WO2007135220A1 - Uso de la proinsulina para la elaboración de una composición farmacéutica neuroprotectora, composición terapéutica que la contiene y sus aplicaciones - Google Patents

Uso de la proinsulina para la elaboración de una composición farmacéutica neuroprotectora, composición terapéutica que la contiene y sus aplicaciones Download PDF

Info

Publication number
WO2007135220A1
WO2007135220A1 PCT/ES2007/070097 ES2007070097W WO2007135220A1 WO 2007135220 A1 WO2007135220 A1 WO 2007135220A1 ES 2007070097 W ES2007070097 W ES 2007070097W WO 2007135220 A1 WO2007135220 A1 WO 2007135220A1
Authority
WO
WIPO (PCT)
Prior art keywords
proinsulin
nucleotide sequence
compound
pharmaceutical composition
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/ES2007/070097
Other languages
English (en)
Spanish (es)
French (fr)
Inventor
Enrique J. De La Rosa Cano
Maria Flora DE PABLO DÁVILA
Patricia Boya Tremoleda
Silvia CORROCHANO SÁNCHEZ
Pedro De La Villa Polo
Rima Barhoum Tannous
Fátima BOSCH TUBERT
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Consejo Superior de Investigaciones Cientificas CSIC
Universitat Autonoma de Barcelona UAB
Universidad de Alcala de Henares UAH
Original Assignee
Consejo Superior de Investigaciones Cientificas CSIC
Universitat Autonoma de Barcelona UAB
Universidad de Alcala de Henares UAH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Consejo Superior de Investigaciones Cientificas CSIC, Universitat Autonoma de Barcelona UAB, Universidad de Alcala de Henares UAH filed Critical Consejo Superior de Investigaciones Cientificas CSIC
Priority to AU2007253212A priority Critical patent/AU2007253212B2/en
Priority to US12/227,554 priority patent/US20100330042A1/en
Priority to ES07765882T priority patent/ES2433389T3/es
Priority to CA2652983A priority patent/CA2652983C/en
Priority to EP07765882.1A priority patent/EP2042189B1/en
Priority to JP2009511534A priority patent/JP4727748B2/ja
Publication of WO2007135220A1 publication Critical patent/WO2007135220A1/es
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/22Hormones
    • A61K38/28Insulins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • A61P27/06Antiglaucoma agents or miotics

Definitions

  • the present invention is within the field of biomedicine and more specifically in the development of therapeutic compounds.
  • the invention relates to the specific use of the proinsulin molecule for the manufacture of a medicament for the treatment of degenerative diseases of the retina such as retinitis pigmentosa, as well as other neurodegenerative conditions.
  • Neurodegenerative diseases comprise a variety of progressive disorders of the central nervous system of genetic-hereditary, traumatic, sporadic or senile origin.
  • the vast majority of neurodegenerative diseases have programmed cell death of neurons and / or glial cells in their origin or progression. Said death process, which constitutes an irreversible stage of nerve tissue damage, appears independently of the primary cause of the disorder, be it genetic, traumatic, sporadic or senile.
  • members of the insulin family that include insulin, its proinsulin precursor, and IGF-I and IGF-II (Várela-Nieto, I., de la Rosa, EJ, Valenciano, AI, and León, Y. (2003) CeIl death in the nervous system: lessons from insulin and insulin-like growth factors. Mol Neurobiol 28: 23-50).
  • the retina is part of the central nervous system and is a well established model for the study of both physiological and pathological processes of the nervous system; for this reason, it is the cellular model used in the present invention.
  • Pigmentary Retinosis One of the most important pathological processes studied in the retina is the so-called Pigmentary Retinosis, since this pathology comprises a large group of inherited retinal disorders and represents one of the major causes of blindness in the world, with an approximate incidence of a person between 4,000. Although more than 120 involved loci have been characterized and there are different etiologies, in all cases there is a chronic and progressive loss due to programmed cell death of retinal neurons, specifically photoreceptors, leading individuals to blindness.
  • mice provide an ideal model for the trial of new therapeutic approaches to the treatment of hereditary retinal dystrophies, since they allow to study the degenerative process of photoreceptors from a molecular, cellular and genetic point of view.
  • Gene therapy interventions tend to reintroduce a functional copy of the mutated gene that causes neurodegeneration.
  • Progress has been made with recombinant adenoviruses or viral vectors associated with adenovirus.
  • the transplantation of neuronal stem cells or precursors in order to develop new photoreceptors constitutes the purpose of neuroreparation therapies.
  • the new photoreceptors have to reestablish proper connections with the neurons of the internal retina.
  • the neuroprotection induced by treatment with growth factors seeks to prevent cell death associated with the neurodegenerative process.
  • Different forms of administration have been tested in several animal models with retinal degeneration.
  • the first attempts consisted of intravitreal injections of several recombinant proteins in rats or mice with retinal degeneration (Faktorovich, EG, Steinberg, RH, Yasumura, D., Matthes, MT, and LaVail, MM (1990) Photoreceptor degeneration in inherited retinal dystrophy delayed by basic fibroblast growth factor. Nature 347: 83-86; LaVail, MM, Unoki, K., Yasumura, D., Matthes, MT, Yancopoulos, GD, and
  • Intravitreal injections of CNTF analogues in mouse models with hereditary retinal degenerations resulted in an evident improvement of some degenerations.
  • the neuroprotective effect by CNTF analogues has also been proven in studies in cats with autosomal dominant rod-cones dystrophy, in which intravitreal injections of CNTF had beneficial effects (Chong, NH, Alexander, RA, Waters, L., Barnett, K. C, Bird, A. C, and Luthert, PJ (1999) Repeated injections of a ciliary neurotrophic factor analogue leading to long-term photoreceptor survival in hereditary retinal degeneration. Invest Ophthalmol Vis Sci 40: 1298-1305).
  • Photoreceptor peripherin is the normal product of the gene responsible for retinal degeneration in the rds mouse. Proc Nati Acad Sci U A 88: 723-726.), Subretinal injections of adenoviral vectors coding for a secretable form of CNTF delayed the death of photoreceptors (Cayouette, M., and Gravel, C.
  • the transgenic expression of BDNF in the retina which is hardly active by intravitreal injections, delays neurodegeneration in Q344ter mice (Okoye, G., Zimmer, J., Sung, J., Gehlbach, P., Deering , T., Nambu, H., hackett, S., Melia, M., Esumi, N., Zack, DJ, and Campochiaro, PA (2003) Increased expression of brain-derived neurotrophic factor preserves retinal function and slows cell death from rhodopsin mutation or oxidative damage. J Neurosci 23: 4164-4172; Sung, CH., Makino, C, Baylor, D., and Nathans, J.
  • the CNTF which on the one hand does have a neuroprotective effect with a single injection, It has proved counterproductive when its prolonged expression is induced by AAV vectors encoding the secretable form of CNTF, in Prph2Rd mice and two transgenic rats with retinal degeneration (Liang, FQ, German, TS, Dejneka, NS, Dudus, L., Fisher, KJ, Maguire, AM, Jacobson, SG, and Bennett, J. (2001) Long-term protection of retinal structure but not function using RAAV. CNTF in animal models of retinitis pigmentosa. Mol Ther 4: 461-472) ya that the function of the photoreceptors worsened according to an analysis by ERG.
  • the present invention provides a practical solution to the systems used so far.
  • insulin survival functions other than their metabolic function in the chicken embryo have been revealed, since insulin, in the form of its proinsulin precursor, is expressed during development before there is a pancreatic outline.
  • proinsulin regulates multiple cellular processes. In the early embryo it is a survival factor, as was shown in a study by inhibiting the expression of the proinsulin gene or its receptor through the use of antisense oligonucleotides (Morales, AV, Serna, J., Alarcon, C, of the Rosa, EJ, and de Pablo, F.
  • An object of the present invention is the use of a compound that induces proinsulin activity, hereinafter used an inducer compound of the present invention, for the preparation of a medicament or pharmaceutical composition for prevention and treatment.
  • a compound that induces proinsulin activity hereinafter used an inducer compound of the present invention
  • said pharmaceutical composition is suitable for administration systemically or locally on a sustained basis.
  • a particular object of the invention is the use of a compound that induces proinsulin activity in which the inducer compound is a nucleotide sequence, hereinafter used the proinsulin nucleotide sequence of the present invention, which allows the expression of a neuroprotective protein or peptide, and which is constituted by one or several nucleotide sequences belonging to the following group: a) a nucleotide sequence consisting of the nucleotide sequence coding for human proinsulin (SEQ ID NO1), b) a sequence of nucleotides analogous to the sequence of a), c) a fragment of any one of the sequences of a) and b), and d) a nucleotide sequence comprising any sequence belonging to: a), b), and / or c) .
  • a particular embodiment of the present invention is the use of a compound that induces proinsulin activity where the nucleotide sequence is constituted by SEQ ID NOl encoding human proinsulin.
  • Another particular object of the present invention is the use of a compound that induces the activity of the proinsulin where the nucleotide sequence of d) is an expression vector, hereinafter used the proinsulin expression vector of the invention, which comprises a nucleotide sequence or a genetic construct encoding a proinsulin protein capable of inducing neuroprotection.
  • Another particular object of the present invention is the use of a compound that induces proinsulin activity in which the inducer compound is a eukaryotic cell, preferably human, hereinafter use of proinsulin cells of the invention, genetically modified and comprising the nucleotide sequence, construction or proinsulin expression vector of the invention and which can adequately express and release the proinsulin protein to the extracellular medium.
  • the inducer compound is a eukaryotic cell, preferably human
  • Another particular object of the invention is the use of a compound that induces proinsulin activity in which the inducer compound is a protein or peptide, hereinafter used the proinsulin protein of the present invention, which has neuroprotective activity, and comprising one or more amino acid sequences belonging to the following group: a) an amino acid sequence consisting of the amino acid sequence of human proinsulin (SEQ ID NO2), b) an amino acid sequence analogous to the sequence of a), c ) a fragment of any one of the sequences of a) and b), and d) an amino acid sequence comprising any sequence belonging to: a), b), and / or c).
  • Another particular embodiment of the present invention is the use of an inducing compound of the invention in which the inducing compound is the human proinsulin protein (SEQ ID NO2).
  • Another object of the present invention is a pharmaceutical composition or medicament for the treatment of diseases, disorders or pathologies that occur with neurodegenerative alterations, hereinafter pharmaceutical composition of the present invention, which comprises a compound that induces the activity of proinsulin in the invention, in therapeutically effective amount together with, optionally, one or more pharmaceutically acceptable adjuvants and / or vehicles suitable for maintaining a systemically or locally maintained administration of the inducing compound.
  • a particular embodiment of the invention is a pharmaceutical composition of the invention in which the proinsulin activity inducing compound is one or more nucleotide sequences belonging to the following group: a) a nucleotide sequence consisting of the nucleotide sequence coding for human proinsulin (SEQ ID NO1), b) a nucleotide sequence analogous to the sequence of a), c) a fragment of any one of the sequences of a), and b), and d) a nucleotide sequence comprising any sequence belonging to: a), b), and / or c).
  • SEQ ID NO1 human proinsulin
  • Another particular embodiment of the present invention is the pharmaceutical composition of the invention in which the nucleotide sequence is constituted by SEQ ID NO1, which codes for human proinsulin.
  • Another particular embodiment of the present invention is a pharmaceutical composition of the invention in which the nucleotide sequence is an expression vector of human proinsulin.
  • Another particular object of the present invention is a pharmaceutical composition of the invention in which the proinsulin activity inducing compound is a protein or peptide encoded by the sequence, genetic construct or proinsulin vector of the invention.
  • a particular embodiment of the invention is a pharmaceutical composition of the invention in which the protein or peptide that induces proinsulin activity belongs to the following group: a) an amino acid sequence consisting of the amino acid sequence of human proinsulin
  • Another particular embodiment of the present invention is the pharmaceutical composition of the invention in which the amino acid sequence is constituted by human proinsulin (SEQ ID NO2).
  • Another particular object of the present invention is a pharmaceutical composition of the invention in which the compound that induces proinsulin activity is a cell, preferably human, and more preferably a cell of the central nervous system, transformed by the sequence, construction or proinsulin expression vector of the invention.
  • Another object of the invention is the use of the pharmaceutical composition of the invention, hereinafter use of the pharmaceutical composition of the invention, in a method of treatment or prophylaxis of a mammal, preferably a human being, affected by a disease, disorder or neurodegenerative pathology of the central or peripheral nervous system that affects humans, in which programmed cell death occurs, consisting of the administration of said therapeutic composition in adequate dose that allows to attenuate said neuroregeneration.
  • the present invention is based on the fact that the inventors have shown that proinsulin - the growth factor of the insulin family, normally known as the precursor form of insulin - is also a cell survival factor in chronic neurodegeneration processes. , in particular in the retinal neurodegeneration processes that take place in retinitis pigmentosa.
  • mice which carry a homozygous recessive mutation in the specific cyclic GMP phosphodiesterase enzyme gene, have been chosen as a model of retinal degeneration. it causes an alteration in the function of that enzyme, which leads to the progressive cell death of the photoreceptors, and the consequent secondary degeneration of the rest of the cell types of the retina, mainly the cones.
  • Two lines of transgenic mice have been generated that express human proinsulin protein and homozygous recessive for the rdlO mutation, Proins / rdlO mice
  • Example 1.1 These Proins / rdlO '7' mice with retinal degeneration, produce human proinsulin constitutively in the striated muscle - which is not processed by insulin - which is detected in serum and is not subject to normal pancreas regulation by levels of glucose. This causes that the animal has maintained circulating levels of human proinsulin, without depending on dose, of the state of the product before the administration - since being endogenously produced it does not degrade as it can be a commercial product -, and of the way and moment of the injection. This has allowed not to do pharmacokinetic studies to see how to administer it.
  • the fact that in the mice the state of the retina is also maintained better for longer, is beneficial. If, in addition to slowing down the process of cell death in properly damaged cells (the retinal sticks), the rest of the retina is kept in a better state, such as preventing the death of cones that do not have intrinsic damage, but that degenerate secondarily, several aspects of the disease are improving. In this particular case, if the cones are maintained for a longer time, even if the rods end up degenerating, the day vision is maintained, although the night vision is lost, and that means quality of life in a patient with pigmentary retinosis.
  • proinsulin in a form of administration that allows physiological levels maintained over time allows proinsulin to exert its neuroprotective function (see Example 1.4), contrary to what is observed with punctual administrations.
  • specific subcutaneous and intravitreal proinsulin administrations have been tested, but were not successful in improving Retinal neurodegeneration probably because stable levels are not obtained and maintained over time (Examples 3 and 4).
  • proinsulin does not have the metabolic effects of insulin and, therefore, can be administered to patients who do not have impaired glucose metabolism.
  • insulin also exhibits antiapoptotic activity, its normal metabolic activity makes its use unviable for a treatment like the one described here.
  • the application of proinsulin would be a preventive and suffocating treatment of neurodegenerative disease, since it prevents the death of damaged neurons.
  • an object of the present invention is the use of a compound that induces proinsulin activity, hereinafter used an inducer compound of the present invention, for the preparation of a medicament or pharmaceutical composition for the prevention and the treatment of neurodegenerative conditions, disorders or diseases in which programmed cell death occurs, preferably neurodegenerative pathologies of the central and peripheral nervous system, and more preferably from the group of inherited degenerative diseases known as retinitis pigmentosa.
  • the pharmaceutical composition further comprises a vehicle suitable for administering the pharmaceutical composition in a systemically or locally maintained manner.
  • a pharmaceutical composition is suitable for administration systemically or locally in a sustained manner, when said composition is formulated, compressed or pharmaceutically transported in such a way that it is constantly released in the body, being maintained at an effective dose in the target tissue for a prolonged period of time.
  • any vehicle capable of maintaining the pharmaceutical composition of the present invention in a sustained manner for example but not limited to polymers or patches, is included within the scope of protection of the present invention.
  • the term "compound that induces proinsulin activity” refers to a molecule that mimics, increases the intensity or prolongs the duration of the neuroprotective activity of the human proinsulin protein.
  • An activator compound may consist of a chemical molecule, a peptide, a protein or a nucleotide sequence, as well as those molecules that allow the expression of a nucleotide sequence encoding a protein with neuroprotective activity.
  • neuroprotective activity refers to the attenuation of the process of programmed cell death of cells. primarily affected in neurodegenerative disease, and / or cells secondarily affected by neurodegeneration, and / or potentiation of neurofunctional activity of the remaining cells.
  • neurodegenerative disease refers to a disease, disorder or pathology belonging, among others by way of illustration and without limiting the scope of the invention, to the following group: Alzheimer's disease, disease of Parkinson's, multiple sclerosis, pigmentary retinosis, Lewy body dementia, amyotrophic lateral sclerosis, spinocerebellar atrophies, frontotemporal dementia, Pick's disease, vascular dementia, Huntington's disease, Baten's disease, spinal cord injury, macular degeneration and glaucoma.
  • a particular object of the invention is the use of a compound that induces proinsulin activity in which the inducer compound is a nucleotide sequence, hereinafter used the proinsulin nucleotide sequence of the present invention, which allows the expression of a neuroprotective protein or peptide, and which is constituted by one or more nucleotide sequences belonging to the following group: a) a nucleotide sequence consisting of the nucleotide sequence encoding human proinsulin (SEQ ID NO1), b) a nucleotide sequence analogous to the sequence of a), c) a fragment of any one of the sequences of a) and b), and d) a nucleotide sequence comprising any sequence belonging to: a), b), and / or o.
  • analogous is intended to include any nucleotide sequence that can be isolated or constructed based on the sequence shown herein, for example, by introducing conservative or non-conservative nucleotide substitutions. , including the insertion of one or more nucleotides, the addition of one or more nucleotides at any of the ends of the molecule or the deletion of one or more nucleotides at any end or within the sequence, and allowing the coding of a peptide or protein capable of mimicking the activity of human proinsulin (SEQ ID NO2).
  • an analogous nucleotide sequence is substantially homologous to the nucleotide sequence discussed above.
  • the term "substantially homologous” means that the nucleotide sequences in question have a degree of identity of at least 30%, preferably of at least 85%, or more preferably of At least 95%.
  • the preferred form of the nucleotide sequence to be used is the proinsulin nucleotide sequence of human origin (SEQ ID NO1) and its derivatives.
  • nucleotide sequence refers to a sequence of DNA, cDNA or mRNA.
  • a particular embodiment of the present invention is the use of a compound that induces proinsulin activity where the nucleotide sequence is constituted by SEQ ID NOl that codes for human proinsulin.
  • the nucleotide sequence defined in section d) corresponds to a gene construct and gene expression vector that allows the expression of a proinsulin protein.
  • the proinsulin gene construct of the invention can also comprise, if necessary and to allow a better isolation, detection or secretion outside the cell of the expressed peptide, to a nucleotide sequence encoding a peptide capable of being used for the purpose of isolation, detection or secretion of said peptide. Therefore, another particular object of the present invention is a gene construct comprising, in addition to the proinsulin nucleotide sequence of the invention, any other nucleotide sequence encoding a peptide or peptide sequence that allows isolation, detection or detection.
  • a polyhistidine sequence (6xHis), a peptide sequence recognizable by a monoclonal antibody (for example, for identification) , or any other that serves to purify the resulting fusion protein by immunoaffinity chromatography: tag peptides such as c-myc, HA, E-tag) (Using antibodies: a laboratory manual. Ed. Harlow and David La ⁇ e (1999). CoId Spring Harbor Laboratory Press. New York. Chapter: Tagging proteins. Pp. 347-377).
  • nucleotide sequence and gene construction described previously can be isolated and obtained by an expert by employing techniques widely known in the state of the art (Sambrook et al. "Molecular cloning, a Laboratory Manual 2 nd ed., CoId Sping Harbor Laboratory Press, NY, 1989 vol 1-3). Said nucleotide sequences can be integrated into a gene expression vector that allows the regulation of the expression thereof under suitable conditions inside the cells.
  • another particular object of the present invention is the use of a compound that induces proinsulin activity
  • the nucleotide sequence of d) is an expression vector, hereinafter used the proinsulin expression vector of the invention, comprising a nucleotide sequence or a gene construct encoding a proinsulin protein capable of inducing neuroprotection.
  • An example of a particular embodiment is the use of an expression vector elaborated in the present invention in which the expression is regulated by a specific muscle promoter and the nucleotide sequence SEQ ID NO1 (see Example 1).
  • an expression vector comprises, in addition to the nucleotide sequence or genetic construction described in the invention, a promoter that directs its transcription (eg, pT7, plac, ptrc, ptac, pBAD, ret, etc.) , preferably tissue, to which it is operatively linked, and other necessary or appropriate sequences that control and regulate said transcription and, where appropriate, the translation of the product of interest, for example, transcription initiation and termination signals (tlt2, etc.). ), polyadenylation signal, origin of replication, ribosome binding sequences (RBS), coding sequences of transcriptional regulators (enhancers), transcriptional silencers (silencers), repressors, etc.
  • a promoter that directs its transcription eg, pT7, plac, ptrc, ptac, pBAD, ret, etc.
  • tissue e.g., a promoter that directs its transcription
  • expression vectors can be selected according to the conditions and needs of each specific case among expression plasmids, viral vectors (DNA or RNA), cosmids, artificial chromosomes, etc. that can also contain usable markers to select cells transfected or transformed with the gene or genes of interest.
  • the choice of the vector will depend on the host cell and the type of use to be performed. Therefore, according to a particular embodiment of the present invention said vector is a plasmid or a viral vector.
  • the obtaining of said vector can be carried out by conventional methods known to those skilled in the art, as well as for the transformation of microorganisms and eukaryotic cells different widely known methods can be used - chemical transformation, electroporation, microinjection, etc. - described in various manuals
  • Gene expression systems may or may not allow the integration of the new genetic material into the genome of the host cell.
  • both the nucleotide sequence, the gene construct or the proinsulin expression vector can be used as a medicament to protect human cells, preferably human neurons and / or human sexual cells affected from a neurodegenerative alteration, in a treatment and prophylaxis procedure. of gene therapy of a human being affected by a disease that involves neuronal and / or sexual disorders.
  • Neurodegenerative once administered to a human being affected by a disease
  • Neurodegenerative can be introduced in a general or specific way in tissue cells where, once integrated into the cell genome, they allow the expression of a proinsulin protein, which once secreted to the extracellular environment reaches the central nervous system where it can carry out its neuroprotective action ( see examples).
  • these gene expression systems can also be used to transform human cells outside the human body, autologous or heterologous with respect to the receptor potential, these cells becoming proinsulin-inducing compounds once they are administered to a sick human being. of a neurodegenerative disease since they express and release proinsulin protein with neuroprotective activity of neurons and / or human sexual cells.
  • another particular object of the present invention is the use of a compound that induces proinsulin activity in which the inducer compound is a eukaryotic cell, preferably human, hereinafter use of proinsulin cells of the invention, genetically modified and comprising the nucleotide sequence, construction or proinsulin expression vector of the invention and which can adequately express and release the proinsulin protein to the extracellular medium.
  • proinsulin cells of the invention genetically modified and comprising the nucleotide sequence, construction or proinsulin expression vector of the invention and which can adequately express and release the proinsulin protein to the extracellular medium.
  • These cells can be transformed, infected or transcribed by said nucleotide sequences by genetic engineering techniques known to a person skilled in the art. [Sambrook, J., Fritsch, EF, and Maniatis, T. (1989). Molecular cloning: a laboratory manual, 2nd ed. CoId Spring Harbor Laboratory]. Biopharmaceutical tools and gene therapy procedures are sufficiently known to an expert in the field
  • Another particular embodiment would be the use of a human cell transformed by the nucleotide sequence of the human proinsulin (SEQ ID NO1), from different cell lines, preferably from the central nervous system and more preferably a neuron that can be used as tissue regenerating cells humans.
  • SEQ ID NO1 human proinsulin
  • another particular object of the invention is the use of a compound that induces proinsulin activity in which the inducer compound is a protein or peptide, hereinafter used the proinsulin protein of the present invention, which has neuroprotective activity.
  • the inducer compound is a protein or peptide
  • the proinsulin protein of the present invention which has neuroprotective activity.
  • the proinsulin protein of the present invention comprising one or more amino acid sequences belonging to the following group: a) an amino acid sequence consisting of the amino acid sequence of human proinsulin (SEQ ID N02), b) an amino acid sequence analogous to the sequence of a) c) a fragment of any one of the sequences of a) and b), and d) an amino acid sequence comprising any sequence belonging to: a), b), and / or c).
  • analogous is intended to include any amino acid sequence that can be isolated or constructed based on the sequence shown herein, for example, by introducing conservative or non-conservative amino acid substitutions. , including the insertion of one or more amino acids, the addition of one or more amino acids at either end of the molecule or the deletion of one or more amino acids at any end or inside the sequence, and that mimics the neuroprotective activity of human proinsulin.
  • an analogous amino acid sequence is substantially homologous to the amino acid sequence discussed above.
  • the term "substantially homologous” means that the amino acid sequences in question have a degree of identity of at least 30%, preferably of at least 85%, or more preferably of At least 95%.
  • Another particular embodiment of the present invention is the use of an inducer compound of the invention in which the inducer compound is the human proinsulin protein (SEQ ID NO2).
  • Another object of the present invention is a pharmaceutical composition or medicament for the treatment of diseases, disorders or pathologies that occur with neurodegenerative alterations, hereinafter pharmaceutical composition of the present invention, which comprises a compound that induces the activity of proinsulin in the invention, in therapeutically effective amount together with, optionally, one or more pharmaceutically acceptable adjuvants and / or vehicles suitable for administering the proinsulin activity inducing compound in a systemically or locally maintained manner.
  • compositions are the adjuvants and vehicles known to those skilled in the art. matter and commonly used in the elaboration of therapeutic compositions.
  • the term "therapeutically effective amount” refers to the amount of the agent or compound capable of developing neuroprotection, calculated to produce the desired effect and, in general, will be determined, among other causes, by the characteristics own of the compounds, including the age, condition of the patient, the severity of the alteration or disorder, and the route and frequency of administration.
  • said therapeutic composition is prepared in the form of a solid form or aqueous suspension, in a pharmaceutically acceptable diluent.
  • the therapeutic composition provided by this invention can be administered by any appropriate route of administration, for which said composition will be formulated in the pharmaceutical form appropriate to the route of administration chosen.
  • the administration of the therapeutic composition provided by this invention is performed parenterally, orally, nasal inhalation, intraperitoneally, subcutaneously, etc.
  • Another particular object of the present invention is a pharmaceutical composition of the invention in which the neuroprotective compound or agent belongs to the following group: sequence, genetic construction or proinsulin expression vector that allow the expression of a protein or peptide with proinsulin activity.
  • a particular embodiment of the invention is a pharmaceutical composition of the invention in which the proinsulin activity inducing compound is one or more nucleotide sequences belonging to the following group: a) a nucleotide sequence consisting of the nucleotide sequence coding for human proinsulin (SEQ ID NO1), b) a nucleotide sequence analogous to the sequence of a), c) a fragment of any one of the sequences of a) and b), and d) a nucleotide sequence comprising a any sequence belonging to: a), b), and / or c).
  • nucleotide sequence is constituted by SEQ ID NO1, which codes for human proinsulin.
  • nucleotide sequence is an expression vector of human proinsulin.
  • Another particular object of the present invention is a pharmaceutical composition of the invention in which the proinsulin activity inducing compound is a protein or peptide encoded by the sequence, genetic construct or proinsulin vector of the invention.
  • a particular embodiment of the invention is a pharmaceutical composition of the invention in which the protein or peptide inducing proinsulin activity belongs to the following group: a) an amino acid sequence consisting of the amino acid sequence of human proinsulin (SEQ ID N02), b) an amino acid sequence analogous to the sequence of a), c) a fragment of any one of the sequences of a) and b ), and d) an amino acid sequence comprising any sequence belonging to: a), b), and / or c).
  • Another particular embodiment of the present invention is the pharmaceutical composition of the invention in which the amino acid sequence is constituted by human proinsulin (SEQ ID N02).
  • Another particular object of the present invention is a pharmaceutical composition of the invention in which the compound that induces proinsulin activity is a cell, preferably human, and more preferably a cell of the central nervous system, transformed by the sequence, construction or proinsulin expression vector of the invention.
  • Another object of the invention is the use of the pharmaceutical composition of the invention, hereinafter use of the pharmaceutical composition of the invention, in a method of treatment or prophylaxis of a mammal, preferably a human being, affected by a disease, disorder or neurodegenerative pathology of the central or peripheral nervous system that affects humans, in which programmed cell death occurs, consisting of the administration of said therapeutic composition in adequate dose that allows to attenuate said neuroregeneration.
  • the pharmaceutical composition of the present invention can be used in a treatment method in isolation or in conjunction with other pharmaceutical compounds.
  • Another particular object of the present invention is the use of the pharmaceutical composition of the invention in a method of treatment of a neurodegenerative disease belonging to the following group: Alzheimer's disease, Parkinson's disease, multiple sclerosis, Lewy body dementia, Sclerosis amyotrophic lateral, spinocerebellar atrophies, frontotemporal dementia, Pick's disease, vascular dementia, Huntington's disease, Baten's disease and spinal cord injury.
  • Another particular embodiment of the present invention is the use of the pharmaceutical composition of the invention in a method of treatment of a neurodegenerative disease belonging to the following group: pigmentary retinosis, macular degeneration and glaucoma.
  • Figure 1 shows a schematic representation of the cDNA insert of the human preproinsulin gene and the plasmid pMLC-hlns.
  • a schematic representation of the DNA sequence that is inserted into the plasmid is shown. It corresponds to the cDNA of the human proinsulin gene.
  • the inserted DNA sequence is the one translated, the ORF (open reading frame) of 347 bp.
  • the untranslated flanking areas, (5'UTR and 3'UTR) are not inserted in the construction.
  • the protein that is translated is the preproinsulin of 110 amino acids (aa).
  • This protein consists of a signal peptide (pep. Signal), the B chain, the C peptide and the A chain. The signal peptide is removed, leaving the proinsulin molecule.
  • the plasmid contains the insert described in the previous section lA, which encodes for the preproinsulin protein of 110 amino acids (thick black zone), under the transcriptional control of the MLCl (Miosin Light Chain) muscle constitutive promoter of striated muscle myosin light chain fibers. This plasmid is the one used to produce the two lines of transgenic mice producing human proinsulin that crossed to reach homozygous for rdlO.
  • Figure 2 shows sections of cryostat of 12 ⁇ m of eyes of mice at P32 where the state of rods and cones that show with different markers the progression of degeneration can be seen.
  • Wild control mouse A and D
  • transgenic mouse producing proinsulin and homozygous rdlO, Proins / rdlO, (B and E) and homozygous control rdlO mouse (C and F).
  • CNE outer nuclear layer
  • the internal nuclear layer (CNI) is where the nuclei of bipolar, amacrine, horizontal and Müller cells are found.
  • a conglomerate labeled with the fluorochrome Alexa 488 was used for the cones mareaje, whose reaction shows the external segments (up arrow) and the synaptic feet of the cones (down arrow).
  • the bar represents 45 ⁇ m.
  • Figure 3 shows cryostat sections of 12 ⁇ m of eyes of mice at P32 where the state of synaptic connections can be seen.
  • Wild control mouse (A) transgenic mouse producing proinsulin and homozygous rdlO, Proins / rdlO
  • CCG chaptic plexiform layer
  • CPE internal plexiform layer
  • CPI internal plexiform layer
  • Figure 4 represents the results of the faithful electroretinographic records performed at P30. Wild mouse (wt), RdIO mouse '7' control and Proins / RdlO mouse “7" , both on line 1 (Ll) and line 2 (L2).
  • wt Wild mouse
  • RdIO mouse '7' control and Proins / RdlO mouse “7” , both on line 1 (Ll) and line 2 (L2).
  • examples of the electroretingraphic responses recorded in scotopic (nocturnal) conditions, originating in the rods (upper row) and mixed responses (intermediate row) are shown.
  • the electroretingraphic responses recorded under photopic conditions are also shown.
  • mice (diurnal), originated in cones (lower row). Note the widest range of responses obtained in mice
  • Figure 5 shows the correlation between human proinsulin levels and the maintenance of vision parameters.
  • the levels of human proinsulin in Proins / RdlO "7" mice were determined at P32 in the quadriceps muscle of the mice to which a full electroretingraphic examination at P30 had been performed.
  • the respective values of proinsulin and the different vision parameters follow hyperbolic curves.
  • the amplitudes of the electroretinographic waves b max (recorded in response to 1.5 log cd-sm "2 ), OP (oscillatory potential), b fo t (recorded in response to 1.5 log cd-sm " 2 ), and the response are shown
  • Flicker Figure 6 shows the results of the faithful electroretingraphic records performed on different days.
  • A it is shown for each type of animal and at different times of postnatal development, examples of responses recorded under scotopic conditions, exclusive of sticks (-2.55 log cd » s » m-2) and mixed responses (1.48 log cd » s » m-2)
  • Figure 7 shows the presence of human proinsulin in the retina after injection subcutaneously. Quantification of human proinsulin by ELISA in retinal extracts of C57B1 / 6 mice injected subcutaneously with the amounts of proinsulin indicated, 2 hours before the preparation of the extract, or daily, between PIl and P14, the last injection being also 2 hours before Extract preparation
  • Figure 8 shows the effect of subcutaneous injections of human proinsulin on the histology of the retinal of mice in neurodegeneration. Retinal sections of RdI "7" to P14 mice injected every 12 hours between P6 and P14 or P18 with human proinsulin (B and D) or vehicle (A and C). Through nuclear staining with DAPI, the loss of photoreceptors in the outer nuclear layer can be seen in all cases.
  • CNE external nuclear layer
  • CNI internal nuclear layer
  • GCC ganglion cell layer.
  • the bar represents 25 ⁇ m.
  • Figure 9 shows the effect of subcutaneous injections of human proinsulin on the visual function of mice in neurodegeneration. Electroretinograms of RdI "7" mice injected every 12 hours between P6 and P14 or P18 with human proinsulin (Proins) or vehicle (PBS). Electroretinograms of mutant rd brothers of bait submitted to the different treatments are shown. Proinsulin injection did not prevent the process of loss of visual function. EXAMPLES OF REALIZATION
  • Example 1 Human proinsulin is able to prevent the death of retinal rods and maintain synaptic connections in the Proins / rdlO ⁇ / ⁇ transgenic mouse.
  • 1.1. Production of two lines of transgenics producing human proinsulin and homozygous for the rdlO mutation (Proins / rdlO "7" ) After obtaining several lines of transgenic mice producing human proinsulin, under the control of the constituent promoter of the light chain of the myosin
  • wild mouse is understood as the mouse used as a control. It has no alteration. It is commercial and its name is C57B1 / 6J, from Jackson laboratories.
  • Rdl mouse is understood as commercial mice that carry the mutation in the rod-specific cyclic GMP phosphodiesterase gene, whose trade name is Pdeb rdl / rdl , from Jackson laboratories.
  • the mouse rdlO is understood as commercial mice that carry the mutation in the specific cyclic GMP phosphodiesterase gene of rods, whose trade name is Pdeb rdl0 / rdl °, from Jackson laboratories.
  • Mouse Proins / rdlO '7' is understood to be cross-generated mice that are rdlO and transgenic mice producing human proinsulin under the striated muscle promoter MLCl.
  • the construction introduced in these mice carries the human proinsulin protein cDNA controlled by the light chain myosin muscle promoter, whose expression is constitutive ( Figure IB, SEQ ID NO1).
  • Figure IB SEQ ID NO1
  • a variability in expression is observed, which may be due to the different penetrance of the transgenic. This correlates with the production of human proinsulin found in serum.
  • the construction used to generate the transgenic mouse consisted of a plasmid (pMLC-hlns) of a size of 6.4 kb.
  • the expression is mediated by the constitutive muscle promoter of the myosin light chain (MLC).
  • the cDNA of the human proinsulin gene is cloned between the two EcoRI sites ( Figure IB).
  • Genotyping Genomic DNA was obtained from tissues according to the technique described by Miller and cois, 1988 (Miller, SA, Dykes, DD and Polesky, HF (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res, 16, 1215.). The tails of weaned mice were digested in 0.5 ml of lysis buffer (40 mM Tris-HCl, pH 8.0, 20 mM EDTA, 0.5% SDS and 200 mM NaCl) with 0.3 mg Proteinase K (Roche Diagnostics, Mannheim, Germany) . After precipitating the DNA, it was cut with the enzyme HindIII (Roche).
  • Nylon membranes (Schleicher & Schuell BioSciencie, USA) were used and the DNA was fixed to the membrane by UV radiation in the Stratalinker oven (Stratagene, La Jolla, CA, USA). The wet transfer was performed overnight at room temperature.
  • a radioactively labeled 32 P probe was used in the dCTP base against the sequence of the human proinsulin cDNA inserted in the construct.
  • the mold for making the probe was taken from the plasmid itself, digesting with EcoRI (Roche).
  • the insert released after digestion of the construct with EcoRI was purified by the DNA extraction kit (Millipore).
  • the probe mapping was done using the first Random Kit (Stratagene), in the presence of [ 32 PJdCTP. Subsequently, the probe was purified on Microspin G25 columns (Amershan Pharmacia Biotech).
  • the membrane was prehybridized at 65 ° C with a solution containing 50% formamide, Denhardt Ix (0.02% Ficol, 0.02% polyvinylpyrrolodone and 0.02% BSA), 1% SDS, 5x SSC ( 0.15 M NaCl and 15 mM sodium citrate at pH 7.2) and 0.1 mg / ml salmon sperm DNA for at least 2 hours; subsequently, it was hybridized at 65 ° C overnight with the prehybridization solution, to which 1.5 x 10 6 cpm / ml of the probe was added. Two 15 minute washes were performed with 2x SSC at room temperature, another 30 minutes with 1% SSC2x SDS and a last 30 minutes with 2x SSC and 0.1% SDS at 62.5 ° C.
  • the filters were washed, without letting them dry, they were wrapped in a GLAD-type plastic and exposed between two amplification screens (Genescreen plus, DuPont) to an 18x24 cm photographic film, Kodak Biomax MS type
  • the probe produced against the human proinsulin cDNA detected a 1.5 Kb band in the genomic DNA gel.
  • RdlO mice have a point mutation located in exon 13 of the rod-specific cyclic GMP phosphodiesterase 6 gene gene. In wild mice, there is a cutting site with the enzyme Cfo ⁇ at that location. In the case of mutants, the enzyme cutoff site disappears. This allowed a control of the intrinsic genotyping technique.
  • Genomic PCR was performed with the following primers: 3'- CTTTCTATTCTCTGTCAGCAAAGC -5 '(Oligo A, SEQ ID NO3) and 3'- CATGAGTAGGGTAAACATGGTCTG -5' (Oligo B, SEQ ID NO4) that amplified a 97 bp fragment. Then the PCR product was digested with the enzyme Cfol (Roche) for two hours at 37 ° C. It was then fractionated on a 3% Metaphor agarose gel. Wild mice showed two bands, after digestion, of 54 and 43 bp.
  • the homozygous rdlO mice gave a single band of 97 bp, since the enzyme does not cut the amplicon and the heterozygous rdl ⁇ / + mice showed three bands (of an allele that is cut and the another no). In this gene, no variability was found among individuals, which means that degeneration follows a standard pattern that is usually met in the same way for all individuals who possess it.
  • mice All mice were tested for blood glucose with test strips (Accu-Chek, Roche) after 12 hours of fasting. Normal levels of a mouse are usually between 100 and 200 mg / dl. In the double mutants Proins / rdlO a variation of between 80 and 150 mg / dl was found, which did not correlate directly with proinsulinemia levels.
  • Muscle and serum were analyzed, both from transgenic and control mice. In the case of serum, all the manufacturer's recommendations were followed, but in the case of muscle, a prior protein extraction with a lysis buffer was required (50 mM Tris-HCl pH 7.0, 100 mM NaCl and 0 , 1% of Triton) and a quantification of it with the BCA kit (Pierce, Rockford, IL, USA).
  • the human proinsulin detected in muscle extracts was always very high and had to be corrected for the amount of protein. Human proinsulin detected in serum ranged between 1 and 15 pM. This concentration was measured in a volume of 20 ⁇ l, according to the kit instructions. The measurements were made systematically at P30. This indicated that Proins / rdlO '7' transgenic mice produce human proinsulin in muscle and that it is poured into the blood circulation from where it is able to reach the neural retina.
  • Wild control mice without degeneration have between eight and twelve rows of nuclei in the CNE ( Figure 2D).
  • the number of cones, which carry the external segments and also the synaptic buttons thereof in the CPE is quite representative for the agglutinin staining observed in the CPE ( Figure 2A).
  • Figure 2F In the mouse RDLO " ⁇ " controlling the number of rows of rods in the CNE was quite small, between 1 and 2 rows, because the degeneration at this point was quite advanced (Figure 2F).
  • the most surprising thing is that the cones have already begun to degenerate at this point, although they are not primarily affected by the mutation (Figure 2C). It was observed how only external segments of cones appeared and their synaptic buttons greatly reduced their number.
  • the SV2 antibody at a 1:50 dilution, binds to a synaptic vesicle protein, thus marking the plexiform layers of the retina (external plexiform layer, CPE, and the internal plexiform layer, CPI). It was incubated at 4 ° C overnight in the blocking solution. Incubation with the secondary antibody conjugated with Alexa 488 (1/200) was performed 1 hour at room temperature. After the corresponding PBS washes, the sections were mounted with DAPI mounting means, to counteract the cores.
  • Example 2. Human proinsulin improves the visual function assessed by ERG in the Proins / rdlCT 7 " transgenic mouse compared to the control and diseased mice.
  • mice Although the mice are always kept in 12-hour cycles of light and dark, for the electroretingraphic study, the mice were adapted to darkness throughout the night. For information purposes, the cones are responsible for photopic (daytime) vision and scotopic (night) canes.
  • the mice were anesthetized under a faint red light with an intraperitoneal injection of a solution containing ketamine (at a rate of 95 mg / kg) and xylazine (at a rate of 5mg / kg).
  • the pupils were dilated with a drop of a solution containing 1% tropicamide (Colircusi Tropicamide, Alcon CUS ⁇ , SA, El Masnou, Barcelona, Spain).
  • the recording electrode is a lens that was placed over the mouse eye.
  • the reference electrode was placed in the mouth, and the ground electrode was placed in the tail.
  • the anesthetized animals were placed in a Faraday box and all scotopic experiments were carried out in absolute darkness.
  • the electroretinographic responses induced by low intensity light flashes produced by a Ganzfeld stimulator were thus recorded, allowing to record the responses originated only in sticks (stick response) or cones and sticks
  • the intensity of the light stimuli used were adjusted to values between -4 and 1.52 log cd-sm "2.
  • the light intensity was determined by a photometer (USB Mavo Monitor) at eye level. For each intensity from stimulus, a maximum of 64 responses were averaged. The interval between light stimuli varies depending on the intensity, thus, for low intensity stimuli (-4 log cd-sm "2 ) the time between stimuli was adjusted to 10 seconds and for high intensity stimuli (1.52 log cd- sm "2 ) was 60 seconds.
  • the animal was adapted to photopic conditions. Under these conditions, the interval between the light flashes was set at 1 second.
  • the electrical signals from the retina were amplified and filtered between 0.3 and 1000 Hz with a Grass amplifier (CP511 AC amplifier, Grass Instruments, Quincy, MA).
  • the signals were digitized (PC-card ADI instruments, CA). The records were stored on the computer for later analysis.
  • the responses mediated by canes were recorded under conditions of adaptation to the dark, before the application of light flashes of intensities between -4 and -1.52 log cd-sm "2.
  • the mixed responses generated by cones and canes were recorded before the application of light flashes of intensities between -1.52 and 0.48 log cd-sm ⁇ 2.
  • the oscillatory potentials were also isolated, by applying electric filters between 100 and 1000 Hz.
  • the mediated response The cones were registered under conditions of adaptation to the light (backlight of the register of 30 Cd-m ⁇ 2 ), before the application of light flashes of intensities included -0.52 and 2 log cd-sm "2 .
  • Figure 5 shows the result of analyzing in a larger group of mice the correlation between the electroretinographic responses between insulin and proinsulin levels. This correlation suggests a dose response relationship that supports the possible efficiency of a pharmacological approach with human proinsulin.
  • Proins / rdlO mice maintained very significant photophotopic and scotopic electroretinographic responses to P35 and managed to maintain a certain degree of response up to P55. Thus, it was observed that the visual response was better in the Proins / rdlO transgenic mice and is prolonged over time.
  • Example 3 Effect of proinsulin in intravitreal injection in mouse retina rdl.
  • mice of the rdl type were used which share the C57BL / 6 genetic background with the rdlO, as well as a different mutation but in the same cyclic GMP phosphodiesterase gene specific for sticks.
  • proinsulin in intravitreal injection in mouse retina rdl in vivo, in particular, to intravitreal injection of 1 ⁇ g, at a concentration of 1 ⁇ g / ⁇ l, of human proinsulin in mice rdl to P13.
  • the right eyes were injected with proinsulin and the left with the vehicle.
  • the injections were unique and the effects were analyzed 24 or 48 hours later, by TUNNEL, both in flat-mounted retinas and in sections.
  • the TUNNEL technique was used for the detection of cell death (TdT-mediated dUTP Nick End Labelling).
  • the terminal transferase enzyme (TdT) adds fluorescein-labeled nucleotides (dUTP) to the free 3'OH ends of the DNA, which allows the detection of DNA fragmentation that occurs during programmed cell death.
  • the TUNNEL Kit used was from Promega. The technique was performed on cells, sections or tissues. After a permeabilization step according to the nature of the tissue, it was washed with PBS and pre-incubation was carried out with the Kit solution for 30 minutes at room temperature.
  • the reaction mixture was prepared according to the manufacturer's instructions and the reaction was carried out for 1 hour at 37 ° C. Then, the reaction was stopped with the SSC2X solution for 15 minutes at room temperature. It was washed with PBS and mounted with Vectashield. For the detection of cell death in flat-mounted retinas, the entire neural retina, dissected from the rest of the eye elements, was mounted under the magnifying glass on a black nitrocellulose membrane (Sartorius, Goettingen, Germany), for better contrast during the manipulation. Generally, it was placed with the photoreceptor layer facing up, adhering to the nitrocellulose with the help of fine dissection forceps.
  • Collagenase (20 U / ml, Sigma) was allowed to act for 1 hour at 37 ° C and then Proteinase K (20 ⁇ g / ml, Promega) for 15 minutes at 37 ° C. Then it was necessary to refine the retinas for at least two hours. They were washed well with PBS and with BSA (30 mg / ml in PBS) and the TUNNEL reaction was carried out, as indicated above. Flat-mounted retinas were analyzed by confocal microscopy (Leica TCS-SP2-A0BS).
  • the TUNNEL technique was performed on retinal sections as described above, always fixed in 4% PFA (w / v) in 0.1 M phosphate buffer, pH 7.1 and cryoprotectant with 30% sucrose (w / v) in 10 mM phosphate buffer, pH 7.1.
  • For the tunneling of TUNNEL in sections less permeation is required than for flat-mounted retinas.
  • two series of permeation were made with BGT [100 mM Glycine, 3 mg / ml BSA, 0.25% Triton X-100 (w / v) in PBS] of 15 minutes each. They were washed with PBS and the TUNNEL reaction was performed as indicated.
  • 50 ⁇ l of the corresponding reagents were added and covered with parafilm®
  • Example 4 Effect of proinsulin on subcutaneous injections in the rdl mouse.
  • a protein extraction was performed with a lysis buffer [50 mM Tris-HCl, pH 7, 100 mM NaCl and 0.1% Triton X-IOO (w / v)] and a quantification of the protein extracted with the BCA kit (Pierce).
  • the neural retinas were extracted in a volume of 60 ⁇ l each.
  • the muscles of the hind legs were extracted in a volume of between 200 and 300 ⁇ l, according to the piece of muscle achieved.
  • serum all the manufacturer's recommendations were followed, always placing duplicates of 20 ⁇ l.
  • 20 ⁇ l of extract was also placed, in duplicate, sometimes using serial dilutions for greater precision.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Neurology (AREA)
  • Endocrinology (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Diabetes (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Psychology (AREA)
  • Hospice & Palliative Care (AREA)
  • Psychiatry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/ES2007/070097 2006-05-22 2007-05-21 Uso de la proinsulina para la elaboración de una composición farmacéutica neuroprotectora, composición terapéutica que la contiene y sus aplicaciones Ceased WO2007135220A1 (es)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AU2007253212A AU2007253212B2 (en) 2006-05-22 2007-05-21 Use of proinsulin for the preparation of a neuroprotective pharmaceutical composition, therapeutic composition containing it and applications thereof
US12/227,554 US20100330042A1 (en) 2006-05-22 2007-05-21 Use of Proinsulin for the Preparation of a Neuroprotective Pharmaceutical Composition, Therapeutic Composition Containing it and Applications Thereof
ES07765882T ES2433389T3 (es) 2006-05-22 2007-05-21 Uso de la proinsulina para la elaboración de una composición farmacéutica neuroprotectora, composición terapéutica que la contiene y sus aplicaciones
CA2652983A CA2652983C (en) 2006-05-22 2007-05-21 Use of proinsulin for the preparation of a neuroprotective pharmaceutical composition, therapeutic composition containing it and applications thereof
EP07765882.1A EP2042189B1 (en) 2006-05-22 2007-05-21 Use of proinsulin for the preparation of a neuroprotective pharmaceutical composition, therapeutic composition containing it and applications thereof
JP2009511534A JP4727748B2 (ja) 2006-05-22 2007-05-21 神経保護医薬組成物の製造のためのプロインスリンの使用、それを含む治療組成物、およびそれらの応用

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ES200601314A ES2331342B1 (es) 2006-05-22 2006-05-22 Uso de la proinsulina para la elaboracion de una composicion farmaceutica neuroprotectora, composicion terapeutica que la contiene y sus aplicaciones.
ESP200601314 2006-05-22

Publications (1)

Publication Number Publication Date
WO2007135220A1 true WO2007135220A1 (es) 2007-11-29

Family

ID=38722988

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2007/070097 Ceased WO2007135220A1 (es) 2006-05-22 2007-05-21 Uso de la proinsulina para la elaboración de una composición farmacéutica neuroprotectora, composición terapéutica que la contiene y sus aplicaciones

Country Status (7)

Country Link
US (1) US20100330042A1 (enExample)
EP (1) EP2042189B1 (enExample)
JP (1) JP4727748B2 (enExample)
AU (1) AU2007253212B2 (enExample)
CA (1) CA2652983C (enExample)
ES (2) ES2331342B1 (enExample)
WO (1) WO2007135220A1 (enExample)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110021974A1 (en) * 2010-10-05 2011-01-27 Shantha Totada R Retinitis pigmentosa treatment and prophalaxis
JP6199965B2 (ja) * 2012-07-11 2017-09-20 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア Rpgrx連鎖性網膜変性のaav媒介型遺伝子治療

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2104380A (en) * 1981-08-27 1983-03-09 Lilly Co Eli Human proinsulin pharmaceutical formulations

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5652214A (en) * 1989-06-05 1997-07-29 Cephalon, Inc. Treating disorders by application of insulin-like growth factors and analogs
US5667968A (en) * 1989-08-30 1997-09-16 Regeneron Pharmaceuticals, Inc. Prevention of retinal injury and degeneration by specific factors
DE69508605T2 (de) * 1994-07-08 1999-07-22 Trustees Of Dartmouth College, Hanover, N.H. Proinsulin-peptid-verbindungen für den nachweis und die behandlung von typ-i-diabetes
AU8508398A (en) * 1998-07-15 2000-02-07 Wisconsin Alumni Research Foundation Treatment of diabetes with synthetic beta cells
DE10055857A1 (de) * 2000-11-10 2002-08-22 Creative Peptides Sweden Ab Dj Neue pharmazeutische Depotformulierung
US7312192B2 (en) * 2001-09-07 2007-12-25 Biocon Limited Insulin polypeptide-oligomer conjugates, proinsulin polypeptide-oligomer conjugates and methods of synthesizing same
WO2003103608A2 (en) * 2002-06-11 2003-12-18 The Burnham Institute Neuroprotective synergy of erythropoietin and insulin-like growth factor

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2104380A (en) * 1981-08-27 1983-03-09 Lilly Co Eli Human proinsulin pharmaceutical formulations

Non-Patent Citations (29)

* Cited by examiner, † Cited by third party
Title
"Tagging proteins.", vol. 10, 1999, COLD SPRING HARBOR LABORATORY PRESS, article "Using antibodies: a laboratory manual.", pages: 347 - 377
BENNETT, J. ET AL.: "Photoreceptor cell rescue in retinal degeneration (rd) mice by in vivo gene therapy", NAT MED, vol. 2, 1996, pages 649 - 654
C. FAULI I TRILLO: "Tratado de Farmacia Galenica", 1993
CAYOUETTE, M. ET AL.: "Intraocular gene transfer of ciliary neurotrophic factor prevents death and increases responsiveness of rod photoreceptors in the retinal degeneration slow mouse", J NEUROSCI, vol. 18, 1998, pages 9282 - 9293, XP000917334
CAYOUETTE, M.; GRAVEL, C.: "Adenovirus-mediated gene transfer of ciliary neurotrophic factor can prevent photoreceptor degeneration in the retinal degeneration (rd) mouse", HUM GENE THER, vol. 8, 1997, pages 423 - 430, XP000876513
CHANG, G.Q.; HAO, Y.; WONG, F.: "Apoptosis: final common pathway of photoreceptor death in rd, rds, and rhodopsin mutant mice", NEURON, vol. 30, no. 11, 1993, pages 595 - 605
CHONG, N.H. ET AL.: "Repeated injections of a ciliary neurotrophic factor analogue leading to long-term photoreceptor survival in hereditary retinal degeneration", INVEST OPHTHALMOL VIS SCI, vol. 40, 1999, pages 1298 - 1305
CONNELL, G. ET AL.: "Photoreceptor peripherin is the normal product of the gene responsible for retinal degeneration in the rds mouse", PROC NATL ACAD SCI US A, vol. 88, 1991, pages 723 - 726
CORROCHANO SANCHEZ S. ET AL.: "Insulina an muerte celular programada: expresion and efectos durante la neurogenesis in la retina de raton", XI CONGRESO OF THE SOCIEDAD SPANISH DE BIOLOGIA CELULAR. CADIZ, 3 November 2005 (2005-11-03) - 6 November 2005 (2005-11-06), pages 90, XP008092512 *
DIAZ B. ET AL.: "Apoptotic cell death of proliferating neuroepithelial cells in the embryonic retina is prevented by insulin", EUROPEAN JOURNAL OF NEUROSCIENCE, vol. 11, no. 5, May 1999 (1999-05-01), pages 1624 - 1632, XP008090592 *
DIAZ B. ET AL.: "In vivo regulation of death by embryonic (pro)insulin and the insulin receptor during early retinal neurogenesis", DEVELOPMENT, vol. 127, no. 8, 15 April 2000 (2000-04-15), pages 1641 - 1649, XP008090540 *
DIAZ, B. ET AL.: "In vivo regulation of cell death by embryonic(pro) insulin and the insulin receptor during early retinal neurogenesis", DEVELOPMENT, vol. 127, 2000, pages 1641 - 1649, XP008090540
FAKTOROVICH, E.G. ET AL.: "Photoreceptor degeneration in inherited retinal dystrophy delayed by basic fibroblast growth factor", NATURE, vol. 347, 1990, pages 83 - 86, XP002927535, DOI: doi:10.1038/347083a0
HERNANDEZ-SANCHEZ, C. ET AL.: "Upstream AUGs in embryonic proinsulin mRNA control its low translation level", EMBO J, vol. 22, 2003, pages 5582 - 5592
LAVAIL, M.M. ET AL.: "Multiple growth factors, cytokines, and neurotrophins rescue photoreceptors from the damaging effects of constant light", PROC NATL ACAD SCI USA, vol. 89, 1992, pages 11249 - 11253, XP002118631, DOI: doi:10.1073/pnas.89.23.11249
LAVAIL, M.M. ET AL.: "Protection of mouse photoreceptors by survival factors in retinal degenerations", INVEST OPHTHALMOL VIS SCI, vol. 39, 1998, pages 592 - 602
LIANG, F.Q. ET AL.: "Long-term protection of retinal structure but not function using RAAV.CNTF in animal models of retinosis pigmentaria", MOL THER, vol. 4, 2001, pages 461 - 472
MILLER, S.A.; DYKES, D.D.; POLESKY, H.F.: "A simple salting out procedure for extracting DNA from human nucleated cells", NUCLEIC ACIDS RES, vol. 16, 1988, pages 1215
MORALES, A.V. ET AL.: "Role of prepancreatic (pro)insulin and the insulin receptor in prevention of embryonic apoptosis", ENDOCRINOLOGY, vol. 138, 1997, pages 3967 - 3975
OKOYE, G. ET AL.: "Increased expression of brain-derived neurotrophic factor preserves retinal function and slows cell death from rhodopsin mutation or oxidative damage", J NEUROSCI, vol. 23, 2003, pages 4164 - 4172
RALPH GS ET AL.: "Gene therapy for neurodegenerative and ocular diseases using lentiviral vectors", CLIN SCI (LOND, vol. 110, 2006, pages 37 - 46
SAMBROOK ET AL.: "Molecular cloning, a Laboratory Manual", vol. 1-3, 1989, COLD SPRING HARBOR LABORATORY PRESS
SAMBROOK, J.; FRITSCH, E.F.; MANIATIS, T.: "Molecular cloning: a laboratory manual", 1989, COLD SPRING HARBOR LABORATORY
See also references of EP2042189A4
SUNG, C.H. ET AL.: "A rhodopsin gene mutation responsible for autosomal dominant retinitis pigmentosa results in a protein that is defective in localization to the photoreceptor outer segment", J NEUROSCI, vol. 14, 1994, pages 5818 - 5833
TRAVIS, G.H. ET AL.: "Identification of a photoreceptor-specific mRNA encoded by the gene responsible for retinal degeneration slow (rds", NATURE, vol. 338, 1989, pages 70 - 73
VALENCIANO A.I. ET AL.: "Proinsulin/insulin is synthesized locally and prevents caspase- and cathepsin-mediated cell death in the embryonic mouse retina", JOURNAL OF NEUROCEMISTRY, vol. 99, no. 2, 1 October 2006 (2006-10-01), pages 524 - 536, XP008092214 *
VARELA-NIETO, I. ET AL.: "Cell death in the nervous system: lessons from insulin and insulin-like growth factors", MOL NEUROBIOL, vol. 28, 2003, pages 23 - 50
WANG, D.Y. ET AL.: "Gene mutations in retinitis pigmentosa and their clinical implications", CLIN CHIM ACTA, vol. 351, 2005, pages 5 - 16, XP004654501, DOI: doi:10.1016/j.cccn.2004.08.004

Also Published As

Publication number Publication date
ES2433389T3 (es) 2013-12-10
AU2007253212B2 (en) 2012-09-27
EP2042189B1 (en) 2013-06-26
JP4727748B2 (ja) 2011-07-20
US20100330042A1 (en) 2010-12-30
CA2652983A1 (en) 2007-11-29
AU2007253212A1 (en) 2007-11-29
CA2652983C (en) 2016-07-19
ES2331342B1 (es) 2010-10-13
EP2042189A4 (en) 2010-02-17
JP2009537612A (ja) 2009-10-29
ES2331342A1 (es) 2009-12-29
EP2042189A1 (en) 2009-04-01

Similar Documents

Publication Publication Date Title
Petters et al. Genetically engineered large animal model for studying cone photoreceptor survival and degeneration in retinitis pigmentosa
Hu et al. In vivo CRISPR/Cas9-mediated genome editing mitigates photoreceptor degeneration in a mouse model of X-linked retinitis pigmentosa
Stöver et al. Cochlear gene transfer: round window versus cochleostomy inoculation
Leaver et al. Cooperative effects of bcl‐2 and AAV‐mediated expression of CNTF on retinal ganglion cell survival and axonal regeneration in adult transgenic mice
Tracy et al. Intravitreal implantation of TPP1-transduced stem cells delays retinal degeneration in canine CLN2 neuronal ceroid lipofuscinosis
ES2983990T3 (es) Vectores virales que comprenden regiones codificantes de RDH12 y métodos para tratar distrofias de la retina
US20220347321A1 (en) Expression of neuropeptides
Palmer et al. Expression of Gtf2ird1, the Williams syndrome-associated gene, during mouse development
Stieger et al. Gene therapy for vision loss—recent developments
Komeda et al. The influence of interleukin-1 receptor antagonist transgene on spiral ganglion neurons
US11458129B2 (en) Neurokinin antagonists and uses thereof
US11351225B2 (en) Methods for modulating development and function of photoreceptor cells
KR100958291B1 (ko) T―타입 칼슘채널을 억제하여 불안 장애를 치료하는 방법
ES2433389T3 (es) Uso de la proinsulina para la elaboración de una composición farmacéutica neuroprotectora, composición terapéutica que la contiene y sus aplicaciones
JP2002087983A (ja) 筋萎縮性側索硬化症治療剤
Vasquez et al. Replication-Deficient Adenovirus Vector Transfer ofgfpReporter Gene into Supraoptic Nucleus and Subfornical Organ Neurons
Yokoyama et al. Genomic structure and functional characterization of NBPhox (PMX2B), a homeodomain protein specific to catecholaminergic cells that is involved in second messenger-mediated transcriptional activation
Samardzija et al. Animal models for retinal degeneration
CN111948401A (zh) CHCHD10在促进AChR亚基基因表达和维持NMJ稳定中的应用
KR20230098533A (ko) 타우 단백질 집적 억제용 조성물 및 집적억제 방법
KR20010029506A (ko) 근위축성 측색 경화증 치료방법
JPH09510357A (ja) 酸性繊維芽細胞成長因子(aFGF)をコードする組み換えアデノウィルス
KR100430199B1 (ko) 칼슘 이온 통로 알파1d 유전자 변이 생쥐 및 그의 제조방법
Cheng Exploration of the role of OPN4 in a mouse model of retinal degeneration
FR2717496A1 (fr) Virus recombinants, préparation et utilisation en thérapie génique.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07765882

Country of ref document: EP

Kind code of ref document: A1

DPE1 Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2652983

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2009511534

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2007253212

Country of ref document: AU

Ref document number: 2007765882

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2007253212

Country of ref document: AU

Date of ref document: 20070521

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 12227554

Country of ref document: US