENTRTM2E% pENTRTM3C, pENTRTM4, or pENTRTMl 1 Vectors, to yield an entry vector.
  • the product is then isolated, amplified, and purified using standard molecular biology techniques.
  • a baculoviral vector containing the murine TNFR2 ⁇ 7 cDNA is generated by homologous recombination of the entry vector with BaculoDirectTM Linear DNA (Invitrogen) using LR ClonaseTM (Invitrogen) according to the manufacturer's directions. The reaction mixture is then used to infect Sf9 cells to generate recombinant baculovirus. After harvesting the recombinant baculovirus, expression of murine TNFR2 ⁇ 7 is confirmed. Amplification of the recombinant baculovirus yields a high-titer viral stock. The high-titer viral stock is used to infect Sf9 cells, thereby expressing murine TNFR2 ⁇ 7 protein.
  • a recombinant adeno-associated virus (rAAV) vector is generated using a three plasmid transfection system as described in Grieger, J., et al., 2006, Nature Protocols 1:1412. PCR is performed on the purified murine TNFR2 ⁇ 7 PCR product of Example 13, using forward (TR039)(SEQ ID No: 1 10) and reverse (TR040)(SEQ ID No: 111) primers to introduce unique flanking Notl restriction sites.
  • the resulting PCR product is digested with the Notl restriction enzyme, and isolated by standard molecular biology techniques.
  • the Notl-digested fragment is then ligated to Notl-digested pTR-UF2 (University of North Carolina (UNC) Vector Core Facility), to create a plasmid that contains the murine TNFR2 ⁇ 7 open reading frame, operably linked to the CMVie promoter, flanked by inverted terminal repeats.
  • the resulting plasmid is then transfected with the plasmids pXX680 and pHelper (UNC Vector Core Facility) into HEK-293 cells, as described in Grieger, J., et al., to produce rAAV particles containing the murine TNFR2 ⁇ 7 gene where expression is driven by the strong constitutive CMVie promoter.
  • the virus particles are harvested and purified, as described in Grieger, J., et al., to provide an rAAV stock suitable for transducing mammalian cells.
  • Example 14 is incorporated into an appropriate expression vector, such as a pET Directional TOPO® expression vector (Invitrogen).
  • PCR is performed on the cDNA from Example 14 using forward (TR024)(SEQ ID No: 118) and reverse (TR020)(SEQ ID No: 114) primers to incorporate a homologous recombination site for the vector.
  • the resulting PCR fragment is incubated with the pET101/D-TOPO® vector (Invitrogen) according to the manufacturer's directions, to create the murine TNFRl ⁇ 7 bacterial expression vector.
  • the resulting vector is transformed into the E. coli strain BL21(DE3).
  • the murine TNFRl ⁇ 7 is then expressed from the bacterial cells according to the manufacturer's instructions.
  • TNFRl ⁇ 7 cDNA PCR product from Example 14 is incorporated into an appropriate mammalian expression vector.
  • the murine TNFRl ⁇ 7 cDNA PCR product from Example 14 and the pcDNATM3.1D/V5-His TOPO® expression vector (Invitrogen) are blunt-end ligated according to the manufacturer's directions.
  • the product is then isolated, amplified, and purified using standard molecular biology techniques to yield the mammalian expression vector.
  • the vector is then transfected into a mammalian cell, where expression of the murine TNFRl ⁇ 7 protein is driven by the strong constitutive CMVie promoter.
  • Example 14 is incorporated into a baculoviral vector.
  • PCR is performed on the cDNA from Example 14 using forward (TR041)(SEQ ID No: 120) and reverse (TR042) (SEQ ID No: 121) primers.
  • the resulting PCR product is digested with the restriction enzymes EcoRI and Xhol.
  • the digested PCR product is ligated with a EcoRI and Xhol digested pENTRTM Vector (Invitrogen), such as any one of the pENTRTMl A 3 pENTRTM2B, pENTRTM3C, pENTRTM4, or pENTRTMl 1 Vectors, to yield an entry vector.
  • the product is then isolated, amplified, and purified using standard molecular biology techniques.
  • a baculoviral vector containing the murine TNFRl ⁇ 7 cDNA is generated by homologous recombination of the entry vector with BaculoDirectTM Linear DNA (Invitrogen) using LR ClonaseTM (Invitrogen) according to the manufacturer's directions. The reaction mixture is then used to infect Sf9 cells to generate recombinant baculovirus. After harvesting the recombinant baculovirus, expression of murine TNFRl ⁇ 7 is confirmed. Amplification of the recombinant baculovirus yields a high-titer viral stock. The high-titer viral stock is used to infect Sf9 cells, thereby expressing murine TNFRl ⁇ 7 protein.
  • a recombinant adeno-associated virus (rAAV) vector is generated using a three plasmid transfection system as described in Grieger, J., et al., 2006, Nature Protocols 1:1412. PCR is performed on the purified murine TNFRl ⁇ 7 PCR product of Example 13, using forward (TR043)(SEQ ID No: 122) and reverse (TR044)(SEQ ID No: 123) primers to introduce unique flanking Notl restriction sites.
  • the resulting PCR product is digested with the Notl restriction enzyme, and isolated by standard molecular biology techniques.
  • the Notl-digested fragment is then ligated to Notl-digested pTR-UF2 (University of North Carolina (UNC) Vector Core Facility), to create a plasmid that contains the murine TNFRl ⁇ 7 open reading frame, operably linked to the CMVie promoter, flanked by inverted terminal repeats.
  • the resulting plasmid is then transfected with the plasmids pXX680 and pHelper (UNC Vector Core Facility) into HEK-293 cells, as described in Grieger, J., et al., to produce rAAV particles containing the murine TNFRl ⁇ 7 gene where expression is driven by the strong constitutive CMVie promoter.
  • the virus particles are harvested and purified, as described in Grieger, J., et al., to provide an rAAV stock suitable for transducing mammalian cells.
  • Lentiviral vectors for the expression of TNFR ⁇ 7 For in vitro or in vivo delivery to mammalian cells of a TNFR ⁇ 7 gene for expression in those mammalian cells, a replication-incompetent lentivirus vector is generated.
  • a PCR product from Example 16, Example 19, Example 24 or Example 27 and the pLenti6/V5-D-TOPO® vector (Invitrogen) are blunt-end ligated according to the manufacturer's directions.
  • the resulting plasmid is transformed into E. coli, amplified, and purified using standard molecular biology techniques.
  • This plasmid is transfected into 293FT cells (Invitrogen) according to the manufacturer's directions to produce lentivirus particles containing the TNFR ⁇ 7 gene where expression is driven by the strong constitutive CMVie promoter.
  • the virus particles are harvested and purified, as described in Tiscornia, G., et al., 2006, Nature Protocols 1 :241, to provide a lentiviral stock suitable for transducing mammalian cells.
  • Example 15 The plasmids generated in Example 15 and Example 23 were used to express active protein in mammalian HeLa cells, and the resulting proteins were tested for anti-TNF- ⁇ activity.
  • HeLa cells were seeded in at 1.0 * 10 s cells per well in 24- well plates in SMEM media containing L-glutamine, gentamicin, kanamycin, 5% FBS and 5% HS. Cells were grown overnight at 37 0 C in a 5% CO 2 humidified atmosphere.
  • plasmid DNA was added to 50 ⁇ L of OPTI-MEMTM, and then 50 ⁇ L LipofectamineTM 2000 mix (1 part LipofectamineTM 2000 to 25 parts OPTI-MEMTM) was added and incubated for 20 minutes. Then 400 ⁇ L of serum free media was added and then applied to the cells in the 24-well plates. After incubation for ⁇ 48 hrs at 37 0 C in a 5% CO 2 humidified atmosphere, the media was collected and the cells were harvested in 800 ⁇ L TRI-ReagentTM.
  • the concentration of soluble TNFR2 in the media was measured by ELISA.
  • L929 cells were plated in 96-well plates at 2 x 10 4 cells per well in MEM media containing 10% regular FBS, penicillin and streptomycin and grown overnight at 37°C in a 5% CO 2 humidified atmosphere.
  • the media samples were diluted 1, 2, 4, 8 and 16 fold with media from non-transfected HeLa cells.
  • Ninety ⁇ L of each of these samples was added to 10 ⁇ L of serum-free media, containing 1.0 ng/ml TNF- ⁇ and 1 ⁇ g/ml of actinomyc ⁇ n D. The media from the cells were removed and replaced with these 100 ⁇ L samples.
  • the cells were then grown overnight at 37 0 C in a 5% CO 2 humidified atmosphere. Twenty ⁇ L CellTiter 96® AQu6ous One Solution Reagent (Promega) was then added to each well. Cell viability was measured 4 hrs later by measuring absorbance at 490 nm with a microplate reader. Cell viability was normalized to untreated cells nd plotted as a function of TNF antagonist concentration (FIG. 17).
  • Example 15 The plasmids generated in Example 15 and Example 23 were used to express and purify TNFR2 ⁇ 7 from mammalian HeLa cells. HeLa cells were plated in 6-well plates at 5 x lO 5 cells per well, and grown overnight at 37°C, 5% CO2, in humidified atmosphere.
  • Each well was then transfected with 1.5 ⁇ g of plasmid DNA using either 1144-4 (mouse TNFR2 ⁇ 7 with His-tag), 1145-1 (mouse TNFR2 ⁇ 7, no His-tag), 1230-1 (human TNFR2 ⁇ 7, no His-tag) or 1319-1 (human TNFR2 ⁇ 7 with His-tag) plasmids.
  • Media was collected ⁇ 48 hrs after transfection and concentrated approximately 40-fold using Amicon MWCO 30,000 filters.
  • the cells were lysed in 120 ⁇ L of RIPA lysis buffer (Invitrogen) with protease inhibitors (Sigma-aldrich) for 5 minutes on ice. Protein concentration was determined by the Bradford assay.
  • Proteins were isolated from aliquots of the cell lysates and the extracellular media and analyzed by western blot for TNFR2 as described in Example 1 (FIG. 18).
  • Human and mouse TNFR2 ⁇ 7 with a His-tag (clones 1319-1 and 1144-4, respectively) were purified from the above media by affinity chromatography. HisPurTM cobalt spin columns (Pierce) were used to purify mouse and human TNFR2 ⁇ 7 containing a His-tag from the above media.
  • TNFR2 ⁇ 7 proteins expressed from plasmids 1230-1 or 1145-1 which do not contain a His-tag where subjected to the above purification procedure. These proteins do not bind the affinity column and do not appear in the eluate (FIG. 19).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pain & Pain Management (AREA)
  • Physics & Mathematics (AREA)
  • Rheumatology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne des antagonistes du facteur onconécrosant (TNF) et les acides nucléiques correspondants dérivés des récepteurs du facteur onconécrosant (TNFR) et leur utilisation pour le traitement de maladies inflammatoires. Ces protéines sont des récepteurs leurres secrétés solubles qui se lient au TNS et empêchent le signalement du TNF aux cellules. Les protéines sont notamment des TNFR mammaliens auxquelles manque exon 7 et qui peuvent se lier au TNF et agir en tant qu'antagoniste du TNF.
PCT/US2007/010556 2006-02-08 2007-05-01 Récepteurs de tnf solubles et leur utilisation pour le traitement de maladies WO2008051306A1 (fr)

Priority Applications (24)

Application Number Priority Date Filing Date Title
CA002666981A CA2666981A1 (fr) 2006-10-20 2007-05-01 Recepteurs de tnf solubles et leur utilisation pour le traitement de maladies
AU2007309650A AU2007309650A1 (en) 2006-02-08 2007-05-01 Soluble TNF receptors and their use in treatment of disease
EP07776571A EP2089521A1 (fr) 2006-02-08 2007-05-01 Récepteurs de tnf solubles et leur utilisation pour le traitement de maladies
CA002684724A CA2684724A1 (fr) 2007-05-01 2007-10-19 Oligomeres permutant l'epissage pour la superfamille des recepteurs au tnf et leur utilisation dans le traitement de maladies
CA3165250A CA3165250A1 (fr) 2007-05-01 2007-10-19 Oligomeres permutant l'epissage pour la superfamille des recepteurs au tnf et leur utilisation dans le traitement de maladies
KR1020097025067A KR101531934B1 (ko) 2007-05-01 2007-10-19 Ｔｎｆ 슈퍼패밀리 수용체에 대한 스플라이스 스위칭 올리고머 및 질병 치료에 있어서의 그의 용도
CA3072221A CA3072221A1 (fr) 2007-05-01 2007-10-19 Oligomeres permutant l'epissage pour la superfamille des recepteurs au tnf et leur utilisation dans le traitement de maladies
EP07821575.3A EP2147103B1 (fr) 2007-05-01 2007-10-19 Oligomères permutant l'épissage pour la superfamille des récepteurs au tnf et leur utilisation dans le traitement de maladies
KR1020187020209A KR20180082646A (ko) 2007-05-01 2007-10-19 Ｔｎｆ 슈퍼패밀리 수용체에 대한 스플라이스 스위칭 올리고머 및 질병 치료에 있어서의 그의 용도
MX2012008375A MX346434B (es) 2007-05-01 2007-10-19 Oligómeros de cambio de empalme de receptores de la superfamilia tnf y su uso en el tratamiento de enfermedades.
KR1020157006381A KR20150036814A (ko) 2007-05-01 2007-10-19 Ｔｎｆ 슈퍼패밀리 수용체에 대한 스플라이스 스위칭 올리고머 및 질병 치료에 있어서의 그의 용도
MX2009011856A MX2009011856A (es) 2007-05-01 2007-10-19 Oligomeros de cambio de division de receptores de la superfamilia tnf y su uso en tratamientos o enfermedades.
CN201410244615.9A CN104278033A (zh) 2007-05-01 2007-10-19 Tnf超家族受体的剪接转换寡聚物,以及它们治疗疾病的用途
CN200780053595.5A CN101889086B (zh) 2007-05-01 2007-10-19 Tnf超家族受体的剪接转换寡聚物，以及它们治疗疾病的用途
CA2991580A CA2991580A1 (fr) 2007-05-01 2007-10-19 Oligomeres permutant l'epissage pour la superfamille des recepteurs au tnf et leur utilisation dans le traitement de maladies
PCT/EP2007/061211 WO2008131807A2 (fr) 2007-05-01 2007-10-19 Oligomères permutant l'épissage pour la superfamille des récepteurs au tnf et leur utilisation dans le traitement de maladies
AU2007352163A AU2007352163A1 (en) 2007-05-01 2007-10-19 Splice switching oligomers for TNF superfamily receptors and their use in treatment of disease
KR1020157033784A KR101738655B1 (ko) 2007-05-01 2007-10-19 Ｔｎｆ 슈퍼패밀리 수용체에 대한 스플라이스 스위칭 올리고머 및 질병 치료에 있어서의 그의 용도
KR1020177013046A KR20170056032A (ko) 2007-05-01 2007-10-19 Ｔｎｆ 슈퍼패밀리 수용체에 대한 스플라이스 스위칭 올리고머 및 질병 치료에 있어서의 그의 용도
JP2010504466A JP2010524476A (ja) 2007-05-01 2007-10-19 Ｔｎｆスーパーファミリー受容体についてのスプライススイッチオリゴマーおよび疾患の治療におけるそれらの使用方法
US12/960,296 US20120040917A1 (en) 2006-10-20 2010-12-03 Splice Switching Oligomers for TNF Superfamily Receptors and Their Use in Treatment of Disease
HK11104796.5A HK1150850A1 (en) 2007-05-01 2011-05-16 Splice switching oligomers for tnf superfamily receptors and their use in treatment of disease tnf
JP2013222417A JP2014050400A (ja) 2007-05-01 2013-10-25 Ｔｎｆスーパーファミリー受容体についてのスプライススイッチオリゴマー
HK15105622.8A HK1205184A1 (en) 2007-05-01 2015-06-15 Splice switching oligomers for tnf superfamily receptors and their use in treatment of disease tnf

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US86235006P 2006-10-20 2006-10-20
US60/862,350 2006-10-20
USPCT/US2006/043651 2006-11-10
PCT/US2006/043651 WO2007058894A2 (fr) 2005-11-10 2006-11-10 Oligomeres permutant l’epissage destines a la superfamille des recepteurs tnf et leur utilisation lors de traitements de maladies

Publications (2)

Publication Number Publication Date
WO2008051306A1 true WO2008051306A1 (fr) 2008-05-02
WO2008051306A8 WO2008051306A8 (fr) 2009-10-01

Family

ID=40822966

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/010556 WO2008051306A1 (fr) 2006-02-08 2007-05-01 Récepteurs de tnf solubles et leur utilisation pour le traitement de maladies

Country Status (4)

Country Link
EP (1) EP2089521A1 (fr)
AU (1) AU2007309650A1 (fr)
CA (1) CA2666981A1 (fr)
WO (1) WO2008051306A1 (fr)

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008131807A2 (fr) * 2007-05-01 2008-11-06 Santaris Pharma A/S Oligomères permutant l'épissage pour la superfamille des récepteurs au tnf et leur utilisation dans le traitement de maladies
US7785834B2 (en) 2005-11-10 2010-08-31 Ercole Biotech, Inc. Soluble TNF receptors and their use in treatment of disease
US7888012B2 (en) 2005-02-09 2011-02-15 Avi Biopharma, Inc. Antisense composition and method for treating muscle atrophy
WO2011048125A1 (fr) 2009-10-20 2011-04-28 Santaris Pharma A/S Administration orale d'oligonucléotides de lna thérapeutiquement efficaces
WO2013001372A2 (fr) 2011-06-30 2013-01-03 University Of Oslo Procédés et compositions pour inhiber l'activation des lymphocytes t régulateurs
WO2013005108A1 (fr) 2011-07-06 2013-01-10 Sykehuset Sorlandet Hf Traitement ayant pour cible egfr
US8415313B2 (en) 2004-01-23 2013-04-09 Avi Biopharma, Inc. Antisense oligomers and methods for inducing immune tolerance and immunosuppression
US8436163B2 (en) 2000-05-04 2013-05-07 Avi Biopharma, Inc. Splice-region antisense composition and method
US8722615B2 (en) 2009-12-02 2014-05-13 Acceleron Pharma, Inc. Compositions and methods for increasing serum half-life
WO2014076195A1 (fr) 2012-11-15 2014-05-22 Santaris Pharma A/S Conjugués d'oligonucléotides
WO2014118267A1 (fr) 2013-01-30 2014-08-07 Santaris Pharma A/S Conjugués glucidiques d'oligonucléotides d'acides nucléiques bloqués
US8883982B2 (en) 2011-06-08 2014-11-11 Acceleron Pharma, Inc. Compositions and methods for increasing serum half-life
US8911729B2 (en) 2011-01-10 2014-12-16 The Regents Of The University Of Michigan Stem cell factor inhibitor
US10106795B2 (en) 2011-10-04 2018-10-23 Royal Holloway And Bedford New College Oligomers
US10501535B2 (en) 2011-01-10 2019-12-10 The Regents Of The University Of Michigan Antibody targeting stem cell factor
US10611844B2 (en) 2012-12-21 2020-04-07 Sykehuset Sørlandet Hf EGFR targeted therapy of neurological disorders and pain
US10988543B2 (en) 2015-11-11 2021-04-27 Opi Vi—Ip Holdco Llc Humanized anti-tumor necrosis factor alpha receptor 2 (anti-TNFR2) antibodies and methods of use thereof to elicit an immune response against a tumor
US11015200B2 (en) 2015-03-18 2021-05-25 Sarepta Therapeutics, Inc. Antisense-induced exon exclusion in myostatin
CN112921046A (zh) * 2021-02-24 2021-06-08 上海市第十人民医院 一种可溶性人肿瘤坏死因子ⅱ型受体蛋白的制备方法

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994006476A1 (fr) * 1992-09-15 1994-03-31 Immunex Corporation Procede de traitement de l'inflammation dependante du facteur necrosant des tumeurs malignes (tnf) a l'aide d'antagonistes dudit tnf
WO2000053624A1 (fr) * 1999-03-11 2000-09-14 Gryphon Sciences Synthese chimique et utilisation de domaines de recepteurs de proteines membranaires solubles
WO2007058894A2 (fr) * 2005-11-10 2007-05-24 The University Of North Carolina At Chapel Hill Oligomeres permutant l’epissage destines a la superfamille des recepteurs tnf et leur utilisation lors de traitements de maladies

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994006476A1 (fr) * 1992-09-15 1994-03-31 Immunex Corporation Procede de traitement de l'inflammation dependante du facteur necrosant des tumeurs malignes (tnf) a l'aide d'antagonistes dudit tnf
WO2000053624A1 (fr) * 1999-03-11 2000-09-14 Gryphon Sciences Synthese chimique et utilisation de domaines de recepteurs de proteines membranaires solubles
WO2007058894A2 (fr) * 2005-11-10 2007-05-24 The University Of North Carolina At Chapel Hill Oligomeres permutant l’epissage destines a la superfamille des recepteurs tnf et leur utilisation lors de traitements de maladies

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
LAINEZ, B. ET AL.: "Identification and characterization of a novel spliced variant that encodes human soluble tumor necrosis factor receptor 2.", INTERNATIONAL IMMUNOLOGY, vol. 16, no. 1, January 2004 (2004-01-01), pages 169 - 177, XP002437188, ISSN: 0953-8178 *
MOOSMAYER DIETER ET AL: "Characterization of different soluble TNF receptor (TNFR80) derivatives: Positive influence of the intracellular domain on receptor/ligand interaction and TNF neutralization capacity", JOURNAL OF INTERFERON AND CYTOKINE RESEARCH, vol. 16, no. 6, 1996, pages 471 - 477, XP008086260, ISSN: 1079-9907 *
MUC-WIERZGON M ET AL: "Genetic disregulation of gene coding tumor necrosis factor alpha receptors (TNFalpha Rs) in colorectal cancer cells.", JOURNAL OF EXPERIMENTAL & CLINICAL CANCER RESEARCH, vol. 23, no. 4, December 2004 (2004-12-01), pages 651 - 660, XP008086271, ISSN: 0392-9078 *
SANTEE S M ET AL: "Human tumor necrosis factor receptor p75/80 (CD120b) gene structure and promoter characterization", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 271, no. 35, 30 August 1996 (1996-08-30), pages 21151 - 21159, XP002427327, ISSN: 0021-9258 *
See also references of EP2089521A1 *

Cited By (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10533174B2 (en) 2000-05-04 2020-01-14 Sarepta Therapeutics, Inc. Splice-region antisense composition and method
US9416361B2 (en) 2000-05-04 2016-08-16 Sarepta Therapeutics, Inc. Splice-region antisense composition and method
US8436163B2 (en) 2000-05-04 2013-05-07 Avi Biopharma, Inc. Splice-region antisense composition and method
US8895722B2 (en) 2000-05-04 2014-11-25 Sarepta Therapeutics, Inc. Splice-region antisense composition and method
US8415313B2 (en) 2004-01-23 2013-04-09 Avi Biopharma, Inc. Antisense oligomers and methods for inducing immune tolerance and immunosuppression
US7888012B2 (en) 2005-02-09 2011-02-15 Avi Biopharma, Inc. Antisense composition and method for treating muscle atrophy
US10626396B2 (en) 2005-02-09 2020-04-21 Sarepta Therapeutics, Inc. Antisense composition and method for treating muscle atrophy
US10006031B2 (en) 2005-02-09 2018-06-26 Sarepta Therapeutics, Inc. Antisense composition and method for treating muscle atrophy
US8785410B2 (en) 2005-02-09 2014-07-22 Sarepta Therapeutics, Inc. Antisense composition and method for treating muscle atrophy
US7785834B2 (en) 2005-11-10 2010-08-31 Ercole Biotech, Inc. Soluble TNF receptors and their use in treatment of disease
WO2008131807A2 (fr) * 2007-05-01 2008-11-06 Santaris Pharma A/S Oligomères permutant l'épissage pour la superfamille des récepteurs au tnf et leur utilisation dans le traitement de maladies
WO2008131807A3 (fr) * 2007-05-01 2009-02-12 Santaris Pharma As Oligomères permutant l'épissage pour la superfamille des récepteurs au tnf et leur utilisation dans le traitement de maladies
WO2011048125A1 (fr) 2009-10-20 2011-04-28 Santaris Pharma A/S Administration orale d'oligonucléotides de lna thérapeutiquement efficaces
US8722615B2 (en) 2009-12-02 2014-05-13 Acceleron Pharma, Inc. Compositions and methods for increasing serum half-life
US10501535B2 (en) 2011-01-10 2019-12-10 The Regents Of The University Of Michigan Antibody targeting stem cell factor
US8911729B2 (en) 2011-01-10 2014-12-16 The Regents Of The University Of Michigan Stem cell factor inhibitor
US9353178B2 (en) 2011-01-10 2016-05-31 The Regents Of The University Of Michigan Stem cell factor inhibitor
US9790272B2 (en) 2011-01-10 2017-10-17 The Regents Of The University Of Michigan Stem cell factor inhibitor
US8883982B2 (en) 2011-06-08 2014-11-11 Acceleron Pharma, Inc. Compositions and methods for increasing serum half-life
WO2013001372A2 (fr) 2011-06-30 2013-01-03 University Of Oslo Procédés et compositions pour inhiber l'activation des lymphocytes t régulateurs
US10980879B2 (en) 2011-07-06 2021-04-20 Sykehuset Sørlandet Hf EGFR targeted therapy
WO2013005108A1 (fr) 2011-07-06 2013-01-10 Sykehuset Sorlandet Hf Traitement ayant pour cible egfr
US10947536B2 (en) 2011-10-04 2021-03-16 Royal Holloway And Bedford New College Oligomers
US10106795B2 (en) 2011-10-04 2018-10-23 Royal Holloway And Bedford New College Oligomers
US10421969B2 (en) 2011-10-04 2019-09-24 Royal Holloway And Bedford New College Oligomers
US10662431B2 (en) 2011-10-04 2020-05-26 Royal Holloway And Bedford New College Oligomers
US11155816B2 (en) 2012-11-15 2021-10-26 Roche Innovation Center Copenhagen A/S Oligonucleotide conjugates
EP3406718A1 (fr) 2012-11-15 2018-11-28 Roche Innovation Center Copenhagen A/S Conjugués d'oligonucléotides
US10077443B2 (en) 2012-11-15 2018-09-18 Roche Innovation Center Copenhagen A/S Oligonucleotide conjugates
WO2014076195A1 (fr) 2012-11-15 2014-05-22 Santaris Pharma A/S Conjugués d'oligonucléotides
US10611844B2 (en) 2012-12-21 2020-04-07 Sykehuset Sørlandet Hf EGFR targeted therapy of neurological disorders and pain
US11396548B2 (en) 2012-12-21 2022-07-26 Sykehuset Sørlandet Hf EGFR targeted therapy of neurological disorders and pain
WO2014118267A1 (fr) 2013-01-30 2014-08-07 Santaris Pharma A/S Conjugués glucidiques d'oligonucléotides d'acides nucléiques bloqués
US11015200B2 (en) 2015-03-18 2021-05-25 Sarepta Therapeutics, Inc. Antisense-induced exon exclusion in myostatin
US10988543B2 (en) 2015-11-11 2021-04-27 Opi Vi—Ip Holdco Llc Humanized anti-tumor necrosis factor alpha receptor 2 (anti-TNFR2) antibodies and methods of use thereof to elicit an immune response against a tumor
CN112921046A (zh) * 2021-02-24 2021-06-08 上海市第十人民医院 一种可溶性人肿瘤坏死因子ⅱ型受体蛋白的制备方法

Also Published As

Publication number Publication date
EP2089521A1 (fr) 2009-08-19
CA2666981A1 (fr) 2008-05-02
AU2007309650A8 (en) 2009-11-26
AU2007309650A1 (en) 2008-05-02
WO2008051306A8 (fr) 2009-10-01

Similar Documents

Publication Publication Date Title
US20210363222A1 (en) Soluble TNF Receptors and Their Use in Treatment of Disease
WO2008051306A1 (fr) Récepteurs de tnf solubles et leur utilisation pour le traitement de maladies
EP2147103B1 (fr) Oligomères permutant l'épissage pour la superfamille des récepteurs au tnf et leur utilisation dans le traitement de maladies
US20170015697A1 (en) Splice switching oligomers for tnf superfamily receptors and their use in treatment of disease
KR101789603B1 (ko) Ｔｎｆ 수퍼패밀리 수용체에 대한 스플라이스 스위칭올리고머 및 염증성 질환 치료용 약제학적 조성물
AU2022200560A1 (en) Soluble tnf receptors and their use in treatment of disease
AU2020213269A1 (en) Soluble tnf receptors and their use in treatment of disease
US20190359986A1 (en) Splice switching oligomers for tnf superfamily receptors and their use in treatment of disease

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07776571

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2666981

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2007309650

Country of ref document: AU

Ref document number: 2007776571

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2007309650

Country of ref document: AU

Date of ref document: 20070501

Kind code of ref document: A