WO2008033304A2 - Méthodes de promotion de vascularisation collatérale exempte de fuites. - Google Patents

Méthodes de promotion de vascularisation collatérale exempte de fuites. Download PDF

Info

Publication number
WO2008033304A2
WO2008033304A2 PCT/US2007/019670 US2007019670W WO2008033304A2 WO 2008033304 A2 WO2008033304 A2 WO 2008033304A2 US 2007019670 W US2007019670 W US 2007019670W WO 2008033304 A2 WO2008033304 A2 WO 2008033304A2
Authority
WO
WIPO (PCT)
Prior art keywords
hif
protein
hypoxia
ischemic
transcriptional activation
Prior art date
Application number
PCT/US2007/019670
Other languages
English (en)
Other versions
WO2008033304A3 (fr
Inventor
Richard J. Gregory
Canwen Jiang
Original Assignee
Genzyme Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genzyme Corporation filed Critical Genzyme Corporation
Publication of WO2008033304A2 publication Critical patent/WO2008033304A2/fr
Publication of WO2008033304A3 publication Critical patent/WO2008033304A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • A61P5/48—Drugs for disorders of the endocrine system of the pancreatic hormones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/035—Animal model for multifactorial diseases
    • A01K2267/0375—Animal model for cardiovascular diseases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/71—Fusion polypeptide containing domain for protein-protein interaction containing domain for transcriptional activaation, e.g. VP16
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/022—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from an adenovirus

Definitions

  • the walls of small blood vessels act as a microf ⁇ lter, allowing the passage of water and solutes but blocking that of macromolecules and cells.
  • An increase in the permeability of the blood vessels results in extravasation of both fluid and plasma macromolecules, such as proteins.
  • vascular permeability is observed during acute events, such as tissue trauma, infection, and sepsis resulting in an increase in intracellular fluid in tissues or organs. Eventually, this increase in fluid will negatively impact tissue and organ function. Examples of such conditions include pulmonary edema, cerebral edema and cardiac edema.
  • Diabetes mellitus is a chronic disease that affects approximately 13 million people in the United States. Approximately 90% of diabetics have type 2 diabetes, which is related to insulin resistance (lack of the ability of the body to respond to insulin appropriately) and is often accompanied by obesity and high cholesterol. Type 2 diabetes increases the risk for many serious complications including an increased risk of infections, microvascular complications (e.g., retinopathy, nephropathy), neuropathic complications, and macrovascular disease. Individuals suffering from diabetes also exhibit an increase in vascular permeability, most notably in the micro vasculature of the kidney, eye, brain, and other peripheral tissues, such as the skin and muscles.
  • VEGF vascular endothelial growth factor
  • Hypoxia-inducible factor 1 is a transcription factor that functions as a master regulator of hypoxia-induced angiogenesis.
  • Hypoxia a state in which tissue or cellular O 2 demand exceeds supply
  • hypoxia is a powerful modulator of gene expression.
  • the physiologic response to hypoxia involves enhanced erythropoiesis (Jelkman, Physiol. Rev.
  • VEGF vascular endothelial growth factor
  • vascular endothelial growth factor a primary regulator of angiogenesis and thus a major determinant of tissue perfusion
  • hypoxia-responsive element located within the promoter/enhancer elements of hypoxia-inducible genes.
  • HREs consist of an hypoxia-inducible factor protein binding site (that contains the core sequence 5'-CGTG-3') as well as additional DNA sequences that are required for function, which in some elements includes a second binding site.
  • the present invention provides a method for promoting non- leaky collateral vascularization in a patient in need thereof.
  • the method comprises administering to the patient an effective amount of a nucleic acid molecule encoding a biologically active chimeric transactivator protein comprising the DNA-binding domain of a hypoxia-inducible factor protein and a protein domain capable of transcriptional activation.
  • the vascularization is in a peripheral tissue of the patient.
  • the peripheral tissue comprises tissue located in an organ selected from the group consisting of kidney, eye, brain, bone, skin and muscle.
  • the patient has a disorder that is characterized by increased vascular permeability (e.g., diabetes (e.g., type 2 diabetes), Clarkson's disease).
  • a disorder that is characterized by increased vascular permeability e.g., diabetes (e.g., type 2 diabetes), Clarkson's disease).
  • hypoxia-inducible factor protein is HIF- lot (e.g., human HIF- l ⁇ ).
  • the DNA-binding domain of HIF- l ⁇ comprises amino acids 1-390 of human HIF-l ⁇ .
  • the protein domain capable of transcriptional activation is not derived from a hypoxia-inducible factor protein.
  • the protein domain capable of transcriptional activation is derived from a protein selected from the group consisting of: HSV VP 16; NFKB; a heat shock factor; p53; fos; v-jun; factor EF-C; HIV tat; HPV E2; Ad El ⁇ ; SpI ; API; CTF/NF1 ; E2F1 ; HAPl ; HAP2; MCMl; PHO2; GAL4; GCN4; and GALl 1.
  • the protein domain capable of transcriptional activation is synthetic.
  • hypoxia-inducible factor protein is HIF- l ⁇ (e.g., human HIF-I ⁇ ) and the protein domain capable of transcriptional activation is a transcriptional activation domain from HSV VPl 6.
  • hypoxia-inducible factor protein is HIF-I ⁇ (e.g., human HIF-I ⁇ ) and the protein domain capable of transcriptional activation is a transcriptional activation domain from NFKB.
  • the nucleic acid molecule in some embodiments, is administered via a recombinant expression vector.
  • the recombinant expression vector comprises the nucleic acid molecule operatively linked to an expression control sequence.
  • the expression control sequence further comprises an inducible promoter.
  • the expression vector is an adenoviral vector.
  • the expression control sequence comprises an inducible promoter.
  • the expression vector is Ad2/HIF-l ⁇ /VP16.
  • collateral vascularization occurs in vasculature comprising vessels with an internal diameter no greater than 3.75 mm.
  • collateral vascularization occurs in vasculature comprising vessels having an internal diameter that is no greater than that of vessels located two bifurcations downstream of a major conductance artery (e.g., popliteal artery, saphenous artery, main coronary artery).
  • a major conductance artery e.g., popliteal artery, saphenous artery, main coronary artery.
  • the methods of the invention further comprise coadministering one or more therapeutic agents or regimens (e.g., a lipid-lowering agent, an anti-hypertensive agent or regimen, an anti-diabetic agent or regimen, a smoking-cessation intervention agent or regimen, a homocysteine-lowering agent or regimen, an anti-platelet and/or anti-thrombotic agent, an exercise and/or lower extremity rehabilitation regimen).
  • one or more therapeutic agents or regimens e.g., a lipid-lowering agent, an anti-hypertensive agent or regimen, an anti-diabetic agent or regimen, a smoking-cessation intervention agent or regimen, a homocysteine-lowering agent or regimen, an anti-platelet and/or anti-thrombotic agent, an exercise and/or lower extremity rehabilitation regimen.
  • the biologically active chimeric transactivator nucleic acid is administered in combination with a medical and pharmacological treatment for claudication (e.g., cilostazol, pentoxifylline, naftidrofuryl, L-arginine, propionyl-L-carnitine, and/or vasodilator prostaglandins, such as beraprost and iloprost).
  • a medical and pharmacological treatment for claudication e.g., cilostazol, pentoxifylline, naftidrofuryl, L-arginine, propionyl-L-carnitine, and/or vasodilator prostaglandins, such as beraprost and iloprost.
  • the biologically active chimeric transactivator nucleic acid is administered to a patient who has undergone, or is undergoing, endovascular intervention (e.g., percutaneous transluminal angioplasty
  • the collateral vascularization occurs at a site that is distal to the site of injection of the nucleic acid molecule.
  • the invention is a method of treating diabetes (e.g., type 2 diabetes) in a subject comprising administering to the subject an effective amount of a nucleic acid molecule encoding a biologically active chimeric transactivator protein comprising the DNA-binding domain of a hypoxia-inducible factor protein and a protein domain capable of transcriptional activation.
  • the diabetic subject does not have an ischemic disorder.
  • the invention is a method of treating a subject having an ischemic disorder (e.g., ischemic heart disease, peripheral vascular disease, ischemic limb disease) and a disorder characterized by increased vascular permeability (e.g., diabetes (e.g., type 2 diabetes)), comprising administering to the subject an effective amount of a nucleic acid molecule encoding a biologically active chimeric transactivator protein comprising the DNA-binding domain of a hypoxia-inducible factor protein and a protein domain capable of transcriptional activation.
  • an ischemic disorder e.g., ischemic heart disease, peripheral vascular disease, ischemic limb disease
  • a disorder characterized by increased vascular permeability e.g., diabetes (e.g., type 2 diabetes)
  • FIG. 1 is a restriction map schematic of the hybrid construct pcDNA3/HIF/VP 16/Afl2.
  • FIG. 2 is a restriction map schematic of the hybrid construct pcDN A3/HIF/VP 16/Rl.
  • FIG. 3 is a schematic of the recombinant adenoviral vector containing the HIF-IoWP 16 hybrid chimeric sequence.
  • FIG. 4 A is a graph showing induction of VEGF mRNA in skeletal myoblasts (SkMBs) infected with Ad2/HIF-l ⁇ /VPl 6 and Ad2/HIF-1 ⁇ /NF ⁇ B.
  • Naive non- infected skeletal myoblasts
  • EV skeletal myoblasts infected with the empty adenoviral vector control Ad2/CMVEV (no transgene)
  • HIF-l ⁇ /VP16 SkMBs expressing Ad2/HIF-l ⁇ /VP16
  • HIF-I ⁇ /NF ⁇ B SkMBs expressing Ad2/HIF-
  • FIG. 4B is a graph showing induction of VEGF protein in skeletal myoblasts
  • SkMBs infected with Ad2/HIF-l ⁇ /VP16 and Ad2/HIF-l ⁇ /NF ⁇ B.
  • Naive non- infected skeletal myoblasts
  • EV skeletal myoblasts infected with the empty adenoviral vector control Ad2/CMVEV (no transgene)
  • HIF-l ⁇ /VP16 SkMBs expressing Ad2/HIF-l ⁇ /VP16
  • HIF-l ⁇ /NF ⁇ B SkMBs expressing Ad2/HIF- l ⁇ / NF ⁇ B.
  • FIG. 5 A is a graph showing induction of VEGF mRNA in skeletal myoblasts (SkMBs) infected with different numbers of Ad2/HIF-l ⁇ /VP16 virus particles.
  • EV skeletal myoblasts infected with the empty adenoviral vector control
  • Ad2/CMVEV no transgene
  • HIF-l ⁇ /VP16 SkMBs expressing Ad2/HIF- l ⁇ /VP16.
  • ⁇ * indicates p ⁇ 0.01 vs. EV at the same dose.
  • FIG. 5B is a graph showing induction of VEGF protein in skeletal myoblasts (SkMBs) infected with Ad2/HIF-l ⁇ /VP16 or Ad2/HIF-l ⁇ /NF ⁇ B virus particles.
  • Naive SkMB non-infected skeletal myoblasts
  • EV skeletal myoblasts infected with the empty adenoviral vector control Ad2/CMVEV (no transgene)
  • HIF- l ⁇ /VP16 SkMBs expressing Ad2/HIF-l ⁇ /VP16
  • HIF-l ⁇ /NF ⁇ B SkMBs expressing Ad2/HIF- lot/ NFKB. ** indicates p ⁇ 0.01 vs. Naive SkMB.
  • FIGS. 6A-6C are representative micrographs depicting enhanced collateral development by transplantation of skeletal myoblasts (SkMBs) infected with
  • FIG. 6A shows an ischemic hind limb treated only with the vehicle
  • FIG. 6B shows a hind limb that has been injected with unmodified (i.e., non-infected) SkMBs
  • FIG. 6C shows a hind limb that was injected with SkMBs that were infected with Ad2/HIF-l ⁇ /VP16.
  • FIG. 7 is a graph showing angiographic scores in ischemic hind limbs of rats that were treated with various infected skeletal myoblasts (SkMBs).
  • FIG. 8 is a graph showing the number of collateral arteries that were present in ischemic hind limbs of rats treated with various infected skeletal myoblasts (SkMBs).
  • FIG. 9 is a graph showing the diameter ( ⁇ m) of collateral arteries that were present in ischemic hind limbs of rats treated with various infected skeletal myoblasts (SkMBs).
  • FIG. 10 is a graph illustrating promotion of vessel integrity, as measured by Evans blue content, in ischemic hind limbs of rats treated with skeletal myoblasts (SkMBs) expressing Ad2/HIF-l ⁇ /VP16 or Ad2/HIF- 1 ⁇ /NF ⁇ B, as compared to ischemic hind limbs of rats treated with SkMBs expressing VEGF.
  • SkMBs skeletal myoblasts
  • FlG. 1 1 is a graph depicting angiographic scores in ischemic hind limbs of normal and ZDF rats that were treated with various infected skeletal myoblasts (SkMBs). Angiographic scores were obtained from postmortem angiograms performed 28 days after removal of the femoral artery (21 days after adenoviral vector delivery).
  • Vehicle ischemic hind limb treated only with the vehicle;
  • Uninf ischemic hind limb treated with non-infected SkMBs;
  • EV ischemic hind limb treated with SkMBs infected with the empty adenoviral vector control Ad2/CMVEV (no transgene);
  • VEGF ischemic hind limb treated with SkMBs expressing
  • FIG. 12 is a graph depicting angiographic scores in ischemic hind limbs of lean and ZDF rats that were treated with various infected skeletal myoblasts (SkMBs).
  • Lean rat + EV ischemic hind limb of lean rat treated with SkMBs infected with the empty adenoviral vector control Ad2/CMVEV (no transgene);
  • ZDF rat + EV ischemic hind limb of ZDF rat treated with SkMBs infected with the empty adenoviral vector control Ad2/CMVEV (no transgene);
  • ZDF rat + VEGF ischemic hind limb of ZDF rat treated with SkMBs infected with SkMBs expressing Ad2/VEGF;
  • ZDF rat + HIF ischemic hind limb of ZDF rat treated with SkMBs infected with SkMBs expressing Ad2/HIF-l ⁇ /VP16.
  • FIG. 13 is a graph depicting the ischemic limb/normal limb ratio of normal and ZDF rats that were treated with various infected skeletal myoblasts (SkMBs).
  • Normal rat + EV ischemic hind limb of normal rat treated with SkMBs infected with the empty adenoviral vector control Ad2/CMVEV (no transgene);
  • ZDF rat + EV ischemic hind limb of ZDF rat treated with SkMBs infected with the empty adenoviral vector control Ad2/CMVEV (no transgene);
  • ZDF rat + VEGF ischemic hind limb of ZDF rat treated with SkMBs infected with SkMBs expressing Ad2/VEGF;
  • ZDF rat + HIFIa ischemic hind limb of ZDF rat treated with SkMBs infected with SkMBs expressing Ad2/HIF-l ⁇ /VP16.
  • FIG. 14 is a graph depicting the relative perfusion change from baseline for particular tissues (feet, calf and quadricep) for rats that were treated with intramuscular injection (IM) of Ad2/HIF- 1 ⁇ /VP 16 (HIF), a control vector (EV) or no treatment (no) in the medial vastus and adductor muscles.
  • FIGS. 15A-15D are pictures showing complete resolution of an ulcer
  • FIG. 15A shows a non-healing ulcer at baseline.
  • FIG. 15B shows the ulcer after receiving placebo, demonstrating treatment failure 4.9 months after receiving the placebo.
  • FIG. 15C shows the result of rollover to active treatment with IxIO 10 vp Ad2/HIF-l ⁇ /VP16. As shown in FIG. 15C, there is evidence of ulcer healing 6 months after treatment.
  • FIG. 15D shows complete ulcer healing after 1 year of Ad2/HIF-l ⁇ /VP16-treatment.
  • FIGS. 16A-16B show representative post-mortem angiograms in ZL and ZDF rats 35 days after the removal of the femoral artery.
  • FIGS. 17A-D show mRNA levels of VEGF (17A), Ang-1 (17B), Ang-2 (17C), and Ang-4 (17D) in ZL (open columns) and ZDF (solid columns) rats.
  • FIGS. 18A-18B show representative post-mortem angiograms in ZL and ZDF rats 21 days after the removal of the femoral artery and 14 days after the injection of vehicle, Ad2/EV (EV), Ad2/VEGF (VEGF), or Ad2/HIF- 1 ⁇ /VP 16 (HIF-I ⁇ /VP 16).
  • FIGS. 19A-19B FIG.
  • FIG. 19A shows representative post-mortem angiograms in ZL and ZDF rats 35 days after the removal of the femoral artery and 28 days after the injection of vehicle, Ad2/EV (EV), Ad2/VEGF (VEGF), or Ad2/HIF-l ⁇ /VP16 (HIF-l ⁇ VP16).
  • FIG. 20 shows representative microphotographs of lectin staining in ZL and ZDF rats 35 days after the removal of the femoral artery and injection of vehicle, Ad2/EV (EV), Ad2/VEGF (VEGF), or Ad2/HIF-l ⁇ /VP16 (HIF-I ⁇ /VP 16).
  • Ad2/EV EV
  • VEGF Ad2/VEGF
  • Ad2/HIF-l ⁇ /VP16 Ad2/HIF-l ⁇ /VP16
  • the present invention provides for methods and compositions useful in promoting the formation of non-leaky collateral vascularization.
  • the promotion of non-leaky collateral vascularization is desirable in patients suffering from diseases or conditions that are characterized either by a lack of sufficient blood vessels or the presence of abnormally leaky blood vessels.
  • An increase in vascular permeability is observed during acute events, such as tissue trauma, infection, and sepsis.
  • vascular permeability increases in vascular permeability are observed in certain diseases including diabetes, Clarkson's disease, and diseases of the peripheral tissue and organs including diseases of the liver, kidney eye, brain, bone, skin, and muscle tissues. Increased vascular permeability results in the deterioration of the microcirculation and is implicated in organ and tissue damage.
  • the patient to be treated is suffering from a disease or condition associated with a vascular permeability abnormality.
  • the patient is suffering from diabetes, especially type 2 diabetes, or Clarkson's disease.
  • One aspect of the invention provides for a method of promoting non-leaky collateral vascularization in a patient in need thereof comprising administering to the patient an effective amount of a nucleic acid molecule encoding a biologically active chimeric transactivator protein.
  • Non-leaky vessels or vascularization refers to blood vessels that have vascular integrity similar to that observed in physiologically normal, or healthy, blood vessels.
  • Vascular integrity is known by those of skill in the art to refer to the ability of the blood vessel to retain fluids and macromolecules, such as proteins, within its interior.
  • Leaky vessels permit an abnormally high level of macromolecules and/or fluid to leak through the wall of the blood vessel into the surrounding tissue.
  • the vasculature formed as a result of administration of the nucleic acid molecule encoding a biologically active chimeric transactivator protein may have the same vascular integrity of normal, or healthy, blood vessels but a range of relative integrity is allowed.
  • the vasculature promoted by administration of the nucleic acid molecule encoding the biologically active chimeric transactivator protein has greater than 80% of the vascular integrity of normal blood vessels, or alternatively, greater than 85%, greater than 90%, greater than 95%, or greater than 98%, of the vascular integrity of normal blood vessels.
  • administration of a nucleic acid molecule encoding a biologically active chimeric transactivator protein can increase the integrity of preexisting vessels.
  • the vasculature thus repaired has a greater than 20% increase in the vascular integrity as compared to the integrity of the blood vessels prior to administration of the nucleic acid molecule, or alternatively, greater than 40%, greater than 50%, greater than 75%, or greater than 100%, increase in the vascular integrity as compared to the integrity of the blood vessels prior to administration of the nucleic acid molecule encoding the biologically active chimeric transactivator protein.
  • Methods of determining vascular integrity are known in the art, including the use of a fully confluent endothelial monolayer culture, an Evans Blue Dye assay (e.g., as described herein), enhanced MRJ, CT, or PET scan.
  • an Evans Blue Dye assay e.g., as described herein
  • enhanced MRJ CT
  • PET scan PET scan.
  • endothelial cells are cultured on fibronectin-coated transwell and treated with growth factors or vasoactive agents (see, e.g., LaI, B.K. et al., Microvasc Res. 62(3):252-62 (2001)).
  • FITC-dextran can then be added into the upper compartment of the transwell cultures, followed by stimulation with thrombin.
  • the amount of FITC-dextran in the culture medium taken from the lower compartment is indicative of the permeability of the HPAEC monolayer, as determined using a fluorimeter.
  • Evans Blue Dye assay performed in an animal model, Evans blue dye is injected into the jugular vein or other major blood vessel of the animal. The animal is then perfused with a fixative, tissue samples of interest are isolated and the dye is extracted from the samples. The optical density of the dye extracts is measured, wherein an increase in optical density values for the tissue extracts indicates increased dye retention and hence vascular leakage.
  • Other methods of determine vascular integrity include, for example, enhanced MRJ (Zcharia, E. et al., FASEB J.
  • collateral vascularization occurs in vasculature comprising vessels with an internal diameter no greater than 3.75 mm.
  • collateral vascularization occurs in vasculature comprising vessels having an internal diameter that is no greater than that of vessels located two bifurcations downstream of a major conductance artery (e.g., popliteal artery, saphenous artery, main coronary artery).
  • a major conductance artery e.g., popliteal artery, saphenous artery, main coronary artery.
  • the vasculature that is most affected by diseases or conditions characterized by the presence of abnormally leaky blood vessels are capillaries and small blood vessels. In general, these capillaries and small blood vessels have an internal diameter no greater than about 80 ⁇ m (for arterioles) or no greater than about 10 ⁇ m (for capillaries).
  • the capillaries and small blood vessels have an internal diameter that is no greater than 70 ⁇ m, no greater than 60 ⁇ m, no greater than 50 ⁇ m, no greater than 40 ⁇ m, no greater than 30 ⁇ m, no greater than 20 ⁇ m, or no greater than 10 ⁇ m.
  • the nucleic acid molecule encoding a biologically active chimeric transactivator protein comprises the DN A-binding domain of a hypoxia-inducible factor (HIF) protein and a protein domain capable of transcriptional activation.
  • HIF hypoxia-inducible factor
  • HIF-I is a heterodimeric protein composed of two subunits: (i) a constitutively expressed beta ( ⁇ ) subunit also known as aryl hydrocarbon nuclear translocator (ARNT) (which is shared by other related transcription factors (e.g., the dioxin/aryl hydrocarbon receptor (DR/ AhR)); and (ii) an alpha (ot) subunit (see, e.g., WO 96/39426, International Application No. PCT/US96/10251 describing the recent affinity purification and molecular cloning of HIF-I ⁇ ) whose accumulation is regulated by a post-translational mechanism such that high levels of the alpha subunit can only be detected during hypoxic conditions.
  • ⁇ constitutively expressed beta subunit also known as aryl hydrocarbon nuclear translocator (ARNT) (which is shared by other related transcription factors (e.g., the dioxin/aryl hydrocarbon receptor (DR/ AhR)); and
  • alpha (ot) subunit see
  • Both subunits are members of the basic helix-loop-helix (bHLH)-PAS family of transcription factors. These domains regulate DNA binding and dimerization.
  • the transactivation domain resides in the C-terminus of the protein.
  • the basic region consists of approximately 15 predominantly basic amino acids responsible for direct DNA binding. This region, is adjacent to two amphipathic ⁇ helices, separated by a loop of variable length, which forms the primary dimerization interface between family members (Moore, A. W., et al., Proc. Natl. Acad. Sci. USA 97: 10436-41 (2000)).
  • the PAS domain which is named after the first three proteins in which it was identified (Per, ARNT and Sim), encompasses 200-300 amino acids containing two loosely conserved, largely hydrophobic regions approximately 50 amino acids, designated PAS A and PAS B.
  • HIF- l ⁇ (ARNT) is expressed constitutively at a high level
  • accumulation of HIF-I ⁇ in the cell is sensitive to O 2 concentration, such that high levels are detected only during hypoxia.
  • O 2 concentration is detected by a sensor protein and through a complex signaling mechanism leads to stabilization of the HIF- l ⁇ subunit.
  • HIF- lot is then available to complex with HIF- l ⁇ and bind selectively to HRE sites in the promoter/enhancer of the target gene(s). Regions of the HIF- 1 ⁇ protein involved in conferring this response are thought to coincide with regions involved in transactivation.
  • HIF-I activity in response to hypoxia is thought to occur via stabilization of the HIF-I ⁇ protein.
  • Regions of HIF-I ⁇ involved in this response have been localized to the C-terminus of the protein and overlap the transactivation domain.
  • Jiang et al., J. Biol. Chem. 271(30): 17771 78 (1996) showed that HIF- l ⁇ truncated at amino acid 390 lost transactivation activity but retained the ability to bind DNA and showed high levels of protein under both normoxic and hypoxic conditions. This result demonstrated that the transactivation domain and the region conferring instability with normoxia reside in the C-terminal half of the protein.
  • Pugh et al., J. Biol. Chem. 272(17): 1 1205 14 (1997) have further localized the regions involved to two areas, amino acids 549-582 and 775-826.
  • ODD oxygen-dependent degradation domain
  • this invention provides nucleic acid molecules encoding biologically active chimeric transactivator proteins comprising a domain of the HIF- l ⁇ protein sufficient for DNA binding and dimerization with HIF-I ⁇ (ARNT) and a protein domain capable of transcriptional activation.
  • transcripts In mice, two HIF- l ⁇ transcripts (I.I and 1.2) are produced from different promoters, as opposed to alternate splicing (Wenger, R.H., et al., Eur. J. Biochem. 246: 155-65 (1997). These transcripts are both efficiently translated independent of oxygen, but differ in that transcript I.I encodes a protein lacking the first 12 amino- terminal amino acids and is expressed in a tissue-restricted manner, while 1.2 is ubiquitously expressed and encodes a full-length protein. In spite of these differences, no specificity in DNA binding or transactivation activity has been observed (Wenger, R.H., et al., Blood 91 :3471-80 (1998); Gorlach, A., et al.,
  • HIF-l ⁇ HIF-l ⁇ splice variant that lacks exon 14 has been found to be present in skin and several cell lines (Gothie, E., et al., J. Biol. Chem. 275:6922-27 (2000)). This leads to a frame shift and encodes a shorter protein (736 amino acids) which, although still hypoxically inducible, lacks a carboxy-terminal TAD (C-TAD) and therefore is less active than wild-type HIF-I ⁇ (Gothie, E., et al., J. Biol. Chem.
  • a dominant-negative isoform lacking exons 1 1 and 12 has also been identified, which encodes a protein that is 516 amino acids long, stable in normoxia and displays no transactivation (Chun, Y. S., et al., Biochem. J. 362:71-79 (2002)).
  • a zinc-induced splice variant lacking exon 12 also acts as a dominant negative, inhibiting HIF activity by binding to ARNT and preventing its nuclear accumulation (Chun, Y. S., et al., Biochem. Biophys. Res. Commun. 268:652-56 (2000)).
  • Representative sequences of human HIF- l ⁇ include, for example, Genbank Accession Nos. NM_001530 (transcript variant 1 ) and NM_181054 (transcript variant 2).
  • Representative sequences of the human HIF-I ⁇ subunit include, for example, Genbank Accession Nos. NM OO 1668 (ARNT transcript variant 1), NM_178426 (ARNT transcript variant 2) and NMJ 78427 (ARNT transcript variant 3).
  • a closely related protein, HIF-2 ⁇ also termed endothelial PAS (EPAS), HIF-related factor (HRF) and member of PAS superfamily 2 (MOP2) was identified shortly after HIF- lot was cloned (Tian, H., et al., Genes Dev.
  • HIF-2 ⁇ shares 48% amino acid identity with HIF- l ⁇ and lesser similarity with other members of bHLH/PAS domain family of transcription factors (representative HIF-2 ⁇ human sequences are GenBank Accession Nos. NM OO 1430 and U81984; a representative HIF-2 ⁇ mouse sequence is GenBank Accession No.
  • HIF-2 ⁇ was found to heterodimerize with ARNT and bind HREs (Tian, H., et al., Genes Dev. 1 1 :72-82 (1997); Ema, M., et al., Proc. Natl. Acad. Sci. USA 94:4273-78 (1997)). Deletion analysis has demonstrated that both HIF- l ⁇ and HIF-2 ⁇ share a common functional domain architecture.
  • HIF-I ⁇ and HIF-2 ⁇ possess two transactivation domains (TADs) separated by a region termed the inhibitory domain (ID), which is responsible for normoxic repression of TAD activity.
  • TADs transactivation domains
  • ID inhibitory domain
  • ODDD oxygen-dependent degradation domain
  • HIF-2 ⁇ Human and murine HIF-2 ⁇ share extensive primary amino acid sequence identity with HIF- l ⁇ (48%). Sequence conservation between the two proteins is highest in the bHLH (85%), PAS-A (68%), and PAS-B (73%) regions. A second region of sequence identity occurs at the extreme C termini of the HIF- l ⁇ and HIF- 2 ⁇ proteins. This conserved region in mHIF-l ⁇ has been shown to contain a hypoxia response domain (Li et al., J. Biol. Chem. 271(35):21262-67 (1996)). The high degree of sequence similarity between HIF- l ⁇ and HIF-2 ⁇ suggests that they share common physiological function(s).
  • hypoxic conditions stimulate the ability of HIF-I ⁇ to transactivate target genes containing the HRE core sequence.
  • the activity of HIF-2 ⁇ is also enhanced in cells grown under hypoxic conditions.
  • RNA expression patterns have revealed that both HIF- l ⁇ and HIF-2 ⁇ are largely ubiquitously expressed in human and mouse tissues in an oxygen- ihdependent manner (Tian, H., et al., Genes Dev. 1 1 :72-82 (1997); Ema, M., et al., Proc. Natl. Acad. Sci. USA 94:4273-78 (1997); Flamme, I., et al., Mech. Dev.
  • HIF-2 ⁇ mRNA is predominantly expressed in specific cell types, such as endothelial, epithelial, neuronal, fibroblasts and macrophage cells (Bracken, CP. , et al., CMLS. Cell. MoI. Life Sci. 60:1376-93 (2003)).
  • HIF-3 ⁇ A third HIF ⁇ gene has also been discovered and been termed HIF-3 ⁇ . Like HIF- l ⁇ and HIF-2 ⁇ , HIF-3 ⁇ is expressed by a variety of tissues, dimerizes with ARNT, binds to HRE DNA sequences and upregulates reporter expression in a hypoxia-inducible and ARNT-dependent manner (Gu, Y.Z., et al., Gene Expr. 7:205-13 (1998)).
  • a splice variant of HIF-3 ⁇ termed inhibitory PAS (IPAS)
  • IPAS appears to lack endogenous transactivation activity but acts as a dominant-negative regulator of HIF, interacting with the amino-terminal region of HIF- l ⁇ and preventing DNA binding.
  • Representative sequences of human HIF-3 ⁇ are Genbank Accession Nos. NM l 52794 (HIF-3 ⁇ transcript variant 1), NM_152794 (HIF-3 ⁇ transcript variant 2) and NM 022462 (HIF-3 ⁇ transcript variant 3).
  • sequences of HIF-I ⁇ , HIF-2 ⁇ and/or H ⁇ F-3 ⁇ can be used in the methods of the invention.
  • HIF- ⁇ is polyubiquitylated under normoxia with the level of ubiquitylation decreasing in hypoxia (Huang, L.E., et al., Proc. Natl. Acad. Sci.
  • HIF- l ⁇ has been shown to physically interact with the 2OS proteasomal subunit PSMA7 (Cho, S., et al., FEBS Lett. 498:62-66 (2001)).
  • VHL von-Hippel-Lindau
  • E3 ubiquitin-protein ligase complex containing elongins B and C, Cul2 and Rbxl, and it is this capacity by which VHL mediates the proteasomal degradation of HIF-l ⁇ and HIF-2 ⁇ (Lisztwan, J., et al., Genes Dev. 13:1822-33 (1999)).
  • VHL is able to exert this effect by binding to amino acids 517-571 or 380-417 of HIF-l ⁇ in normoxia (amino acids 517-534 and 383-418 in HIF-2 ⁇ ) via its ⁇ domain, while the ⁇ domain binds elongins.
  • Ubiquitin is then transferred to residues of HIF, marking the protein for proteasomal degradation (Cockman, M.E., et al., J. Biol. Chem. 275:25733-741 (2000); Ohh, M., et al., Nat. Cell Biol. 2:423-27 (2000)); Tanimoto, K., et al., EMBO J. 19:4298-4309 (2000); Masson, N., et al., EMBO J. 20:5197-5206 (2001); Srinivas, V., et al., Biochem. Biophys. Res. Commun. 260:557-61 (1999)).
  • the PHD/HPHs are 2-oxogluterate-dependent enzymes that require oxygen (O 2 ) for hydroxylation. They contain iron bound to two histidine and one aspartic acid residue, which, when maintained in its ferrous state by ascorbate, binds dioxygen. One oxygen is transferred to the target proline residue of HIF; the second reacts with 2-oxogluterate to produce succinate and carbon dioxide. Thus, the absence of oxygen leads to no enzyme activity, nonmodification of HIF proline residues and no VHL/HIF binding, resulting in stabilized HIF- ⁇ protein. Therefore, it is likely that PHD/HPHs function as a direct oxygen sensor in cells that directly modulate HIF in response to physiological oxygen concentration (Bracken, C. P., et al., CMLS. Cell. MoI. Life Sci. 60:1376-93 (2003)).
  • the nucleic acid molecules encoding the chimeric transactivator proteins comprise a domain of a non-mammalian hypoxia-inducible factor protein.
  • hypoxia-inducible factor proteins would be expected to occur in a wide variety of species including non-mammalian vertebrates and non-vertebrates, such as insects. See, for example, Bacon et al., Biochem. Biophys. Res. Comm., 249:811-816 (1998), which reports the functional similarity between the Sima basic-helix-loop- helix PAS protein from Drosophila and the mammalian HIF- l ⁇ protein.
  • Nucleic acid and amino acid sequences for non-mammalian hypoxia- inducible factor proteins may be obtained by the skilled artisan by a variety of techniques, for example, by cross-hybridization or amplification using all or a portion of the sequences referred to herein. Once the sequence encoding a candidate hypoxia-inducible factor protein has been determined, the localization of portions of the protein sufficient to bind to HREs and dimerize with HIF- l ⁇ may be determined using, e.g., the same types of techniques used to determine the location of those domains within the human HIF-l ⁇ protein.
  • non-mammalian hypoxia-inducible factor proteins useful in the compositions and methods of this invention may also be produced synthetically or by site-directed manipulations of the DNA encoding known mammalian hypoxia-inducible factor proteins. It is also expected that the sequence motifs in common among various mammalian and non- mammalian hypoxia-inducible factor proteins will suggest consensus sequences that, while perhaps not occurring naturally in any species, would nevertheless produce domains useful in the methods and compositions of this invention.
  • hypoxia-inducible factor proteins e.g., HIF- l ⁇ , HIF-2 ⁇ and HIF-3 ⁇
  • the induction of the hypoxia- inducible factor proteins results in the promotion of non-leaky vascularization.
  • VEGF transgenic overexpression of VEGF alone results in formation of abnormally leaky blood vessels (Lee, R. J., et al., Circulation, 102:898-901, 2000; Carmeliet. P. et al., Nature 1998; 394:485-490 2000), but expression of both VEGF and angiopoietin-1 leads to healthier vessels (Thurston et al., Nat Med, 6:460-463 (2000)).
  • the inventors determined that obese ZDF rats (a diabetic rat model) exhibit an increase in capillary permeability in addition to retarded collateral vessel development as compared to lean counterpart rats.
  • the invention is a method of promoting non-leaky collateral vascularization in a subject in need thereof comprising administering to the subject a nucleic acid of the invention.
  • the invention is a method of treating a subject having a disorder characterized by increased vascular permeability comprising administering to the subject a nucleic acid of the invention.
  • the invention is a method of treating a non-ischemic subject having diabetes (e.g., type 2 diabetes) comprising administering to the subject a nucleic acid of the invention.
  • the invention is a method of treating a subject having Clarkson's disease comprising administering to the subject a nucleic acid of the invention.
  • the invention is a method of treating a subject having an ischemic disorder and a disorder characterized by increased vascular permeability, comprising administering to the subject a nucleic acid of the invention.
  • the subject has an ischemic disorder and diabetes (e.g., type 2 diabetes).
  • the ischemic disorder to be treated is ischemic heart disease, peripheral vascular disease (peripheral arterial disease) or ischemic limb disease (e.g., critical limb ischemia).
  • the subject to be treated has type 2 diabetes and peripheral arterial disease.
  • the subject to be treated has type 2 diabetes and critical limb ischemia.
  • a constitutively expressed hypoxia- inducible factor protein to promote the formation of non-leaky collateral vascularization.
  • Constitutive expression of the HIF protein is obtained, for example, by removing the C-terminal (transactivation) domain of the hypoxia-inducible factor protein and replacing it with a strong transactivator sequence. This modification does not alter its ability to dimerize with the ⁇ /ARNT subunit or bind to specific
  • DNA sequences e.g., HREs
  • the hypoxia-inducible factor protein into a constitutive inducer of potentially therapeutic genes (for example, VEGF, EPO, phosphoglycerate kinase, and the like).
  • the strong transactivator sequence is not derived from a hypoxia-inducible factor protein.
  • HIF- l ⁇ subunit is unstable during normoxic conditions, overexpression of this subunit in cultured cells under normal oxygen levels is capable of inducing expression of genes normally induced by hypoxia.
  • An alternative strategy would be to modify the HIF- l ⁇ subunit such that it no longer is destabilized by normoxic conditions and would therefore be more potent under a range of oxygen conditions.
  • Replacement of the C terminal (or transactivation) region of the hypoxia- inducible factor protein with a strong transactivation domain from a transcriptional activator protein such as, for example, Herpes Simplex Virus (HSV) VP 16, NFKB or yeast transcription factors GAL4 and GCN4, is designed to stabilize the protein under normoxic conditions and provide strong, constitutive, transcriptional activation.
  • a transcriptional activator protein such as, for example, Herpes Simplex Virus (HSV) VP 16, NFKB or yeast transcription factors GAL4 and GCN4
  • a nucleic acid molecule encoding a biologically active chimeric transactivator protein comprising the DNA-binding domain of a hypoxia-inducible factor protein (e.g., HIF- l ⁇ ) and a protein domain capable of transcriptional activation (e.g., a transcriptional activation domain from HSV VP 16, a transcriptional activation domain from NFKB) can promote non-leaky collateral vascularization in a patient in need thereof.
  • the DNA-binding domain is a DNA-binding domain of HIF-I ⁇ and the protein domain capable of transcriptional activation is a transcriptional activation domain of HSV VPl 6.
  • a representative cDNA nucleic acid sequence of such a HIFl ⁇ /VP16 construct which contains the DNA-binding domain and HIF- l ⁇ dimerization domain of HIF-I ⁇ and the transcriptional activation domain of HSV VP 16, is the following:
  • the sequence of the HIF- l ⁇ DNA-binding and HIF-I ⁇ dimerization domains is the following: ATGGAGGGCGCCGGCGGCGCGAACGACAAGAAAAAGATA AGTTCTGAACGTCGAAAAGAAAAGTCTCGAGATGCAGCCA GATCTCGGCGAAGTAAAGAATCTGAAGTTTTTTATGAGCT TGCTCATCAGTTGCCACTTCCACATAATGTGAGTTCGCATC TTGATAAGGCCTCTGTGATGAGGCTTACCATCAGCTATTTG
  • sequence of the transcriptional activation domain of HSV VP 16 is the following:
  • the invention encompasses other nucleic acids that encode biologically active chimeric transactivator proteins, for example, a protein comprising the DNA- binding and dimerization domains of HIF-I ⁇ and the transactivation domain from an NFKB protein (e.g., a human NFKB protein).
  • a protein comprising the DNA- binding and dimerization domains of HIF-I ⁇ and the transactivation domain from an NFKB protein (e.g., a human NFKB protein).
  • the inventors determined that direct administration of an adenovirus vector comprising a constitutively active form of HIF-I (specifically, Ad2/HIF-1 ⁇ /VP 16) into a rat ischemic hindlimb model resulted in an increase in collateral vessel formation even in tissues that are distal to the site of administration of the nucleic acid (see, e.g., Example 3 and FIG. 14).
  • promotion of non-leaky collateral vascularization occurs in a site distal to the site of injection of the nucleic acid molecule.
  • administration of the nucleic acid to the quadriceps would result in promotion of non-leaky collateral vascularization at distal sites (e.g., calf, foot).
  • hypoxia refers to the state in which O 2 demand exceeds supply.
  • Hypoxia-inducible genes means genes containing one or more hypoxia responsive elements (HREs; binding sites) within sequences mediating transcriptional activation in hypoxic cells.
  • Hypoxia-inducible factor means a DNA-binding protein/transcription factor, the expression of which is upregulated under hypoxic conditions, which recognizes and binds to a hypoxia responsive element core sequence within a gene and thereby activates such gene.
  • nucleic acids encompasses RNA as well as single and double-stranded DNA, cDNA and oligonucleotides. Nucleic acids also encompass isolated nucleic acid sequences, including sense and antisense oligonucleotide sequences, e.g., derived from HIF- l ⁇ , HIF-2 ⁇ , or HIF-3 ⁇ sequences. HIF-Ia-, HIF-2a- and HIF-3 ⁇ -derived sequences may also be associated with heterologous sequences, including promoters, enhancers, response elements, signal sequences, polyadenylation sequences, and the like.
  • isolated means a polynucleotide that is in a form that does not occur in nature.
  • One means of isolating polynucleotides is to probe a tissue-specific library (e.g., a human tissue-specific library) with a natural or artificially- designed DNA probe using methods well known in the art.
  • DNA probes derived from human HIF- l ⁇ , HIF-2 ⁇ , and/or HIF-3 ⁇ sequences are particularly useful for this purpose.
  • DNA and cDNA molecules can be used to obtain complementary genomic DNA, cDNA or RNA from human, mammalian, or other animal sources, or to isolate related cDNA or genomic clones by the screening of cDNA or genomic libraries, using methods known in the art and/or described in more detail below.
  • the nucleic acids can be modified to alter stability, solubility, binding affinity, and specificity.
  • invention-derived sequences can further include nuclease-resistant phosphorothioate, phosphoroamidate, and methyl phosphonate derivatives, as well as "protein nucleic acid” (PNA) formed by conjugating bases to an amino acid backbone as described in Nielsen et al., Science, 254:1497, (1991).
  • PNA protein nucleic acid
  • the nucleic acid may be derivatized by linkage of the ⁇ -anomer nucleotide, or by formation of a methyl or ethyl phosphotriester or an alkyl phosphoramidate linkage.
  • the nucleic acid sequences of the present invention may also be modified with a label capable of providing a detectable signal, either directly or indirectly.
  • Exemplary labels include radioisotopes, fluorescent molecules, biotin, and the like.
  • nucleic acid manipulations according to the present invention use methods that are well known in the art, as disclosed in, for example, Sam brook et al., Molecular Cloning, A Laboratory Manual 2d Ed. (Cold Spring Harbor, N. Y., 1989), or Ausubel et ah, Current Protocols in Molecular Biology (Greene Assoc, Wiley Interscience, NY, N. Y., 1992).
  • This invention also encompasses nucleic acids that differ from the nucleic acids encoding a chimeric hypoxia-inducible factor protein (e.g., a chimeric HlF- l ⁇ , HIF-2 ⁇ , or HIF-3 ⁇ protein), but which have the same phenotype, i.e., that encode substantially the same amino acid sequence, respectively.
  • Phenotypically similar nucleic acids are also referred to as “functionally equivalent nucleic acids”.
  • the phrase "functionally equivalent nucleic acids” encompasses nucleic acids characterized by slight and non-consequential sequence variations that will function in substantially the same manner to produce the same or substantially the same protein product(s) as the nucleic acids disclosed herein.
  • nucleic acids encode proteins that are the same as those disclosed herein or that have conservative amino acid variations.
  • conservative variations include substitution of a non-polar amino acid residue with another non-polar amino acid residue, or substitution of a charged residue with a similarly-charged residue.
  • Such variations include those recognized by skilled artisans as not substantially altering the tertiary structure of the protein.
  • a structural gene is that portion of a gene comprising a DNA segment encoding a protein, polypeptide or a portion thereof, and excluding the 5' sequence which drives the initiation of transcription.
  • the structural gene may be one that is normally found in the cell or one that is not normally found in the cellular location where it is introduced, in which case it is termed a heterologous gene.
  • a heterologous gene may be derived in whole or in part from any source known in the art, including a bacterial genome or episome, eukaryotic, nuclear or plasmid DNA, cDNA, viral DNA or chemically-synthesized DNA.
  • a structural gene may contain one or more modifications in either the coding or the untranslated regions that could affect the biological activity or the chemical structure of the expression product, the rate of expression and/or the manner of expression control. Such modifications include, but are not limited to, mutations, insertions, deletions and substitutions of one or more nucleotides.
  • the structural gene may constitute an uninterrupted coding sequence or it may include one or more introns, bound by the appropriate splice junctions.
  • the structural gene may be a composite of segments derived from a plurality of sources, naturally-occurring or synthetic.
  • the structural gene may also encode a fusion protein. It is contemplated that the introduction of recombinant DNA molecules containing the structural gene/transactivator complex will include constructions wherein the structural gene and the transactivator are each derived from different sources or species.
  • Eukaryotic transcription factors are often composed of separate and independent DNA-binding and transcriptional activator domains (Mitchell and Tjian, Science 245:371-378 (1989)). The independence of the domains has allowed for the creation of functional fusion proteins consisting of the DNA-binding and activating domains of heterologous proteins. Chimeric eukaryotic regulatory proteins, consisting of the lexa DNA-binding protein and the activation domain of the yeast transcription factor, GAL4, were constructed by Brent and Ptashne (Nature 312:612-615 (1985)). The use of fusion proteins has identified several types of protein domains which act as transcriptional activators.
  • domains have little amino acid similarity but often are characterized as being either highly acidic (as in the case of GAL4 and GNC4), glutamine-rich (as in the case of SpI), or proline-rich (as in the case of NFl, Ma and Ptashne, Cell 51 :1 13-119 (1987); Courey and Tjian (1988); Mermod et al., Cell 58:741-753 (1989)).
  • VP16 Herpes Simplex Virus virion protein 16
  • HSV Herpes Simplex Virus
  • VP16 also known as Vmw65 or alpha-gene trans-inducing factor
  • ICPO and ICP4 are structural proteins of HSV which activates transcription of the immediate early promoters of the virus, including those for ICPO and ICP4 (Campbell et al., J. MoI. Biol. 180:1-19 (1984); Kristie and Roizman. Proc. Natl. Acad.
  • VP16 specifically activates promoters containing the so called TAATGARAT element, the specificity is endowed by a cellular DNA- binding protein(s) that is complexed with the amino terminal domains(s) of VP 16 (McKnight et al., Proc. Natl. Acad. Sci., USA 84:7061-7065 (1987); Preston et al., Cell 52:425-434 (1988)).
  • the present invention provides nucleic acids encoding hybrid/chimeric transactivating proteins comprising a functional portion of a DNA-binding protein and a functional portion of a transcriptional activator protein.
  • hybrid/chimeric transactivating proteins offer a variety of advantages, including specific activation of expression of hypoxia-inducible genes containing hypoxia responsive elements (HREs), thereby achieving exceptionally high levels of gene expression.
  • HREs hypoxia responsive elements
  • Nucleic acids encoding such hybrid/chimeric transactivating proteins are capable of functioning in vertebrate cells and may encode naturally-occurring transcriptional transactivating proteins or domains of proteins (e.g., naturally-occurring transcriptional transactivating proteins or domains from eukaryotic cells including vertebrate cells), viral transactivating proteins or domains or any synthetic amino acid sequence that is able to stimulate transcription from a vertebrate promoter.
  • transcriptional transactivating proteins or domains of proteins e.g., naturally-occurring transcriptional transactivating proteins or domains from eukaryotic cells including vertebrate cells
  • viral transactivating proteins or domains or any synthetic amino acid sequence that is able to stimulate transcription from a vertebrate promoter examples include, but are not limited to, the lymphoid specific transcription factor identified by Muller et al.
  • the transactivating protein is Herpes simplex virus VPl 6 (Sadowski et al., Nature 335:563-564 (1988); Triezenberg et al., Genes and Dev. 2:718-729 (1988)), NF.kappa.B ((Schmitz and Baeuerle, EMBO J. 10:3805-3817 (1991); Schmitz, et al., J.Biol.Chem.
  • transcriptional activation domains useful in the compositions and methods of this invention may also be synthetic, i.e., based on a sequence that is not contained within a known, naturally- occurring protein. See, for example, Pollock and Gilman, PNAS 94: 13388-13389 (1997), which teaches that transcriptional activation is an inherently flexible process in which there is little, if any, requirement for specific structures or stereospecific protein contacts.
  • nucleic acid sequences encoding a DNA-binding domain and a transactivating domain are combined so as to preserve the respective binding and transactivating properties of each of the domains.
  • the nucleic acid encoding the transactivating protein, or a portion thereof capable of activating transcription may be inserted into nucleic acid at a locus which does not completely disrupt the function of the encoded DNA- binding domain.
  • Regions of hypoxia-inducible factor proteins that are not required for DNA-binding and dimerization functions and regions of proteins that are not required for transcriptional transactivating function are known and/or may be identified by methods known in the art, including, e.g., analysis of mapped mutations as well as identification of regions lacking mapped mutations, which are presumably less sensitive to mutation than other, more functionally relevant portions of the molecule.
  • the appropriate recombinant constructs may be produced using standard techniques in molecular biology, including those set forth in Maniatis (Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, N. Y., Cold Spring Harbor Laboratory ( 1989)).
  • the recombinant DNA construct encoding the chimeric transactivator protein may be placed under the control of (i.e., operatively linked to) a suitable promoter and/or other expression control sequence. It may be desirable for the transactivator protein to be placed under the control of a constitutively active promoter sequence, although the transactivator protein may also be placed under the control of an inducible promoter, such as the metallothionine promoter (Brinster et al., Nature 296:39-42 (1982)) or a tissue-specific promoter.
  • an inducible promoter such as the metallothionine promoter (Brinster et al., Nature 296:39-42 (1982)) or a tissue-specific promoter.
  • Promoter sequences that can be used according to the invention include, but are not limited to, the SV40 early promoter region (Benoist and Chambon, Nature 290:304-310 (1981)), the promoter contained in the long terminal repeat of Rous sarcoma virus (Yamamoto, et al., Cell 22:787-797 (1980)), the herpes thymidine kinase promoter (Wagner et al., Proc. Natl. Acad. Sci., U.S.A.
  • CMV human cytomegalovirus
  • elastase I gene control region which is active in pancreatic acinar cells (Swift et al., Cell 38:639-646 (1984); Ornitz et al., Cold Spring Harbor Symp. Quant. Biol.
  • mouse mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder et al., Cell 45:485-495 (1986)), albumin gene control region, which is active in liver (Pinkert et al., Genes and Devel. 1 :268-276 (1987)), alpha-fetoprotein gene control region, which is active in liver (Krumlauf et al., MoI. Cell. Biol. 5: 1639-1648 (1985); Hammer et al., Science 235:53-58 (1987)); alpha 1 -antitrypsin gene control region, which is active in the liver (Kelsey et al, Genes and Devel.
  • beta-globin gene control region which is active in erythroid cells (Mogram et al., Nature 315:338-340 (1985); Kollias et al., Cell 46:89-94 (1986)); myelin basic protein gene control region, which is active in oligodendrocyte cells in the brain (Readhead et al., Cell 48:703-712 (1987)); myosin light chain-2 gene control region, which is active in skeletal muscle (Sani, Nature 314:283-286 (1985)), and gonadotropic releasing hormone gene control region, which is active in the hypothalamus (Mason et al., Science 234:1372-1378 (1986)).
  • ⁇ -myosin heavy chain gene (Subramaniam, et al., J. Biol. Chem. 266:24613-24620, (1991)) and the myosin light chain-2 promoter (Henderson et al., J. Biol. Chem. 264:18142-18148 (1989) and Ruoqian-Shen et al., MoI. Cell. Biol. 11 : 1676-1685 (1991), both of which are active in cardiac muscle.
  • the chimeric transactivator protein is encoded by pcDNA3/HlF/VP16/Afl2.
  • Example 1 and FIG.l describe the construction of pcDNA3/HIF/VP16/Afl2.
  • the chimeric transactivator protein is encoded by pcDNA3/HIF/VP16/RI, which is identical to pcDNA3/HIF/VP16/Afl2 except that the VP 16 segment is inserted after codon 530 of the HIF-I ⁇ coding region.
  • the nucleic acids encoding hybrid/chimeric transactivator proteins may be utilized to specifically regulate the expression of genes containing hypoxia responsive elements (HREs).
  • HREs hypoxia responsive elements
  • HREs correspond to a nucleic acid sequence recognized and bound by the DNA-binding protein used as the backbone of the chimeric transactivator protein.
  • the nucleic acids encoding chimeric transactivator proteins may be used to selectively control the expression of genes of interest.
  • chimeric transactivator proteins may be placed under control of a constitutive promoter and may be used to constitutively increase the expression of a gene of interest associated with hypoxia responsive elements (HREs), for example, when it is desirable to produce a particular gene product in quantity in a cell culture or in a transgenic animal.
  • HREs hypoxia responsive elements
  • the transactivator protein may be placed under the control of a tissue-specific promoter so that the gene of interest is expressed in a particular tissue.
  • the chimeric transactivator function is inducible, so that the expression of a gene of interest, via hypoxia responsive elements (HREs), may be selectively increased or decreased.
  • HREs hypoxia responsive elements
  • the chimeric transactivating proteins possess the advantageous property of binding specifically to responsive elements homologous to DNA sequences recognized by the chimeric protein's DNA-binding protein backbone.
  • Vectors examples are viruses, such as adenoviruses, adeno- associated viruses (AAV), lentiviruses, herpes viruses, positive strand RNA viruses, vaccinia viruses, baculoviruses and retroviruses, bacteriophages, cosmids, plasmids, fungal vectors and other recombination vehicles typically used in the art which have been described for expression in a variety of eukaryotic and prokaryotic hosts, and may be used for gene therapy as well as for simple protein expression.
  • viruses such as adenoviruses, adeno- associated viruses (AAV), lentiviruses, herpes viruses, positive strand RNA viruses, vaccinia viruses, baculoviruses and retroviruses, bacteriophages, cosmids, plasmids, fungal vectors and other recombination vehicles typically used in the art which have been described for expression in a variety of eukaryotic and prokaryotic
  • Polynucleotides/transgenes are inserted into vector genomes using methods well known in the art.
  • insert and vector DNA can be contacted, under suitable conditions, with a restriction enzyme to create complementary ends on each molecule that can pair with each other and be joined together with a ligase.
  • synthetic nucleic acid linkers can be ligated to the termini of restricted polynucleotide. These synthetic linkers contain nucleic acid sequences that correspond to a particular restriction site in the vector DNA. Additionally, an oligonucleotide containing a termination codon and an appropriate restriction site can be ligated for insertion into a vector containing, for example, some or all of the following: a selectable marker gene, such as the neomycin gene for selection of stable or transient transfectants in mammalian cells; enhancer/promoter sequences for high levels of transcription (e.g., from the immediate early gene of human CMV); transcription termination and RNA processing signals for mRNA stability (e.g., from SV40); SV40 polyoma origins of replication and CoIEl for proper episomal replication; versatile multiple cloning sites; and T7 and SP6 RNA promoters for in vitro transcription of sense and antisense RNA. Other means are well known and available in the art.
  • the polynucleotides/transgenes are operatively linked to expression control sequences.
  • Vectors that contain both a promoter and a cloning site into which a polyn ⁇ cleotide can be operatively linked are well known in the art. Such vectors are capable of transcribing RNA in vitro or in vivo, and are commercially available from commercial sources, such as Stratagene (La Jolla, Calif.) and Promega Biotech (Madison, Wis.).
  • hypoxia-inducible factor protein e.g., HIF- let , HIF-2 ⁇ , HIF-3 ⁇
  • alternative codons encoding the same amino acid, can be substituted for coding sequences of the hypoxia-inducible factor protein (e.g., HIF- let , HIF-2 ⁇ , HIF-3 ⁇ ) in order to enhance transcription (e.g., the codon preference of the host cell can be adopted, the presence of G-C rich domains can be reduced, and the like).
  • Preparations of invention polynucleotides encoding HIF-I ⁇ , HIF-2 ⁇ , and/or HIF-3 ⁇ or another hypoxia-inducible factor protein can be incorporated in a suitable vector for delivery into an individual's cells using methods that are known in the art. See, for example, Finkel and Epstein, FASEB J. 9:843-851 (1995); Feldman et al., Cardiovascular Res. 32:194-207 (1996).
  • this invention provides compositions comprising a pharmaceutically-acceptable carrier and nucleic acid molecules capable of expressing biologically active chimeric transactivator proteins.
  • the chimeric transactivator proteins encoded by the nucleic acid molecules include a DNA- binding domain from a hypoxia-inducible factor protein and a protein domain capable of transcriptional activation.
  • the transcriptional activation domain may be from either a naturally-occurring or synthetic transcriptional activator molecule.
  • the nucleic acid molecules within the composition are in a form suitable for delivery into cells in vivo or in vitro. A variety of such forms are well known in the art.
  • Naked DNA ⁇ Naked plasmid DNA can be introduced into muscle cells, for example, by direct injection into the tissue. (Wolff et al., Science 247:1465 (1989)).
  • Lipid carriers can be associated with naked DNA (e.g., plasmid DNA) to facilitate passage through cellular membranes. Cationic, anionic, or neutral lipids can be used for this purpose. However, cationic lipids are generally preferred because they have been shown to associate better with DNA, which generally has a negative charge. Cationic lipids have also been shown to mediate intracellular delivery of plasmid DNA (Feigner and Ringold, Nature 337:387 (1989)). Intravenous injection of cationic lipid-plasmid complexes into mice has been shown to result in expression of the DNA in lung (Brigham et al., Am. J. Med. Sci. 298:278 (1989)).
  • Cationic lipids are known to those of ordinary skill in the art.
  • Representative cationic lipids include those disclosed, for example, in U.S. Pat. No. 5,283,185 and PCT/US95/16174 (WO 96/18372), the disclosures of which are incorporated herein by reference.
  • the cationic lipid is N 4 -spermine cholesterol carbamate (GL-67) disclosed in WO 96/18372.
  • Adenovirus-based vectors for the delivery of transgenes are well known in the art and may be obtained commercially or constructed by standard molecular biological methods.
  • Recombinant adenoviral vectors containing exogenous genes for transfer are, generally, derived from adenovirus type 2 (Ad2) and adenovirus type 5 (Ad5). They may also be derived from other non-oncogenic serotypes. See, for example, Horowitz, "Adenoviridae and their Replication" in VIROLOGY, 2d ed., Fields et al. Eds., Raven Press Ltd., New York, 1990, incorporated herein by reference.
  • the adenoviral vectors of the present invention are incapable of replicating, have minimal viral gene expression and are capable of expressing a transgene in target cells.
  • Adenoviral vectors are generally rendered replication-defective by deletion of the El region genes.
  • the replication-defective vectors may be produced in the 293 cell line (ATCC CRL 1573), a human embryonic kidney cell line expressing El functions.
  • the deleted El region may be replaced by the transgene of interest under the control of an adenoviral or non-adenoviral promoter.
  • the transgene may also be placed in other regions of the adenovirus genome.
  • Skilled artisans are also aware that other non-essential regions of the adenovirus can be deleted or repositioned within the viral genome to provide an adenoviral vector suitable for delivery of a transgene in accordance with the present invention.
  • PCT/US93/1 1667 WO 94/12649
  • U.S. Pat. No. 5,670,488, incorporated herein by reference disclose that some or all of the El and E3 regions may be deleted, and non-essential open reading frames (ORFs) of E4 can also be deleted.
  • ORFs open reading frames
  • Other representative adenoviral vectors are disclosed, for example, by Rich et al., Human Gene Therapy 4:461 (1993); Brody et al., Ann. NY Acad. Sci.
  • the adenoviral vector is an El deleted Ad2-based vector.
  • the subject is administered a dose of 1 x 10 to 2 x 10 virus particles.
  • the subject is administered a dose of 1 x 10 9 to 2 x l ⁇ " virus particles (e.g., 2 x 10 9 , 2 x 10 l0 , 2 x l ⁇ " virus particles).
  • the chimeric transactivator protein is present in an adenovirus 2.
  • the chimeric transactivator protein is encoded by Ad2/HIF/VP 16, set forth in FIG. 3.
  • the polynucleotide/transgene is operably linked to expression control sequences, e.g., a promoter that directs expression of the transgene.
  • expression control sequences e.g., a promoter that directs expression of the transgene.
  • the phrase "operatively linked” refers to the functional relationship of a polynucleotide/transgene with regulatory and effector sequences of nucleotides, such as promoters, enhancers, transcriptional and translational stop sites, and other signal sequences.
  • operative linkage of a polynucleotide to a promoter refers to the physical and functional relationship between the polynucleotide and the promoter, such that transcription of DNA is initiated from the promoter by an RNA polymerase that specifically recognizes and binds to the promoter, and wherein the promoter directs the transcription of RNA from the polynucleotide.
  • Promoter regions include specific sequences that are sufficient for RNA polymerase recognition, binding and transcription initiation. Additionally, promoter regions include sequences that modulate the recognition, binding and transcription initiation activity of RNA polymerase. Such sequences may be cis-acting or may be responsive to trans-acting factors. Depending upon the nature of the regulation, promoters may be constitutive or regulated. Examples of promoters are SP6, T4, T7, SV40 early promoter, cytomegalovirus (CMV) promoter, mouse mammary tumor virus (MMTV) steroid-inducible promoter, Moloney murine leukemia virus (MMLV) promoter, phosphoglycerate kinase (PGK) promoter, and the like.
  • CMV cytomegalovirus
  • MMTV mouse mammary tumor virus
  • PGK phosphoglycerate kinase
  • the promoter may be an endogenous adenovirus promoter, for example, the EIa promoter or the Ad2 major late promoter (MLP).
  • MLP Ad2 major late promoter
  • those of ordinary skill in the art can construct adenoviral vectors utilizing endogenous or heterologous poly A addition signals.
  • promoter refers to the nucleotide sequences at the 5 1 end of a structural gene that direct the initiation of transcription. Promoter sequences are necessary, but not always sufficient, to drive the expression of a downstream gene.
  • eukaryotic promoters include a characteristic DNA sequence homologous to the consensus 5' TATA box about 10-30 bp 5' to the transcription start site (CAP site).
  • promoter component is often found about 30-70 bp 5' to the TATA box.
  • enhancer refers to a eukaryotic promoter sequence element that appears to increase transcriptional efficiency in a manner relatively independent of position and orientation with respect to a nearby gene (Khoury and Gruss (1983) Cell 33:313-314). The ability of enhancer sequences to function upstream from, within, or downstream from eukaryotic genes distinguishes them from classic promoter elements.
  • the viral and non-viral vectors of the present invention are useful for transferring a polynucleotide/transgene to a target cell.
  • the target cell may be in vitro or in vivo.
  • Use of invention vectors in vitro allows the transfer of a polynucleotide/transgene to a cultured cell and is useful for the recombinant production of the polynucleotide/transgene product.
  • In vitro methods are also useful in ex vivo gene therapy methods, in which a transgene is introduced into cells in vitro and the cells are then implanted into an individual. The skilled artisan will recognize that in employing such techniques, the transgene may be introduced into freshly isolated cells or cultured cells. Furthermore, the transgene-containing cells may be implanted immediately after introduction of the transgene or may be cultured prior to implantation.
  • the vectors of this invention find use in a variety of ex vivo gene therapy methods useful for promotion of non-leaky collateral vascularization.
  • introduction of a nucleic acid molecule capable of expressing a chimeric transactivator protein according to this invention into target cells prior to implantation in vivo may provide additional advantages to cellular therapy methods in at least two ways.
  • the cells may serve as a transport vehicle for the expression construct, resulting in site- directed delivery of the chimeric transactivator protein in any region of the body in which the cells are transplanted.
  • a chimeric transactivator protein in the implanted cells may aid their survival after implantation, either by allowing them to more easily adapt to any hypoxic conditions which may be present after implant, and/or by stimulating blood vessel development in the region of implantation.
  • Use of invention vectors to deliver a polynucleotide/transgene to a cell in vivo is useful for treating a patient that would benefit from the promotion of non- leaky collateral vascularization.
  • this invention provides methods for increasing the expression of hypoxia-inducible genes in target cells of a subject in which such increased expression is desired by administering an effective amount of a composition comprising a nucleic acid molecule encoding a biologically active chimeric transactivator protein according to this invention in a form suitable for expression (e.g., operatively linked to expression control sequences).
  • a composition comprising a nucleic acid molecule encoding a biologically active chimeric transactivator protein according to this invention in a form suitable for expression (e.g., operatively linked to expression control sequences).
  • In vivo administration of the compositions of this invention may be effected by a variety of routes including intramuscular, intravenous, intranasal, subcutaneous, intubation, lavage and intra-arterial delivery. Such methods are well known to the skilled artisan.
  • the precise effective amount of the composition to be administered may be determined by the skilled artisan with consideration of factors, such as the specific components of the composition to be administered,
  • vectors comprising a polynucleotide encoding HIF- l ⁇ , HIF-2 ⁇ , or HIF-3 ⁇ polypeptides and domains of other hypoxia- inducible factor proteins, adapted for expression in bacterial cells, yeast cells, amphibian cells, insect cells, mammalian cells and/or other animal cells.
  • the vectors additionally comprise the regulatory elements necessary for expression of the polynucleotide in the bacterial, yeast, amphibian, mammalian or animal cells so located relative to the polynucleotide as to permit expression thereof.
  • expression 1 is a polynucleotide encoding HIF- l ⁇ , HIF-2 ⁇ , or HIF-3 ⁇ polypeptides and domains of other hypoxia- inducible factor proteins
  • a bacterial expression vector includes a promoter, such as the lac promoter, and, for transcription initiation, the Shine-Dalgarno sequence and the start codon AUG (Sambrook et al., Molecular Cloning, A Laboratory Manual 2d Ed. (Cold Spring Harbor, N.
  • a eukaryotic expression vector includes a heterologous or homologous promoter for RNA polymerase II, a downstream polyadenylation signal, the start codon AUG, and a termination codon for detachment of the ribosome.
  • RNA polymerase II a heterologous or homologous promoter for RNA polymerase II
  • a downstream polyadenylation signal for RNA polymerase II
  • the start codon AUG a downstream polyadenylation signal
  • a termination codon for detachment of the ribosome.
  • Such vectors can be obtained commercially or assembled by the sequences described using methods well known in the art, for example, methods described herein for constructing vectors in general. Expression vectors are useful to produce cells that express the invention hybrid/chimeric transactivator (fusion) polypeptide.
  • This invention provides a transformed host cell that recombinantly expresses the invention hybrid/chimeric transactivator (fusion) polypeptides.
  • Invention host cells have been transformed with recombinant nucleic acid molecules encoding chimeric transactivators comprising a DNA-binding domain of a mammalian or non- mammalian hypoxia-inducible factor protein and a functional transcriptional activator domain of a transcriptional activator protein.
  • An example is a mammalian cell comprising a plasmid adapted for expression in a mammalian cell.
  • the plasmid contains a polynucleotide encoding a DNA-binding domain of a mammalian or non- mammalian hypoxia-inducible factor protein and a functional transcriptional activator domain of a transcriptional activator protein and the regulatory elements necessary for expression of the invention hybrid/chimeric transactivator (fusion) polypeptide.
  • Appropriate host cells include bacteria, archebacteria, fungi, especially yeast, plant cells, insect cells and animal cells, especially mammalian cells.
  • Preferred replication systems include Ml 3, CoIEl, SV40, baculovirus, lambda, adenovirus, artificial chromosomes, and the like.
  • a large number of transcription initiation and termination regulatory regions have been isolated and shown to be effective in the transcription and translation of heterologous proteins in various hosts.
  • host cells can be used as a source of recombinantly-produced invention hybrid/chimeric transactivator (fusion) protein.
  • Nucleic acids (polynucleotides) encoding invention hybrid/chimeric transactivator (fusion) polypeptides may also be incorporated into the genome of recipient cells by recombination events.
  • Other recombination-based methods such as nonhomologous recombinations or deletion of endogenous gene by homologous recombination, especially in pluripotent cells, may also be used.
  • Targeting invention vectors to target or host cells may be accomplished by linking a targeting molecule to the vector.
  • a targeting molecule is any agent that is specific for a cell or tissue type of interest, including, for example, a ligand, antibody, sugar, receptor, or other binding molecule.
  • a ligand, antibody, sugar, receptor, or other binding molecule e.g., a ligand, antibody, sugar, receptor, or other binding molecule.
  • the ability of targeted vectors renders invention vectors particularly useful in the treatment of hypoxia-associated disorders and/or disorders for which promotion of non-leaky collateral vascularization is desirable (e.g., ischemia (e.g., peripheral arterial disease, critical limb ischemia), Type 2 diabetes, Clarkson's disease and combinations thereof).
  • ischemia e.g., peripheral arterial disease, critical limb ischemia
  • Type 2 diabetes e.g., Clarkson's disease and combinations thereof.
  • Transfer of the polynucleotide/transgene to the target or host cells by invention vectors can be evaluated by measuring the level of the polynucleotide/transgene product in the target or host cell.
  • the level of polynucleotide/transgene product in the target or host cell directly correlates with the efficiency of transfer of the polynucleotide/transgene by invention vectors.
  • Immunological procedures useful for in vitro detection of the hybrid/chimeric transactivator (fusion) polypeptide in a sample include immunoassays that employ a detectable antibody.
  • immunoassays include, for example, ELISA, Pandex microfluorimetric assay, agglutination assays, flow cytometry, serum diagnostic assays and immunohistochemical staining procedures, all of which are well known in the art.
  • An antibody can be made detectable by various means well known in the art. For example, a detectable marker can be directly or indirectly attached to the antibody.
  • Useful markers include, for example, radionuclides, enzymes, fluorogens, chromogens and chemiluminescent labels.
  • a detectable antibody can be administered to a subject, tissue or cell and the binding of the antibody to the polynucleotide/transgene product can be detected by imaging techniques well known in the art.
  • imaging agents include, for example, gamma-emitting radionuclides such as 111 In, 99m Tc, 5I Cr and the like, as well as paramagnetic metal ions, which are described in U.S. Pat. No. 4,647,447.
  • the radionuclides permit the imaging of tissues by gamma scintillation photometry, positron emission tomography, single photon emission computed tomography and gamma camera whole body imaging, while paramagnetic metal ions permit visualization by magnetic resonance imaging.
  • the present invention provides isolated hybrid/chimeric transactivator (fusion) peptide(s), polypeptide(s) and/or protein(s) encoded by the invention nucleic acids.
  • isolated means a protein molecule free of cellular components and/or contaminants normally associated with a native in vivo environment.
  • Invention polypeptides and/or proteins include any naturally- occurring allelic variant, as well as recombinant forms thereof.
  • Invention polypeptides can be isolated using various methods well known to a person of skill in the art.
  • the methods available for the isolation and purification of invention fusion proteins include, for example, precipitation, gel filtration, and chromatographic methods including molecular sieve, ion-exchange, and affinity chromatography using, e.g., HIF-Ia-, HIF-2a-, or HIF-3a-specific antibodies or ligands.
  • chromatographic methods including molecular sieve, ion-exchange, and affinity chromatography using, e.g., HIF-Ia-, HIF-2a-, or HIF-3a-specific antibodies or ligands.
  • Other well- known methods are described in Deutscher et al., Guide to Protein Purification: Methods in Enzymology Vol. 182, (Academic Press, 1990).
  • the recombinant expression vector may comprise additional sequences that encode additional amino- te ⁇ ninal or carboxy-terminal amino acids; these extra amino acids act as "tags" for immunoaffinity purification using immobilized antibodies or for affinity purification using immobilized ligands.
  • invention hybrid/chimeric transactivator (fusion) polypeptide(s) An example of the means for preparing the invention hybrid/chimeric transactivator (fusion) polypeptide(s) is to express invention polynucleotides in a suitable host cell, such as a bacterial cell, a yeast cell, an amphibian cell (e.g., an oocyte), an insect cell (e.g., Drosophila cell) or a mammalian cell, using methods well known in the art, and recovering the expressed polypeptide, again using well- known methods.
  • a suitable host cell such as a bacterial cell, a yeast cell, an amphibian cell (e.g., an oocyte), an insect cell (e.g., Drosophila cell) or a mammalian cell, using methods well known in the art, and recovering the expressed polypeptide, again using well- known methods.
  • Invention polypeptides can be isolated directly from cells that have been transformed with expression vectors, described herein in more detail.
  • biologically active fragment refers to any portion of the polypeptide that can assemble into an active protein having the desired function(s).
  • Synthetic polypeptides can be produced using, e.g., an Applied Biosystems, Inc. Model 430A or 431 A automatic peptide synthesizer (Foster City, Calif.) employing the chemistry provided by the manufacturer.
  • nucleic acids, polynucleotides, polypeptides, peptides or proteins with the following phrases: "recombinantly expressed/produced”, “isolated”, or “substantially pure”, encompasses nucleic acids, polynucleotides, polypeptides, peptides or proteins that have been produced in such form by the hand of man, and are thus separated from their native in vivo cellular environment.
  • the recombinant nucleic acids, polynucleotides, polypeptides, peptides and proteins of the invention are useful in ways that the corresponding naturally-occurring molecules are not, such as identification of selective drugs or compounds.
  • the present invention provides for non-human transgenic animals carrying transgenes encoding chimeric transactivator proteins. These transgenic animals may further comprise a gene of interest under the control of hypoxia responsive elements (HREs).
  • HREs hypoxia responsive elements
  • the transactivator protein may constitutively enhance the expression of the gene of interest. Alternatively, the transactivator protein may only enhance the expression of the gene of interest under certain conditions; for example, and not by way of limitation, by induction.
  • the recombinant DNA molecules of the invention may be introduced into the genome of non-human animals using any method for generating transgenic animals known in the art.
  • the invention provides a transgenic non-human mammal that is capable of expressing nucleic acids encoding invention hybrid/chimeric transactivator (fusion) polypeptides.
  • transgenic non-human mammal capable of expressing nucleic acids encoding invention hybrid/chimeric transactivator (fusion) polypeptides so mutated as to be incapable of normal activity.
  • the present invention also provides a transgenic non-human mammal having a genome comprising antisense nucleic acids complementary to nucleic acids encoding invention hybrid/chimeric transactivator (fusion) polypeptides so placed as to be transcribed into antisense mRNA complementary to mRNA encoding invention fusion polypeptides, which hybridizes thereto and, thereby, reduces the translation thereof.
  • the polynucleotide may additionally comprise an inducible promoter and/or tissue-specific regulatory elements, so that expression can be induced, or restricted to specific cell types. Examples of non-human transgenic mammals are transgenic cows, sheep, goats, pigs, rabbits, rats and mice.
  • tissue specificity-determining elements are the metal lothionein promoter and the T7 promoter.
  • Animal model systems which elucidate the physiological and behavioral roles of invention polypeptides are produced by creating transgenic animals in which the expression of the polypeptide is altered using a variety of techniques. Examples of such techniques include the insertion of normal or mutant versions of nucleic acids encoding invention fusion polypeptides by microinjection, retroviral infection or other means well known to those skilled in the art, into appropriate fertilized embryos to produce a transgenic animal.
  • homologous recombination of mutant or normal versions of these genes with the native gene locus in transgenic animals may be used to alter the regulation of expression or the structure of the invention polypeptides (see, Capecchi et al., Science 244:1288, (1989); Zimmer et al., Nature 338:150, (1989)).
  • Homologous recombination techniques are well known in the art. Homologous recombination replaces the native (endogenous) gene with a recombinant or mutated gene to produce an animal that cannot express native (endogenous) protein but can express, for example, a mutated protein that results in altered expression of invention fusion polypeptides.
  • microinjection adds genes to the host genome, without removing host genes.
  • Microinjection can produce a transgenic animal that is capable of expressing both endogenous and exogenous polypeptides.
  • Inducible promoters can be linked to the coding region of the nucleic acids to provide a means to regulate expression of the transgene.
  • Tissue-specific regulatory elements can be linked to the coding region to permit tissue-specific expression of the transgene.
  • Transgenic animal model systems are useful for in vivo screening of compounds for identification of ligands, i.e., agonists and antagonists, which activate or inhibit polypeptide responses.
  • This invention further provides a composition containing an acceptable carrier and any of an isolated, purified hybrid/chimeric transactivator (fusion) polypeptide, an active fragment thereof, or a purified, mature protein and active fragments thereof, alone or in combination with each other.
  • fusion hybrid/chimeric transactivator
  • polypeptides or proteins can be recombinantly derived, chemically-synthesized or purified.
  • the term "acceptable carrier” encompasses any of the standard pharmaceutical carriers, such as phosphate-buffered saline solution, water, and emulsions, such as an oil/water or water/oil emulsion, and various types of wetting agents.
  • the term "effective amount” refers to an amount that alleviates the deficiency by the sustained production of a biologically active chimeric human-viral transactivator protein in the cells of an individual. Sustained production of biologically active chimeric human-viral transactivator protein in individuals can be evaluated by monitoring formation of collateral blood vessels.
  • the precise effective amount of vector to be used in the method of the present invention can be determined by one of ordinary skill in the art with consideration of, for example, the age, weight, extent of disease and physical condition of the subject.
  • the biologically active chimeric transactivator nucleic acid can be introduced in combination with other therapeutic agents.
  • the biologically active chimeric transactivator nucleic acid is administered in combination with a lipid-lowering agent.
  • Lipid-lowering agents include, but are not limited to, hydroxymethyl glutaryl coenzyme-A reductase inhibitor (statin) medication and fibric acid derivatives.
  • the biologically active chimeric transactivator nucleic acid is administered in combination with an anti-hypertensive agent or regimen.
  • Anti-hypertensive agents and regimens include, but are not limited to, beta-adrenergic blocking drugs, ACE inhibitors, angiotensin-converting enzyme inhibitors, angiotensin receptor antagonists, diuretics, nitrates, and calcium channel blockers.
  • the biologically active chimeric transactivator nucleic acid is administered in combination with an anti-diabetic agent or regimen.
  • Anti-diabetic agents and regimens include, but are not limited to, glucose control therapies, such as insulin supplements, metformin and thiazolidinediones.
  • the biologically active chimeric transactivator nucleic acid is administered in combination with a smoking cessation intervention agent or regimen.
  • Smoking cessation intervention agents and regimens include, but are not limited to, behavior-modification therapy, nicotine replacement therapy, and bupropion.
  • the biologically active chimeric transactivator nucleic acid is administered in combination with a homocysteine-lowering agent or regimen.
  • Homocysteine-lowering agents and regimens include, but are not limited to, folic acid and Bi 2 vitamin supplements.
  • the biologically active chimeric transactivator nucleic acid is administered in combination with an antiplatelet and/or antithrombotic agent.
  • Anti-platelet and/or anti-thrombotic agents include, but are not limited to, aspirin and clopidogrel.
  • the biologically active chimeric transactivator nucleic acid is administered in combination with an exercise and/or lower extremity rehabilitation regimen, including, but not limited to, supervised exercise training.
  • the biologically active chimeric transactivator nucleic acid is administered in combination with a medical and pharmacological treatment for claudication.
  • Medical and pharmacological treatments for claudication include, but are not limited to, cilostazol, pentoxifylline, naftidrofuryl, L-arginine, propionyl-L-carnitine, and vasodilator prostaglandins, such as beraprost and iloprost.
  • the biologically active chimeric transactivator nucleic acid is administered to a patient who has undergone, or is undergoing, endovascular intervention.
  • Endovascular intervention includes, but is not limited to, percutaneous transluminal angioplasty, stents, atherectomy and cutting balloons.
  • the biologically active chimeric transactivator nucleic acid is administered to a patient who has undergone, or is undergoing, surgical intervention, including but not limited to, peripheral artery bypass procedures with autogenous vein grafts or synthetic grafts.
  • the combination therapy involves introduction of the biologically active chimeric transactivator nucleic acid and an angiogenic factor (e.g., VEGF, an angiopoietin).
  • an angiogenic factor e.g., VEGF, an angiopoietin
  • Therapeutic agents and regimens can be administered by any method known in the art. and specifically by the methods described herein to introduce the biologically active chimeric transactivator protein.
  • the angiogenic factor can be administered at the same time as administration of the biologically active chimeric transactivator protein or it can be administered before or after administration of the biologically active chimeric transactivator protein.
  • the present invention is further illustrated by the following examples which in no way should be construed as being further limiting. The contents of all references cited throughout this application are hereby expressly incorporated by reference.
  • a hybrid transcription factor (pcDNA3/HIF.VP-16.Afl2) composed of a DNA-binding and dimerization domain from HIF- l ⁇ and the transactivation domain from herpes simplex virus VPl 6 (FIG. 1) was constructed to provide strong, constitutive activation of genes normally involved in the physiological adaptation to hypoxia. As is described below, we analyzed the effect of this HIF- l ⁇ /VP 16 transcription factor on VEGF gene expression in vitro, and on neovascularization in a hind limb ischemia model.
  • HIF- l ⁇ gene was isolated by PCR (Advantage cDNA PCR Kit, Clontech, Palo Alto, Calif.) from a HeLa cell cDNA library (Clontech) using the primers set forth in SEQ ID NOs 1 and 2 (SEQ ID NO: 1 : ggggtacctt ctcttctccg cgtgtggagg gagccagc; SEQ ID NO:2: gctctagagt gagccaccag tgtccaaaaaaggatg) and inserted between the Kpnl and Xbal sites of the expression vector, pcDNA3 (Invitrogen, Carlsbad, Calif.).
  • HIF- 1 ⁇ /VP- 16 hybrid was constructed by truncating HIF- 1 ⁇ at aa 390 (an Afl2 site) and then joining the transactivation domain of HSV VP- 16 downstream.
  • a VP 16 fragment (aa 413-490) with Afl2 and Xbal ends was amplified by PCR using Vent polymerase (New England Biolabs, Beverly, MA) and the primers set forth in SEQ ID NOs 3 and 4 (SEQ ID NO:3: cgtacgctta agccggaatt cccggggatc tgg; SEQ ID NO:4: cgctctagac tacccaccgt actcgtcaat tc) and this fragment was cloned into the appropriate sites of the pcDNA3/ HIF- l ⁇ construct.
  • a related construct (pcDNA3/HIF/VP-16/Rl) was produced by truncating HIF-l ⁇ at aa 530 by partial digestion with EcoRl . The integrity of all sequences generated by PCR was verified by DNA sequencing using an Applied Biosystems 377 DNA Sequencer. All cloning manipulations were carried out following standard procedures (Sambrook, J. et al., Molecular Cloning, A Laboratory Manual 2d Ed. (Cold Spring Harbor, N. Y., 1989)). Restriction enzymes and DNA-modifying enzymes were obtained from ether New England Biolabs or Life Technologies, Inc. (Gaithersburg, Md.) and used according to the manufacturer's specifications.
  • Plasmid DNAs were purified with kits obtained from Qiagen (Chatsworth, Calif).
  • the plasmid construct expressing human VEGFi ⁇ s has been described previously (Tsurumi, et al., Circulation 96:11-382-11-388 (1997)).
  • Luciferase reporter plasmids EPO-luc and VEGF-luc were generously provided by Dr. H. Franklin Bunn (Brigham and Women's Hospital, Harvard Medical School).
  • Ad2/HIF-l ⁇ /VP16 (FIG. 3A) 5 Ad2/HIF-l ⁇ /NF ⁇ B, and the empty adenoviral vector control Ad2/CMVEV, which encode chimeric HIF- 1 ⁇ /VP 16, chimeric HIF- l ⁇ /NF ⁇ B, and no transgene, respectively, were constructed as described previously (Belanger, A. J., et al., J MoI Cell Cardiol 34:765-774, 2002; Date, T., et al, Am J Physiol 288:C314-C320, 2005, both of which are incorporated by reference herein).
  • Ad2/E4ORF6 backbone wild-type E2 and E3, and deletion of E4 except for ORF6.
  • the Ad2 nucleotide sequences between 357 and 4021 were replaced with the cytomegalovirus enhancer-promoter, the HIF-I ⁇ hybrid or VEGF, and the SV40 polyadenylation signal.
  • the HIF- l ⁇ /VP 16 hybrid which is composed of the DNA- binding and dimerization domains of HIF-I ⁇ and the transactivation domain of HSV VP16, was constructed by truncating HIF-l ⁇ at amino acid 390 and then joining the VP16 fragment (amino acid 413 to 490) downstream.
  • the HIF-l ⁇ /NF ⁇ B hybrid contains amino acids 1-390 of HIF-l ⁇ fused to amino acids 350 to 550 of the human NFKB p65 subunit.
  • Ad2/CMVEV was constructed in a similar manner to that for Ad2/HIF-1 ⁇ /VP 16 except that Ad2/CMVEV lacked a transgene.
  • Ad2/VEGF was constructed in a similar manner, except that human VEGFi 65 sequence was used (Houck K. A., MoI. Endocrinol. 5(12): 1806- 14 (1991); Walter, D.H., et al., Lab. Invest. 74(2):546-56 (1996)).
  • these adenovirus vectors were used in a diabetic rat hind limb model to determine promotion of non-leaky collateral vascularization.
  • the femoral artery from the point of the inguinal ligament down to the bifurcation of saphenous and popliteal arteries was dissected free, ligated (including branches derived from this artery) with silk suture and excised. The skin incision was closed with 5-0 Vicryl. The rats were kept for 7 days before cell transplantation.
  • Rat skeletal myoblasts were obtained from tibialis anterior muscles of male syngeneic rats and propagated in a culture medium composed of Myosics-modified MCDB 120 supplemented with 20% FBS, 10 ng/ml human basic FGF (R&D Systems) and 1 ⁇ M dexamethasone sodium phosphate (Hanna's Pharmaceutical) to make cryo-preserved banks.
  • Rat skeletal myoblasts of the fifth passages were cultured in collagen I- coated flasks starting at a cell density of 3,000 cells/cm 2 .
  • the SkMBs were divided into several groups for gene modification: naive SkMB (no virus infection), SkMB-EV (infected with Ad2/CMVEV), SkMB- VEGF (infected with Ad2/VEGF), SkMB-HIF/VP 16 (infected with Ad2/HIF- l ⁇ /VP16) and SkMB-HIF/NF ⁇ B (infected with Ad2/HIF-l ⁇ /NF ⁇ B).
  • An additional group of rats was injected buffer only (vehicle group).
  • SkMBs were infected with viruses at 300 viral particles/cell (all virus- infected SkMB groups) or given a medium change (naive SkMB group). For in vitro analyses, SkMBs were also infected at other doses. Twenty-four hours after infection, the skeletal myoblasts were harvested by trypsinization. After a wash with injection medium (HEPES -buffered DMEM supplemented with 0.1% human serum albumin), the skeletal myoblasts were resuspended in injection medium at required density. Vehicle (injection buffer, 2 x 75 ⁇ l) or SkMBs (4 x 10 6 cells in 2 x 75 ⁇ l) were injected into medial thigh of ischemic hind limb.
  • injection buffer 2 x 75 ⁇ l
  • SkMBs 4 x 10 6 cells in 2 x 75 ⁇ l
  • the femoral artery from the point of the inguinal ligament down to the bifurcation of saphenous and popliteal arteries was dissected free, ligated (including branches derived from this artery) with silk suture and excised. The skin incision was closed with 5-0 Vicryl. The rats were kept for 7 days before cell transplantation. Blood samples collected to monitor the animals for diabetic phenotype (non-fasting tail blood for blood glucose and fasting eyebleed blood for HbAIc & lipids) before and after the animals were enrolled in studies.
  • mRNA levels were analyzed with Taqman real-time RT-PCR (ABI Prism 7700, Applied Biosystems). Each sample or standard was tested in duplicate. The mRNA levels were normalized with 18S rRNA and expressed as fold changes over controls (Jiang 2002). Secreted VEGF protein in conditioned medium was measured using a VEGF ELISA kit (R & D Systems) and the results were normalized to total cellular protein levels as measured using the DC Protein Assay Kit (Bio-Rad). Fragmented DNA as a result of apoptosis was detected using the Deadend Fluorometric TdT-mediated dUTP Nick-end Labeling (TUNEL) System (Promega).
  • TUNEL Deadend Fluorometric TdT-mediated dUTP Nick-end Labeling
  • Collateral vessels were quantified by angiographic scores as previously described (Takeshita, S., et al., J Clin Invest. 93(2):662-70 (1994)).
  • the quantification zone (collateral zone) was defined as the medial thigh area between the proximate edge of the lesser trochanter and the bifurcation site of the popliteal and saphenous arteries.
  • a grid with 2-mm spaces was placed over the angiogram in the region of the medial thigh (collateral zone).
  • the number of contrast-opacified arteries crossing over the circles and the total number of lines encompassing the medial thigh area were counted in a blinded fashion.
  • the angiographic score was calculated as the ratio of overlying opacified arteries divided by the total number of lines in the ischemic thigh. This angiographic score reflects vascular density in the medial thigh.
  • OCT optical cutting temperature
  • Capillary endothelial cells were detected by incubation with biotinylated Griffonia simplicifolia lectin I (GS-I lectin, Vector Laboratories, 80 ⁇ g/ml) at room temperature for 1 hour.
  • GS-I lectin binding was detected with Vectastain Elite ABC Reagent (Vector Laboratories) and 3,3'-diaminobenzidine tetrahydrochloride (DAB) reagent.
  • the number of capillaries was evaluated from GS-I lectin-stained sections.
  • capillary-to-muscle fiber ratio was also determined.
  • Evans blue (Sigma, 30 mg/kg) was injected over 10 seconds into jugular vein. Thirty minutes later, rats were perfused with acidified fixative (1% paraformaldehyde in 0.05 M citrate buffer, pH 3.5) for 2 min (10 ml/min) via left ventricle. Muscle samples were removed from hind limbs (medial thigh), blotted, weighed and transferred into formamide (4 ml/g tissue) overnight at 6O 0 C to extract Evans blue from tissues. Trachea was harvested as positive control. The extract was ultra-centrifuged at 13,000 rpm for 45 min at 4°C to precipitate proteins that might interfere with absorbance.
  • acidified fixative 1% paraformaldehyde in 0.05 M citrate buffer, pH 3.5
  • the supernatant was used to measure the absorbance at 620 nm with a spectrophotometer.
  • concentration of Evans blue in the extracts was calculated from a standard curve of Evans blue in formamide, and Evans blue content in each sample was divided by tissue weight. A ratio between ischemic and contralateral limbs was calculated to eliminate individual variations.
  • VEGF mRNA and protein levels were measured.
  • VEGF mRN A levels were measured by Taqman PCR and expressed as fold increase over SkMBs infected with the corresponding dose of Ad2/CMVEV (EV) (FIGS. 4A and 4B).
  • VEGF protein secreted from the SKMBs over a period of 24 hours was also measured in the conditioned culture medium by ELISA and normalized to total cellular protein.
  • the VEGF protein levels in SkMBs infected with Ad2/CMVEV (EV), Ad2/HIF- l ⁇ /VP16, and Ad2/HIF-l ⁇ /NF ⁇ B were expressed as fold increase over that of uninfected cells (FIG. 4B).
  • Ad2/HIF-l ⁇ /VP16 significantly increased VEGF expression in a dose- dependent manner at both the mRNA and protein level (P ⁇ 0.0I), whereas there was little VEGF expression in uninfected SkMBs (Naive) and Ad2/CMVEV-infected SkMBs (EV) (FIGS. 4A, 4B, 5A and 5B).
  • FIG. 6 shows untreated ischemic hind limb; FIG. 6B shows a hind limb injected with unmodified SkMBs, and FIG. 6C shows a hind limb injected with Ad2/HIF-l ⁇ /VP16-modified SkMBs.
  • Angiographic scores were obtained from postmortem angiograms performed twenty-eight days after the removal of the femoral artery (21 days after adenoviral vector delivery) (FIG. 7). Quantitative analysis of the angiograms suggest that collateral development was significantly enhanced by Ad2/HIF-l ⁇ /VP16 modification, compared to other treatment groups. Moreover, the collateral arteries that developed in the Ad2/HIF-l ⁇ /VP16 animals were also of significantly larger diameter as compared to the vehicle (EV) or uninfected (Naive) SkMB group (FIG. 9).
  • EV vehicle
  • Naive uninfected
  • An Evans blue content assay was used to evaluate vascular permeability. The assay was performed by measuring leakage of the dye into adjacent tissues. Evans blue contents in ischemic limbs were corrected with those of non-ischemic contralateral limbs to eliminate differences due to animal-to-animal variations. Among all the groups, only the VEGF-modified SkMB group showed higher leakiness, as compared with the vehicle (EV) group (P ⁇ 0.05) (FIG. 10). The limbs in the HIF-l ⁇ /VP16-modified SkMB animals also showed less leakage as compared with the VEGF-modified SkMB animals (P ⁇ 0.01 ) (FIG. 10).
  • a rat hind limb ischemia model was created by removing the femoral artery in lean or ZDF rats. Thirty-five days after surgery, (twenty-eight days after adenoviral vector delivery), rats were sacrificed and postmortem angiography was performed. Quantitative analyses of the angiograms showed that collateral development following surgery was reduced in ZDF rats that received Ad2/CMVEV ("ZDF rat + EV"), as compared to their lean counterparts (Lean rat + EV”), as measured by angiographic scores (FIG. 12).
  • Ad2/HIF-lct/VP16 (ZDF rat + HIF) and Ad2/HIF-1 ⁇ /NF ⁇ B enhanced collateral development in ZDF rats and had angiographic scores comparable to those of the lean controls (FIG. 12).
  • the medial and anterior aspects of the hindlimbs of the rats were shaved and a standard surgical scrub applied.
  • the femoral artery was exposed with a longitudinal incision made in the medial aspect of the thigh, extending distally from the inguinal ligament to a point just proximal to the patella.
  • a section of the femoral artery was then removed as described by Taniyama et al, Gene Therapy, 8:181, 2001.
  • the femoral artery was dissected free from a point distal to the external iliac and proximal to the internal iliac, to a point just proximal to the popliteal and saphenous arteries.
  • the femoral artery was double ligated with silk suture and excised. All collateral vessels along the femoral artery were ligated with silk suture.
  • rats were IM injected with 2 X lOO ⁇ L of either Ad2/HIF-l ⁇ /VP16 or Ad2/CMV/EV at a concentration of 1 x 10 10 or 1 x 10 1 ' particles. Injections were to the medial vastus and adductor muscles adjacent and towards the distal section where the femoral artery was removed using a 1 ml syringe containing a 30-gauge needle.
  • a lateral thoracotomy was performed after the animal was intubated and connected to a respirator to assist with breathing.
  • a 24-gauge catheter was inserted into the LV of the heart.
  • a vasodilator e.g., adenosine at 1 mg/kg
  • the microspheres were injected within one minute of vasodilator introduction. After delivering the microspheres, the catheter was withdrawn.
  • microspheres With a relatively small amount of microspheres (approximately 1.5 million per injection) being injected, the small microspheres (15 microns diameter) did not affect the physiological state of the rat model because its microvascular system is vast. Microspheres became homogeneously lodged in less then one percent of the capillaries within the tissue, having no harmful effects to the rat. The lateral thoracotomy site was surgically closed and air evacuated.
  • the experimental animals were euthanized and the ischemic and non-ischemic feet, calves and quadriceps, as well as the kidneys were harvested for fluorescent microsphere analysis. All samples were weighed and then stored at 4° C or in formalin for later microsphere analysis.
  • fluorescent microsphere analysis the fluorescent signal from microspheres lodged in the capillaries of the sampled tissue was quantitated as follows. Tissue samples were individually digested in 2N potassium hydroxide/ethanol mixture at 50C overnight. Microspheres were collected from the tissue digest by filtration and washed with 1% Triton X-100 solution. Microspheres were dissolved in diethylene glycol monoethyl ether acetate overnight to release fluorescent dye.
  • the objective of this study was to utilize fluorescent microsphere analysis to characterize changes in hindlimb perfusion in the Sprague Dawley (SD) rat ischemic hindlimb model at 42 days (d42) following an intramuscular (IM) injection of 1 x 10 10 Ad2/HIF-l ⁇ /VP16 virus particles at the time of ischemia creation (d ⁇ ).
  • the method involved monitoring the distance fluorescently-labeled microspheres perfused into the tissue of the model rats. An increase in distance was indicative of neovascularization. Control microspheres having a first fluorescent label were used to determine background perfusion and test microspheres having a second fluorescent label were used to determine changes in perfusion after the Ad2/HIF- l ⁇ /VP16 was administered to the rats.
  • the data displays a marked increase of 0.4 units above baseline in RPC in the feet and calves of Ad2/ ⁇ IF-l ⁇ /VP16-treated animals at 42 days post administration when compared to the same tissues in Ad2/CMV-EV negative control-treated animals or animals that received no treatment (—0.05-1.4 units).
  • Levels of RPC were similar in the Ad2/CMV-EV and no treatment controls although the RPC in Ad2/CMV-EV treated animals trended lower.
  • the improvement in perfusion in the foot and calf was observed at 42 days post- Ad2/HIF- 1 ⁇ /VP 16 administration, while most published preclinical studies evaluating putative angiogenic agents in ischemic hindlimb models report results from 28 day or 1 month post-treatment.
  • the improvement in perfusion was observed in tissues distal to the site of Ad2/HIF-l ⁇ /VP 16 administration.
  • the RPC level was similar in animals that received Ad2/HIF-l ⁇ /VP16 and animals that received no treatment.
  • RPC in the quadriceps of animals that received Ad2/CMV-EV was slightly lower than that of the other groups.
  • CLI patients between 21 and 85 years of age with no options for surgical or endovascular revascularization and total or sub-total occlusion of at least 1 main artery in a limb, confirmed by angiography, were recruited to the study from five centers in the United States.
  • CLI was defined as Rutherford Category 4 or 5 present for a minimum of four weeks without response to conventional therapies, with lack of further revascularization options confirmed by both the investigator and an independent reviewer at the institution.
  • Exclusion criteria included contraindications to growth factor therapy that have been published previously (e.g., history of cancer within 5 years, active diabetic retinopathy) (see, e.g., Simons, M., et al., Circulation. 2000;102:E73-86; Cao, Y., et al., Cardiovasc Res. 2005;65:639-48; and Epstein, S. E., et al., Circulation. 2001 ;104: 115-9), inflammatory arteritides, such as thromboangiitis obliterans, Rutherford Category 6 status, prior successful lower extremity arterial surgery, angioplasty, or lumbar sympathectomy during the two months prior to screening. Patients who had participated in other experimental protocols within 30 days of enrollment, or who had ever been enrolled in a similar VEGF or FGF adenoviral or plasmid gene therapy protocol, were excluded.
  • This Phase I program consisted of two dose escalation safety studies: a randomized, double-blind placebo controlled (RDBPC) design and an open label extension (Open Label) design.
  • the first study was placebo-controlled to ensure objectivity of initial safety evaluations by investigators and an independent Data Safety Monitoring Board (DSMB). Based on the results of preclinical safety and bioactivity testing, five dosing cohorts were evaluated, increasing from 1x10 8 vp to IxIO 10 Vp in 1 A log increments.
  • the "Open-Label" portion of the study was modified during the trial, based on the safety data accrued to that point and new, supportive preclinical toxicity data.
  • the modified Open-label study was expanded to include treatment of 3 patients each with doses of 3xlO 10 , lxlO 1 1 , and 2xl ⁇ " vp. (Patient 38, in screening at the end of the study, received IxIO 10 vp). A maximal dose of 2xl ⁇ " vp was chosen based on additional preclinical toxicity data, in consultation with FDA and continuing DSMB review.
  • Safety variables included adverse event reports and changes from baseline in physical examinations, clinical laboratory evaluations, adenoviral antibody titer measurement, retinal eye examinations, and examinations of the index limb to assess rest pain, ulcer status, and Rutherford Category (RC) (Rutherford, R.B., et al., J. Vase. Surg. 1997;26:517-38).
  • Preliminary efficacy measures included changes in ischemic rest pain, healing of ischemic ulcers, ABI, and bioactivity assessment of new vessel development using 3D gadolinium contrast-enhanced, and 3D time-of- flight MRA to detect changes in vascularization.
  • Ad2/HIF-l ⁇ /VP16 is a recombinant, replication-deficient adenovirus with an insert containing the DNA-binding and dimerization domains from the HIF-Ia subunit, as well as a herpes virus VP 16 transactivation domain to enable constitutive activation (Jiang, C, et al., Physiol. Genomics. 2002;8:23-32; Vincent, K.A., et al., Circulation. 2000;102:2255-61 ; Armentano, D., et al., Hum. Gene Ther. 1995;6: 1343-53).
  • Ad2/HIF- 1 ⁇ /VP 16 is propagated in human 293 cells, a permanent cell line of primary human embryonal kidney (HEK.) cells that were immortalized with sheared fragments of human Type 5 adenovirus (Ad5) DNA.
  • the bulk substance was purified using column chromatography, filtration (for vector concentration), and final sterile filtration.
  • the resulting pre-formulated drug substance subsequently underwent final dilution in formulation buffer consisting of phosphate buffered saline (PBS) with 10% sucrose.
  • Ad2/HIF-lalpha/VP16 is manufactured by Genzyme Corporation (Cambridge, MA).
  • the total dose of Ad2/HIF-l ⁇ /VP16 or placebo i.e., PBS with 10% sucrose
  • the total dose of Ad2/HIF- 1 ⁇ /VP 16 consisted of 20 100- ⁇ l direct IM injections of 1 x 10 1 ' vp to achieve a total dose of 2x10* ' vp, given into a single limb for a total volume of 2.0 ml.
  • the placement of the injections was at the discretion of the investigator, based on patient anatomy and the location of the occluded artery(s) within the affected limb.
  • This Phase 1 dose escalation program included 2 studies: a randomized, double-blind, placebo-controlled study and an open-label extension study.
  • 34 no-option patients with CLI received HIF- Ia at doses of IxI O 8 viral particles (vp) to 2xl ⁇ " vp.
  • No serious adverse events were attributable to study treatment.
  • 7 of 21 HIF- l ⁇ patients met treatment failure criteria and had major amputations.
  • Three of the 7 placebo patients rolled over to receive HIF- l ⁇ in the extension study.
  • Three of 13 extension study HIF-I ⁇ patients had major amputations. No deaths or amputations occurred in the 2 highest dose groups
  • Ad2/HIF-1 ⁇ /VPl 6 Phase I program in patients with critical limb ischemia (CLI) there were 4 patients with type II diabetes and non-healing ischemic ulcers who enrolled. These diabetic patients received Ad2/HIF-l ⁇ /VP16 at doses ranging from Ixl ⁇ e9 vp to lxlOel 1 vp. To meet study eligibility requirements, these patients were confirmed to have such advanced atherosclerotic disease in at least one of their lower extremities that they were no longer candidates for either an endovascular or surgical revascularization procedure.
  • CLI critical limb ischemia
  • Ad2/HIF-l ⁇ /VP16 can change the pathophysiology of peripheral artery disease in diabetic patients, and that these patients may exhibit increased efficacy from treatment with the nucleic acid molecules of the invention.
  • Ad2/HIF-l ⁇ /VP16 may be able to overcome the known difficulty diabetic patients have with endogenous inducement of new blood vessel formation and/or remodeling of existing vessels into larger arterioles that are sufficiently developed to maintain the integrity of this new vascular structure.
  • Hypoxia- inducible factor-1 is the master regulator of an angiogenic response to hypoxia.
  • adenoviral vectors expressing a constitutively active HIF- 1 ⁇ hybrid (Ad2/HIF- 1 ⁇ /VP 16) or vascular endothelial growth factor (Ad2/VEGF) were studied.
  • VEGF vascular endothelial growth factor
  • Angiopoietin-1 vascular endothelial growth factor-1
  • Angiopietin-4 vascular endothelial growth factor-4
  • Ad2/HIF-l ⁇ /VP16 and Ad/2VEGF In separate animals, intramuscular injection of Ad2/HIF-l ⁇ /VP16 and Ad/2VEGF into the thigh muscles significantly increased the angiographic score and capillary density 21 and 35 days after the injection, compared to Ad2/CMVEV (a vector expressing no transgene) or vehicle. Following the injection of Ad/CMVEV or vehicle, the Evans-blue dye content in the thigh muscles was significantly higher in ZDF rats than their ZL counterparts. Ad2/HIF-l ⁇ /VP16 but not Ad2/VEGF reduced tissue Evans blue dye content.
  • Ad2/HIF- 1 ⁇ /VP 16 enhanced collateral development and reduced vascular leakage in the ischemic hindlimb of ZDF rats indicating that hybrid HIF- l ⁇ angiogenic therapy is likely efficacious for peripheral vascular disease with a diabetic co-morbidity.
  • the HIF-I ⁇ /VP 16 hybrid was constructed by truncating the transactivation and oxygen-dependent degradation domains of HIF-I ⁇ and then joining the HSV VP 16 transactivation domain fragment downstream, to yield a normoxically stable, constitutively active form of HIF-I ⁇ (Vincent KA, et al. Circulation. 2000; 102: 2255-2261).
  • Ad2/HIF-l ⁇ /VP16, Ad2/VEGF, and Ad2/CMVEV which encode HIF-l ⁇ /VP16, vascular endothelial growth factor (VEGF) 165, and no transgene, respectively, were generated as described previously (Yamakawa M, et al., Circ Res. 2003; 93: 664-673; Clark JB, et al., Proc Soc Exp Biol Med. 1983; 173: 68-75).
  • the lower part of the animal body was fixed in 10% formalin for 3 days, transferred into PBS, and stored at 4 0 C.
  • the fixed body parts were placed in the cabinet of a Faxitron specimen radiography system (Faxitron X-ray Corporation, Wheeling, IL 5 USA).
  • a digitalized angiographic image was obtained for each hindlimb (22 kV, 15 seconds) and stored in the computer for quantitative analysis.
  • An angiographic score in the areas of collateral development was generated for each hindlimb, as described previously (Bauters C, et al., Circulation. 1995; 91: 2802-2809; Tsurumi Y, et al., Circulation.
  • thigh muscles were harvested, embedded in optical cutting temperature (OCT) compound (Sakura Finetek, Torrance, CA, USA), snap-frozen in liquid nitrogen, and stored at -80 0 C.
  • OCT optical cutting temperature
  • Six ⁇ m frozen tissue sections were fixed in acetone, treated with 0.3% H 2 ⁇ 2 /methanol for 15 min to deplete the endogenous peroxidase, and then incubated with biotinylated Griffonia simplicifolia lectin I (GS- I lectin, 80 ⁇ g/ml, Vector Laboratories, CA, USA) at room temperature for 1 hour.
  • OCT optical cutting temperature
  • GS-I lectin binding was detected with Vectastain Elite ABC Reagent (Vector Laboratories) and 3,3'-diaminobenzidine tetrahydrochloride (DAB) Reagent kits.
  • Vector Laboratories Vectastain Elite ABC Reagent
  • DAB 3,3'-diaminobenzidine tetrahydrochloride
  • the absorbance at 620 nm in the supernatant was measured with a spectrophotometer.
  • the levels of Evans blue dye in the extracts was calculated based on a standard curve generated from known constrations of Evans blue dye in formamide.
  • the Evans blue content in each tissue sample was normalized to tissue weight.
  • a ratio of the ischemic over the contralateral limb was calculated to eliminate animal to animal variability.
  • Calf muscle samples excised from both the ischemic and contralateral limb were immediately frozen in liquid nitrogen, and stored at -80 0 C. Samples were then homogenized in TRIzol reagent (Invitrogen, CA, USA) and the total RNA extracted. The total RNA samples were incubated in RNase-free DNase I (Ambion, TX, USA), and purified using the RNeasy Mini Kit (Quiagen, MD, USA). The mRNA levels of specific genes were measured by TaqMan 5' nuclease fluorogenic quantitative PCR analysis (Yamakawa, 2003). Primers and probes were designed according to ABI- Perkin Elmer guidelines. The mRNA levels of the gene of interest were normalized to 18 S rRNA and the results were expressed as the ratio between the ischemic and contralateral limb.
  • ZDF rats fed with a high fat diet exhibited a progressive diabetic phenotype, as indicated by an increase in body weight and HbAIc levels (data not shown).
  • Thirty five days after surgical removal of the femoral artery collateral vessels developed in both ZL and ZDF rats, as measured by post-mortem angiography ( Figure 16A).
  • the angiographic score was significantly lower in ZDF than ZL animals ( Figure 16B).
  • mRNA levels of angiogenic genes in the calf muscles after surgical removal of the femoral artery were examined next Three days after the surgery, in ZL animals the mRNA levels of VEGF, Ang-1 , and Ang-4 were higher in the ischemic hindlimb than the contralateral non-ischemic hindlimb. This increase diminished at later time-points examined, except that the increase of Ang-4 mRNA levels was maintained at day 7. Ang-2 mRNA levels did not significantly change. In contrast, in ZDF animals the mRNA levels of VEGF, Ang-1, and Ang-4 were not significantly altered, while Ang-2 mRNA levels were transiently elevated in the ischemic hindlimb. Taken together, these results indicate that decreased expression of the angiogenic genes was, at least in part, responsible for the impaired collateral development in ZDF rats.
  • ZL and ZDF rats at the age of 8 weeks were enrolled into various experimental groups.
  • the ZDF rats were significantly (p ⁇ 0.01) overweight (33 l . l ⁇ 5.4g), compared to their lean counterparts (245.7 ⁇ 4.9g).
  • the HbAIc levels were also significantly (p ⁇ 0.01) higher in ZDF (6.4 ⁇ 0.3%) than ZL animals (4.8 ⁇ 0.1%).
  • the HbAIc levels in the ZDF rats increased further to 1 1.2 ⁇ 0.4%, while HbAIc levels in the ZL animals remained normal (4.91 ⁇ 0.1%).
  • the ZDF rat harbors an autosomal recessive gene, fa, and exhibits a progressive phenotype of obesity, insulin resistance, and type II diabetes (Clark JB, et al.
  • Angiopoietins are ligands for the endothelium-specif ⁇ c receptor tyrosine kinase Tie-2 (Yamakawa M, et al. Circ Res. 2003; 93: 664-673; Lee JH, et al., FASEB J. 2004; 18: 1200- 1208; Schaper W and Scholz D, Arterioscler Thromb Vase Biol.
  • Ang-2 antagonizes the activation of Tie-2 by Ang-1 and Ang-4 and causes endothelial cell apoptosis and vascular leakage.
  • the defective upregulation of VEGF and angiopoietins may partially explain the impaired collateral development and increased vascular leakage in ZDF rats.
  • Hybrid HIF-I ⁇ but not VEGF decreased vascular leakiness
  • Angiopoietin- 1 and Angiopoietin-4 plays an important role in the assembly of newly formed vasculature and in the maintenance of vascular integrity (Yamakawa M, et al Circ Res. 2003; 93: 664-673; Lee JH, et al, FASEB J. 2004; 18: 1200-1208; Sheil M and Schaper W., Circ Res. 2004; 95: 449-458).
  • the ability of HIF-I to activate the angiopoitin/Tie-2 system may contribute to the ⁇ irrerences in the quality of the vasculature resulting from overexpression of VEGF or HIF-I ⁇ l 1.
  • the impaired endogenous angiogenic response to ischemia in ZDF rats can be rescued by adenoviral-mediated gene transfer of HIF-l ⁇ /VP16.
  • Ad2/HIF-l ⁇ /VP16 is capable of enhancing collateral development and reducing vascular leakage in the ischemic hindlimb, indicating an advantage over a single growth factor for therapeutic angiogenesis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Diabetes (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Endocrinology (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Urology & Nephrology (AREA)
  • Vascular Medicine (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Emergency Medicine (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Epidemiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention porte sur des molécules d'acide nucléique de recombinaison codant pour des protéines chimères transactivatrices, et sur leur utilisation pour promouvoir une vascularisation collatérale exempte de fuites. L'invention porte également sur des méthodes de traitement des troubles caractérisés par un accroissement de la perméabilité vasculaire.
PCT/US2007/019670 2006-09-12 2007-09-11 Méthodes de promotion de vascularisation collatérale exempte de fuites. WO2008033304A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US82539606P 2006-09-12 2006-09-12
US60/825,396 2006-09-12

Publications (2)

Publication Number Publication Date
WO2008033304A2 true WO2008033304A2 (fr) 2008-03-20
WO2008033304A3 WO2008033304A3 (fr) 2008-07-03

Family

ID=39060222

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/019670 WO2008033304A2 (fr) 2006-09-12 2007-09-11 Méthodes de promotion de vascularisation collatérale exempte de fuites.

Country Status (2)

Country Link
AR (1) AR062762A1 (fr)
WO (1) WO2008033304A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016069760A1 (fr) * 2014-10-31 2016-05-06 Steven Yu Procédé de traitement de démence par administration intranasale de thérapie de gène vegf

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060127361A1 (en) * 1997-12-04 2006-06-15 Genzyme Corporation Compositions and methods for inducing gene expression

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060127361A1 (en) * 1997-12-04 2006-06-15 Genzyme Corporation Compositions and methods for inducing gene expression

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS: "Annual Meeting of the German-Society-for-Microcirculation-and-Va scula r-Biology, Rostock, GERMANY, September 15 -17, 2005" JOURNAL OF VASCULAR RESEARCH, vol. 43, no. 1, 31 October 2005 (2005-10-31), pages 27-58, XP002478670 & ANNUAL MEETING OF THE GERMAN-SOCIETY-FOR-MICROCIRCULATION-AND-VA SCULA R-BIOLOGY; ROSTOCK, GERMANY; SEPTEMBER 15 -17, 2005 ISSN: 1018-1172 *
ANONYMOUS: "Clinical trial: Safety and efficacy study of Ad2/hypoxia inducible factor (HIF)-1alpha/VP16 gene transfer in patients with intermittent claudication" INTERNET, [Online] 25 July 2005 (2005-07-25), XP002478665 Retrieved from the Internet: URL:http://goldbamboo.com/topic-a141096.html> [retrieved on 2008-04-24] *
CARROLL VERONICA A ET AL: "Role of hypoxia-inducible factor (HIF)-1alpha versus HIF-2alpha in the regulation of HIF target genes in response to hypoxia, insulin-like growth factor-I, or loss of von Hippel-Lindau function: implications for targeting the HIF pathway." CANCER RESEARCH 15 JUN 2006, vol. 66, no. 12, 15 June 2006 (2006-06-15), pages 6264-6270, XP002478669 ISSN: 0008-5472 *
ELSON D A ET AL: "Induction of hypervascularity without leakage or inflammation in transgenic mice overexpressing hypoxia-inducible factor-1alpha." GENES & DEVELOPMENT 1 OCT 2001, vol. 15, no. 19, 1 October 2001 (2001-10-01), pages 2520-2532, XP002478666 ISSN: 0890-9369 *
PAJUSOLA KATRI ET AL: "Stabilized HIF-1alpha is superior to VEGF for angiogenesis in skeletal muscle via adeno-associated virus gene transfer." THE FASEB JOURNAL : OFFICIAL PUBLICATION OF THE FEDERATION OF AMERICAN SOCIETIES FOR EXPERIMENTAL BIOLOGY AUG 2005, vol. 19, no. 10, August 2005 (2005-08), pages 1365-1367, XP002478667 ISSN: 1530-6860 cited in the application *
RAJAGOPALAN SANJAY ET AL: "Use of a constitutively active hypoxia-inducible factor-1alpha transgene as a therapeutic strategy in no-option critical limb ischemia patients: phase I dose-escalation experience." CIRCULATION 13 MAR 2007, vol. 115, no. 10, 13 March 2007 (2007-03-13), pages 1234-1243, XP002478671 ISSN: 1524-4539 *
RIVARD A ET AL: "Rescue of diabetes-related impairment of angiogenesis by intramuscular gene therapy with adeno-VEGF." THE AMERICAN JOURNAL OF PATHOLOGY FEB 1999, vol. 154, no. 2, February 1999 (1999-02), pages 355-363, XP002959461 ISSN: 0002-9440 *
TRENTIN DIANA ET AL: "Peptide-matrix-mediated gene transfer of an oxygen-insensitive hypoxia-inducible factor-1alpha variant for local induction of angiogenesis." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA 21 FEB 2006, vol. 103, no. 8, 21 February 2006 (2006-02-21), pages 2506-2511, XP002478668 ISSN: 0027-8424 *
VINCENT K A ET AL: "Angiogenesis is induced in a rabbit model of hindlimb ischemia by naked DNA encoding an HIF-1alpha/VP16 hybrid transcription factor" CIRCULATION, AMERICAN HEART ASSOCIATION, DALLAS, TX, US, vol. 102, no. 18, 31 October 2000 (2000-10-31), pages 2255-2261, XP002225125 ISSN: 0009-7322 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016069760A1 (fr) * 2014-10-31 2016-05-06 Steven Yu Procédé de traitement de démence par administration intranasale de thérapie de gène vegf

Also Published As

Publication number Publication date
AR062762A1 (es) 2008-12-03
WO2008033304A3 (fr) 2008-07-03

Similar Documents

Publication Publication Date Title
CA2311643C (fr) Compositions et procedes induisant l'expression genique
JP6726291B2 (ja) 心筋線維化の処置のための医薬組成物
JP4993606B2 (ja) Ｒａｍｐ２を標的とする血管構造の安定化剤及び血管新生剤
WO2014153385A2 (fr) Méthodes de traitement de troubles métaboliques
Heilig et al. Antisense GLUT-1 protects mesangial cells from glucose induction of GLUT-1 and fibronectin expression
Ward et al. Angiopoietin 1 expression levels in the myocardium direct coronary vessel development
JPWO2006134692A6 (ja) Ｒａｍｐ２を標的とする血管構造の安定化剤及び血管新生剤
Ro et al. Adipocyte enhancer‐binding protein 1 modulates adiposity and energy homeostasis
Chiang et al. Inactivation of tensin3 in mice results in growth retardation and postnatal lethality
JPWO2004022753A1 (ja) アクチン関連新規細胞骨格タンパク質ｌａｃｓ
DK2970463T3 (en) METHOD OF TREATING AND / OR LIMITING THE DEVELOPMENT OF DIABETES
JPWO2007139120A1 (ja) アミロイドβクリアランス促進剤
WO2008033304A2 (fr) Méthodes de promotion de vascularisation collatérale exempte de fuites.
CZ2003444A3 (cs) Konstrukty nukleové kyseliny, vaskulární buňky jimi transformované a farmaceutické prostředky a způsoby používající je k indukci angiogenesy
US6960444B2 (en) Transcriptional mediators of blood vessel development and endothelial differentiation
US8969080B2 (en) Remedy for the treatment of cardio-vascular diseases or disorders
JP2022509445A (ja) 線維症を治療又は予防するための組成物及び方法
Zhang et al. Phosphorylation dependent mitochondrial translocation of Nr4a3 provokes cardiomyocyte death
Venkata Deletion of G Protein-Coupled Receptor 39 in Endothelial Cells Protects Angiogenesis in Hyperglycemia
Hernandez The Physiology and Pharmacology of FGF21 in the Exocrine Pancreas
Dulak et al. Gene transfer of naked VEGF plasmid induces the formation of microvessels but not mature collaterals in ischaemic limb muscles
Wang The Role of Smad3 in Islet β Cell Proliferation and It's Therapeutic Potential in Diabetes
US8110185B2 (en) Method for preventing and treating cardiovascular diseases with BRCA1
JPWO2009044787A1 (ja) テノモジュリンを有効成分とする腱断裂性疾患治療剤
MXPA00005516A (es) Composiciones y metodos para inducir la expresion de genes

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07837977

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07837977

Country of ref document: EP

Kind code of ref document: A2