WO2008015662A1 - A method of producing recombinant biological products - Google Patents

A method of producing recombinant biological products Download PDF

Info

Publication number
WO2008015662A1
WO2008015662A1 PCT/IE2007/000078 IE2007000078W WO2008015662A1 WO 2008015662 A1 WO2008015662 A1 WO 2008015662A1 IE 2007000078 W IE2007000078 W IE 2007000078W WO 2008015662 A1 WO2008015662 A1 WO 2008015662A1
Authority
WO
WIPO (PCT)
Prior art keywords
mirna
cells
cell
mammalian producer
cho
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IE2007/000078
Other languages
English (en)
French (fr)
Other versions
WO2008015662A8 (en
Inventor
Patrick Gammell
Niall Barron
Martin Clynes
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dublin City University
Original Assignee
Dublin City University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=38720408&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2008015662(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Dublin City University filed Critical Dublin City University
Priority to US12/376,345 priority Critical patent/US8476244B2/en
Priority to EP07789931.8A priority patent/EP2046970B2/en
Priority to JP2009522414A priority patent/JP2009545309A/ja
Priority to AU2007280004A priority patent/AU2007280004A1/en
Priority to CA002658301A priority patent/CA2658301A1/en
Publication of WO2008015662A1 publication Critical patent/WO2008015662A1/en
Anticipated expiration legal-status Critical
Publication of WO2008015662A8 publication Critical patent/WO2008015662A8/en
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/111—Antisense spanning the whole gene, or a large part of it
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/50—Methods for regulating/modulating their activity

Definitions

  • the invention relates to methods for the generation of Chinese hamster ovary (CHO) cell cultures, and methods of producing recombinant biopharmaceutical products using CHO cell cultures.
  • the invention also relates to recombinant CHO cell lines.
  • CHO Chinese hamster ovary cells
  • Mahersen and Krummen 2002
  • CHO transcriptional profiling studies have been carried out either using non-CHO arrays (Baik et al., 2006) or proprietary CHO cDNA arrays (Wong et al., 2006). These studies have described the effects of both low temperature and the induction of apoptosis during CHO culture.
  • proteomic studies have investigated the proteome of CHO and the changes in protein expression in response to culture conditions such as temperature (Baik et al.,2006; Champion et al., 1999; Van Dyk et al. 2003; Kaufmann et al., 1999 Lee et al.,2003). These studies have increased overall understanding of the regulation of CHO function and particularly with respect to the effects of reduced temperature.
  • CRIP cold inducible RNA binding protein
  • miRNAs are small ( ⁇ 22nt) non-coding RNAs (ncRNAs) that regulate gene expression at the level of translation. Each miRNA apparently regulates multiple genes and hundreds of miRNA genes are predicted to be present in mammals (Lim et al. 2003). The first miRNA was discovered in C. elegans in 1993 (Lee et al., 1993) and over the last number of years it has become apparent that there are a huge number of these molecules (up to 2% of the human genome encode miRNAs (Miska, 2005)). Recently miRNAs have been found to be critical for development (Ambros, 2003; Chen et al., 2004), cell proliferation and cell death (Brennecke et al. 2003), apoptosis and fat metabolism (Xu et al. 2003), and cell differentiation (Chang et al. 2004).
  • the present invention is based on a finding that certain miRNA molecules are differentially expressed at different stages of the growth cycle of mammalian producer cells. Accordingly, the invention relates to the modification of mammalian producer cells to increase or decrease levels of specific miRNAs (i.e. as shown in Table 1) in an appropriate temporal manner to modulate growth of the cell culture.
  • expression of miRNA' s is promoted to promote cell arrest. This cell arrest is associated with accumulation of cells in the Gl (growth arrest) phase of the cell cycle and this is linked to increased productivity.
  • the inhibition or depression of specific miRNAs at the initial phase of culture is promoted, thereby encouraging biomass generation prior to growth arrest. This has the advantage of generating an increased working stock of cells in a shorter time.
  • inhibition (or repression) of specific miRNAs at the initial phase of culture is initially promoted, and then the conditions are changed to cause an increase in the level of miRNA' s during the growth arrest phase of the cell cycle (i.e. through transient transfection with miRNA' s, inducing the expression of nucleic acids encoding miRNA' s, or through the removal of repressors) .
  • These methods find application in the growth and use of mammalian producer cell cultures, particularly in the production of recombinant biological products, especially recombinant biopharmaceutical products.
  • mammalian producer cells should be understood as meaning mammalian cells useful in the production of recombinant biological products such as biopharmaceuticals and the like. Examples of such cell types would be Chinese hamster ovary (CHO) cells or baby hamster kidney (BHK) cells. According to the invention, there is provided a method of producing recombinant biological products, which method employs a mammalian producer cell culture, comprising the steps of:
  • a person skilled in the art would know when a desired concentration of mammalian producer cells is achieved. Generally, this would be at, or just prior to, the start of the growth arrest phase of the cell cycle.
  • the cells are transiently transfected with one or more of the miRNA molecules of Table 1.
  • the miRNA molecules are miRNA precursor molecules, ideally synthetic miRNA precursor molecules.
  • the miRNA molecules may be primary miRNA or mature miRNA molecules. The sequences of the primary, precursor and mature miRNA' s molecules of Table 1 is available from the database of miRNA sequences, targets and gene nomenclature, MIRBase, at http:microrna.sanger.ac.uk
  • the cells may be transiently transfected with an expression vector comprising a nucleic acid sequence coding for a miRNA molecule of Table 1 under the control of a transcriptional promotor.
  • the nucleic acid sequence codes for a precursor of a miRNA molecule of Table 1.
  • the transcriptional promoter is a constitutive or inducible promoter.
  • the promoter is temperature inducible, and is ideally switched on in biphasic cell cultures when the temperature drops.
  • the nucleic acid sequence may also code for a primary miRNA or a mature miRNA, however generally the vector codes for the precursor version of any of the miRNA molecules of Table 1.
  • the expression vector may be a plasmid, or a linear nucleic acid construct such as a PCR product or a restriction fragment.
  • the transfection is mediated using a liposome-based method such as, for example, NeoFx (Ambion Cat:4511).
  • a liposome-based method such as, for example, NeoFx (Ambion Cat:4511).
  • other methods of transfection will be apparent to the skilled person such as, for example, transfection mediated using electroportation or transfection mediated using calcium phosphate.
  • the method may employ cells that are engineered to have the coding sequence for a miRNA molecule of Table 1 stably integrated into the cell genome under the control of an inducible promoter, and in such cases the method generally involves inducing the expression of the miRNA molecule at a desired point in the growth cycle, generally at or just prior to the start of the cell arrest phase (i.e. when a desired concentration of viable producer cells have been achieved).
  • the promoter is a temperature inducible promoter, In such circumstances, the temperature drop from 37° to 31° will induce expression of the miRNA molecules.
  • the coding sequence for the miRNA molecule may code for primary, precursor, or a mature version of the miRNA; generally it will code for the precursor version of the miRNA molecule, and the precursor will be processed into mature miRNA by the machinery of the cell.
  • miRNA coding sequences in the cells are repressed using suitable repressors during an initial phase of growth, and then the level of miRNA in the cells is increased by withdrawal of the repressor at or just prior to the growth arrest phase.
  • suitable promoter/repressor pairs will be well known to those skilled in the art.
  • the miRNA molecule is selected from the group comprising: hsa-miR-21; and hsa-miR-24.
  • the invention also provides a method of producing recombinant biological products, which method employs a mammalian producer cell culture, the method comprising the step of increasing a level of an inhibitor of one or more of miRNA molecules of Table 1 within the cells during an initial phase of culture, and typically at the start of the initial phase of culture.
  • the sequences of such inhibitors are available from the database of miRNA sequences, targets and gene nomenclature, MIRBase, at http :microrna. sanger.ac.uk
  • the method employs cells that are engineered to have the coding sequence for a miRNA inhibitor molecule stably integrated into the cell genome under the control of an inducible promotor, and wherein the method involves inducing the expression of the miRNA inhibitor molecule during the initial phase of culture, and ideally at the start of the initial phase of culture.
  • This has the effect of encouraging biomass generation prior to growth arrest, which has the advantage of generating an increased working stock of cells in a shorter time
  • expression is induced by the presence of an inducer of expression.
  • the sequence coding for the inhibitor may be under the control of a repressible promoter.
  • the inhibitor will be freely expressed during the initial phase of culture, with a repressor being added to inhibit expression of the miRNA inhibitor(s) at a desired stage of the cell cycle, generally at or just prior to the start of growth arrest stage of the cell cycle.
  • the inducing of the expression of the miRNA inhibitor molecule is stopped once a suitable cell biomass is achieved.
  • the miRNA inhibitor molecule is selected from the group comprising inhibitors of the following: hsa-miR-21; and hsa-miR- 24.
  • the invention relates to a method of generating mammalian producer cell culture comprising the step of causing an increase in a level of an inhibitor of one or more of the miRNA molecules of Table 1 within the cells during or at the start of an initial phase of culture according to the invention, and subsequently increasing a level of one or more of the miRNA molecules of Table 1 within the cells at or just prior to a start of the growth arrest phase of the cell cycle according to the invention.
  • the methods of the invention are suitable for application in the growth and use of CHO cells such as CHO-Kl or CHO-DUKX cells or BHK cells.
  • the growth arrest phase is carried out at a lower culture temperature than the initial growth phase.
  • the initial growth phase is carried out at 37 0 C.
  • the growth arrest phase is carried out at 31 0 C.
  • the invention also relates to a mammalian producer cell comprising a nucleic acid encoding a miRNA molecule of Table 1 stably incorporated into the genome of the cell and under the control of an inducible promoter.
  • the nucleic acid encodes a miRNA molecule selected from the group comprising: hsa-miR-21; and hsa-miR-24.
  • the promoter is a temperature inducible promoter.
  • the mammalian producer cell of the invention may comprise a nucleic acid encoding an inhibitor of a miRNA molecule of Table 1, stably incorporated into the genome of the cell and under the control of an inducible promoter.
  • the nucleic acid encodes an inhibitor of an miRNA molecule selected from the group comprising: hsa-miR-21; and hsa- miR-24.
  • the promoter is a temperature inducible promoter.
  • the mammalian producer cell is a CHO cell such as, for example, a CHO-Kl cell or a CHO-DUKX cell.
  • the mammalian producer cell may be a BHK cell. These cells may be obtained from LGCProtochem- atcc of Middlesex, England under the following catalogue references: CRL- 10154-CHO DuKX; CRL-9618-CHOK1; CCL-lO-BHK-21.
  • the mammalian producer cell lines of the invention may be genetically engineered to inducibly express specific miRNA molecules (of Table 1) at or just before the growth arrest phase to generate an increased level of the miRNA molecules during the growth arrest phase, or they may be engineered to inducibly express inhibitors of the miRNA molecules of Table 1 during the initial stages of the cell culture, or they may be engineered to do both, i.e. express inhibitors of the miRNA molecules during the initial stages of the culture, and then express the miRNA molecules during cell arrest phase.
  • specific miRNA molecules of Table 1
  • they may be engineered to inducibly express inhibitors of the miRNA molecules of Table 1 during the initial stages of the cell culture, or they may be engineered to do both, i.e. express inhibitors of the miRNA molecules during the initial stages of the culture, and then express the miRNA molecules during cell arrest phase.
  • control of expression may exercised by using inducible promotors and then adding or removing the inducers to the culture broth as required.
  • inducible promotors may also be controlled by using constitutive promotors and controlling expression by the use of repressors of expression.
  • constitutive promotors may be used as an alternative, and that the modification of the methods or of the mammalian producer cell lines that is required to achieve the promise of the invention will be apparent to the skilled person.
  • the invention also provides a kit useful for producing recombinant biological products, the kit comprising: (a) a mammalian producer cell line; (b) means for transfecting the cells with a miRNA molecule of Table 1 ; and/or (c) means for transfecting the cells with an inhibitor of one of the miRNA molecules of Table 1.
  • the transfection means may be transient or stable, and involves introducing into the cells either or both of (a) synthetic miRNA molecules (or inhibitors) and (b) nucleic acid encoding miRNA molecule (or encoding the miRNA inhibitors).
  • FIG. 1 Viable cell counts for CHO-Kl batch culture following seeding at 1x10 5 cells/ml for cultures incorporating a temperature shift (A) and cells cultured at a constant temperature of 37 0 C. In each case biological triplicate samples were taken from the spinner flasks at 72 and 144 hours post seeding (indicated by arrows).
  • Figure 2 15% denaturing acrylamide gel analysis of RNA extracted from the TS samples demonstrating the yield and integrity of the small RNA species.
  • FIG. 4 An outline of the Ambion qRT-PCR process for the detection and quantification of mature miRNAs. This image has been used courtesy of Ambion Inc. Detailed Description of the Invention
  • Suspension adapted CHO-Kl cells were used in this study.
  • the culture medium consisted of ATCC medium (DMEM / F- 12 Hams containing glutamine and sodium pyruvate; Sigma) supplemented with 10% fetal bovine serum (Sigma).
  • Cells were maintained in 25OmL spinner vessels (Techne) at 60rpm on spinner platforms in 37 0 C or 31 0 C incubators as appropriate.
  • For batch culture experiments exponentially growing cells were inoculated at 1x10 5 cells/mL into spinners vessels at a final volume of 10OmL. All cultures were gassed with compressed air (Air Products) each day for ⁇ 1 min.
  • RNA quality was determined by using both Agilent 6000 nano chips and by 15% denaturing acrylamide gel electrophoresis. RNA quantification was carried out using a Nanodrop (ND- 1000; Labtech. International).
  • microRNA profiling studies were processed by Asuragen according to the company's standard operating procedures.
  • the microRNA enriched fraction was obtained by passing lO ⁇ g of total RNA through a flashPAGETM Fractionator apparatus (Ambion, Inc., Austin, TX) and cleaned and concentrated using the flashPAGE Reaction Clean-Up Kit (Ambion, Inc., Austin, TX).
  • the 3' ends of the RNA molecules were tailed and labeled using the mirVanaTM miRNA Labeling Kit (Ambion, Inc., Austin, TX) according to the manufacturer's instructions.
  • Amine-modified nucleotides were incorporated during the poly (A) polymerase mediated tailing reaction, and Cy5 succinimide esters (Amersham Biosciences (GE Healthcare), Piscataway, NJ) were conjugated to the amine moieties on the microRNAs.
  • Hybridization to the mirVana miRNA Bioarrays was performed using the mirVana miRNA Bioarray Essentials Kit (Ambion, Inc., Austin, TX).
  • the Cy5 fluorescence on the arrays was scanned at an excitation wavelength of 635nm using a GenePix 4200 AL scanner (Molecular Devices, Union City, CA).
  • the fluorescent signal associated with the probes and local background was extracted using GenePix Pro (version 6.0, Molecular Devices, Union City, CA).
  • Thresholding and signal scaling were generated using algorithms selected by Asuragen, as implemented as part of the microRNA Standard Service Premium Analysis (miSSP package).
  • the background adjusted fluorescent values generated by GenePix Pro were normalized for each microRNA using a variation stabilization transformation method described by Huber et al., 2002.
  • Pair-wise comparisons are carried out on differentially expressed genes identified by ANOVA to see how they differ from each other. For each pair of treatments, a two-sample t-test is carried out for every gene and multiplicity correction is followed to control the false discovery rate (FDR) using a step-up approach as described by Benjamini and Hochberg (1995) using an FDR of 5%. This method is referred to as "protected Least Significant Difference (LSD)". The detailed miRNA lists and associated information such as fold-change and p-values are reported. MiRNA profiling of temperature shifted CHO-Kl cells at 144 hours of culture vs. exponentially growing CHO-Kl cells at 37 0 C identified 26 miRNAs as being significantly different (Table 1).
  • sequences of the mature transcripts the above miRNA's are provided in the Sequence Listing below.
  • the sequence of the primary and precursor transcripts of the above miRNA's may be obtained from the database of miRNA sequences, targets and gene nomenclature, MIRBase, at http:microrna.sanger.ac.uk The content and use of the database is explained in the Griffiths- Jones et al. article.
  • the miRNA inhibitor sequences employed in the methods of the invention are exact antisense sequences of the mature miRNAs of Table 1, available at http://microrna.sanger.ac.ulc/sequences/.
  • the inhibitors are modified to have 2' Ome modifications and a 3' C3 containing amino linker (Angie M. Cheng, Mike W. Byrom, Jeffrey Shelton and Lance P. Ford* "Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis" Nucleic Acids Research 2005 33(4): 1290-1297. )
  • Inhibitors of the miR-21 and miR-24 miRNA' s are commercially available form Ambion under catalogue references AM10206 (miR-21) and AM10737 (miR-24).
  • the miRVana qRT- PCR miRNA detection kits and primer sets were used according to manufacturers instructions. In all cases SuperTaq (Ambion) was used for polymerisation reactions. Detection and normalisation was facilitated using SYBR green and ROX normalisation dyes (Invitrogen). Both RT and PCR reactions were carried out using an ABI 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA). Biological replicate results were checked for statistical significance using a students t-test with a p value cutoff of 0.05.
  • Primers were designed for cloning Cricetulus griseus miR-21 based on alignment of the corresponding genomic regions flanking the pre-miR-21 sequence from Mus musculus, Rattus norvigicus and Homo sapiens.
  • the primers used were 5'atgtttgctttgctttaaaccctgcctgagca3' and 5'ctgcaaaccatgatgctgggtaatgtttga3 ⁇
  • Genomic DNA was extracted from approx. 5x10 6 CHO-Kl cells (Whole blood extraction kit, Nucleon) and eluted in lOOul water. 1.5ul ( ⁇ 100ng) DNA was used as template for PCR.
  • the reaction also contained 40OnM of each primer, IuI DMSO and 20.5ul Platinum Supermix (Invitrogen). Cycling conditions were: 3min at 95 0 C, 30 cycles of 30sec at 94 0 C, 30sec at 53 0 C and 45sec at 72 0 C, followed by 7 mins at 72 0 C.
  • PCR product was checked on an agarose gel for a specific band of appropriate length (ca.220bp) and the remainder of the mix cleaned up (Qiagen PCR cleanup kit) for sequencing. Sequencing was performed on both strands using the cloning primers (MWG Biotech, Germany).
  • Suspension adapted CHO-Kl cells were seeded at 1x10 5 cells/ml in spinner flasks (supplier) and cultured for either 37 0 C for 6 days or for 3 days at 37 0 C followed by a temperature shift to 31 0 C for a further 3 days.
  • the cells that were temperature shifted immediately ceased logarithmic growth and did not exceed a peak viable cell density of 1.67 xlO 6 + 0.15 cells/ml whereas the cells cultured at 37 0 C continued in logarithmic growth for a further 24 hours and achieved average peak viable densities of 2.02 x 10 6 ⁇ 0.11 cells/ml.
  • Cells were sampled at 72 hours and 144 hours for RNA and protein extraction.
  • RNA bioarrays were probed with labelled Cricetus griseus RNA, the average percent present call was in the region of 27.3% ( ⁇ 4.8), this compares favourably with human cell line RNA which had an average present call of 26.9% ( ⁇ 5.7).
  • the average flourescence signal from arrays probed with CHO-Kl RNA was 306.4 ⁇ 55.2 Fluorescence Units which was comparable to the human cell data (296.6 ⁇ 71.5).
  • Unsupervised cluster analysis of the expression data revealed that CHO-Kl samples clustered as a discrete sub- cluster separate to six human cell lines included in the analysis as non- hamster controls (data not shown). Unsupervised clustering within the CHO- Kl samples resulted in separation of the exponential 37 0 C samples from those at stationary phase grown at 31 0 C ( Figure 3). Within the sub clusters it is clear that spinner samples 1 (TSd3A) & 5 (TSd6B) are outliers and it is likely an artefact of labelling and/or hybridisation due to overall lower median foreground readings and lower percent present calls associated with these arrays. This is an important quality control metric for subsequent analysis steps.
  • RNA from CHO-Kl cells cultured at 37 0 C for 144 hours was sampled at day 3 (37d3) 5 and day 6 (37d6) ( Figure Ib) and RNA from cells incorporating a temperature shift at day 3 (TSd3 & TSd6) was used for the qRT-PCR analysis of selected targets from the bioarray analysis.
  • TSd3 & TSd6 RNA from cells incorporating a temperature shift at day 3
  • the principle of the qRT-PCR reaction for miRNAs employs a proprietary RT-primer specific for the 3 ' end of a specific miRNA which is then extended to a micro-cDNA by an ArrayScriptTM enzyme during the RT-reaction step.
  • the qPCR step is carried out in-situ and uses a 5' miRNA specific primer and a 3' universal primer targeting universal 3' end of the original RT-primer ( Figure 4). Hence this is a highly specific means of amplifying individual mature miRNAs.
  • miRNA-21 a representative miRNA was selected (miR-21) for cloning and sequencing. As can be seen in Table 2 below, the mature miR-21 is conserved across all species for which sequence is available but the entire precursor sequence is completely identical to that of Rat.
  • the CHO sequence is identical to that of rno-miR-21 published in the Sanger miRNA repository (http://microrna.sanger.ac.ulc/scquences/).
  • MiRNA profiling of temperature shifted CHO-Kl cells at 144 hours of culture vs. exponentially growing CHO-Kl cells at 37 0 C identified 26 miRNAs as being significantly different (Table 1).
  • Overall profiling analysis of CHO-Kl RNA clearly demonstrated that Ambion bioarrays are suitable for CHO profiling based on percent present calls and median spot intensities.
  • CHO-Kl profiles were compared to 6 human cell lines, it was clearly observed that CHO-Kl are uniquely different in the profile of miRNAs they express.
  • qRT-PCR validation studies showd that miR-21 and miR-24 were found to be significantly upregulated in CHO-Kl cells at the end of the batch run in a non-temperature dependent manner.
  • the relative expression levels of the individual miRNAs identified on the bioarray were reflected by the qRT- PCR data, indicating a quantitative as well as qualitative aspect to the bioarray.
  • miR-21 and miR-24 are associated with growth inhibition.
  • Preliminary analysis in this laboratory has indicated that miR-21 levels are elevated in cells continuously cultured at 31 0 C and again this is associated with slow growth.
  • the Applicant has identified increased expression of a number of miRNAs in Chinese hamster ovary cells (CHO) upon cessation of proliferation either due to reduced temperature culture or through normal stationary phase growth resulting from nutrient limitation and waste product accumulation.
  • the Applicant proposes that the miRNA molecules of Table 1, and/or inhibitors of the miRNA molecules, may be employed to create the conditions, or augment existing conditions, necessary for the efficient growth and use of CHO cell culture, especially in the production of recombinant biopharmaceutical products.
  • CHO cell behaviour in culture is modified using synthetic miRNA precursor molecules miR-21 (Table 1) (Ambion Cat: 17100) which is introduced into CHO-Kl cells (LGSProtochem-atcc catalogue ref: CRL-9618-CHOK1 ) once sufficient biomass is achieved (usually at achieving about 80% of maximal viable cell density).
  • the purpose of this transfection is to inhibit growth without necessitating temperature shift and/or to enhance the beneficial effects of reducing culture temperature by transiently transfecting the specific miRNAs in Table I (alone or in combination) at the same time.
  • the transfection is mediated via conventional liposome based methods including NeoFx (Ambion Cat:4511). The methods used are according to manufacturers instructions.
  • CHO behaviour in culture is modified using synthetic miRNA coding sequences in expression vectors (Ambion Cat: 5775, 5777, 5779) (or linear expression molecules obtained from a PCR reaction or as a restriction fragment) which are introduced into cells once sufficient biomass is achieved.
  • expression vectors Ambion Cat: 5775, 5777, 5779
  • linear expression molecules obtained from a PCR reaction or as a restriction fragment which are introduced into cells once sufficient biomass is achieved.
  • These expression constructs contain at least the following components - a transcription promoter (constitutive or inducible, of viral, mammalian or other origin) and a sequence coding for an miRNA precursor molecule.
  • the pSILENCER expression cassette employed conatins a modified RNA pol II type CMV promoter and optimised SV40 polyadenylation signals to drive high level expression. This facilitates high expression in a broad range of cells.
  • transfection is to inhibit growth without necessitating temperature shift and/or to enhance the beneficial effects of reducing culture temperature by transfecting the specific miRNAs in Table I (alone or in combination) at the same time.
  • the transfection is mediated via conventional liposome based methods including Lipofectamine 2000 (Invirogen). The methods used are according to manufacturers instructions.
  • Novel CHO based cell lines are generated which have the coding sequences for the miR-21 or miR-24 miRNAs of Table I stably integrated in the cell genome under the control of the inducible promoter, MT.
  • This promoter is inactive until specific signals are received to activate the promoter (i.e. ZnSO 4 ) - once these signals are received then any coding sequences under the control of the promoter are transcribed.
  • the method involves subcloning the miRNA coding sequence from the commercially available expression systems (Ambion Cat: 5775, 5777, 5779) into an inducible system e.g. pCytTS (Cytos biotechnology).
  • an inducible system e.g. pCytTS (Cytos biotechnology).
  • Other possible expression systems are complete control® system (Stratagene) or pSUPERIOR (Oligoengine) (this may also be achieved by modifying the Ambion vectors to include inducible promoters).
  • These new expression systems are transfected into CHO cells using conventional liposome based transfection agents such as Lipofectamine 2000 (Invitrogen) according to manufacturers instructions. Following isolation of homogenous clonal populations using selection with an appropriate selective agent, the new cell lines are grown normally in exponential growth until the culture temperature is reduced.
  • the expression of the miRNA is induced by addition of ZnSO 4 at a level of 100 ⁇ M.
  • ZnSO 4 the temperature shift alone will result in enhanced growth arrest due to increased expression of growth inhibitory miRNAs (Table 1).
  • the promoter will be activated by addition or withdrawl of stimulatory/repressor molecules (e.g. tetracycline) to the culture broth.
  • stimulatory/repressor molecules e.g. tetracycline
  • Novel CHO based cell lines are created which have the inhibitor sequences targeting the miRNAs listed in Table 1 under the control of either a temperature inducible promoter or another variety of inducible promoter.
  • the methods will involve subcloning the miRNA inhibitor coding sequence from the commercially available expression systems (Ambion Cat: 5775, 5777, 5779) into an inducible system e.g. complete control® system (Stratagene) or pSUPERIOR (Oligoengine). (this may also be achieved by modifying the Ambion vectors to include inducible promoters).
  • These new expression systems will be transfected into CHO cells using conventional liposome based transfection agents such as Lipofectamine 2000 (Invitrogen).
  • the new cell lines will grow at accelerated rates during exponential growth at 37 C in the presence/absence of the inducer/repressor (e.g. tetracycline) until the culture temperature is reduced and the inducer is withdrawn/repressor is added. At this point the expression of the inhibitors will cease. Once the inhibitors are withdrawn this will allow expression of the specific miRNAs, growth inhibition and hence improved production.
  • the inducer/repressor e.g. tetracycline
  • MiRNAs act by preventing translation of specific proteins hence methods such as 2D gel electrophoresis can be uses to identify differentially expressed proteins following expression or inhibition of specific proteins and therefore the targets. This has the potential to facilitate rational design approaches to cell line engineering and to process design e.g. the inclusion of specific inhibitor molecules in medium formulations.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
PCT/IE2007/000078 2006-08-04 2007-08-03 A method of producing recombinant biological products Ceased WO2008015662A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US12/376,345 US8476244B2 (en) 2006-08-04 2007-08-03 Method of producing recombinant biological products
EP07789931.8A EP2046970B2 (en) 2006-08-04 2007-08-03 A method of producing recombinant biological products
JP2009522414A JP2009545309A (ja) 2006-08-04 2007-08-03 組換え型生物学的製剤を製造する方法
AU2007280004A AU2007280004A1 (en) 2006-08-04 2007-08-03 A method of producing recombinant biological products
CA002658301A CA2658301A1 (en) 2006-08-04 2007-08-03 A method of producing recombinant biological products

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IE20060587 2006-08-04
IES2006/0587 2006-08-04

Publications (2)

Publication Number Publication Date
WO2008015662A1 true WO2008015662A1 (en) 2008-02-07
WO2008015662A8 WO2008015662A8 (en) 2009-07-23

Family

ID=38720408

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IE2007/000078 Ceased WO2008015662A1 (en) 2006-08-04 2007-08-03 A method of producing recombinant biological products

Country Status (7)

Country Link
US (1) US8476244B2 (OSRAM)
EP (1) EP2046970B2 (OSRAM)
JP (1) JP2009545309A (OSRAM)
CN (1) CN101541972A (OSRAM)
AU (1) AU2007280004A1 (OSRAM)
CA (1) CA2658301A1 (OSRAM)
WO (1) WO2008015662A1 (OSRAM)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2520649A3 (en) * 2007-11-23 2013-02-20 Panagene, Inc. MicroRNA antisense PNAs, compositions comprising the same, and methods for using and evaluating the same
WO2013177062A2 (en) 2012-05-21 2013-11-28 Genentech, Inc. Methods for improving safety of blood-brain barrier transport
WO2013182553A3 (en) * 2012-06-06 2014-01-30 Boehringer Ingelheim International Gmbh CELL ENGINEERING USING RNAs
WO2014204405A1 (en) * 2013-06-18 2014-12-24 Agency For Science, Technology And Research Method for modulating recombinant protein production
WO2015018703A1 (en) * 2013-08-06 2015-02-12 Lonza Biologics Plc Means and methods for the generation of mammalian producer cells for the production of recombinant proteins
EP2971035A4 (en) * 2013-03-14 2016-11-09 Medimmune Llc RECOMBINED POLYPEPTIDE PRODUCTION
WO2019105747A1 (de) 2017-11-30 2019-06-06 Trumpf Laser Gmbh Scanspiegel, spiegelhalter und scanspiegel-einheit für ein laser-scansystem

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PL3063278T3 (pl) * 2013-11-01 2018-08-31 Sementis Limited Wytwarzanie wektora wirusowego

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005013901A2 (en) * 2003-07-31 2005-02-17 Isis Pharmaceuticals, Inc. Oligomeric compounds and compositions for use in modulation of small non-coding rnas
WO2006027776A1 (en) * 2004-09-07 2006-03-16 Yissum Research Development Company Of The Hebrew University Of Jerusalem Agents, compositions and methods for treating pathologies in which regulating an ache-associated biological pathway is beneficial

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20000006549A (ko) * 1998-06-30 2000-01-25 윤재승 생체내혈소판증식효능이향상된신규한트롬보포이에틴유도체
US8106180B2 (en) * 2003-08-07 2012-01-31 Whitehead Institute For Biomedical Research Methods and products for expression of micro RNAs
CA2857878A1 (en) † 2004-11-12 2006-12-28 Asuragen, Inc. Methods and compositions involving mirna and mirna inhibitor molecules
WO2006133022A2 (en) † 2005-06-03 2006-12-14 The Johns Hopkins University Compositions and methods for decreasing microrna expression for the treatment of neoplasia
EP2377559A1 (en) † 2005-06-03 2011-10-19 Southern Adelaide Health Service - Flinders Medical Centre Targeting cells with altered microRNA expression

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005013901A2 (en) * 2003-07-31 2005-02-17 Isis Pharmaceuticals, Inc. Oligomeric compounds and compositions for use in modulation of small non-coding rnas
WO2006027776A1 (en) * 2004-09-07 2006-03-16 Yissum Research Development Company Of The Hebrew University Of Jerusalem Agents, compositions and methods for treating pathologies in which regulating an ache-associated biological pathway is beneficial

Non-Patent Citations (37)

* Cited by examiner, † Cited by third party
Title
AI-FAGEEH, M.B.; MARCHANT, R.J.; CARDEN, M.J.; SMALES, C.M.: "The cold-shock response in cultured mammalian cells: harnessing the response for the improvement of recombinant protein production", BIOTECHNOL. BIOENG., vol. 93, 2006, pages 829 - 835, XP007912835, DOI: doi:10.1002/bit.20789
AMBROS, V.: "MicroRNA pathways in flies and worms: growth, death, fat, stress, and timing", CELL, vol. 113, 2003, pages 673 - 676
ANDERSEN DC; KRUMMEN L.: "Recombinant protein expression for therapeutic applications", CURR OPIN BIOTECHNOL., vol. 13, no. 2, 2002, pages 117 - 23, XP002436894, DOI: doi:10.1016/S0958-1669(02)00300-2
BAIK, J.Y.; LEE, M.S.; AN, S.R.; YOON, S.K.; JOO, E.J.; KIM, Y.H.; PARK, H.W.; LEE, G.M.: "Initial transcriptome and proteome analyses of low culture temperature-induced expression in CHO cells producing erythropoietin", BIOTECHNOL. BIOENG., vol. 93, 2006, pages 361 - 371, XP002470709, DOI: doi:10.1002/bit.20717
BOLLATI-FOGOLIN MARIELA ET AL: "Temperature reduction in cultures of hGM-CSF-expressing CHO cells: Effect on productivity and product quality", BIOTECHNOLOGY PROGRESS, vol. 21, no. 1, January 2005 (2005-01-01), pages 17 - 21, XP002461348, ISSN: 8756-7938 *
BRENNECKE, J.; HIPFNER, D.R.; STARK, A.; RUSSELL, R.B.; COHEN, S.M.: "Bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in drosophila", CELL, vol. 113, 2003, pages 25 - 36, XP001181836, DOI: doi:10.1016/S0092-8674(03)00231-9
BUTLER MICHAEL: "Animal cell cultures: recent achievements and perspectives in the production of biopharmaceuticals", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 68, no. 3, August 2005 (2005-08-01), pages 283 - 291, XP002457678, ISSN: 0175-7598 *
BUTLER, M.: "Animal cell cultures: recent achievements and perspectives in the production of biopharmaceuticals", APPL. MICROBIOL. BIOTECHNOL., vol. 68, no. 3, 2005, pages 283 - 291
CHAMPION, K.M.; ARNOTT, D.; HENZEL, W.J.; HERMES, S.; WEIKERT, S.; STULTS, J.; VANDERLAAN, M.; KRUMMEN, L.: "A two-dimensional protein map of Chinese hamster ovary cells", ELECTROPHORESIS, vol. 20, 1999, pages 994 - 1000, XP055085565, DOI: doi:10.1002/(SICI)1522-2683(19990101)20:4/5<994::AID-ELPS994>3.0.CO;2-N
CHANG, S.; JOHNSTON JR., R.J.; FROKJAER-JENSEN, C.; LOCKERY, S.; HOBERT, O.: "MicroRNAs act sequentially and asymmetrically to control chemosensory laterality in the nematode", NATURE, vol. 430, 2004, pages 785 - 789
CHEN, C.Z.; LI, L.; LODISH, H.F.; BARTEL, D.P.: "MicroRNAs modulate hematopoietic lineage differentiation", SCIENCE, vol. 303, 2004, pages 83 - 86, XP002605499
CHENG A M ET AL: "Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis", NUCLEIC ACIDS RESEARCH, vol. 33, no. 4, 1 March 2005 (2005-03-01), pages 1290 - 1297, XP002354612, ISSN: 0305-1048 *
CHENG, A.M.; BYROM, M.W.; SHELTON, J.; FORD, L.P.: "Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis", NUCLEIC ACIDS RES., vol. 33, 2005, pages 1290 - 1297
CHUPPA, S.; TSAI, Y.S.; YOON, S.; SHACKLEFORD, S.; ROZALES, C.; BHAT, R.; TSAY, G.; MATANGUIHAN, C.; KONSTANTINOV, K.; NAVEH, D.: "Fermenter temperature as a tool for control of high-density perfusion cultures of mammalian cells", BIOTECHNOL. BIOENG., vol. 55, 1997, pages 328 - 338, XP002155997, DOI: doi:10.1002/(SICI)1097-0290(19970720)55:2<328::AID-BIT10>3.0.CO;2-D
DANNO, S.; ITOH, K.; MATSUDA, T.; FUJITA, J.: "Decreased expression of mouse Rbm3, a cold-shock protein, in sertoli cells of cryptorchid testis", AM. J. PATHOL., vol. 156, 2000, pages 1685 - 1692, XP002486927
FOGOLIN, M.B.; FORNO, G.; NIMTZ, M.; CONRADT, H.S.; ETCHEVERRIGARAY, M.; KRATJE, R.: "Temperature reduction in cultures of hGM-CSF-expressing CHO cells: effect on productivity and product quality", BIOTECHNOL. PROGR., vol. 21, 2005, pages 17 - 21, XP002461348, DOI: doi:10.1021/bp049825t
FOGOLIN, M.B.; WAGNER, R.; ETCHEVERRIGARAY, M.; KRATJE, R.: "Impact of temperature reduction and expression of yeast pyruvate carboxylase on hGM-CSF-producing CHO cells", J. BIOTECHNOL., vol. 109, 2004, pages 179 - 191, XP002537212, DOI: doi:10.1016/J.JBIOTEC.2003.10.035
FOX, S.R.; PATEL, U.A.; YAP, M.G.; WANG, D.I.: "Maximizing interferon- gamma production by Chinese hamster ovary cells through temperature shift optimization: experimental and modelling", BIOTECHNOL. BIOENG., vol. 85, 2004, pages 177 - 184, XP002425198, DOI: doi:10.1002/bit.10861
FURUKAWA, K.; OHSUYE, K.: "Effect of culture temperature on a recombinant CHO cell line producing a C-terminal alpha-amidating enzyme", CYTOTECHNOLOGY, vol. 26, 1998, pages 153 - 164, XP019236530, DOI: doi:10.1023/A:1007934216507
FUSSENEGGER, M.: "The impact of mammalian gene regulation concepts on functional genomic research, metabolic engineering, and advanced gene therapies", BIOTECHNOL. PROG., vol. 17, 2001, pages 1 - 51, XP001121901, DOI: doi:10.1021/bp000129c
GAMMELL PATRICK ET AL: "Initial identification of low temperature and culture stage induction of miRNA expression in suspension CHO-K1 cells", JOURNAL OF BIOTECHNOLOGY, vol. 130, no. 3, June 2007 (2007-06-01), pages 213 - 218, XP002461349, ISSN: 0168-1656 *
GRIFFITHS-JONES S; GROCOCK RJ; VAN DONGEN S; BATEMAN A; ENRIGHT AJ.: "miRBase: microRNA sequences, targets and gene nomenclature", NUCLEIC ACIDS RES., vol. 34, 2006, pages D140 - 4
HENDRICK, V.; WINNEPENNINCKX, P.; ABDELKAFI, C.V.; VANDEPUTTE, O.; CHERLET, M.; MARIQUE, T.; RENEMANN, G.; LOA, A.; KRETZMER, G.;: "Increased productivity of recombinant tissular plasminogen activator (t-PA) by butyrate and shift of temperature: a cell cycle phases analysis", CYTOTECHNOLOGY, vol. 36, 2001, pages 71 - 83, XP019236697, DOI: doi:10.1023/A:1014088919546
KAUFMANN, H.; MAZUR, X.; FUSSENEGGER, M.; BAILEY, J.E.: "Influence of low temperature on productivity, proteome and protein phosphorylation of CHO cells", BIOTECHNOL. BIOENG., vol. 63, 1999, pages 573 - 582, XP002389455, DOI: doi:10.1002/(SICI)1097-0290(19990605)63:5<573::AID-BIT7>3.0.CO;2-Y
LEE, M.S.; KIM, K.W.; KIM, Y.H.; LEE, G.M.: "Proteome analysis of antibody-expressing CHO cells in response to hyperosmotic pressure", BIOTECHNOL. PROG., vol. 19, 2003, pages 1734 - 1741, XP002470710, DOI: doi:10.1021/bp034093a
LEE, R.C.; FEINBAUM, R.L.; AMBROS, V.: "The C.elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14", CELL, vol. 75, 1993, pages 843 - 854, XP024246130, DOI: doi:10.1016/0092-8674(93)90529-Y
LIM LP; GLASNER ME; YEKTA S; BURGE CB; BARTEL DP.: "Vertebrate microRNA genes", SCIENCE, vol. 299, no. 5612, 2003, pages 1540, XP002409653, DOI: doi:10.1126/science.1080372
MISKA EA; ALVAREZ-SAAVEDRA E; TOWNSEND M; YOSHII A; SESTAN N; RAKIC P; CONSTANTINE-PATON M; HORVITZ HR.: "Microarray analysis of microRNA expression in the developing mammalian brain", GENOME BIOL., vol. 5, no. 9, 2004, pages R68, XP021012927, DOI: doi:10.1186/gb-2004-5-9-r68
MOORE, A.; MERCER, J.; DUTINA, G.; DONAHUE, C.J.; BAUER, K.D.; MATHER, J.P.; ETCHEVERRY, T.; RYLL, T.: "Effects of temperature shift on cell cycle, apoptosis and nucleotide pools in CHO cell batch cultures", CYTOTECHNOLOGY, vol. 23, 1997, pages 47 - 54
NISHIYAMA, H.; HIGASHITSUJI, H.; YOKOI, H.; ITOH, K.; DANNO, S.; MATSUDA, T.; FUJITA, J.: "Cloning and characterization of human CIRP (cold-inducible RNA-binding protein) cDNA and chromosomal assignment of the gene", GENE, vol. 204, 1997, pages 115 - 120, XP004100701, DOI: doi:10.1016/S0378-1119(97)00530-1
PATRICK GAMMELL: "MicroRNAs: recently discovered key regulators of proliferation and apoptosis in animal cells; Identification of miRNAs regulating growth and survival", CYTOTECHNOLOGY, vol. 53, no. 1-3, 20 February 2007 (2007-02-20), pages 55 - 63, XP019499818, ISSN: 1573-0778 *
SONNA, L.A.; FUJITA, J.; GAFFIN, S.L.; LILLY, C.M.: "Effects of heat and cold stress on mammalian gene expression", J. APPL. PHYSIOL., vol. 92, 2002, pages 1725 - 1742, XP003009770
VAN DYK, D.D.; MISZTAL, D.R.; WILKINS, M.R.; MACKINTOSH, J.A.; POLJAK, A.; VARNAI, J.C.; TEBER, E.; WALSH, B.J.; GRAY, P.P.: "Identification of cellular changes associated with increased production of human growth hormone in a recombinant Chinese hamster ovary cell line", PROTEOMICS, vol. 3, 2003, pages 147 - 156
WONG, D.C.; WONG, K.T.; LEE, Y.Y.; MORIN, P.N.; HENG, C.K.; YAP, M.G.: "Transcriptional profiling of apoptotic pathways in batch and fed-batch CHO cell cultures", BIOTECHNOL. BIOENG., vol. 94, 2006, pages 373 - 382, XP002393428, DOI: doi:10.1002/bit.20872
XU, P.; VERNOOY, S.Y.; GUO, M.; HAY, B.A.: "The Drosophila microRNA Mir-14 suppresses cell death and is required for normal fat metabolism", CURR. BIOL., vol. 13, 2003, pages 790 - 795, XP002994326, DOI: doi:10.1016/S0960-9822(03)00250-1
YOON, S.K.; KIM, S.H.; LEE, G.M.: "Effect of low culture temperature on specific productivity and transcription level of anti-4-1BB antibody in recombinant Chinese hamster ovary cells", BIOTECHNOL. PROG., vol. 19, 2003, pages 1383 - 1386, XP002331693, DOI: doi:10.1021/bp034051m
YOON, S.K.; SONG, J.Y.; LEE, G.M.: "Effect of low culture temperature on specific productivity, transcription level, and heterogeneity of erythropoietin in Chinese hamster ovary cells", BIOTECHNOL. BIOENG., vol. 82, 2003, pages 289 - 298, XP055092889, DOI: doi:10.1002/bit.10566

Cited By (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2520649A3 (en) * 2007-11-23 2013-02-20 Panagene, Inc. MicroRNA antisense PNAs, compositions comprising the same, and methods for using and evaluating the same
WO2013177062A2 (en) 2012-05-21 2013-11-28 Genentech, Inc. Methods for improving safety of blood-brain barrier transport
EP3536789A1 (en) * 2012-06-06 2019-09-11 Boehringer Ingelheim International GmbH Cell engineering using rnas
WO2013182553A3 (en) * 2012-06-06 2014-01-30 Boehringer Ingelheim International Gmbh CELL ENGINEERING USING RNAs
US11230725B2 (en) 2012-06-06 2022-01-25 Boehringer Ingelheim International Gmbh Cell engineering using MICRORNAs
EP2971035A4 (en) * 2013-03-14 2016-11-09 Medimmune Llc RECOMBINED POLYPEPTIDE PRODUCTION
US10006026B2 (en) 2013-03-14 2018-06-26 Medimmune, Llc Recombinant polypeptide production
WO2014204405A1 (en) * 2013-06-18 2014-12-24 Agency For Science, Technology And Research Method for modulating recombinant protein production
TWI646194B (zh) * 2013-08-06 2019-01-01 龍沙生物股份有限公司 用於產生供製造重組蛋白之哺乳動物製造細胞之手段和方法
US10669541B2 (en) 2013-08-06 2020-06-02 Lonza Biologics Plc. Means and methods for the generation of mammalian producer cells for the production of recombinant proteins
WO2015018703A1 (en) * 2013-08-06 2015-02-12 Lonza Biologics Plc Means and methods for the generation of mammalian producer cells for the production of recombinant proteins
WO2019105747A1 (de) 2017-11-30 2019-06-06 Trumpf Laser Gmbh Scanspiegel, spiegelhalter und scanspiegel-einheit für ein laser-scansystem
DE102017128356A1 (de) 2017-11-30 2019-06-06 Trumpf Laser Gmbh Scanspiegel, Spiegelhalter und Scanspiegel-Einheit für ein Laser-Scansystem

Also Published As

Publication number Publication date
EP2046970A1 (en) 2009-04-15
US20100190258A1 (en) 2010-07-29
JP2009545309A (ja) 2009-12-24
WO2008015662A8 (en) 2009-07-23
US8476244B2 (en) 2013-07-02
EP2046970B2 (en) 2020-04-29
CA2658301A1 (en) 2008-02-07
AU2007280004A1 (en) 2008-02-07
EP2046970B1 (en) 2014-01-08
CN101541972A (zh) 2009-09-23

Similar Documents

Publication Publication Date Title
US8476244B2 (en) Method of producing recombinant biological products
JP5735927B2 (ja) タンパク質生産の増強のためのmRNAの一次構造の再操作
Barroso-delJesus et al. Embryonic stem cell-specific miR302-367 cluster: human gene structure and functional characterization of its core promoter
Meseguer et al. MicroRNAs-10a and-10b contribute to retinoic acid-induced differentiation of neuroblastoma cells and target the alternative splicing regulatory factor SFRS1 (SF2/ASF)
Listowski et al. microRNAs: fine tuning of erythropoiesis
Gammell et al. Initial identification of low temperature and culture stage induction of miRNA expression in suspension CHO-K1 cells
CN101215560B (zh) 一种具有抗白血病作用的miR-21反义寡核苷酸及其应用
WO2009002462A1 (en) Pre-mirna loop-modulated target regulation
AU2019252204A1 (en) Novel small activating RNA
CN106032532A (zh) 一种小激活rna及其制备方法和应用
Xiao et al. Role of microRNA-129-5p in osteoblast differentiation from bone marrow mesenchymal stem cells
Hayashi et al. Mesenchymal miR-21 regulates branching morphogenesis in murine submandibular gland in vitro
Park et al. Serum Response Factor–Dependent MicroRNAs Regulate Gastrointestinal Smooth Muscle Cell Phenotypes
Klanert et al. Endogenous microRNA clusters outperform chimeric sequence clusters in Chinese hamster ovary cells
Park et al. MicroRNA clustering on the biogenesis of suboptimal microRNAs
EP2240582B1 (en) Positive controls for expression modulating experiments
JP2016532445A (ja) 組換えタンパク質の生産のための哺乳動物生産細胞の生成のための手段及び方法
CN107760718B (zh) 绵羊cnksr2基因双荧光素酶报告基因载体及构建方法和应用
Yang et al. Expression analysis of miRNAs in BmN cells
CN103103189B (zh) 过表达单一MicroRNA成熟体序列的新方法
JP2015180203A (ja) タンパク質生産の増強のためのmRNAの一次構造の再操作
CN119177217B (zh) Parit1在促进干细胞多能性维持和重编程中的应用
WO2026074556A1 (en) Methods for rejuvenating human cells with micro rnas
Alizadeh et al. Mir-155 downregulation by miRCURY LNA™ microRNA inhibitor can increase alpha chain hemoglobins expression in erythroleukemic K562 cell line
WO2026074557A1 (en) Methods for rejuvenating human cells with transcription factors and micro rnas

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200780031874.1

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07789931

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2658301

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2007280004

Country of ref document: AU

Ref document number: 2007789931

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2009522414

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2007280004

Country of ref document: AU

Date of ref document: 20070803

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: RU

WWE Wipo information: entry into national phase

Ref document number: 12376345

Country of ref document: US