WO2008000028A1 - Porphyromonas gingivalis polypeptides useful in the prevention of periodontal disease - Google Patents

Porphyromonas gingivalis polypeptides useful in the prevention of periodontal disease Download PDF

Info

Publication number
WO2008000028A1
WO2008000028A1 PCT/AU2007/000890 AU2007000890W WO2008000028A1 WO 2008000028 A1 WO2008000028 A1 WO 2008000028A1 AU 2007000890 W AU2007000890 W AU 2007000890W WO 2008000028 A1 WO2008000028 A1 WO 2008000028A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
polypeptide
gingivalis
protein
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2007/000890
Other languages
English (en)
French (fr)
Other versions
WO2008000028A8 (en
Inventor
Stuart Geoffrey Dashper
Ching Seng Ang
Paul David Veith
Eric Charles Reynolds
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Melbourne
Oral Health Australia Pty Ltd
Original Assignee
University of Melbourne
Oral Health Australia Pty Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2006903425A external-priority patent/AU2006903425A0/en
Application filed by University of Melbourne, Oral Health Australia Pty Ltd filed Critical University of Melbourne
Priority to AU2007264402A priority Critical patent/AU2007264402B2/en
Priority to US12/306,495 priority patent/US20100092471A1/en
Priority to JP2009516822A priority patent/JP2009544279A/ja
Priority to CA002652957A priority patent/CA2652957A1/en
Priority to EP07719129A priority patent/EP2038297A4/en
Publication of WO2008000028A1 publication Critical patent/WO2008000028A1/en
Anticipated expiration legal-status Critical
Publication of WO2008000028A8 publication Critical patent/WO2008000028A8/en
Priority to US13/547,556 priority patent/US8916166B2/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • A61K39/0216Bacteriodetes, e.g. Bacteroides, Ornithobacter, Porphyromonas
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/164Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/02Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/195Assays involving biological materials from specific organisms or of a specific nature from bacteria
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/18Dental and oral disorders

Definitions

  • the present invention relates to compositions and methods of isolating Porphyromonas gingivalis (P. gingivalis) proteins useful in the prevention of and treatment of periodontal disease. More particularly, the invention is directed to vaccine compositions and methods based on P. gingivalis proteins identified to be regulated by haem availability that can be used in the prevention and treatment of periodontal disease.
  • P. gingivalis Porphyromonas gingivalis
  • Periodontal disease is a chronic bacterial infection that affects the gums and bone supporting the teeth. Periodontal disease begins when the bacteria in plaque (the sticky biofilm that constantly forms on teeth) causes the gums to become inflamed. Periodontal disease can affect the gingival tissue (gums); periodontal membrane (connective tissue embedded in the ceme ⁇ tum and alveolar bone); cemenlum (mineralized connective tissue covering the roots of the teeth); and the alveolar bone (bone socket). Depending on the progression of the disease, there may occur a destruction of periodontal membranes, alveolar hone loss, and apical migration of the connective tissue attachment.
  • Periodontal disease may result in the formation of periodontal pockets harbouring bacterial plaque, and progressive loosening and eventual loss of teeth.
  • Periodontal disease includes gingivitis that can advance to periodontitis.
  • Chronic periodontitis is an inflammatory disease of the supporting tissues of teeth iliac is associated with specific bacteria in subgingival dental plaque. The disease has been estimated to affect around 35% of dentate adults and is a major cause of tooth loss in the Western world (l> .
  • P. gingivalis a member of the normal oral microflora of subgingival dental plague, has been implicated as one of the major opportunistic pathogens in the progression of this disease ⁇ .
  • P. gingivalis is a black-plgmcntcd, asaccharolytic, Gram-negative anaerobic, cocco-bacillus, that relies on the fermentation of amino acids for enecgy production (3 l
  • P. gingivalia has an essential growth requirement for iron lhat it preferentially acquires in the form of haem, u molecule comprised of a protoporphyrin IX ring (PPIX) with a co-ordinated central ferrous atom (4) .
  • This utilization of haem. as an iron source may reflect the inability of P. gingivalis to synthesize PPIX de novo (5) .
  • Haem is preferentially obtained from haemoglobin, and is acquired through the activity of the cell-iurface Arg- and Lys-specific proteinase/adliesin complex ⁇ '* 1 ' 7 " 1 , possibly in conjunction with a TonB-linked outer membrane receptor, HmuR w .
  • Arg- and Lys-specific proteinase/adliesin complex ⁇ '* 1 ' 7 " 1 , possibly in conjunction with a TonB-linked outer membrane receptor, HmuR w .
  • Unlike aerobic or facultative bacteria that obtain iron using sidcropliores P. gingivalis does not produce siderophores and lacks the ferric reductase activity usually associated with siderophore-mediated iron acquisition ⁇ ' I0) .
  • gingivalis stores haem on its surface in the form of ⁇ -oxo bis-haern, which has inherent catalase activity that helps to protect the cell from oxidative attack* 1 ' ⁇
  • P. gingivalis to be able to compete with the large numbers and diversity of bacteria within the micronutrienl-limiting environment of the oral cavity ⁇ 12 "* it not only has to establish itself bul also has to evade or overcome numerous host defences.
  • compositions which would be useful in the prevention and treatment of periodontal disease it is desirable to identify agents that interfere and prevent the initial stages of the disease process.
  • the present inventors have now developed methods for identifying specific P. gingivalis proteins regulated by haem availability that can be used as suitable targets for the prevention and treatment of periodontal disease. SUMMARY OF THE INVENTION
  • the present inventors have successfully developed methods of identifying P. gingivalis proteins regulated by hacm availability that are responsible for P. gingivalis metabolism, virulence and invasion of host cells.
  • two specific internali ⁇ -Hke P. giugiva ⁇ s proteins namely PG0350, PG1374 involved in the internalization of P. gingivalis by host cells, a hypothetical protein, PG 1019 purported to be a cell surface lipoprotein and an. alkyl hydroperoxide reductase protein, PGO618 have been identified as useful targets for the prevention and treatment of periodontal disease.
  • a first aspect of the invention is an isolated antigenic P. gingivalis polypeptide, the polypeptide being selected from the group consisting of:
  • amino acid sequence comprising at least 10 amino acids identical to a contiguous amino acid sequence of SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4.
  • a second aspect of the invention is a vaccine composition for use in raising an immune response directed against P. gingivalis in a subject, the composition comprising an effective amount of at least one polypeptide of the first aspect of the invention and a pharmaceutically acceptable carrier.
  • a third aspect of the invention is a method of preventing or treating a subject for periodontal disease comprising administering to the subject a vaccine composition according to the present invention.
  • a fourth aspect of the invention is an antibody raised against a polypeptide of the first aspect of the present invention.
  • the antibody binds specifically to the polypeptides of the present invention.
  • a fifth aspect of the invention is a composition useful in the prevention or treatment of periodontal disease, the composition comprising an antibody of the fourth aspect of the present invention and a pharmaceutically acceptable carrier.
  • a method of identifying a P. gingivalis polypeptide involved in the progression of periodontal disease comprising the steps of:
  • step b) determining the relative amount of the polypeptide or peptide thereof produced by P. gingivalis grown under higher haem conditions than step a);
  • step a) wherein an increase in the amount of the polypeptide or peptide fragment thereof detected in step a) compared to step b) indicates lhat the polypeptide is involved in the progression of periodontal disease.
  • an interfering RNA molecule comprising a double stranded region of at least 19 base pairs in each strand wherein one of the strands of the double stranded region is complementary to a region of SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8.
  • Figure 1 shows a diagrammatic representation of the combined strategy used to identify proteins from P. gingivalis grown under huem-limitation.
  • the lysed cells were prefractionated into soluble a ⁇ d insoluble fractions using ultra-centrifugation, followed by analysis of these two fractions.
  • the separation and analysis procedure consists of two main methods; LCMS with gas phase fractionation and geLCMS.
  • Figure 2 shows a graph indicating the codon adaptation index (CAl) distribution of the identified P. gingivalis proteome and the predicted P. gingivalis genome calculated using INCA tl4) .
  • CAl codon adaptation index
  • Figure 3 shows the analysis and identification of PG0390 based on detection of a single peptide
  • A Total ion chromatogram.
  • B Mass spectrum at 54.8min, insert showing an cmlarged ICAT peptide ion pair at 703.9 and 708.4 m/z of ratio 1 :2 (LJH),
  • Figure 4 shows the distribution of protein abundance " based on ratio of haem- limitation over hacm-excess (every one unit on the Log2 scale indicates a two fold change).
  • Figure 6 shows the amino acid sequence of PG0350 protein (referred to as SEQ TD NO: I as also indicated in the sequence listing).
  • Figure 7 shows the amino acid sequence of PG1374 protein (referred to as SRQ ID NO:2 as also indicated in the sequence listing).
  • Figure 8 shows the amino acid sequence of PG1019 protein (referred to as SEQ TD NO:3 as also indicated in the sequence listing).
  • Figure 9 shows the amino acid sequence of PG0618 protein (referred to as SEQ ID NO:4 as also indicated in the sequence listing).
  • the present invention advantageously provides the identification of P. gingivalis proteins regulated by haem availability as useful targets for the prevention and treatment of periodontal disease.
  • the invention provides the identification of P. gingivalis proteins upregulated by hacm-limitation as useful targets for the prevention and treatment of periodontal disease.
  • the invention provides an isolated antigenic P. gingivalis polypeptide, the polypeptide being .selected from the group consisting of:
  • amino acid sequence comprising at least 10 amino acids identical to a contiguous amino acid sequence of SEQ ID NO: 1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4.
  • the isolated antigenic polypeptide is 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to flic amino acid sequence of SEQ ID NO: 1 or SEQ ID NO:2 or SEQ ID NO:3 or SEQ ID NO:4.
  • the isolated antigenic polypeptide comprises an amino acid sequence comprising at least 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids identical to a contiguous amino acid sequence of SEQ ID NO:1 or SEQ ID NO;2 or SEQ ID NO;3 or SEQ ID NO:4.
  • the antigenic polypeptides comprise amino acid sequences that compose the hydrophilic, surface-exposed regions of the PG1374 or PGO35O or PG1019 or PGO618 protein.
  • polypeptides, proteins, and polypeptides arc used interchangeably herein.
  • the polypeptides of the present invention can include recombinant polypeptides such as fusion polypeptides. Methods for the production of a fusion polypeptide are well-known to those skilled in the art.
  • alterations may be made to the amino acid sequences set out in the Sequence Listings. These alterations may be deletions, insertions, or substitutions of amino acid residues.
  • the altered polypeptides can be either naturally occurring (that is to say, purified or isolated from a natural source) or synthetic (for example, by site-directed metagenesis on the encoding DNA). Tt is intended that such altered polypeptides which have at least 85%, preferably at least 90%, 95%, 96%, 97%, .98% or 99% identity with the sequences set out in the Sequence Listing are within the scope of the present invention. Antibodies raised against these altered polypeptides will also bind to the polypeptides having one of the sequences set out in the Sequence Listings.
  • isolated polypeptide refers to a polypeptide that has been separated from other proteins, lipids, and nucleic acids with which it naturally occurs or the polypeptide or peptide may be synthetically synlhesised.
  • the polypeptide is also separated from substances, for example, antibodies or gel matrix, for example, polyacrylamide, which are used to purify it.
  • the polypeptide constitutes al least 10%, 20%, 50%, 70%, and 80% of dry weight of the purified preparation.
  • the preparation contains a sufficient amount of polypeptide to allow for proLein sequencing (i.e. at least 1, 10, or 100 mg).
  • the isolated polypeptides described herein may be purified by standard techniques, such as column chromatography (using various matrices which interact with the protein products, • such as ion exchange matrices, hydrophobic matrices and the like), affinity chromatography utilizing antibodies specific for the protein or other ligands which bind to die protein.
  • an "antigenic polypeptide” used herein is a moiety, such as a polypeptide, analog or fragment thereof, that is capable of binding to a specific antibody with sufficiently high affinity to form a detectable antigen-antibody complex.
  • the antigenic polypeptide comprises an immunogenic component that is capable of eliciting a humoral and/or cellular immune response in a host animal.
  • a “contiguous amino acid sequence" as used herein refers to a continuous stretch of amino acids.
  • amino acid sequence identities or similarities may be calculated using the GAP programme and/or aligned using the PILEUP programme of the Computer Genetics Group, Inc., University Research Park, Madison, Wisconsin, United States oC America (20) .
  • the GAP programme utilizes the algorithm of Needleman and Wunsch (2!> to maximise the number of identical/similar residues and to minimise the number and length of sequence gaps in the alignment.
  • the Clustal W is used.
  • the present invention also provides a vaccine composition for use in raising an immune response directed against P, gingivalis in a subject, the composition comprising an effective amount of at least one polypeptide of the first aspect of the invention and a pharmaceutically acceptable carrier.
  • the vaccine composition of the present invention preferably comprises an antigenic polypeptide that comprises at least one antigen that can be used to confer immunity against P. gingivalis.
  • the subject treated by the method of the invention may be selected from, but is not limited to, the group consisting of humans, sheep, cattle, horses, bovine, pjgs, poultry, dogs and cats.
  • the subject is a human.
  • An immune response directed against P. gingivatis is achieved in a subject, when the subject's immune system produces antibodies against the specific antigenic polypeptides.
  • the vaccine composition is preferably administered to a subject to induce immunity to P. gingivals and thereby prevent periodontal disease.
  • the terra "effective amount" as used herein means a dose sufficient to elicit an immune respados against P. gingivalis. This will vary depending on the subject and the level of P. gingival is infection and ultimately will be decided by the attending scientist, physician or veterinarian.
  • the vaccine composition of the present Invention comprises a suitable pharmaceutically- acceptable carrier, such as diluent and/ or adjuvant suitable for administration to a human or animal subject.
  • the vaccine preferably comprises a suitable adjuvant for delivery orally by nasal spray, or by injection to produce a specific immune response against P. gingivctlis.
  • a vaccine of the present invention can also be based upon a recombinant nucleic acid sequence encoding an antigenic polypeptide of the present invention, wherein the ⁇ ucieic acid sequence is incorporated i ⁇ lo an appropriate vector and expressed in a suitable transformed host (e.g. E.
  • the vaccine can be produced using recombinant DNA methods as illustrated herein, or can be synthesized chemically from the amino acid sequence described in the present invention. Additionally, according to the present invention, the antigenic polypeptides may be used to generate P. gingivalis antisera useful for passive immunization against periodontal disease and infections caused by P. gingivalis.
  • adjuvants known those skilled in the art are commonly used in conjunction with vaccine Formulations.
  • the adjuvants aid by modulating the immune response and in attaining a more durable and higher level of immunity using smaller amounts of vaccine antigen or fewer doses than if the vaccine antigen were administered alone.
  • adjuvants include incomplete Frcunds adjuvant (IFA), Adjuvant 65 (containing peanut oil, marrnide monooleate and aluminium monostrearate), oil emulsions, Ribi adjuvant, the pluronic polyols, polyamines, Avridine, Quil A, saponin, MPL, QS-21, and mineral gels such as aluminium salts.
  • the vaccine may include conventional pharmaceutically acceptable carriers, cxcipicnts, fillers, buffers or diluents as appropriate.
  • One or more doses of the vaccine containing adjuvant may be administered prophylactically to prevent periodontal disease or therapeutically to treat already present periodontal disease.
  • the preparation is combined with a mucosal adjuvant and administered via the oral or nasal rouLe.
  • mucosal adjuvants are cholera toxin and heat labile E. colt toxin, the non-toxic B sub-units of these toxins, genetic mutants of these toxins which have reduced toxicity.
  • Other methods which may be utilised to deliver the antigenic polypeptides orally or nasally include incorporation of the polypeptides into particles of biodegradable polymers (such as acrylates or polyesters) by microencapsulation to aid uptake of the microspheres from the gastrointestinal tract or nasal cavity and to protect degradation of the proteins.
  • Liposomes, ISCOMs, hydrogels are examples of other potential methods which may be further enhanced by the incorporation of targeting molecules such as LTB, CTB or lectins (manna ⁇ , chitin, and chitosan) for delivery of the antigenic polypeptides to the mucosal immune system.
  • targeting molecules such as LTB, CTB or lectins (manna ⁇ , chitin, and chitosan)
  • the vaccine may include conventional pharmaceutically acceptable carriers, excipients, fillers, coatings, dispersion media, antibacterial and antifungal agents, buffers or diluents as appropriate.
  • Another mode of this embodiment provides for either, a live recombinant viral vaccine, recombinant bacterial vaccine, recombinant attenuated bacterial vaccine, or an i ⁇ activaLed recombinant viral vaccine which is used to protect against infections caused by P. gingivalis.
  • Vaccinia virus is the best known example, in the art, of an infectious virtus that is engineered to express vaccine antigens derived from other organisms.
  • the recombinant live vaccinia virus which is attenuated or otherwise treated so that it does not caused disease by itself, is used to immunise the host. Subsequent replication of the recombinant virus within the host provides a continual stimulation of the immune system with the vaccine antigens such as the antigenic polypeptides, thereby providing long lasting immunity.
  • live vaccine vectors include: adenovirus, cytomegalovirus, and preferably the poxviruses such as vaccinia (M) and attenuated salmonella strai ⁇ s (2S"2ii) .
  • Live vaccines are particularly advantageous because they continually stimulate the immune system which can confer substantially long-lasting immunity.
  • the live vaccine itself may be used in a protective vaccine against P. glngivalis.
  • the live vaccine can be based on a bacterium that is a commensal inhabitant of the oral cavity.
  • This bacterium can be transformed with a vector carrying a recombinant inactivated polypeptide and then used to colonise the oral cavity, in particular the oral mucosa. Once colonised the oral mucosa, the expression of the recombinant protein will stimulate the mucosal associated lymphoid tissue to produce neutralising antibodies.
  • the genes encoding the polypeptides may be inserted into the vaccinia virus genomic DNA at a site which allows for expression of epitopes but does not negatively affect the growth or replication of the vaccinia virus vector.
  • the resultant recombinant virus can be used as the im ⁇ iunogen in a vaccine formulation.
  • immunisation may be passive, i.e. immunisation comprising administration of purified immunoglobulin containing an antibody against a polypeptide of the present invention.
  • the antigenic polypeptides used in the methods and compositions of the present invention may be combined with suitable cxcipicnts, such as cmulsificrs, surfactants, stabilisers, dyes, penetration enhancers, anti-oxidants, water, salt solutions, alcohols, polyethylene glycols, gelatine, lactose, magnesium steratc and silicic acid.
  • suitable cxcipicnts such as cmulsificrs, surfactants, stabilisers, dyes, penetration enhancers, anti-oxidants, water, salt solutions, alcohols, polyethylene glycols, gelatine, lactose, magnesium steratc and silicic acid.
  • the antigenic polypeptides are preferably formulated as a sterile aqueous solution.
  • the vaccine compositions of the present invention may be used to complement existing treatments for periodontal disease.
  • a third aspect of the invention is a method of preventing or treating a subject for periodontal disease comprising administering to the subject a vaccine composition according to the present invention.
  • Periodontal diseases range from simple gum inflammation to serious disease that results in major damage to the soft tissue and bone that support the teeth.
  • Periodontal disease includes gingivitis and periodontitis.
  • Bacteria, mainly Gmm-negative species including P. gingivalis cause inflammation of the gums that is called "gingivitis.” In gingivitis, the gums become red, swollen and can bleed easily. When gingivitis is not treated, it can advance to "periodontitis" (which means "inflammation around the tooth.”), Tn periodontitis, gums pull away from the teeth and form “pockets" that are infected.
  • the body's immune system fights the bacteria as the plaque spreads and grows below the gum line. Jf not treated, the hones, gums, and connective tissue that support the teeth are destroyed. The teeth may eventually become loose and have to be removed.
  • a fourth aspect of the invention is an antibody raised against a polypeptide of the first aspect of the present invention.
  • the antibody is specifically directed against the polypeptides of the present invention.
  • antibody is used in the broadest sense and specif ically covers monoclonal antibodies, polyclonal antibodies, multispecifie antibodies (e.g., bispecific antibodies), chimeric antibodies, diabodics, triabodies and antibody fragments.
  • the antibodies of the present invention are preferably able to specifically bind to an antigenic polypeptide as hereinbefore described without cross-reacting with antigens of other polypeptides.
  • binding specifically to is intended to refer to the binding of an antigen by an immunoglobulin variable region of an antibody with a dissociation constant
  • the affinity or dissociation constant (Kd) for a specific binding interaction is preferably about 500 nM to about 50 pM, more preferably about 500 nM or lower, more preferably about 300 nM or lower and preferably at least about 300 nM to about 50 pM, about 200 nM to about 50 pM, and more preferably at least about 100 nM to about 50 pM, about 75 nM to about 50 pM, about 10 nM to about 50 pM.
  • binding fragments of an antibody include (I) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHl domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CIIl domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody; (v) a dAb fragment which consists of a VH domain, or a VL domain ; and (vi) an isolated complementarity determining region (CDR).
  • a Fab fragment a monovalent fragment consisting of the VL, VH, CL and CHl domains
  • F(ab')2 fragment a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region
  • a Fd fragment consisting of the VH and CI
  • the two domains of the Fv fragment, VL and VH are coded by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain hi which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv),
  • scFv single chain Fv
  • Other forms of single chain antibodies, such as diabodies or triabodies are also encompassed.
  • Diabodies are bivalent, bispecific antibodies in which VH and VL domains are expressed on a single polypeptide chain, but using a linker that h too short to allow for pairing between the two domains on the same chain, thereby forcing the domains to pair with complementary domains of another chain and creating two antigen binding sites.
  • Antibodies and antibody fragments may be produced in large amounts by standard techniques (eg in either tissue culture or serum free using a fermenler) and purified using affinity columns such as protein A (e.g. for murine Mabs), Protein G (eg for rat Mabs) or MTEP HYPERCEL (eg for IgM and IgG Mabs).
  • protein A e.g. for murine Mabs
  • Protein G e.g for rat Mabs
  • MTEP HYPERCEL eg for IgM and IgG Mabs.
  • Humanized antibodies may be prepared according to procedures in the literature ⁇ " ' ⁇
  • the recently described "gene conversion metagenesis" strategy for the production of humanized monoclonal antibody may also be employed in the production of humanized antibodics (31) .
  • techniques for generating the recombinant phase library of random combinations of heavy and light regions may be used to prepare recombinant antibodies (32) .
  • the present invention also provides a composition useful in the prevention or treatment of periodontal disease, the composition comprising an antagonist of a P. gingivalis polypeptide of the first aspect of the present invention and a pharmaceutically acceptable carrier, wherein the antagonist inhibits P. gingivalis infection.
  • the term "antagonist” refers to a nucleic acid, peptide, antibody, ligands or other chemical entity which inhibits die biological activity of (he polypeptide of interest.
  • a person skilled in the art would be familiar with techniques of testing and selecting suitable antagonists of a specific protein, such techniques would including binding assays.
  • Possible antagonists of PGO35O, PG1374, PG1019 and PG0618 are preferably antibodies, cither monoclonal or polyclonal, which will inhibit the binding of these proteins to host cells or other substrates or they may be proteins or peptides that interfere with the binding of these proteins.
  • the antibodies and antagonists of the present invention have a number of applications, for example, (hey can be used as antimicrobial preservatives, in oral care products (toothpastes and mouth rinses) for the control of dental plaque and suppression of pathogens associated with dental caries and periodontal diseases.
  • the antibodies and antagonists of the present ⁇ invention may also be used in pharmaceutical preparations (eg, topical and systemic anti infective medicines).
  • Ia a sixth aspect of the present invention there is provided a method of identifying a P. gingivalis polypeptide involved in the progression of periodontal disease, wherein the method comprises the steps of:
  • step b) determining the relative amount of the polypeptide or peptide thereof produced by P. gingivalis grown under higher haem conditions than step a); wherein an increase in lhe amount of the polypeptide or peptide fragment thereof detected in step a) compared to step b) indicates thai the polypeptide is involved in the progression of periodontal disease.
  • thai lhe concentration of hacmin is about 0.1 ⁇ g/ml to about 0.5 ⁇ g/mL
  • Haem limiting conditions are achieved when the cell density of the P. gingivalis cells is signifieanLly lower than that observed under Lhe growth conditions of step (b) of the method of the invention.
  • the higher haem conditions of step (b) is preferably achieved using a concentration of haemm of above 5 ⁇ g/ml.
  • a comparison of the relative amounts of a polypeptide in the haem limited and higher haem conditions can be preferably determined by ⁇ ising a differential protcomie approach.
  • the amount of a polypeptide is determined by qualitative pr ⁇ teomic analysis commonly used in the art, such as but not limited to, a combined strategy of in-solulion and in-gel digestion and LC-MS/MS, analysis using stable isotope labelling strategies (ICAT) in combination with MS .
  • ICAT stable isotope labelling strategies
  • the isolated antigenic P, gingivals polypeptides identified according to the method defined in the sixth aspect of the invention can be used as targets for treating and preventing periodontal disease, in particular, the isolated polypeptides can be used to develop vaccine compositions against P. gingivalvi, for instance P. gingivalis infection, such as periodontal disease.
  • the present invention also provides interfering RNA molecules which are targeted against the mRNA molecules encoding the polypeptides of the first aspect of the present invention. Accordingly, in a seventh aspect of the present invention there is provided an interfering RNA molecule, the molecule comprising a double stranded region of at least 19 base pairs in each strand wherein one of the strands of the double stranded region is complementary to a region of SEQ ID NO: 5 or SEQ JD NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8.
  • RNA interference So called RNA interference or RNAi is well known and further infoitnation regarding RNAi is provided in Harmon (2002) Nature 418: 244-251, and McManus & Sharp (2002) Nature Reviews: Genetics 3(10); 737-747, the disclosures of which are incorporated herein by reference.
  • the present invention also contemplates chemical modification(s) of siRN ' As that enhance siRNA stability and support their use in vivo (see for example, Shea et al. (2006) Gene Therapy 13: 225-234). These modifications might include inverted abasic moieties at ihe 5' and 3' end of the sense strand oligonucleotide, and a single phosphorthioate linkage between the last two nucleotides at the 3' end of the antisense strand.
  • the double stranded region, of the interfering RNA comprises at least 20, preferably at least 25, and most, preferably at leasl 30 base pairs in each strand of the double stranded region.
  • the present invention also provides a method of treating a subject for periodontal disease comprising administering to the subject at least one of the interfering RNA molecules of the invention.
  • P. gingivals W50 (ATCC 53978) was obtained from the culture collection of the Centre for Oral Health Science, The University of Melbourne. Chemicals used were ultra high purity except for MS work where LC MS grade reagents were used (Sigma, Reidel-de Hacn).
  • P. gingivalis W50 was grown in continuous culture using a Bioflo 1 ⁇ O fermcntcr/bioreactor (New Brunswick Scientific) with a 400 mL working volume.
  • the growth medium was 37 g/mL brain heart infusion medium (Oxoid) supplemented with 5 mg/mL filler sterilized cysteine hydrochloride, 5.0 ⁇ g/rnL haemin (haem-excess) or 0.1 ⁇ g/m ' L haemin (hacm- limitcd). Growth was initiated by inoculating the culture vessel with a 24 h batch culture (100 mL) of P. gingivalis grown in the same medium (haem-excess).
  • the medium reservoir pump was turned on arid ihe medium flow adjusted to give a dilution rate of 0.1 h "1 (mean generation time (MGT) of 6.9 h).
  • MCT mean generation time
  • the temperature of the vessel was maintained at ' 37°C and the pH at IA + 0.1.
  • the culture was continuously gassed with S 5% COa in 95% N2.
  • CcUs were harvested during steady stale growth, washed three times with wash buffer (50 mM Tris-HCl pH 8.0, 150 roM NaCl, 5 mM MgCl*) at 5000 g for 30 min and disrupted with 3 passes through a French Pressure Cell (SLM, AMINCO) at 138 MPa, The lysed cells were then ccntrifugcd at 2000 g for 30 min to remove unbroken cells followed by ultracenlrifugation at 100000 g, producing a soluble (supernatant) and membrane0 fraction. All fractions were carried out on ice.
  • wash buffer 50 mM Tris-HCl pH 8.0, 150 roM NaCl, 5 mM MgCl*
  • SLM French Pressure Cell
  • Non-quantitative proteome analysis was carried out using iwo methods, in-solutio ⁇ digestion wilh trypsin followed by LCMS with gas phase fractionation (GPF) and in-gcl digestion followed by LCMS (geLC-MS) as part of a combined strategy (Figure 1).
  • protein was boiled at 95°C for 3 min, precipitated with TCA (16%) and resuspended in solubilization buffer (8 M Urea, 50 mM Tris-HCl pH 8.3, 5 mM EDTA, 0.05% SDS). Protein concentration was determined with a BCA protein reagent (Pierce) and adjusted to 2 ⁇ g/ ⁇ L.
  • Reduction was carried out with 1 mM DTT for 30 min and alkylation using 10 mM iodoacetamide for 60 min.
  • the solution was diluted with water to a final0 concentration of 1 M urea before digestion.
  • Digestion was carried out using sequencing- grade modified trypsin (Promega) at a ratio of 1 : 100 w/w trypsin to protein at 37 0 C for 16 h. The digestion was terminated by formic acid addition to a final concentration of 1 % v/v.
  • Peptides were ihen desalted using Sep-Pak Cl 8 cartridges (Waters), dried using a vacuum centrifuge (Thermos horr) and resuspended in 5% acetonitrile in 0.1 % TFA. An amount of peptide equivalent to 2 ⁇ g was injected for each LC-MS/MS analysis.
  • the reduction solution was then replaced with 55 mM of iodoacetamide in 25 niM ABC and incubated for 45 min.
  • the gel cubes were washed twice in 50 mM ABC and dehydrated with. 100% ethanol.
  • Thirty ⁇ L of modified sequencing-grade trypsin at a concentration of 5 ⁇ g/mL in 25 mM ABC buffer and 1 mM CaCl 2 was added and incubated at 4 U C for 30 min. Excess trypsin solution was removed and 15 ⁇ L of 25 mM ABC buffer was added. Digestion was carried out overnight at 37°C and terminated by TFA addition to a final concentration of 0.1 % v/v. The supernatant was then transferred to an eppendorf tube.
  • Protein labelling and separation were based on the gcLC-MS/MS approach 1 '" 5 using the cleavablc ICAT reagent (Applied Biosysterns). Protein was first precipitated using TCA (16%) and solubilised with 6 M urea, 5 mM EDTA, 0,05% SDS and 50 mM Tris-HCl pH 8.3, Protein concentration was determined using the BCA protein reagent and adjusted t ⁇ 1 mg/ml. 100 ⁇ g of protein from each growth condition was individually reduced using 2 ⁇ L of 50 mM Tris(2-carboxy-ethyl)phosphine hydrochloride for 1 h at 37 U C.
  • Reduced protein from the haem-limitation growth condition was then alkylated with the lCAT h eavy reagent aud protein from hacm-cxcess growth condition with the ICAT
  • the two samples were then combined and subjected to SDS-PAGE on a precast Novex 10% NUPAGE gel (Invitrogen).
  • the gel was stained for 5 min using Simply Blue SafeStain (Tnvitroge ⁇ ) followed by destai ⁇ ing with water.
  • the gel lane was then excised into 20 sections from the top of the gel to the dye front.
  • the excised sections were further diced into 1 mm 3 cubes and in-gcl digested overnight and extracted twice according to the above procedure.
  • the pooled supernatant was dried under reduced vacuum to about 50 ⁇ L followed by mixing with 500 ⁇ L of affinity load buffer before loading onto the affinity column as per manufacturer's instruction (Applied Biosysterns).
  • Elutcd peptides were dried and the biotin tag cleaved with neat TFA at 37"C for 2 Ii followed by drying under reduced vacuum.
  • the dried samples were suspended in 35 ⁇ L of 5% acetonitrile in 0.1% TFA.
  • MS was carried out using an Esquire HCT ion trap mass spectrometer (Bruker Daltonics) coupled to an UltiMatc Na ⁇ o LC system (LC Packings — Dionex). Separation was achieved using a LC Packings reversed phase column (C18 PepMaplOO, 75 ⁇ m i.d. x 15 cm, 3 ⁇ m, 100 A), and clutcd in 0.1% formic acid with the following acetonitrile gradient: 0-5 mi ⁇ (0%), 5-10 mi ⁇ (0-10%), 10-100 min (10-50%), 100-120 rnin (50-80%), 120-130 rain (80-100%).
  • the LC output was directly interfaced to the nanospray ion source.
  • MS acquisitions were performed under an ion charge control of 100000 in the m/z range of 300-1500 with maximum accumulation lime of 100 ms.
  • GPF three additional m/z ranges (300- 800, 700-1200 aud 1100-1500) were used to select for precursor ions and each m/z tangc was carried out in duplicate to increase the number of peptides identified.
  • MS/MS acquisition was obtained over a mass range from 100-3000 m/z and was performed on up to 10 precursors for initial complete protcorne analysis and 3 for IC ⁇ T analysis for the most, intense multiply charged ions with ail active exclusion time of 2 min.
  • a global charge limitation of +2 and +3 were set for exported data.
  • Protein identification was achieved using the MASCOT search engine (MASCOT 2.1.02, Matrix Science) on MS/MS data queried against the P. gingivalis database obtained from The Institute for Genomic Research (TIGR) website (www.tigr.org).
  • peptides with a probability based Mowse score corresponding to a p- value of at most 0.05 were regarded as positively identified, where the score is -log X 10(log(P)) and P is the probability that the observed match is a random event ii) where only one peptide was used in the identification of a specific protein and the MASCOT score was below 30, manual verification of the spectra was performed.
  • peptides with a probability based Mowse score corresponding to a p- value of at most 0.05 were regarded as positively identified, where the score is -log X 10(log(P)) and P is the probability that the observed match is a random event ii) where only one peptide was used in the identification of a specific protein and the MASCOT score was below 30, manual verification of the spectra was performed.
  • the ratio of isotopicaliy heavy 13 C to light ' 2 C ICAT labelled peptides was determined using a. script from DataAnalysis (Ekuker Daltonics) and verified manually based on measurement of tiic inonoisotopic peak intensity (signal intensity and peak area) in a single MS spectrum.
  • the mininum ion count of parent, ions used for quantification was 2000 although >%% of bom heavy and light precursor ions were >10000.
  • P. gingivalis W50 Open Reading Frame PG1374 potentially encodes an immunorcactivc 47 KDa antigen (PG97) based on the P. gingvalis W83 genome (www.tigr.org).
  • PG97 immunorcactivc 47 KDa antigen
  • restriction sites (underlined) was generated from the W50 genomic DNA by PCR with primers ECR312ApaI-For (5'- AG AGGGCCCTAGC AATCATTGC ATTGCT - 3') and ECR312Aat ⁇ -Rev (5' - TGCGACGTCGTGTTACCAATAGAGGATT - 3'), This fragment was cloned into Aatll and BamHI sites on pAL30, pGem ® T-easy (Promcga) containing a subdoned erniF cassette ⁇ to create pAL36.
  • an antibiotic protection assay was carried out as described previously in a 24-well cell culture Briefly, a fixed number of P. gingivalis cells were allowed to invade _ ⁇ KB monolayer (-10 3 cells in each well). Non invaded or adhered cells were killed by further incubaiio ⁇ for 1 h with gentamicin (300 ⁇ g/mL) and metronidazole (200 ⁇ g/mL), Colony forming units of invaded bacteria were then enumerated on horse blood agar plates.
  • the cell binding assay was carried out as described previously 1 - 405 . Briefly, P. gingivalis was first grown to mid log phase to a cell density of ⁇ 2.9 x 10 9 celLs/mL. The cells were then washed followed by labelling with 500 ⁇ g of fluorescein isothiocyanatc (FITC) (Invitrogen) resuspended in 500 ⁇ L DMSO followed by incubation al 37 U C for 45 rnin with shaking. After incubation, the cells were further washed, resuspended in incomplete Earl's minimum essential medium (JRH Bio.sciences) and the P.
  • FITC fluorescein isothiocyanatc
  • gingivulLs cells adjusted based on cell counts using a F ⁇ CSCaliber flow cytometer (Bccton Dickinson.San Jose, CA).
  • the green emission of FITC was measured with a 525-nm filter (FLl).
  • the mulliparametric data were analyzed using CcllQuest software (Becton Dickinson, San Jose, CA). All measurements were done in duplicate, and for quantitation of FITC fluorescence, mean fluorescence intensity (MFI) values were used.
  • Binding of the wild type P. gingivalis and ECR312 was carried out in parallel by inoculating 200 ⁇ L of cell suspension onto the KB cells al 5% CO 2 atmosphere at 37 0 C fur 40 mi ⁇ . Following incubation the supernatant containing the KB cells and bacteria were transferred to a 1.5 mL lube. The remaining bound cells were then detached off the well with 200 ⁇ L of Trypsin-EDTA mixture (JRH Bioscience) for 5 rnin at 37 0 C and pooled with the corresponding collected supcmatants. 500 ⁇ L of complete EMEM was then added to inactivate the trypsin followed by three washes and final suspension in 1 mL PBS. The bound celts were counted on the flow cytometer as described earlier. 2. Results and discussion
  • proteome of P. gingivalls grown under haem-limitation was extensively analysed by two different approaches. Using in-nolution digestion followed by LCMS with gas phase fractionation, 344 proteins were identified. In the geLCMS approach, 385 proteins were identified while 247 proteins were found by both approaches. With the combined strategy a total of 478 proteins were identified (see Table 1) with an estimated false positive rate of 0.4% calculated from searches against the P. gingivalis reverse database, 77,0% of all proteins were identified by ⁇ 2 unique peptides or by > 2 identical peptides from independent LCMS runs (from different m/7. ranges or $DS PAGE bands).
  • the 478 identified proteins represent ⁇ 25% of all the 1988 assigned proiein-encoding genes identified by whole-genome analysis (43) . Although a quarter of the total predicted proteome was identified this figure is higher if the actual number of genes expressed during any one growth condition is taken into account. In Pseud ⁇ m ⁇ nus aeruginosa and Bacillus xubtilis the percentage of total ORFs transcribed during a single growth condition was estimated to be 60% and 40%, respectively (44 . 45) ⁇ gy examining the duty cycle limitation of their mass spectrometers Zhang and co- workers ⁇ esiirnaied that around 60% of P. gingivals predicted ORFs were expressed under their growth condition. Therefore based on these figures between 41-62% of P. gingivalix proteins expressed under the present growth conditions have been identified. The functional classification of the 478 identified proteins is shown in Table 1.
  • TMHMM Transmembrane Hidden Markov Model
  • CAI Codon Adaptation Index
  • the functional classes of proteins with the highest percentage of identified proteins are those involved in energy metabolism (Table 1), typically those involved in fermentation (95%, CAI 0.70-0.80), glycolysis (82%, CAI 0.71-0.83) and metabolism of amino acids and amines (81%, CAl 0.71-0.84). This was largely expected as essential proteins involved in basic metabolic functions such as energy metabolism have been shown to be very abundant in the bacterial cell. Most importantly almost 90% of these proteins are predicted to be in the cytoplasm, which also made detection easier compared with membrane proteins.
  • the functional classes of proteins represented least arc those involved in transpositioning, hypothetical proteins and regulatory functions.
  • P. gingivalis is known to be asaccharolytic (3> although the genome contains putative ORFs for all enzymes of the glycolytic pathway (43) .
  • the poor utilization of this pathway has been attributed to the glucose kinase gene being interrupted by an insertion clement (43) .
  • glucose kinase or another glycolysis-specific enzyme, phosphofructoki ⁇ asc was not identified.
  • all enzymes involved in gluconeogencsis were found, suggesting glucose necessary for processes such as polysaccharide biosynthesis may be derived via this pathway.
  • the geLCMS approach was chosen, as the in-solution TCAT method was unsatisfactory due to the presence of strong interfering triply charged ions. The presence of these triply charged ions resulted in very low number of protein identifications.
  • the ICAT labelled soluble and insoluble prote ⁇ i fractions were therefore independently separated by SDS-PAGE and each ge) lane divided into 20 sections for in-gel tryptic digestion followed by affinity purification and LCMS. In total 1.42 proteins were identified. No matches to the reverse database were obtained indicating a low level of false positive identification.
  • One of the predicted operons encodes the outer membrane proteins, Oi"np40 (PU0694) and Omp41 (PG0695) whose abundance were unchanged at a ratio of 1.1 (haem-Hmitation/haem-excess, LfE), These proteins have high sequence similarity to the OmpA-likc porinu of Gram-negative bacteria fSl) and are thought to provide a physical linkage between the outer membrane and the peptidoglycan layer. These structural proteins would not be expected to vary in abundance with a change in environmental haem levels. The remaining four predicted operons were found to be associated with glutamate or aspartate catabolism.
  • PG1374 and PG0350 belong to a new class of cysteine containing protein wirh leucine rich repeat domains similar to the L. monocytogenes r ⁇ tcrnalui protein InIJ (52) .
  • L. monocytogenes there are at least fifteen members of the intemzilin family and all have been found to share certain structural features consisting of a signal peptide, N- terminal leucine rich repeat domain followed by a conserved inter-repeat region. Many of these proteins are involved in the cellular invasion process ⁇ 53 ⁇ It has not been demonstrated why multiple internalins exist, but they are proposed to confer tropism toward different cell types c54) .
  • P. gingivalis into gingival epithelial cells is thought IO involve a coordinated process of attachment and invasion mediated by fimbriae and a variety of cell surface proteinases (58"60) .
  • a P. gingivalis 33277 mutant lacking a functional putalive intemalin (PGO350) was shown to exhibit similar invasive characteristics but reduced biofilm f ⁇ rmaLion capability compared to the wild type bacteria ' .
  • the .similar invasion was attributed to the presence of Fimbriae that also play a role in epithelial cell invasion by strain 33277 although there is also a possibility that the similar invasiveness of this mutant was due to the presence of a second putative internalin protein (PG 1374) encoded in the P. gingivalis genome.
  • PG 1374 second putative internalin protein
  • gingivalis invasion has been, demonstrated by Lament's group at the University of Florida and includes haloacid dchalogenasc, cndopcptidasesi a calion-l ⁇ anspoiting ATPase and an ATP- bi ⁇ ding cassette transporter ⁇ ' 6 ' %
  • PG 1374 as an epithelial cell invasion related protein therefore adds to the list of proteins involved in this complex host cell invasion process by bacterial pathogens.
  • PG1019 was observed to be 25 times more abundant when the bacterium was grown under haem-limitation.
  • Bioinformatic analyses suggest that PGl ⁇ i.9 is a lipoprotein that is encoded by a gene located immediately upstream of a gene encoding a putative outer membrane receptor protein (PG1020) in a predicted operon. Multiple alignment (not shown) of PG 1020 with known P.
  • gingivaiis TorvB-Unked outer membrane receptors shows the presence of a putative TonB box (residues 118-126), that is one of the characteristics of Ton ⁇ -linked receptors (67) and a conserved region (residues 236- 272) which Simpson and co-workers (68:> refer to as the TonB box IV region.
  • TonB-lmked outer membrane receptors have been implicated with many iron, iron complex and other micronulriem uptake systems.
  • OxyR an oxygen sensitive transcriptional activator also plays a role in the expression of alkyl hydroperoxide during anaerobic growth (71) where a P. gingivalis OxyR " mutant shows decrease of 16 fold in gene expression. More recently Duran-Pincdo and co-workers also demonstrated the positive regulation of aphC expression by the RprY response regulator.
  • haein availability may have a role in RprY and OxyR-controlled gene expression.
  • CAT Codon Adaption Index
  • Porphyromonas gingivalis Construction of mutants with $ combination of rgpA, rgpB, kgp, a ⁇ d hagA. /. Biol Chem. 274:17955-60.
  • Tribblc GD Mao S, James CE, Richard J. Lamont RJ. (2006).
  • a Porphyromonas gingivalis haJoacid dehalogenase family phosphatase interacts with human phosphoprotcins and is important for invasion Proc Natl Acad Sci USA 103: 1 1027- 11032.
  • Diaz PI Rogers AH (2004). The effect of oxygen on the growth and physiology of Porphyromonas gingivalis. Oral Microbiol. Immunol. 19:88-94.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Other Investigation Or Analysis Of Materials By Electrical Means (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
PCT/AU2007/000890 2006-06-27 2007-06-27 Porphyromonas gingivalis polypeptides useful in the prevention of periodontal disease Ceased WO2008000028A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AU2007264402A AU2007264402B2 (en) 2006-06-27 2007-06-27 Porphyromonas gingivalis polypeptides useful in the prevention of periodontal disease
US12/306,495 US20100092471A1 (en) 2006-06-27 2007-06-27 Porphyromonas Gingivalis Polypeptides Useful in the Prevention of Periodontal Disease
JP2009516822A JP2009544279A (ja) 2006-06-27 2007-06-27 歯周病の予防に有用なポルフィロモナス・ジンジバリスポリペプチド
CA002652957A CA2652957A1 (en) 2006-06-27 2007-06-27 Porphyromonas gingivalis polypeptides useful in the prevention of periodontal disease
EP07719129A EP2038297A4 (en) 2006-06-27 2007-06-27 PORPHYROMONAS GINGIVALIS POLYPEPTIDES SUITABLE FOR PREVENTION OF PERIODONTITIS
US13/547,556 US8916166B2 (en) 2006-06-27 2012-07-12 Porphyromonas gingivalis polypeptides useful in the prevention of periodontal disease

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2006903425 2006-06-27
AU2006903425A AU2006903425A0 (en) 2006-06-27 Porphyromonas gingivalis polypeptides useful in the prevention of periodontal disease

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US12/306,495 A-371-Of-International US20100092471A1 (en) 2006-06-27 2007-06-27 Porphyromonas Gingivalis Polypeptides Useful in the Prevention of Periodontal Disease
US13/547,556 Division US8916166B2 (en) 2006-06-27 2012-07-12 Porphyromonas gingivalis polypeptides useful in the prevention of periodontal disease

Publications (2)

Publication Number Publication Date
WO2008000028A1 true WO2008000028A1 (en) 2008-01-03
WO2008000028A8 WO2008000028A8 (en) 2009-07-16

Family

ID=38845037

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2007/000890 Ceased WO2008000028A1 (en) 2006-06-27 2007-06-27 Porphyromonas gingivalis polypeptides useful in the prevention of periodontal disease

Country Status (6)

Country Link
US (2) US20100092471A1 (https=)
EP (1) EP2038297A4 (https=)
JP (1) JP2009544279A (https=)
AU (1) AU2007264402B2 (https=)
CA (1) CA2652957A1 (https=)
WO (1) WO2008000028A1 (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009093605A1 (ja) * 2008-01-22 2009-07-30 Ghen Corporation 抗イヌ歯周病組成物
JP2010532765A (ja) * 2007-07-12 2010-10-14 オーラル ヘルス オーストラリア ピーティーワイ リミテッド バイオフィルム治療
WO2011014947A1 (en) * 2009-08-02 2011-02-10 Sanofi Pasteur Limited Porphyromonas gingivalis polypeptides
EP2604692A1 (en) * 2007-07-12 2013-06-19 Oral Health Australia Pty Ltd Immunology treatment for biofilms
US8975032B2 (en) 2010-12-15 2015-03-10 Sunstar Inc. Test kit for plasma or serum antibody titer against periodontal disease-causing bacteria
WO2022150719A3 (en) * 2021-01-11 2022-08-18 Keystone Bio, Inc. Antigenic composition(s) and method(s) against porphyromonas gingivalis for the prevention and/or treatment of infection and/or diseases

Families Citing this family (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AUPO652897A0 (en) 1997-04-30 1997-05-29 University Of Melbourne, The Synthetic peptide constructs for the diagnosis and treatment of periodontitis
US8129500B2 (en) * 1997-12-10 2012-03-06 Csl Limited Porphyromonas gingivalis polypeptides and nucleotides
AUPQ485999A0 (en) * 1999-12-24 2000-02-03 Csl Limited P. gingivalis antigenic composition
DK2328914T3 (en) 2008-08-29 2017-07-10 Oral Health Australia Pty Ltd Prevention, treatment and diagnosis of P. gingivalis infection
MY162557A (en) 2010-02-26 2017-06-15 Oral Health Australia Pty Ltd Treatment or prevention of infection
US12257272B2 (en) 2015-12-24 2025-03-25 Seed Health, Inc. Method and system for reducing the likelihood of developing depression in an individual
US11951140B2 (en) 2011-02-04 2024-04-09 Seed Health, Inc. Modulation of an individual's gut microbiome to address osteoporosis and bone disease
US11998479B2 (en) 2011-02-04 2024-06-04 Seed Health, Inc. Method and system for addressing adverse effects on the oral microbiome and restoring gingival health caused by sodium lauryl sulphate exposure
US12279989B2 (en) 2011-02-04 2025-04-22 Seed Health, Inc. Method and system for increasing beneficial bacteria and decreasing pathogenic bacteria in the oral cavity
US12533312B2 (en) 2011-02-04 2026-01-27 Seed Health, Inc. Method and system for preventing sore throat in humans
US11191665B2 (en) 2011-02-04 2021-12-07 Joseph E. Kovarik Method and system for reducing the likelihood of a porphyromonas gingivalis infection in a human being
US11951139B2 (en) 2015-11-30 2024-04-09 Seed Health, Inc. Method and system for reducing the likelihood of osteoporosis
US11844720B2 (en) 2011-02-04 2023-12-19 Seed Health, Inc. Method and system to reduce the likelihood of dental caries and halitosis
WO2012173244A1 (ja) * 2011-06-17 2012-12-20 国立大学法人東北大学 人獣共通感染性歯周病菌検出用マーカー
JP6310631B2 (ja) * 2011-10-18 2018-04-11 サンスター株式会社 歯周病原菌血漿または血清抗体価検査キット
US11998574B2 (en) 2013-12-20 2024-06-04 Seed Health, Inc. Method and system for modulating an individual's skin microbiome
US12318377B2 (en) 2013-12-20 2025-06-03 Seed Health, Inc. Method and system for reducing the likelihood of a porphyromonas gingivalis infection in a human being
US11672835B2 (en) 2013-12-20 2023-06-13 Seed Health, Inc. Method for treating individuals having cancer and who are receiving cancer immunotherapy
US12246043B2 (en) 2013-12-20 2025-03-11 Seed Health, Inc. Topical application to treat acne vulgaris
US12329783B2 (en) 2013-12-20 2025-06-17 Seed Health, Inc. Method and system to improve the health of a person's skin microbiome
US12005085B2 (en) 2013-12-20 2024-06-11 Seed Health, Inc. Probiotic method and composition for maintaining a healthy vaginal microbiome
US11980643B2 (en) 2013-12-20 2024-05-14 Seed Health, Inc. Method and system to modify an individual's gut-brain axis to provide neurocognitive protection
US11969445B2 (en) 2013-12-20 2024-04-30 Seed Health, Inc. Probiotic composition and method for controlling excess weight, obesity, NAFLD and NASH
US11642382B2 (en) 2013-12-20 2023-05-09 Seed Health, Inc. Method for treating an individual suffering from bladder cancer
US11839632B2 (en) 2013-12-20 2023-12-12 Seed Health, Inc. Topical application of CRISPR-modified bacteria to treat acne vulgaris
US11529379B2 (en) 2013-12-20 2022-12-20 Seed Health, Inc. Method and system for reducing the likelihood of developing colorectal cancer in an individual human being
US11833177B2 (en) 2013-12-20 2023-12-05 Seed Health, Inc. Probiotic to enhance an individual's skin microbiome
US11826388B2 (en) 2013-12-20 2023-11-28 Seed Health, Inc. Topical application of Lactobacillus crispatus to ameliorate barrier damage and inflammation
JP6716241B2 (ja) * 2015-12-18 2020-07-01 サンスター株式会社 歯周病原菌に対するIgG抗体の検出方法

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999029870A1 (en) * 1997-12-10 1999-06-17 Csl Limited Porphorymonas gingivalis polypeptides and nucleotides
WO2001047961A1 (en) * 1999-12-24 2001-07-05 Csl Limited P. gingivalis antigenic composition
US6528038B1 (en) * 1996-03-29 2003-03-04 The University Of Melbourne Porphyromonas gingivalis antigens for the diagnosis and treatment of periodontitis
US6962706B1 (en) * 1999-03-01 2005-11-08 The University Of Melbourne Synthetic peptides containing protective epitopes for the treatment and prevention of periodontitis associated with porphyromonas gingivalis
US20050288866A1 (en) * 2004-02-06 2005-12-29 Council Of Scientific And Industrial Research Computational method for identifying adhesin and adhesin-like proteins of therapeutic potential

Family Cites Families (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5210035A (en) * 1980-05-19 1993-05-11 Board Of Trustees Of Leland Stanford Jr. University Non-reventing live vaccines
US4735801A (en) * 1982-09-07 1988-04-05 Board Of Trustees Of Leland Stanford Jr. University Novel non-reverting salmonella live vaccines
US4837151A (en) * 1980-05-19 1989-06-06 The Board Of Trustees Of The Leland Stanford Junior University, Stanford University Live vaccines comprising two mutations and foreign antigen
US4603112A (en) * 1981-12-24 1986-07-29 Health Research, Incorporated Modified vaccinia virus
US5830710A (en) 1988-09-08 1998-11-03 University Of Florida Cloned porphyromonas gingivalis genes and probes for the detection of periodontal disease
WO1994027606A1 (en) 1993-05-28 1994-12-08 Unisearch Limited Method of treating helicobacter pylori infection
WO1995000110A1 (en) 1993-06-28 1995-01-05 Lion Corporation Composition for oral cavity
US5475097A (en) 1993-10-21 1995-12-12 University Of Georgia Research Foundation, Inc. Lysine-specific Porphyromonas gingivalis proteinase
US6017532A (en) 1993-09-10 2000-01-25 University Of Georgia Research Foundation, Inc. Porphyromonas gingivalis arginine-specific proteinase
WO1995007286A1 (en) 1993-09-10 1995-03-16 University Of Georgia Research Foundation, Inc. Porphyromonas gingivalis arginine-specific proteinase coding sequences
US5523390A (en) 1993-09-10 1996-06-04 University Of Georgia Research Foundation, Inc. Porphyromonas gingivalis arginine-specific proteinase
JPH0797395A (ja) 1993-09-28 1995-04-11 Kyowa Medex Co Ltd ポルフイロモナス・ジンジバリス線毛蛋白質の配列を含有するペプチド類及びその用途
DE69527514T2 (de) 1994-03-29 2003-04-03 Kyowa Hakko Kogyo Co., Ltd. Gen eines zelloberflächenpolypeptids
AUPN627595A0 (en) 1995-10-30 1995-11-23 University Of Melbourne, The Diagnostics and treatments of periodontal disease
CA2249994A1 (en) 1996-03-22 1997-09-25 University Of Georgia Research Foundation, Inc. Immunogenic compositions comprising porphyromonas gingivalis peptides and methods
US7341727B1 (en) * 1996-05-03 2008-03-11 Emergent Product Development Gaithersburg Inc. M. catarrhalis outer membrane protein-106 polypeptide, methods of eliciting an immune response comprising same
AUPO652897A0 (en) 1997-04-30 1997-05-29 University Of Melbourne, The Synthetic peptide constructs for the diagnosis and treatment of periodontitis
AUPP083997A0 (en) 1997-12-10 1998-01-08 Csl Limited Porphyromonas gingivalis nucleotides
US8129500B2 (en) 1997-12-10 2012-03-06 Csl Limited Porphyromonas gingivalis polypeptides and nucleotides
US6444799B1 (en) 1997-12-31 2002-09-03 Csl Limited P. gingivalis polynucleotides and uses thereof
GB9913437D0 (en) 1999-06-09 1999-08-11 Medical Res Council Fusion proteins
AUPQ718200A0 (en) 2000-04-28 2000-05-25 Csl Limited Porphyromonas gingivalis recombinant proteins and truncations
US6576226B1 (en) 2000-11-17 2003-06-10 Gary R. Jernberg Local delivery of agents for disruption and inhibition of bacterial biofilm for treatment of periodontal disease
GB2381449A (en) 2001-10-31 2003-05-07 Smithkline Beecham Plc Oral hygiene compositions comprising an electron acceptor
EP2426140A1 (en) 2003-08-15 2012-03-07 University of Florida Research Foundation, Inc. Identification of porphyromonas gingivalis virulence polynucleotides in the diagnosis, treatment, and monitoring periodontal diseases
EP1799705A4 (en) 2004-09-23 2008-11-05 Univ Melbourne Antigenic complex for the diagnosis and treatment of porphyromonas gingivalis infection
WO2008016385A2 (en) 2006-01-20 2008-02-07 The University Of Washington Deacylase polypeptides, deacylase polynucleotides, and methods of use thereof
WO2008124646A2 (en) 2007-04-06 2008-10-16 The Government Of The U.S.A, As Represented By The Secretary, Dept. Of Health And Human Services Use of amyloid proteins as vaccine scaffolds
US20100297179A1 (en) 2007-07-12 2010-11-25 Stuart Geoffrey Dashper Immunology Treatment for Biofilms
WO2009006699A1 (en) 2007-07-12 2009-01-15 Oral Health Australia Pty Ltd Biofilm treatment
DK2328914T3 (en) 2008-08-29 2017-07-10 Oral Health Australia Pty Ltd Prevention, treatment and diagnosis of P. gingivalis infection
KR20120027535A (ko) 2009-06-19 2012-03-21 오럴 헬스 오스트레일리아 피티와이 엘티디 카제인 유래 프로테아제 저해 펩타이드

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6528038B1 (en) * 1996-03-29 2003-03-04 The University Of Melbourne Porphyromonas gingivalis antigens for the diagnosis and treatment of periodontitis
WO1999029870A1 (en) * 1997-12-10 1999-06-17 Csl Limited Porphorymonas gingivalis polypeptides and nucleotides
US6962706B1 (en) * 1999-03-01 2005-11-08 The University Of Melbourne Synthetic peptides containing protective epitopes for the treatment and prevention of periodontitis associated with porphyromonas gingivalis
WO2001047961A1 (en) * 1999-12-24 2001-07-05 Csl Limited P. gingivalis antigenic composition
US20050288866A1 (en) * 2004-02-06 2005-12-29 Council Of Scientific And Industrial Research Computational method for identifying adhesin and adhesin-like proteins of therapeutic potential

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DASHPER S.G. ET AL.: "Characterization of a Novel Outer Membrane Hemin-Binding Protein of Porphyromonas gingivalis", JOURNAL OF BACTERIOLOGY, vol. 182, no. 22, 2000, pages 6456 - 6462, XP008101164 *
DATABASE GENBANK [online] NELSON K.E. ET AL.: "Complete Genome Sequence of the Oral Pathogenic Bacterium Porphyromonas gingivalis Strain W83", XP008101214, Database accession no. (NC_002950.2) *
JOURNAL OF BACTERIOLOGY, vol. 185, no. 18, 2003, pages 5591 - 5601 *
See also references of EP2038297A4 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010532765A (ja) * 2007-07-12 2010-10-14 オーラル ヘルス オーストラリア ピーティーワイ リミテッド バイオフィルム治療
EP2175851A4 (en) * 2007-07-12 2011-03-16 Oral Health Australia Pty Ltd TREATMENT OF BIOFILM
EP2604692A1 (en) * 2007-07-12 2013-06-19 Oral Health Australia Pty Ltd Immunology treatment for biofilms
AU2008274906B2 (en) * 2007-07-12 2013-11-07 Oral Health Australia Pty Ltd Biofilm treatment
WO2009093605A1 (ja) * 2008-01-22 2009-07-30 Ghen Corporation 抗イヌ歯周病組成物
WO2011014947A1 (en) * 2009-08-02 2011-02-10 Sanofi Pasteur Limited Porphyromonas gingivalis polypeptides
CN102712693A (zh) * 2009-08-02 2012-10-03 圣诺菲·帕斯图尔有限公司 牙龈卟啉单胞菌多肽
AU2010281313B2 (en) * 2009-08-02 2015-09-03 Sanofi Pasteur Limited Porphyromonas gingivalis polypeptides
US8975032B2 (en) 2010-12-15 2015-03-10 Sunstar Inc. Test kit for plasma or serum antibody titer against periodontal disease-causing bacteria
WO2022150719A3 (en) * 2021-01-11 2022-08-18 Keystone Bio, Inc. Antigenic composition(s) and method(s) against porphyromonas gingivalis for the prevention and/or treatment of infection and/or diseases

Also Published As

Publication number Publication date
US20130236488A1 (en) 2013-09-12
US8916166B2 (en) 2014-12-23
AU2007264402A1 (en) 2008-01-03
EP2038297A1 (en) 2009-03-25
JP2009544279A (ja) 2009-12-17
WO2008000028A8 (en) 2009-07-16
EP2038297A4 (en) 2010-03-03
AU2007264402B2 (en) 2012-09-20
US20100092471A1 (en) 2010-04-15
CA2652957A1 (en) 2008-01-03

Similar Documents

Publication Publication Date Title
AU2007264402B2 (en) Porphyromonas gingivalis polypeptides useful in the prevention of periodontal disease
Roier et al. Intranasal immunization with nontypeable Haemophilus influenzae outer membrane vesicles induces cross-protective immunity in mice
US8911745B2 (en) Immunology treatment for biofilms
JP2017074071A (ja) 分類不能型インフルエンザ菌の中耳炎単離物の遺伝子
KR20100063706A (ko) 면역원성 스트렙토코커스 단백질
US20240139302A1 (en) Propionibacterium acnes prophylactic and therapeutic immune treatment
HK1248535A1 (en) Treatment or prevention of infection
JP2006510353A (ja) ハプトグロビン受容体リガンド結合と相互作用する分子の使用
AU2011220335A2 (en) Treatment or prevention of infection
Chen et al. Vaccination with a trivalent Klebsiella pneumoniae vaccine confers protection in a murine model of pneumonia
Buettner et al. Proteomic and immunoproteomic characterization of a DIVA subunit vaccine against Actinobacillus pleuropneumoniae
AU2013203250B2 (en) Immunology treatment for biofilms
Lane Characterizing the Role of Pneumococcal Surface Protein A and Humoral Immunity to Biofilm Antigens During Streptococcus pneumoniae Colonization
Roier et al. Intranasal Immunization with Nontypeable Haemophilus influenzae Outer
HK1185102A (en) Immunology treatment for biofilms
Vågnes et al. Sera from mice immunized with DNA encoding Porphyromonas gingivalis catalytic or adhesin part of HRgpA inhibit degradation of human fibronectin by HRgpA
Liu et al. A multi-epitope subunit vaccine providing broad cross-protection against diverse

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07719129

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2007264402

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 12306495

Country of ref document: US

Ref document number: 2652957

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2009516822

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2007719129

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2007264402

Country of ref document: AU

Date of ref document: 20070627

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: RU