WO2007093819A2 - Dna conformation (loop structures) in normal and abnormal gene expression - Google Patents
Dna conformation (loop structures) in normal and abnormal gene expression Download PDFInfo
- Publication number
- WO2007093819A2 WO2007093819A2 PCT/GB2007/000564 GB2007000564W WO2007093819A2 WO 2007093819 A2 WO2007093819 A2 WO 2007093819A2 GB 2007000564 W GB2007000564 W GB 2007000564W WO 2007093819 A2 WO2007093819 A2 WO 2007093819A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gene
- weight
- expression
- sequence
- marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- the present invention relates to diagnosis and gene expression.
- Protein, mRNA or antibody detection is unsuitable in many cases of diagnosis as the detection of these molecules does not truly represent expression of the genes linked with the disease.
- the stochastic variation for expression levels of these molecules between individual cells is considerably high, while the half-life varies significantly and could be very low, e.g. around 15 min for the c-myc protooncogene polypeptide.
- detection of these molecules follows only subsequent stages in the order of gene expression - transcription and translation.
- the epigenetic conformational set-up of the gene for potential reinitiated rounds of transcription and expression provides a potential for diagnostics at a much earlier stage of gene expression.
- Such conformational structures also appear to be stable, i.e. having a high half-life, making them easier to detect.
- the inventors have found that analysis of chromosome conformation in genomic DNA may be used for disease diagnosis.
- the conformation is formed by the association or juxtaposition of distant or non-adjacent sites in the gene.
- the sites may be CC markers (which are further discussed below). It has been found that a change in the chromosome conformation of different genes causes a change in the expression from the genes, and thus detection of the specific conformation maybe used to detect abnormal expression of a gene.
- the invention provides a method of detection or diagnosis of abnormal gene expression in an individual comprising determining in a sample from the individual the presence or absence of a chromosome structure in which two separate regions of the gene have been brought into close proximity, to thereby detect or diagnose whether the individual has abnormal gene expression.
- Fig 1 shows identification of the markers for RNAPII transcriptional units by pattern recognition algorithm.
- A Scheme for training and testing of the marker model. 422 annotated human genes are sampled, tested and feedback for 10 3 cycles until a convergent model is evolved. At the 3' of the genes the consensus included a previously unknown signal of multiplex pattern, Checkpoint Charlie, along with well-defined poly(A) signal and U-rich consensus sites.
- B At the 3 'end of the human beta-globin gene the CC marker (marked with Gaussian distribution) is present downstream of the U-rich site and corresponds to the CoTC site described earlier. The graph shows a drop in energy value (highlighted in grey) at the CC/CoTC site in relation to its neighbouring sequence.
- Fig 2 shows regulated expression of the model genes.
- A Transcription from the hDHFR gene is regulated on the major and minor promoters in a cell-cycle dependent manner. In quiescent cells, a short transcript is initiated from the upstream minor promoter. Fluorescence-activated cell sorting (FACS) of U2OS cells used in the experiments, grown in presence of 10% FCS (1) and under contact inhibition in presence of 0.5% FCS. Percentage of GO, G2/M, S and Gl cells under each condition is shown on the diagrams. In agreement with earlier reports Northern blot confirms accumulation of DHFR mRNA in proliferating cells (lane 3), as compared to quiescent cells (lane 4).
- FACS Fluorescence-activated cell sorting
- Fig. 3 shows termination properties of the CC markers.
- Human DHFR gene contains three CC markers (solid triangles). Transcription termination properties of the markers were assayed by RT-PCR as depicted in the scheme. Reverse primers (B, C) precede or follow the position of the tested CC marker. RT- PCR for CC DHF R-2 was assayed in quiescent cells, as CC DHFR -2 displayed regulated termination properties only under those conditions. The profiles for free energy of folding using Zuker algorithm show a drop in value (highlighted in grey) for all three CC markers.
- Human CALCRL gene structure includes three CC markers (solid triangles).
- CC markers in hCALCRL (CC C AL CRL -1 , CC CA L CR L-2 and CC CALCRL -3) also show potential termination of transcription.
- a 5' RACE from first exon confirms that all transcripts originate downstream of CC C A LCR L-1, with any potential intergenic transcript successfully terminated.
- Fig. 4 shows chromosome conformation properties of CC markers.
- A The 3 C assay integrated was performed for the CC sites on the hDHFR gene under proliferating and quiescent conditions. Controls indicate full dependence of the assay on crosslinking, restriction, ligation, PCR and enrichment of RNAPII by immunoprecipitation. In proliferating cells, a spatial proximity is detected between CCDHFR-1 and CCDHFR-3 (lane 1+3), but not between CCDHF R -1 and CCDHFR-2 (lane 1+2) sites within the hDHFR gene, hi quiescent cells, the spatial proximity is also detected between CC D H FR -1 and CC D H F R-2 (lane 1+2) sites.
- Fig. 5 shows Checkpoint Charlie predictions in other organisms.
- the model trained on 422 human genes identifies CC markers (red triangles) in other species. Notice that in case of RGF3 a single CC marker separates two annotated genes, serving as a 3' marker for one gene and 5' marker for another one. Exons and introns are drawn as green and grey rectangles respectively. Solid line represents intergenic sequences.
- Fig. 6 shows the principles of chromosome conformation detection using the
- Fig.7 shows typing of c-myc to diagnose renal cancer.
- CC markers 1 and 2 are positioned around the PO promoter. Juxtoposition of CC1-CC2 leads to formation of the closed structure that isolates PO and prevents initiation from PO, but not from P 1 ,2.
- Analysis of the conformational juxtaposition CC 1 -CC2 on tissue samples shows presence of specific PCR product, confirming existing conformation on renal tumor patients (Tl-3), but not in normal tissues (Nl-3). All samples were independently tested for the presence of stable conformation on unrelated gene, calcitonin receptor-like receptor (CRLR). This conformation is present in all tissues and acts as an internal control for the assay (marked as control).
- CRLR calcitonin receptor-like receptor
- Fig. 8 shows chromosome conformation profiling of ovarian cancer
- Fig. 9 shows conformational deregulation in prostate cell lines.
- the invention provides a method for detection of abnormal expression from a gene based on the determination of the three-dimensional higher order structure which the gene has adopted, and in particular based on the position/pattern of associated/juxtaposed sites within the gene.
- the method may detect the presence or absence of juxtaposed sites, or a chromosome conformation caused by such juxtaposition, at one or more locations in the gene.
- the normal form of expression from a gene is typically defined as expression of a product (RNA or polypeptide) in a form and/or amount that allows the product to perform its cellular/physiological function.
- Abnormal expression may be defined as a mode of expression in which a different product is performed (typically due to a change in the position of transcription termination) and/or the amount of product is expressed at an altered level (or even not at all). Abnormal expression may lead to a disease state in the organism (such as any of the diseases mentioned herein), and will typically lead to an impairing of the viability and/or functioning of the cell or tissue or organ in which the abnormal expression occurs.
- Abnormal expression is typically characterized by expression of RNA or protein of increased or decreased length compared to the normal product and/or expression of RNA or protein at an increased or decreased level compared to normal levels of expression.
- the change from normal to abnormal expression comes about due to a change in chromosome structure as defined by CC markers.
- the structural juxtaposition of CC markers typically defines the border of transcription units, and generally abnormal expression over-imposes aberrant (different) borders to the ones observed in normal expression.
- the invention provides diagnosis of a disease condition or diagnosis of the stage of a disease in an individual.
- the disease is typically one where abnormal expression of one or more genes occurs. Such abnormal expression may cause or contribute to the disease.
- the gene may be one which expresses a functional polypeptide or RNA which is not translated (such as non-coding RNA genes and pseudogenes).
- the gene may express RNA which has a regulatory role.
- the gene is preferably a proto-oncogene (such as c-myc) or a tumour suppressor gene (such as BRCAl).
- the gene may be any of the genes listed in Table 2.
- the gene may be hDHFR, hCALCRL, MLHl , PSA or BORIS (for example as disclosed in GenBank Accession No's NM000791, NM005795, NM000249, NM001030047 or NM080618).
- the gene typically has 2, 3, 4 or more CC marker sequences.
- the gene may comprise a CC marker in a promoter proximal intron, typically in the first intron.
- the disease may be a cancer, such a renal, ovarian, bladder, colon or prostate cancer.
- the disease may be a genetic disease, typically caused by expression of an altered RNA or polypeptide product (as defined above) and/or caused by expression of a different level of RNA or polypeptide product (such as the absence of expression of such a product).
- the method is carried out to determine the stage of the disease, particularly in the case where the disease is cancer.
- the method may be carried out to determine the risk of cancer progressing.
- the method may be used to predict the rate or severity of tumour or disease progression.
- the individual to be diagnosed may have one or more symptoms of any of the disease conditions mentioned herein and/or be suspected of having any such disease condition.
- the individual may be at risk of any such disease condition, for example due to having a family history of the disease or due to living in an environment which causes or contributes to the development of the disease.
- the individual In the case of cancer in a human the individual may be over 40 years, such as over 50, or over 60 years old.
- the individual may have a history of smoking.
- the individual may be one that has CC markers (whose association defines chromosome structure) in at least one gene of its genome.
- the individual is typically a eukaryote, such as a lower or higher eukaryote.
- the individual may be a plant, yeast, insect, marsupial, bird or mammal.
- the individual is preferably a mammal, such as a primate, human or rodent.
- the present invention provides a method of diagnosis of abnormal gene expression, and thus a method of diagnosis of particular disease conditions.
- the method comprises detection of whether there is an abnormal chromosome conformation in the DNA of the individual (for example either directly by detection of the actual chromosome structure or indirectly by detection of the sites of association/juxtaposition in the gene).
- Such an abnormal conformation will generally comprise the presence of a new juxtaposition (or a combination of juxtapositions) at sites in a gene (where they are not normally observed, for example when the gene is expressing normally) or the absence of one or more juxtapositions (which are normally observed during normal expression).
- abnormal conformation will lead to the gene expressing RNA transcript with a difference in sequence and/or function and/or amount, and the difference in expression may cause or contribute to a disease in the individual, such as cancer.
- the abnormal chromosome conformation may cause the expression of a different splice variant.
- any suitable means may be used to detect/examine the chromosome conformation of the DNA which is analysed. Typically the detection will determine the position of at least one loop-like structure in the DNA of the individual. In one embodiment the method may comprise determining the presence or absence of a given juxtaposed pair of CC markers, thereby for example allowing the deduction that observed conformation is different from the normal one. Typically the method it is carried out in vitro on a sample from the individual.
- the sample will comprise DNA of the individual in a state where regions of the genome which are associated in the natural state remain associated in the sample (i.e. the epigenetic chromosomal state is preserved), for example for associated regions which less than 5kb, 3kb, lkb, 500 base pairs or 200 base pairs apart.
- the sample will typically comprise cells of the individual.
- the sample will generally comprise cells from a tissue which is involved in the disease to be diagnosed.
- the sample typically comprises a body fluid of the individual and may for example be obtained using a swab, such as a mouth swab.
- the sample is preferably a blood sample or a frozen sample.
- the sample may be a biopsy, such as of a tumour. The method may be carried out on a single cell from the individual.
- the sample is typically processed before the method is carried out, for example DNA extraction may be carried out.
- the DNA in the sample may be cleaved either physically or chemically (e.g. using a suitable enzyme).
- antibody specific to RNA polymerase II is used to separate the DNA from other components of the cell.
- the chromosome conformation maybe detected by determination of the sequences which are associated, for example which form the base of a loop-like structure.
- the DNA is subject to cross-linking before such a determination.
- the cross-link will generally comprise a covalently bonded link to form, and is generally formed by contacting with an agent that causes cross-linking.
- an agent may be an aldehyde, such as para-formaldehyde, or D-Biotinoyl-e- aminocaproic acid-N-hydroxysuccinimide ester or Digoxigenin-3-O-methylcarbonyl- e-aminocaproic acid-N-hydroxysuccinimide ester.
- Para-formaldehyde can cross link DNA chains which are 4 Angstroms apart.
- the site of the juxtaposition may be ascertained by determination of the sequences which are brought into closer proximity by the formation of the loop. Such a determination may be carried out by any suitable means, and in a preferred embodiment it is performed using PCR.
- the chromosome conformation capture assay is used, for example as described in Dekker et al (2002) Science 295, 1306.
- the DNA is crosslinked (for example as described above).
- the cross-linked DNA is then cut, typically by restriction digestion, and the cut/digested structure is subject to ligation. Ligation will result in the DNA strand ends that were formed by cutting/digestion to become ligated together. Thus ligation will generally result in DNA with a new sequence (which was not present in the original gene) which includes both sequences of the juxtaposed sites. Detection of the new sequence may be used as the basis of the detection of the conformation (i.e. to detect the presence of juxtaposition at a particular position).
- the sequence generated by ligation may be detected by any suitable means. Typically it is detected on the basis of its sequence for example by using PCR.
- a PCR detection reaction is used in which PCR primers that are used bind on either side of the point of ligation and result in a successful PCR reaction in the presence of the ligated product, but which do not result in a successful PCR reaction when carried out in the presence of the a gene which does not have the relevant structure (typically because the primers are bound too far apart from each other on the gene sequence and the orientation of the primers excludes choice of other products (the primers are chosen in the same orientation in order to prevent aberrant products)), hi this embodiment a PCR product will only be detected in the presence of the ligated product (see Figure 1). Typically the PCR primers will bind within 500 base pairs of each other when binding the ligated product.
- the ligated sequence may be detected/analysed by sequence specific PCR or by direct sequencing. Detection may be performed using a gel-based system in which the ligated sequence is run on a gel, and then the gel is stained with a detectable compound which binds to polynucleotides.
- the ligated sequence may be detected using a probe, such as a polynucleotide probe that binds specifically to the ligated sequence.
- PCR products which are formed in the PCR reactions mentioned above may be detected by any suitable means, for example by any suitable method from amongst the methods mentioned above for detection of the ligated product.
- the method also comprises detecting the chromosome structure of a further gene, which is a tissue specific gene. Detection of the structure of the further gene (for example by any of the means described herein) will allow determination of whether or not the further gene is being expressed, and therefore will allow determination of the tissue-specificity of expression. This may aid the diagnosis of the disease.
- 3 or more genes are analysed in order to aid diagnosis. In particular in the case of cancer diagnosis analysis of more than one gene which is implicated in causing cancers can aid determination of the specific cancer.
- the analysis of chromosome structure which is carried out according to the method of the invention is compared to the same analysis carried out on a control biopsy from disease tissue (such as a cancer/tumour) in order to aid diagnosis.
- a control biopsy such as a cancer/tumour
- the method of the invention is carried out in a quantitative manner in order to determine the proportion of cells of the individual (for example in a particular in vivo location or in a particular tissue) which have an abnormal gene expression. This can aid determination of the stage of a disease.
- the method of the invention comprises detecting the presence of a chromosome conformation which is formed by association of particular regions of a gene.
- regions are on the same chromosome, and are typically less than 50,000, such as less than 20,000, 10,000, 5000, 1000 or less than 500 bases apart.
- the association of the sequences may cause a loop/loop-like/topologically closed structure to form.
- regions of a gene which are associated are close enough to be cross-linked together, such as by any of the cross-linking agents mentioned herein. They will therefore typically be a distance apart which is in the order of Angstroms, such as for example less than 50 Angstroms or less than 10 Angstroms apart.
- One or both of the sequences which associate may:
- the CC marker typically has a length of 1 to 30 nucleotide bases, for example 5 to 20 or 10 to 15 bases.
- CC markers may be detected in any given gene sequence using the information in Table 1.
- Table 1 One of the later sections below illustrates in detail how CC marker sequences are identified.
- Table 1 the table shows 4 sets of weights. For each set of weights a position is quoted, and positional values for each kind of nucleotide is given with reference to the initial position (in Table 1 this is defined as the column position which is in reference to the initial position).
- values for guanine, cytosine, adenine and thymine are given for positions 0 to 18.
- a score is determined for each base of a given sequence in the forward and reverse strand.
- This analysis is done by scanning the sequence from left to right and then repeating it on its complementary strand. While scanning, a base is considered as a reference point and the score for that base is determined using the positional values of 4 set of weights and the relative distance between the weights (i.e. for each base a score is determined based on the sequences around that base whose positions are defined using the position numbers in Table 1). If this score is greater than the X (input value given by the user), then the base pair in question is within a CC marker. This process is repeated for all bases.
- the score is typically converted to an exponential value (inverse logarithmic) score.
- CC markers are selected which have an inverse logarithmic score of more than 0.9, such as more than 0.95 or more than 0.99 (the calculation of the logarithmic score is described in more detail in a later section).
- the inventors have used the information in Table 1 to detect CC markers in human, yeast and fruit fly (D. melanogaster sequences).
- the invention also provides a kit for carrying out the method.
- the kit will typically comprise a means for detection of specific juxtaposed sequences in a gene.
- the kit will comprise a primer pair or probe that may be used to detect a juxtaposed sequence (for example by detecting a ligated product as described herein).
- one or both primers and/or the probe will comprise sequence which is a fragment of the gene sequence or of sequence which is homologous to the gene sequence (it is understood that references to the gene sequence also includes the complementary sequence, since of course one primer will bind the gene sequence and the other primer will bind the complementary sequence).
- Such gene sequence may be 5' to the coding sequence (for example promoter sequence), coding sequence, intron sequence or sequence 3' to the coding sequence.
- the primers or probe are typically at least 10, 15, 20, 30 or more bases long, and generally comprise DNA, normally in single stranded form.
- the primers or probes may be present in isolated form.
- the primers or probe may carry a revealing/detectable label. Suitable labels include radioisotopes such as 32 P or 35 S, fluorescent labels, enzyme labels or other protein labels such as biotin.
- the kit may comprise instructions for carrying the method of the invention.
- the kit may comprise a cross-linking agent capable of cross-linking DNA, such as any of the cross-linking agents mentioned herein.
- the kit is for carrying out embodiments of the invention in which the chromosome structure of more than one gene is analysed, such as 2, 3, 4 or more genes.
- the kit may also comprise primers or probes for analysing 2, 3, 4 or more different genes.
- the kit may additionally comprise one or more other reagents or instruments which enable any of the embodiments of the method mentioned above to be carried out.
- reagents or instruments include one or more of the following: a detectable label (such as a fluorescent label), an enzyme able to act on a polynucleotide (typically a polymerase, restriction enzyme, ligase, RNAse H or an enzyme which can attach a label to a polynucleotide), suitable buffer(s) (aqueous solutions) for enzyme reagents, a positive and/or negative control, a gel electrophoresis apparatus, a means to isolate DNA from sample, a means to obtain a sample from the individual (such as swab or an instrument comprising a needle) or a support comprising wells on which detection reactions can be done.
- a detectable label such as a fluorescent label
- an enzyme able to act on a polynucleotide typically a polymerase, restriction enzyme, ligase
- the invention provides a method of identifying a compound for treating abnormal expression from a gene comprising determining whether a candidate substance is capable of causing the chromosome structure of the gene to change from the abnormal structure which is adopted during abnormal expression to the normal structure, to thereby determine whether the candidate substance may be capable of treating abnormal expression.
- the change in chromosome structure may be detected using any suitable method described herein.
- the method may also be carried out to identify compounds that are capable of causing a change in expression from a gene (for example a switch from one mode of expression to another mode of expression), by again determining whether a candidate compound is able to cause a change in the structure of the gene.
- the method may be carried out in vitro (inside or outside a cell) or in vivo (upon a non-human organism).
- the method is carried out on a cell, cell culture, cell extract, tissue, organ or organism which comprises the gene.
- the cell is typically one in which abnormal expression of the gene is observed.
- the method is typically carried out by contacting (or administering) the candidate substance with the gene, cell, cell culture, cell extract, tissue, organ or organism and determining whether a change to normal chromosomal structure occurs.
- Suitable candidate substances which tested in the above screening methods include antibody agents (for example, monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies and CDR-grafted antibodies). Furthermore, combinatorial libraries, defined chemical identities, peptide and peptide mimetics, oligonucleotides and natural agent libraries, such as display libraries (e.g. phage display libraries) may also be tested.
- the candidate substances may be chemical compounds, which are typically derived from synthesis around small molecules which may have any of the properties of the agent mentioned herein (such as the organic compounds mentioned herein). Batches of the candidate substances may be used in an initial screen of, for example, ten substances per reaction, and the substances of batches which show modulation tested individually.
- the invention provides a method of changing the expression profile of a gene comprising (i) introducing a CC marker into the gene, and/or (ii) removing a CC marker from gene, optionally by introducing 1 , 2, 3 or more mutations into the CC marker, wherein each mutation is an addition, substitution or deletion of a nucleotide base, wherein at least 50% of the coding sequence of the gene remains unchanged in the method.
- the total number of CC marker sequences (i.e. functional CC marker sequences) remains unchanged in the method.
- removing a CC marker it is understood that the entire CC marker sequence may not need to be removed, but instead mutations can be introduced into the CC marker sequence to make it inactive, so that in one embodiment the altered CC marker sequence is no longer able to cause association of regions of the gene.
- RNA or polypeptide product of from the gene retains functional activity or may have a different activity or may have no activity (in comparison to the product from the non-engineered gene.
- the engineered gene maybe any of those genes mentioned herein.
- the engineered gene may be replicated and/or expressed and/or introduced into a cell.
- the invention provides use of a polynucleotide which comprises a CC marker to change expression from a gene.
- a polynucleotide may be used to introduce or remove a CC marker from a gene, as in the case of the any of the engineered genes described herein.
- the polynucleotide is typically a DNA molecule.
- the polynucleotide may be in the form of a vector, such as a viral vector.
- the polynucleotide maybe in the form of a transposon.
- the invention also provides a non-human engineered eukaryotic organism comprising at least one gene in its genome whose expression profile has been changed by introduction and/or removal of a CC marker sequence, wherein at least 50% of the coding sequence of the gene is left unchanged.
- the organism may thus comprise the engineered gene of the invention which is described above.
- the (transgenic) organism may be any of the organisms mentioned herein.
- the invention also provides a part of the organism which comprises the engineered gene, such as a cell or organ of the organism.
- the invention provides a method of making the engineered organism of the invention comprising introducing or removing a CC marker in a gene in the cell of the organism, and in the case of a multicellular organism allowing the cell to grow into the organism.
- the introduction or removal of the CC marker may be carried out on a germ cell or embryo stem cell.
- homologues of polynucleotide sequences are referred to herein. Such homologues typically have at least 70% homology, preferably at least 80, 90%, 95%, 97% or 99% homology, for example over a region of at least 15, 20, 30, 100 or more contiguous nucleotides. The homology may be calculated on the basis of nucleotide identity (sometimes referred to as "hard homology").
- the UWGCG Package provides the BESTFIT program which can be used to calculate homology (for example used on its default settings) (Devereux et al (1984) Nucleic Acids Research 12, p387-395).
- the PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (such as identifying equivalent or corresponding sequences (typically on their default settings), for example as described in Altschul S. F. (1993) J MoI Evol 36:290-300; Altschul, S, F et al (1990) J MoI Biol 215:403-10.
- HSPs high scoring sequence pair
- Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
- the BLAST algorithm parameters W 5 T and X determine the sensitivity and speed of the alignment.
- the BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787.
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two polynucleotide sequences would occur by chance.
- P(N) the smallest sum probability
- a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1 , preferably less than about 0.1 , more preferably less than about 0.01 , and most preferably less than about 0.001.
- the homologous sequence typically differs by less than 2, 3, 5 or 8 bases (which may be substitutions, deletions or insertions of nucleotides). These changes may be measured across any of the regions mentioned above in relation to calculating homology.
- RNA polymerase II RNA polymerase II
- Pattern recognition analysis has been widely applied to various fields of study, such as medicine, engineering and linguistics where image analysis and data decoding allows identification of underlying characteristic markers within complex systems.
- RVM Relevance Vector Machine
- the RVM trainer applies a sparse Bayesian principle accommodating the distance variation noticed between the regulatory signals (7). From the given set of sequences, the trainer scans for markers defining them and constructs a probabilistic generalized linear model. Later this "trained" model can be used to classify sequences of choice for the presence of the defined markers. Derivation of this model is based on the conditional probability of Bayes theorem given below:
- P(data) where, data represents the set of DNA sequences.
- P(model ⁇ data) is the posterior probability that gives the probability of a sequence derived from the model. It depends on the probability of the data given the model and the probabilities of the model and data.
- Each marker defining the characteristic of the sequence, x is given as a DNA weight matrix relative to the cleavage site. Mathematically, it is represented as:
- ⁇ (x) ⁇ P(i)W ⁇ x, ⁇ )
- Previously known transcription termination signals poly(A) signal and U-rich site near the 3' ends of RNAPII transcribed genes are the two of the three types of markers identified. This result validated our approach as it unambiguously confirmed already described sequences functionally implicated in termination and processing of 3 'end of mRNA (8-10).
- the third type of marker identified by the RVM trainer was previously unknown. It was positioned further downstream of the U-rich site and comprised of multiple DNA weight matrices. The distance variation noticed in each of type of the markers was captured as a Gaussian distribution.
- the marker was not confined to the 3' ends but was also present at the 5' ends of annotated genes. Because of the association of the newly defined marker with the borders of the transcriptional units we have named it after the most famous Berlin border post from the times of Cold War - a Checkpoint Charlie (CC) marker.
- CC Checkpoint Charlie
- CC markers To determine the functional relevance of the CC markers to transcriptional regulation, we searched for any examples of CC markers among already defined regulatory elements. It is important to mention that the algorithm trained on human genes was able to identify CC markers in eukaryotes across many species (Fig.5). We attributed this to the evolutionarily conserved function mediated by the high order structures of the marker.
- CC markers functionally associated with transcriptional regulation.
- the first example of the CC marker was found within the human beta-globin gene, extensively studied for its properties by several laboratories. Recent reports demonstrated that termination of transcription in beta- globin gene depends not only on the recognition of the poly(A) site, but also on the co-transcriptional cleavage site (CoTC) further downstream (7, 12-14). Interestingly, the CoTC site coincides with the identified CC marker and displays low energies of folding, as mentioned before (Fig. IB). This observation not only confirms potential relevance of CC marker to the boundary of the transcribed gene, but also suggests its functional involvement in the mechanism of regulated transcriptional termination.
- CC marker was found on the X chromosome of Drosophila melanogaster, where it coincided with the gypsy insulator within chromosome band 7B2 (Fig. 1C).
- Gypsy is a well characterised 350 bp insulator element, with multiple Su(Hw) binding sites, that direct higher order chromatin loop- like structures (15).
- An experiment done on cut locus in Drosophila showed the two insulator sites at chromosome bands 7B2 and 7B8 come together at the nuclear periphery looping the loci in between (16) (Fig. 1C).
- Similar organisation of chromatin fibres mediated by cross-talk between insulators has also been shown for scs and scs' boundary sequences (77).
- CC markers In order to validate the above observations, we conducted systematic analysis of CC markers on two regulated human genes (Fig.2). Both model genes — the cell cycle regulated dihydrofolate reductase (DHFR) gene (19) and the cell type specific calcitonin receptor-like receptor (CALCRL) gene (20-22) — display alternative modes of regulated transcriptional activity. In our analysis we were particularly interested to know if CC markers (i) could restrict the range of RNAPII transcription and (ii) correlate with any specific chromosomal conformations.
- DHFR cell cycle regulated dihydrofolate reductase
- CACRL cell type specific calcitonin receptor-like receptor
- hDHFR Human DHFR
- hDHFR Human DHFR
- the hDHFR gene contains three CC markers: (i) upstream from both promoters (CC DH FR-1); (ii) in the second intron (CCDHFR-2); (iii) downstream from the functional ⁇ oly(A) signal (CC DHFR -3) (Fig. 3A).
- CC DHFR-1 upstream from both promoters
- CCDHFR-2 in the second intron
- CC DHFR -3 downstream from the functional ⁇ oly(A) signal
- CC sites Fig. 3A.
- CCDHF R -1 site we detected transcription termination of rare intergenic transcripts.
- the short non-coding transcript terminated at the CC D HFR-2 site.
- a canonical AATAAA site is also present near the CC DHFR -2 site and that part of DNA sequence matches with various Expressed Sequence Tags and cDNAs from the public database.
- the CC DHFR -3 site marked the termination of productive transcription mentioned elsewhere.
- the association of the CC DHF R-3 site with the functional poly(A) signal is similar to the earlier described correlation within the beta-globin gene.
- the second model gene of choice was the cell type specific human CALCRL gene (hCALCRL) (Fig. 2B). It encodes a seven trans-membrane G-protein-coupled receptor (GPCR).
- GPCRs G-protein-coupled receptors
- Mammalian GPCRs constitute a large and diverse family of proteins whose primary function is to transduce extracellular stimuli into intracellular signals. Most of the GPCRs respond to endogenous signals (endoGPCRs) such as peptides, lipids, neurotransmitters or nucleotides. EndoGPCRs are highly conserved and their expression profiles are unique, yielding thousands of tissue- and cell- specific receptor combinations for the modulation of physiological processes.
- EndoGPCRs are highly conserved and their expression profiles are unique, yielding thousands of tissue- and cell- specific receptor combinations for the modulation of physiological processes.
- the repertoire of endoGPCRs consists of 367 receptors in humans.
- EndoGPCR encoded by hCALCRL gene is considered to be a key molecule in regulating activity of members of calcitonin family of peptides that play essential roles in cellular growth, survival and navigation.
- Human CALCRL gene (103.15 kb) is located on chromosome 2 and contains fifteen exons and is transcribed in various human tissues and tumours.
- the hCALCRL gene is transcribed to its full length in endothelial and not in non-endothelial cells as shown by the northern blotting and immunohistochemistry (Fig. 2B). However, in non-endothelial cells, a non-coding transcript terminating in the first intron could be detected (Fig. 2B).
- Fig. 2B we considered the hCALCRL gene as a good model of cell type specific regulation of gene expression (22).
- CC markers could be detected both upstream of promoter (CC C ALCRL-1) and downstream of functional poly(A) signal (CC C A LC RL-3) of the hCALCRL gene.
- An additional third CC marker (CCCALCRL-2) is present in the first intron of the gene (Fig. 3B).
- a 5' RACE from the first exon confirms that all transcripts are initiated downstream and none from the upstream of the CC CA LCRL-1 marker. This suggests that CC C A LC R L -1 might terminate intergenic transcripts that could interfere with the hCALCRL transcription unit.
- a 3' RACE analysis confirms the presence of terminated transcripts near CC CALCRL -2 (in the first intron) and CC C A LC R L -3 sites (at region downstream of cleavage site). All three CC marker sites show low free energy of folding as shown above (Fig. 3B). Thus in vivo, both in hDHFR and hCALCRL genes, the CC markers display transcriptional termination properties.
- the 3 C assay In order to validate the second suggested property of CC marker we then tested if they are implicated in any specific chromosomal conformations as defined by the 3 C assay.
- This assay was developed to monitor highly flexible in vivo chromosomal conformations by detecting the spatial proximity of distant sites involved in formation of the loop-like structures. We have adjusted the conditions of the assay to improve the yields and sensitivity of the detection in human cells (see Materials and Methods). Importantly, the initial step of the assay also involves enrichment of the transcribed chromosomal loci with anti-RNAPII immunoprecipitation (24).
- Fig. 4A When analyzed for the hDHFR gene, the sites of the CC DHFR -1 and CCD H FR-3 markers, positioned more than 29 kb apart, were found to juxtapose in normal proliferating cells (Fig. 4A). The spatial proximity of these two sites was highly specific (Fig. 4A, compare 1+2, 1+3 in proliferating cells) and dependent on the presence of RNAPII, cross-linking, restriction, ligation and PCR (Fig. 4A, hDHFR controls). As shown before (Fig. 3A), both these sites also display transcriptional termination properties in proliferating cells. Changes in the transcriptional mode on hDHFR gene under quiescent conditions associates among other things with generation of short transcripts terminating within the second intron.
- the hDHFR gene contains a third CC marker positioned at the same site.
- CC D HFR-2 marker was activated as a termination site for the short non-coding transcript (Fig. 3A).
- Fig. 3A we therefore wanted to analyse if in quiescent state a different transcriptional mode will con-elate with alternative chromosomal conformation for the CC D H FR -2 marker.
- the in vivo conformation juxtaposing CCDHFR-1 and CC DHFR -2 markers can be detected by 3 C assay in quiescent cells. Only low levels of this conformation were detected in the population of proliferating cells.
- CC DHF R- 1 : CCDHFR-2 conformation did not obliterate the CC DHF R-1 :CC DH FR- 3 conformation described earlier for the proliferating cells.
- this result could have several explanations. Firstly, the quiescent-specific conformation might be overimposed onto retained CC DHF R-1 ⁇ CCD HFR - 3 conformation. Secondly, the result might represent two populations of cells as they switch from one conformation into the other. Importantly, the CC DHF R-1 : CC DHFR -2 conformation was specific for the quiescent mode of transcription and consistent with the range of detected transcripts.
- hDHFR gene an in vivo chromosomal conformations characterised by spatial proximity of CC markers.
- the proximity of CC DHFR -1 and CC DHF R-2 markers was specific for the transcriptional mode described for the quiescent state of cell cycle.
- CC markers participate in any structural arrangement associated with cell type specific expression of hCALCRL gene
- HMVEC transcription permissive
- HEK293T non-permissive cells
- HMVEC cells the active hCALCRL gene displays a conformational profile in which all three CC CALCRL markers were juxtaposed, with close proximity between CC C ALCRL- 1 : CCc ALCRL-2 and CCCALCRL- 1 :CC C A LCRL -3 (Fig.4B; data for CC CALCRL -2:CC CALCRL -3 is not shown).
- CC CA L CRL - 1 :CC CALCRL -2 conformation concurs with the presence of short hCALCRL transcripts that terminate in the first intron at the CCcALCRL-2 site in HEK293T cells (Fig. 2B).
- cell type specific expression of the hCALCRL gene is associated with unique chromosomal conformation, as detected between CCCALCRL-1 and CC C ALCRL-3 markers.
- this conformation encompasses full length of the productive transcripts generated in HMVEC cells.
- the marker - Checkpoint Charlie consistently correlates with the borders of coding and non-coding transcriptional units in diverse spectrum of species (see also Fig. 5), displays highly ordered secondary and tertiary structures for the corresponding transcripts, associates with the regulated termination of transcription by RNAPII in vivo, and directs the formation of transcription dependent alternative chromosomal conformations.
- the marker when analysed on the cell cycle specific hDHFR and cell type specific hCALCRL genes, the marker functionally associates with the distinct high-order structural conformations that are characteristic to one or the other modes of the transcriptional activity.
- CC markers not only correlate with sub- chromatin structures loaded with RNAPII, but also outline the boundaries of the transcripts synthesised within those structures.
- Our data is consistent with earlier suggestions that high-order structures are formed in a transcription-dependent manner and might be important for transcriptional re-initiation.
- Transcriptional regulation is conducted at various important levels by a multitude of activities linked to DNA sequence-specific recruitment, chromatin modification and remodelling CC markers and associated structural organization are clearly implicated in vivo in the establishment of the outer boundaries for various transcriptional units.
- Northern blotting for hDHFR was performed from total RNA isolated from U2OS cells. Proliferating cells were cultured in presence of 10% FCS whereas cell quiescence was achieved under contact inhibition in presence of 0.5% FCS. Probes synthesised using a template encompassing sequences between fourth and sixth exon of hDHFR was used as probe. Northern blotting for hCALCRL was performed as previously described (25).
- Resulting vector was sequenced using an Applied Biosystems 377 Genetic analyser and sequence was checked against the GenBank database. The insert was excised and used as a template to generate probes.
- probes were labelled with 32 P-dCTP using MegaPrime labelling Kit (Amersham, UK). After hybridisation and stringent washes the blot was exposed to Hyperfilm (Amersham, UK) and then to Phosphoscreen. The hybridisation signals were analysed using ImageQuant software.
- CCDHFR-1 Forward primer (A): tggggaactgcacaatatga (SEQ ID NO: 1 )
- Reverse primer B
- aggggtgcgtcttttaacct SEQ ID NO:2
- Reverse primer (C): ccgcacgtagtaggttctgtc (SEQ ID NO:3)
- CCDHFR-3 Forward primer (A): tttggaaaaacccatgaagg (SEQ ID NO:7)
- Reverse primer (C): cagggttttggtctgtcacc (SEQ ID NO:9)
- RACE was performed essentially as previously described (27). Gene specific primers were designed for 3'- (cagagagtgtcacctcctgctttagg) (SEQ ID NO: 10) and 5'- RACE (cccacaagcaaggtgggaaagagtg) (SEQ ID NO:11) based on the reported sequence of human CALCRL cDNA (28). The transcripts from 5 ' and 3 ' RACE (terminating in first intron) were sequenced and submitted to the GenBank database.
- Rabbit polyclonal antibody LN-1436 was raised against synthetic peptide corresponding to residues 427-461 (HDIENVLLKPENLYN) (SEQ ID NO: 12) at the extreme C-terminus of human CL (hCL) protein (Accession numbers AAC41994 and
- AAA62158 encoded by CALCRL gene.
- the specificity of the antibodies was characterised by immunoblot analysis of transiently expressed CL in HEK293T cells.
- TMAs tissue microarrays
- Controls included preimmune rabbit serum used at appropriate concentrations.
- Chromosome Conformation Capture (3C) 3C analysis was performed as previously described (31) with the following modifications. Approximately 4 x 10 6 whole cells were crosslinked by treating with 2% formaldehyde at room temperature for 10 min. The crosslinking was stopped with equimolar amount of glycine and vas were narvested and lysed in hypotonic buffer (10 mM Tris-HCl [ ⁇ H7.2], 2 mM MgCl 2 and 0.5% Triton X-100).
- the nuclei were then resuspended and incubated for 20 min on ice in CSK buffer (100 mM NaCl, 300 mM Sucrose, 10 mM PIPES [pH 6.8], 3mM MgCl 2 , 10 ⁇ M leupeptin, 1 mM EGTA, 1.2 mM PMSF and 0.5% Trion X-100).
- CSK buffer 100 mM NaCl, 300 mM Sucrose, 10 mM PIPES [pH 6.8], 3mM MgCl 2 , 10 ⁇ M leupeptin, 1 mM EGTA, 1.2 mM PMSF and 0.5% Trion X-100.
- the suspension was centrifuged for 5000 rpm at 4 0 C in a Hettich Mikro 22R centrifuge and the pellet was treated with 2M NaCl. After incubating for 10 min on ice, sufficient amount of water was added to reduce the NaCl concentration to 150 mM.
- RNAPII chromatin immunoprecipitation assay This sample was used to perform RNAPII chromatin immunoprecipitation assay as previously described (32).
- the chromatin immunoprecipitated with RNAPII antibody H-224, Santa Cruz Biotechnology Inc., USA
- BgIlI restriction enzyme New England Biolabs, UK
- T4 DNA ligase ligated with T4 DNA ligase (Roche, UK).
- the DNA was extracted with ethanol.
- PCR analysis on the extracted DNA was done using gene specific primers with TakaRa LA TaqTM from Takara Bio Inc., Japan.
- Tumour suppressor genes play a vital role in cell survival and maintenance.
- Silencing tumour suppressors signals for uncontrolled growth leading to cancer.
- As a fail safe mechanism cells undergo apoptosis when such signals for uncontrolled growth are detected.
- a human homolog of Escherichia coli mutL gene, colon caner nonpolyposis type 2 (MLHl), is one such gene that encodes a DNA mismatch repair gene. MLHl signals for repair mechanism initiated by DNA damage and induces apoptosis of tumour cells. This gene located in loci, 3p21.3, and accumulates various mutations and modifications as the cells ages.
- MLHl alternative splice variants are tissue specific and contribute to phenotypic variability in inherited cancers.
- CC sites encompassing the transcription unit. Scanning the MLHl sequence, we found a CC marker in the 8 intron and another in 3'UTR formed borders of an alternative splice variant. The 3 C analysis performed on these two sites show, the CC sites juxtapose only in normal patients. Whereas, tissue and fluid samples collected from ovarian cancer patients reveal no juxtaposition. Thus MLHl CC sites can be used as a marker to distinguish ovarian cancer.
- Tests for prostate diagnostics markers were conducted on cell lines, representing either benign or late stage of tumor growth.
- the genes of choice were PSA and BORIS.
- BORIS Brother of the regulator of imprinted sites
- PSA Prostate Specific Antigen
- KLK.3 human Kallikrein 3
- BPHl Benign Prostatic Hyperplasia
- the KLK3 transcription unit is also defined by two CC sites, one in the 5'UTR and the other in 3'UTR. The results show, these two CC sites cross-talk only in BPHl cells and not in U20S.
- PSA and BORIS can be used as biomarkers to identify benign and malignant prostate cancer cells respectively.
- BR5UTR4 GGCTGGAATTGCCCTAAAGT BR5UTR3 CCTATGAGGGGGCAGTATCA
- BR3UTR2 GCTCTTCCTGCTGGGAAAT BR3UTR1 TACAGGGGTGGAGACAGGTT First round of PCR Reaction
- PR5UTR2 CGTGATCCACCCATCTCAG PR5UTR1 CTATTGGGAGACCGAAGCAG
- the gene In normal tissue, the gene is expressed with alternative transcripts. One such transcript starts at the 8 th intron, where CCl is present and terminates at the CC2 marker. In ovarian cancer tissue, the gene is down regulated as it accumulates mutations, deletions and methylation leading to faulty or no transcripts. We found the CCl and 2 juxtaposition in normal tissues, and not in ovarian cancer tissues. This relates to the switch in the transcriptional mode of the gene in these tissues.
- BORIS has two CC sites, one in the 5' UTR and the other in the 3'UTR. In U20S cells, BORIS expression is not expected and hence no juxtaposition of CC markers should be seen. Whereas, in human prostate carcinoma cell line (LNCaP) BORIS is expressed. We found a CCl and CC2 juxtaposition in LNCaP and not in U20S.
- LNCaP human prostate carcinoma cell line
- KLK3 has two CC sites, one near the 5' UTR and the other in the 3 1 UTR. In U20S cells, KLK3 expression is not expected and hence no juxtaposition of CC markers should be seen. Whereas, in benign Prostatic hyperplasia cell line (BPH-I) KLK3 is expressed. Hence the CCl and CC2 juxtaposition is seen in BPH-I and not in U20S.
- BPH-I benign Prostatic hyperplasia cell line
- Pattern recognition analysis has been widely applied to various fields of study, such as medicine, engineering and linguistics where image analysis and data decoding allows identification of underlying characteristic markers within complex systems.
- a set of sequences from 422 manually annotated genes on human chromosome 22 was used for computational identification of regulatory signals present on the borders of the transcriptional units. Particular attention was given to identify the signals at the 3' end of transcription units. This proved to be functionally relevant as later experiments confirmed the signals have termination properties in vivo.
- the pattern found on the borders has multiplex signals and is represented in an XML format explaining 3 key aspects a.
- the DNA alphabets of each signals identified b.
- the positional variation of each signal as Gaussian distribution width c.
- CC markers on an unknown sequence can be identified using a set of code identified as 'Scanner', The Scanner need 3 input data from the user a.
- the Scanner reads the input DNA and tries to fit the patterns in the sequence. This is done by walking along the DNA sequence by taking each base as reference point. The scanner starts with the first base as reference point and tries to fit the pattern defined in the XML format. The extent of fitness is determined by a score. If this score is greater than the stringency factor supplied by the user, a CC marker was found. The position of the CC marker identified is given in a standard GFF format and the scanner moves to the second base in the input sequence. This process is repeated until the scanner reads all the bases on the input
- the end results of this scanning for the CC marker pattern will be a text file with potential CC marker positions on the input sequence with its respective score in GFF format.
- the 4 set of weights have a relative distance between each other with respect to the reference point.
- the first set of weight starts at position 8 with respect to the reference point.
- This first set of weight has 19 positional values for each type of nucleotide appearing at that position. For example, for the first position, a guanine will get a value of 0.19 and a thymine will score 0.33. Likewise, for the second position, a guanine will score 0.20 and a thymine will score 0.39. The second score is multiplied with the first score. This is repeated until all the 19 positional values are read and multiplied to its previous value.
- This process is repeated for other 3 set of weights as well, each time, multiplying the positional value to the previous score calculated so far.
- the final score from all the 4 set of weights is converted to an exponential value (inverse logarithmic) score, for easy handling.
- the logarithmic score is equal to 1.0/(l+e "x ) where X is the score obtained by the above process using the weights in Table 1. If this logarithmic score, is greater than 0.90 (for example) then that base is considered as CC marker.
- multiplying the positional values from all 4 set of weights gave an inverse logarithmic score of 0.99999. Since this value is greater than 0.99, 50 th base, A, is within CC marker sequence. Analysing other bases in the sequence allows identification of the sequence from the 41 st to the 56 th base as the CC marker (with a final score of 0.99968).
- the method described below broadly identifies the key steps in detecting CC marker juxtaposition in tissue samples. This is the first developed methodology for analysing frozen tissue samples from patients.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Saccharide Compounds (AREA)
- General Chemical & Material Sciences (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (13)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| HK09104232.1A HK1125416B (en) | 2006-02-17 | 2007-02-19 | Dna conformation (loop structures) in normal and abnormal gene expression |
| CA2642331A CA2642331C (en) | 2006-02-17 | 2007-02-19 | Dna conformation (loop structures) in abnormal gene expression in cancer |
| AU2007216315A AU2007216315B2 (en) | 2006-02-17 | 2007-02-19 | DNA conformation (loop structures) in normal and abnormal gene expression |
| CN2007800057991A CN101384734B (zh) | 2006-02-17 | 2007-02-19 | 正常和异常基因表达中的dna构象(环结构) |
| JP2008554852A JP5345857B2 (ja) | 2006-02-17 | 2007-02-19 | 正常および異常遺伝子発現におけるdnaの立体構造(ループ構造) |
| US12/279,133 US9777327B2 (en) | 2006-02-17 | 2007-02-19 | DNA conformation (loop structures) in normal and abnormal gene expression |
| EP07712741A EP1991697B1 (en) | 2006-02-17 | 2007-02-19 | Dna conformation (loop structures) in normal and abnormal gene expression |
| AT07712741T ATE519864T1 (de) | 2006-02-17 | 2007-02-19 | Dna-konformation (loop-strukturen) bei normaler und anomaler genexpression |
| MYPI20083134A MY182608A (en) | 2006-02-17 | 2007-02-19 | Dna conformation (loop structures) in normal and abnormal gene expression |
| DK07712741.3T DK1991697T3 (da) | 2006-02-17 | 2007-02-19 | DNA-konformation (LOOP-strukturer) ved normal og anormal genekspression |
| NZ571201A NZ571201A (en) | 2006-02-17 | 2007-02-19 | DNA Conformation (loop structures) in normal and abnormal gene expression |
| NO20083957A NO343718B1 (no) | 2006-02-17 | 2008-09-17 | Fremgangsmåte for diagnose av kreft ved påvisning av tilstedeværelse av en abnormal kromosomstruktur |
| US15/683,504 US11384396B2 (en) | 2006-02-17 | 2017-08-22 | DNA conformation (loop structures) in normal and abnormal gene expression |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB0603251.0 | 2006-02-17 | ||
| GBGB0603251.0A GB0603251D0 (en) | 2006-02-17 | 2006-02-17 | DNA conformation |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/279,133 A-371-Of-International US9777327B2 (en) | 2006-02-17 | 2007-02-19 | DNA conformation (loop structures) in normal and abnormal gene expression |
| US15/683,504 Continuation US11384396B2 (en) | 2006-02-17 | 2017-08-22 | DNA conformation (loop structures) in normal and abnormal gene expression |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2007093819A2 true WO2007093819A2 (en) | 2007-08-23 |
| WO2007093819A3 WO2007093819A3 (en) | 2007-10-04 |
Family
ID=36142050
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2007/000564 Ceased WO2007093819A2 (en) | 2006-02-17 | 2007-02-19 | Dna conformation (loop structures) in normal and abnormal gene expression |
Country Status (15)
| Country | Link |
|---|---|
| US (2) | US9777327B2 (https=) |
| EP (1) | EP1991697B1 (https=) |
| JP (1) | JP5345857B2 (https=) |
| CN (1) | CN101384734B (https=) |
| AT (1) | ATE519864T1 (https=) |
| AU (1) | AU2007216315B2 (https=) |
| CA (1) | CA2642331C (https=) |
| DK (1) | DK1991697T3 (https=) |
| ES (1) | ES2368767T3 (https=) |
| GB (1) | GB0603251D0 (https=) |
| MY (1) | MY182608A (https=) |
| NO (1) | NO343718B1 (https=) |
| NZ (1) | NZ571201A (https=) |
| WO (1) | WO2007093819A2 (https=) |
| ZA (1) | ZA200807948B (https=) |
Cited By (50)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8580520B2 (en) | 2008-09-15 | 2013-11-12 | Herlev Hospital | YKL-40 as a marker for gastrointestinal cancers |
| US8697384B2 (en) | 2008-01-23 | 2014-04-15 | Herlev Hospital | YKL-40 as a general marker for non-specific disease |
| US20140162271A1 (en) * | 2008-06-02 | 2014-06-12 | Oxford Biodynamics Limited | Methods of detecting long range chromosomal interactions |
| WO2016207661A1 (en) * | 2015-06-24 | 2016-12-29 | Oxford Biodynamics Limited | Detection processes using sites of chromosome interaction |
| US10059989B2 (en) | 2013-05-23 | 2018-08-28 | The Board Of Trustees Of The Leland Stanford Junior University | Transposition of native chromatin for personal epigenomics |
| US10208343B2 (en) | 2014-06-26 | 2019-02-19 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10221442B2 (en) | 2012-08-14 | 2019-03-05 | 10X Genomics, Inc. | Compositions and methods for sample processing |
| US10221436B2 (en) | 2015-01-12 | 2019-03-05 | 10X Genomics, Inc. | Processes and systems for preparation of nucleic acid sequencing libraries and libraries prepared using same |
| US10227648B2 (en) | 2012-12-14 | 2019-03-12 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10273541B2 (en) | 2012-08-14 | 2019-04-30 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10287623B2 (en) | 2014-10-29 | 2019-05-14 | 10X Genomics, Inc. | Methods and compositions for targeted nucleic acid sequencing |
| US10318706B2 (en) | 2015-02-17 | 2019-06-11 | Dovetail Genomics, Llc | Nucleic acid sequence assembly |
| US10323279B2 (en) | 2012-08-14 | 2019-06-18 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10323278B2 (en) | 2016-12-22 | 2019-06-18 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10343166B2 (en) | 2014-04-10 | 2019-07-09 | 10X Genomics, Inc. | Fluidic devices, systems, and methods for encapsulating and partitioning reagents, and applications of same |
| US10400235B2 (en) | 2017-05-26 | 2019-09-03 | 10X Genomics, Inc. | Single cell analysis of transposase accessible chromatin |
| US10400280B2 (en) | 2012-08-14 | 2019-09-03 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10428326B2 (en) | 2017-01-30 | 2019-10-01 | 10X Genomics, Inc. | Methods and systems for droplet-based single cell barcoding |
| US10457934B2 (en) | 2015-10-19 | 2019-10-29 | Dovetail Genomics, Llc | Methods for genome assembly, haplotype phasing, and target independent nucleic acid detection |
| US10526641B2 (en) | 2014-08-01 | 2020-01-07 | Dovetail Genomics, Llc | Tagging nucleic acids for sequence assembly |
| US10533221B2 (en) | 2012-12-14 | 2020-01-14 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10550429B2 (en) | 2016-12-22 | 2020-02-04 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10676789B2 (en) | 2012-12-14 | 2020-06-09 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10697000B2 (en) | 2015-02-24 | 2020-06-30 | 10X Genomics, Inc. | Partition processing methods and systems |
| US10745742B2 (en) | 2017-11-15 | 2020-08-18 | 10X Genomics, Inc. | Functionalized gel beads |
| US10752949B2 (en) | 2012-08-14 | 2020-08-25 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10774370B2 (en) | 2015-12-04 | 2020-09-15 | 10X Genomics, Inc. | Methods and compositions for nucleic acid analysis |
| US10815525B2 (en) | 2016-12-22 | 2020-10-27 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10829815B2 (en) | 2017-11-17 | 2020-11-10 | 10X Genomics, Inc. | Methods and systems for associating physical and genetic properties of biological particles |
| US10947579B2 (en) | 2016-05-13 | 2021-03-16 | Dovetail Genomics, Llc | Recovering long-range linkage information from preserved samples |
| US10975417B2 (en) | 2016-02-23 | 2021-04-13 | Dovetail Genomics, Llc | Generation of phased read-sets for genome assembly and haplotype phasing |
| US11078522B2 (en) | 2012-08-14 | 2021-08-03 | 10X Genomics, Inc. | Capsule array devices and methods of use |
| US11084036B2 (en) | 2016-05-13 | 2021-08-10 | 10X Genomics, Inc. | Microfluidic systems and methods of use |
| US11135584B2 (en) | 2014-11-05 | 2021-10-05 | 10X Genomics, Inc. | Instrument systems for integrated sample processing |
| US11155881B2 (en) | 2018-04-06 | 2021-10-26 | 10X Genomics, Inc. | Systems and methods for quality control in single cell processing |
| US11193121B2 (en) | 2013-02-08 | 2021-12-07 | 10X Genomics, Inc. | Partitioning and processing of analytes and other species |
| US11274343B2 (en) | 2015-02-24 | 2022-03-15 | 10X Genomics, Inc. | Methods and compositions for targeted nucleic acid sequence coverage |
| US11560597B2 (en) | 2016-12-01 | 2023-01-24 | Oxford BioDynamics, PLC | Application of epigenetic chromosomal interactions in cancer diagnostics |
| US11591637B2 (en) | 2012-08-14 | 2023-02-28 | 10X Genomics, Inc. | Compositions and methods for sample processing |
| US11629344B2 (en) | 2014-06-26 | 2023-04-18 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11746378B2 (en) | 2016-05-06 | 2023-09-05 | Oxford BioDynamics PLC | Detection of chromosome interaction relevant to breast cancer |
| US11773389B2 (en) | 2017-05-26 | 2023-10-03 | 10X Genomics, Inc. | Single cell analysis of transposase accessible chromatin |
| US11807896B2 (en) | 2015-03-26 | 2023-11-07 | Dovetail Genomics, Llc | Physical linkage preservation in DNA storage |
| US11840737B2 (en) | 2017-11-03 | 2023-12-12 | Oxford BioDynamics PLC | Genetic regulation of immunoresponse by chromosome interactions |
| US12163191B2 (en) | 2014-06-26 | 2024-12-10 | 10X Genomics, Inc. | Analysis of nucleic acid sequences |
| US12264411B2 (en) | 2017-01-30 | 2025-04-01 | 10X Genomics, Inc. | Methods and systems for analysis |
| US12312640B2 (en) | 2014-06-26 | 2025-05-27 | 10X Genomics, Inc. | Analysis of nucleic acid sequences |
| US12377396B2 (en) | 2018-02-05 | 2025-08-05 | The Board Of Trustees Of The Leland Stanford Junior University | Systems and methods for multiplexed measurements in single and ensemble cells |
| US12378592B2 (en) | 2018-01-31 | 2025-08-05 | Dovetail Genomics, Llc. | Sample prep for DNA linkage recovery |
| US12427518B2 (en) | 2016-05-12 | 2025-09-30 | 10X Genomics, Inc. | Microfluidic on-chip filters |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB0603251D0 (en) | 2006-02-17 | 2006-03-29 | Isis Innovation | DNA conformation |
| WO2012005595A2 (en) * | 2010-07-09 | 2012-01-12 | Wouter Leonard De Laat | V3-d genomic region of interest sequencing strategies |
| US9411930B2 (en) * | 2013-02-01 | 2016-08-09 | The Regents Of The University Of California | Methods for genome assembly and haplotype phasing |
| CN110225981B (zh) * | 2016-12-23 | 2024-03-15 | 牛津生物动力有限责任公司 | 分型方法 |
| CA3128973A1 (en) | 2019-03-04 | 2020-09-10 | Bhaskar Bhattacharyya | Data compression and communication using machine learning |
| AU2020381516A1 (en) * | 2019-11-15 | 2022-06-02 | Phase Genomics Inc. | Chromosome conformation capture from tissue samples |
| CN114550817B (zh) * | 2022-01-25 | 2022-12-23 | 云南大学 | 基于多特征的ctcf介导染色质环预测方法 |
| CN114841294B (zh) * | 2022-07-04 | 2022-10-28 | 杭州德适生物科技有限公司 | 一种检测染色体结构异常的分类器模型训练方法及装置 |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2002220521A1 (en) | 2000-11-29 | 2002-06-11 | Statens Seruminstitut | A screening assay for detecting chromosome rearrangements or recombinations |
| CN1231596C (zh) * | 2001-12-27 | 2005-12-14 | 赵兴波 | 利用线粒体dna指纹进行动物遗传信息鉴定的方法 |
| CN1515692A (zh) * | 2003-01-02 | 2004-07-28 | 缪金明 | “锚定点灯”式寡核苷酸芯片的检测技术 |
| EP2295604B1 (en) | 2004-02-09 | 2015-04-08 | Thomas Jefferson University | Diagnosis and treatment of cancers with microRNA located in or near cancer-associated chromosomal features |
| US20060015264A1 (en) | 2004-06-02 | 2006-01-19 | Mcshea Andrew | Interfering stem-loop sequences and method for identifying |
| CA2614118C (en) * | 2005-07-04 | 2013-11-26 | Erasmus University Medical Center | 4c |
| GB0603251D0 (en) | 2006-02-17 | 2006-03-29 | Isis Innovation | DNA conformation |
-
2006
- 2006-02-17 GB GBGB0603251.0A patent/GB0603251D0/en not_active Ceased
-
2007
- 2007-02-19 US US12/279,133 patent/US9777327B2/en active Active
- 2007-02-19 ES ES07712741T patent/ES2368767T3/es active Active
- 2007-02-19 CA CA2642331A patent/CA2642331C/en active Active
- 2007-02-19 EP EP07712741A patent/EP1991697B1/en active Active
- 2007-02-19 MY MYPI20083134A patent/MY182608A/en unknown
- 2007-02-19 NZ NZ571201A patent/NZ571201A/en unknown
- 2007-02-19 AT AT07712741T patent/ATE519864T1/de not_active IP Right Cessation
- 2007-02-19 DK DK07712741.3T patent/DK1991697T3/da active
- 2007-02-19 CN CN2007800057991A patent/CN101384734B/zh active Active
- 2007-02-19 WO PCT/GB2007/000564 patent/WO2007093819A2/en not_active Ceased
- 2007-02-19 ZA ZA200807948A patent/ZA200807948B/xx unknown
- 2007-02-19 JP JP2008554852A patent/JP5345857B2/ja active Active
- 2007-02-19 AU AU2007216315A patent/AU2007216315B2/en active Active
-
2008
- 2008-09-17 NO NO20083957A patent/NO343718B1/no unknown
-
2017
- 2017-08-22 US US15/683,504 patent/US11384396B2/en active Active
Non-Patent Citations (10)
| Title |
|---|
| A. RAMADASS ET AL: "Regulation of the hDHFR gene transcription by the dynamic switch between quasi-stable gene loops"[Online] 4 April 2005 (2005-04-04), page 1, XP002438087 Transcription UK Retrieved from the Internet: URL:http://www.biochemistry.org/meetings/abstracts/SA035/SA035P037.pdf> [retrieved on 2007-06-18] * |
| AKOULITCHEV / RAMADASS: "Checkpoint Charlie: marker - From transcription termination to alternative quasi-stable gene loops / Regulation of the gene transcription by dynamic switch between quasi-stable gene loops"[Online] 9 August 2005 (2005-08-09), pages 1-16, XP002438089 Mechanism of Eukaryotic Transciption Retrieved from the Internet: URL:http://meetings.cshl.edu/meetings/pastprograms/2005%20Past%20Programs/ccell%20program%20report.pdf> [retrieved on 2006-06-16] * |
| BLANTON JASON ET AL: "Protein:protein interactions and the pairing of boundary elements in vivo." GENES & DEVELOPMENT 1 MAR 2003, vol. 17, no. 5, 1 March 2003 (2003-03-01), pages 664-675, XP002438092 ISSN: 0890-9369 cited in the application * |
| BYRD KEITH ET AL: "Visualization of chromatin domains created by the gypsy insulator of Drosophila." THE JOURNAL OF CELL BIOLOGY 18 AUG 2003, vol. 162, no. 4, 18 August 2003 (2003-08-18), pages 565-574, XP002438091 ISSN: 0021-9525 * |
| DEKKER J ET AL: "Capturing chromosome conformation" SCIENCE, AMERICAN ASSOCIATION FOR THE ADVANCEMENT OF SCIENCE,, US, vol. 295, no. 5558, 15 February 2002 (2002-02-15), pages 1306-1311, XP002301470 ISSN: 0036-8075 cited in the application * |
| DEKKER J: "A closer look at long-range chromosomal interactions" TRENDS IN BIOCHEMICAL SCIENCES, ELSEVIER, HAYWARDS, GB, vol. 28, no. 6, June 2003 (2003-06), pages 277-280, XP004433004 ISSN: 0968-0004 * |
| MIKE WEST ET AL: "DYNAMIC GENERALIZED LINEAR MODELS AND BAYESIAN FORECASTING" JOURNAL OF THE AMERICAN STATISTICAL ASSOCIATION, AMERICAN STATISTICAL ASSOCIATION, NEW YORK, US, vol. 80, March 1985 (1985-03), pages 73-83, XP009085285 ISSN: 0162-1459 * |
| PARNELL T J ET AL: "An endogenous Suppressor of Hairy-wing insulator separates regulatory domains in Drosophila" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA 11 NOV 2003 UNITED STATES, vol. 100, no. 23, 11 November 2003 (2003-11-11), pages 13436-13441, XP002438090 ISSN: 0027-8424 * |
| SASHA AKOULITCHEV: "Checkpoint Charlie: from terminating ribozymes to alternative gene loops"[Online] 15 May 2005 (2005-05-15), pages 1-3, XP002438088 Transcription Workshop 2005 Retrieved from the Internet: URL:http://www.mcri.ac.uk/workshops/Transcription05.asp> [retrieved on 2007-06-16] * |
| WEI GUO ET AL: "MECHANISMS OF METHOTREXATE RESISTANCE IN OSTEOSARCOMA" CLINICAL CANCER RESEARCH, THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 5, March 1999 (1999-03), pages 621-627, XP002944952 ISSN: 1078-0432 * |
Cited By (121)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8697384B2 (en) | 2008-01-23 | 2014-04-15 | Herlev Hospital | YKL-40 as a general marker for non-specific disease |
| US20140162271A1 (en) * | 2008-06-02 | 2014-06-12 | Oxford Biodynamics Limited | Methods of detecting long range chromosomal interactions |
| US10844423B2 (en) * | 2008-06-02 | 2020-11-24 | Oxford BioDynamics PLC | Methods of detecting long range chromosomal interactions |
| US8580520B2 (en) | 2008-09-15 | 2013-11-12 | Herlev Hospital | YKL-40 as a marker for gastrointestinal cancers |
| US10221442B2 (en) | 2012-08-14 | 2019-03-05 | 10X Genomics, Inc. | Compositions and methods for sample processing |
| US10752950B2 (en) | 2012-08-14 | 2020-08-25 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US12037634B2 (en) | 2012-08-14 | 2024-07-16 | 10X Genomics, Inc. | Capsule array devices and methods of use |
| US10597718B2 (en) | 2012-08-14 | 2020-03-24 | 10X Genomics, Inc. | Methods and systems for sample processing polynucleotides |
| US10584381B2 (en) | 2012-08-14 | 2020-03-10 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11078522B2 (en) | 2012-08-14 | 2021-08-03 | 10X Genomics, Inc. | Capsule array devices and methods of use |
| US10626458B2 (en) | 2012-08-14 | 2020-04-21 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11591637B2 (en) | 2012-08-14 | 2023-02-28 | 10X Genomics, Inc. | Compositions and methods for sample processing |
| US10669583B2 (en) | 2012-08-14 | 2020-06-02 | 10X Genomics, Inc. | Method and systems for processing polynucleotides |
| US10752949B2 (en) | 2012-08-14 | 2020-08-25 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10273541B2 (en) | 2012-08-14 | 2019-04-30 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US12098423B2 (en) | 2012-08-14 | 2024-09-24 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10450607B2 (en) | 2012-08-14 | 2019-10-22 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11441179B2 (en) | 2012-08-14 | 2022-09-13 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10323279B2 (en) | 2012-08-14 | 2019-06-18 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11021749B2 (en) | 2012-08-14 | 2021-06-01 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11035002B2 (en) | 2012-08-14 | 2021-06-15 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11359239B2 (en) | 2012-08-14 | 2022-06-14 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10400280B2 (en) | 2012-08-14 | 2019-09-03 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10676789B2 (en) | 2012-12-14 | 2020-06-09 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10227648B2 (en) | 2012-12-14 | 2019-03-12 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10253364B2 (en) | 2012-12-14 | 2019-04-09 | 10X Genomics, Inc. | Method and systems for processing polynucleotides |
| US10612090B2 (en) | 2012-12-14 | 2020-04-07 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11421274B2 (en) | 2012-12-14 | 2022-08-23 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11473138B2 (en) | 2012-12-14 | 2022-10-18 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10533221B2 (en) | 2012-12-14 | 2020-01-14 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11193121B2 (en) | 2013-02-08 | 2021-12-07 | 10X Genomics, Inc. | Partitioning and processing of analytes and other species |
| US11597974B2 (en) | 2013-05-23 | 2023-03-07 | The Board Of Trustees Of The Leland Stanford Junior University | Transposition of native chromatin for personal epigenomics |
| US10738357B2 (en) | 2013-05-23 | 2020-08-11 | The Board Of Trustees Of The Leland Stanford Junior University | Transportation of native chromatin for personal epigenomics |
| US10889859B2 (en) | 2013-05-23 | 2021-01-12 | The Board Of Trustees Of The Leland Stanford Junior University | Transposition of native chromatin for personal epigenomics |
| US11519032B1 (en) | 2013-05-23 | 2022-12-06 | The Board Of Trustees Of The Leland Stanford Junior University | Transposition of native chromatin for personal epigenomics |
| US10150995B1 (en) | 2013-05-23 | 2018-12-11 | The Board Of Trustees Of The Leland Stanford Junior University | Transposition of native chromatin for personal epigenomics |
| US10059989B2 (en) | 2013-05-23 | 2018-08-28 | The Board Of Trustees Of The Leland Stanford Junior University | Transposition of native chromatin for personal epigenomics |
| US10337062B2 (en) | 2013-05-23 | 2019-07-02 | The Board Of Trustees Of The Leland Stanford Junior University | Transposition of native chromatin for personal epigenomics |
| US10619207B2 (en) | 2013-05-23 | 2020-04-14 | The Board Of Trustees Of The Leland Stanford Junior University | Transposition of native chromatin for personal epigenomics |
| US10343166B2 (en) | 2014-04-10 | 2019-07-09 | 10X Genomics, Inc. | Fluidic devices, systems, and methods for encapsulating and partitioning reagents, and applications of same |
| US12005454B2 (en) | 2014-04-10 | 2024-06-11 | 10X Genomics, Inc. | Fluidic devices, systems, and methods for encapsulating and partitioning reagents, and applications of same |
| US11713457B2 (en) | 2014-06-26 | 2023-08-01 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10344329B2 (en) | 2014-06-26 | 2019-07-09 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10337061B2 (en) | 2014-06-26 | 2019-07-02 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10208343B2 (en) | 2014-06-26 | 2019-02-19 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11629344B2 (en) | 2014-06-26 | 2023-04-18 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10457986B2 (en) | 2014-06-26 | 2019-10-29 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US12312640B2 (en) | 2014-06-26 | 2025-05-27 | 10X Genomics, Inc. | Analysis of nucleic acid sequences |
| US10480028B2 (en) | 2014-06-26 | 2019-11-19 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10760124B2 (en) | 2014-06-26 | 2020-09-01 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US12163191B2 (en) | 2014-06-26 | 2024-12-10 | 10X Genomics, Inc. | Analysis of nucleic acid sequences |
| US10526641B2 (en) | 2014-08-01 | 2020-01-07 | Dovetail Genomics, Llc | Tagging nucleic acids for sequence assembly |
| US12180535B2 (en) | 2014-08-01 | 2024-12-31 | Dovetail Genomics, Llc | Tagging nucleic acids for sequence assembly |
| US10287623B2 (en) | 2014-10-29 | 2019-05-14 | 10X Genomics, Inc. | Methods and compositions for targeted nucleic acid sequencing |
| US11739368B2 (en) | 2014-10-29 | 2023-08-29 | 10X Genomics, Inc. | Methods and compositions for targeted nucleic acid sequencing |
| US11135584B2 (en) | 2014-11-05 | 2021-10-05 | 10X Genomics, Inc. | Instrument systems for integrated sample processing |
| US10221436B2 (en) | 2015-01-12 | 2019-03-05 | 10X Genomics, Inc. | Processes and systems for preparation of nucleic acid sequencing libraries and libraries prepared using same |
| US11414688B2 (en) | 2015-01-12 | 2022-08-16 | 10X Genomics, Inc. | Processes and systems for preparation of nucleic acid sequencing libraries and libraries prepared using same |
| US12553074B2 (en) | 2015-01-12 | 2026-02-17 | 10X Genomics, Inc. | Processes and systems for preparation of nucleic acid sequencing libraries and libraries prepared using same |
| US10557158B2 (en) | 2015-01-12 | 2020-02-11 | 10X Genomics, Inc. | Processes and systems for preparation of nucleic acid sequencing libraries and libraries prepared using same |
| US10318706B2 (en) | 2015-02-17 | 2019-06-11 | Dovetail Genomics, Llc | Nucleic acid sequence assembly |
| US11600361B2 (en) | 2015-02-17 | 2023-03-07 | Dovetail Genomics, Llc | Nucleic acid sequence assembly |
| US11274343B2 (en) | 2015-02-24 | 2022-03-15 | 10X Genomics, Inc. | Methods and compositions for targeted nucleic acid sequence coverage |
| US11603554B2 (en) | 2015-02-24 | 2023-03-14 | 10X Genomics, Inc. | Partition processing methods and systems |
| US10697000B2 (en) | 2015-02-24 | 2020-06-30 | 10X Genomics, Inc. | Partition processing methods and systems |
| US11807896B2 (en) | 2015-03-26 | 2023-11-07 | Dovetail Genomics, Llc | Physical linkage preservation in DNA storage |
| WO2016207653A1 (en) * | 2015-06-24 | 2016-12-29 | Oxford Biodynamics Limited | Detection of chromosome interactions |
| CN108138222B (zh) * | 2015-06-24 | 2022-05-31 | 牛津生物动力公开有限公司 | 表观遗传染色体相互作用 |
| US11795496B2 (en) | 2015-06-24 | 2023-10-24 | Oxford BioDynamics PLC | Epigenetic chromosome interactions |
| WO2016207661A1 (en) * | 2015-06-24 | 2016-12-29 | Oxford Biodynamics Limited | Detection processes using sites of chromosome interaction |
| EP3822367A1 (en) * | 2015-06-24 | 2021-05-19 | Oxford BioDynamics PLC | Detection processes using sites of chromosome interaction |
| US11802305B2 (en) | 2015-06-24 | 2023-10-31 | Oxford BioDynamics PLC | Detection processes using sites of chromosome interaction |
| AU2016281766B2 (en) * | 2015-06-24 | 2019-05-09 | Oxford BioDynamics PLC | Epigenetic chromosome interactions |
| US11434522B1 (en) | 2015-06-24 | 2022-09-06 | Oxford BioDynamics PLC | Detection of chromosome interactions |
| AU2016281776B2 (en) * | 2015-06-24 | 2019-09-05 | Oxford BioDynamics PLC | Detection processes using sites of chromosome interaction |
| WO2016207647A1 (en) * | 2015-06-24 | 2016-12-29 | Oxford Biodynamics Limited | Epigenetic chromosome interactions |
| CN108138222A (zh) * | 2015-06-24 | 2018-06-08 | 牛津生物动力有限公司 | 表观遗传染色体相互作用 |
| US10457934B2 (en) | 2015-10-19 | 2019-10-29 | Dovetail Genomics, Llc | Methods for genome assembly, haplotype phasing, and target independent nucleic acid detection |
| US11873528B2 (en) | 2015-12-04 | 2024-01-16 | 10X Genomics, Inc. | Methods and compositions for nucleic acid analysis |
| US12421539B2 (en) | 2015-12-04 | 2025-09-23 | 10X Genomics, Inc. | Methods and compositions for nucleic acid analysis |
| US11624085B2 (en) | 2015-12-04 | 2023-04-11 | 10X Genomics, Inc. | Methods and compositions for nucleic acid analysis |
| US11473125B2 (en) | 2015-12-04 | 2022-10-18 | 10X Genomics, Inc. | Methods and compositions for nucleic acid analysis |
| US10774370B2 (en) | 2015-12-04 | 2020-09-15 | 10X Genomics, Inc. | Methods and compositions for nucleic acid analysis |
| US10975417B2 (en) | 2016-02-23 | 2021-04-13 | Dovetail Genomics, Llc | Generation of phased read-sets for genome assembly and haplotype phasing |
| US12404537B2 (en) | 2016-02-23 | 2025-09-02 | Dovetail Genomics, Llc | Generation of phased read-sets for genome assembly and haplotype phasing |
| US11746378B2 (en) | 2016-05-06 | 2023-09-05 | Oxford BioDynamics PLC | Detection of chromosome interaction relevant to breast cancer |
| US12427518B2 (en) | 2016-05-12 | 2025-09-30 | 10X Genomics, Inc. | Microfluidic on-chip filters |
| US12065691B2 (en) | 2016-05-13 | 2024-08-20 | Dovetail Genomics, Llc | Recovering long-range linkage information from preserved samples |
| US12138628B2 (en) | 2016-05-13 | 2024-11-12 | 10X Genomics, Inc. | Microfluidic systems and methods of use |
| US10947579B2 (en) | 2016-05-13 | 2021-03-16 | Dovetail Genomics, Llc | Recovering long-range linkage information from preserved samples |
| US11084036B2 (en) | 2016-05-13 | 2021-08-10 | 10X Genomics, Inc. | Microfluidic systems and methods of use |
| EP4357463A3 (en) * | 2016-12-01 | 2024-07-17 | Oxford BioDynamics PLC | Application of epigenetic chromsomal interactions in cancer diagnostics |
| US11560597B2 (en) | 2016-12-01 | 2023-01-24 | Oxford BioDynamics, PLC | Application of epigenetic chromosomal interactions in cancer diagnostics |
| US11180805B2 (en) | 2016-12-22 | 2021-11-23 | 10X Genomics, Inc | Methods and systems for processing polynucleotides |
| US10480029B2 (en) | 2016-12-22 | 2019-11-19 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10793905B2 (en) | 2016-12-22 | 2020-10-06 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US12534760B2 (en) | 2016-12-22 | 2026-01-27 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10815525B2 (en) | 2016-12-22 | 2020-10-27 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10550429B2 (en) | 2016-12-22 | 2020-02-04 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US12084716B2 (en) | 2016-12-22 | 2024-09-10 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10323278B2 (en) | 2016-12-22 | 2019-06-18 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10858702B2 (en) | 2016-12-22 | 2020-12-08 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US12264411B2 (en) | 2017-01-30 | 2025-04-01 | 10X Genomics, Inc. | Methods and systems for analysis |
| US10428326B2 (en) | 2017-01-30 | 2019-10-01 | 10X Genomics, Inc. | Methods and systems for droplet-based single cell barcoding |
| US12600961B2 (en) | 2017-01-30 | 2026-04-14 | 10X Genomics, Inc. | Methods and systems for droplet-based single cell barcoding |
| US11193122B2 (en) | 2017-01-30 | 2021-12-07 | 10X Genomics, Inc. | Methods and systems for droplet-based single cell barcoding |
| US12264316B2 (en) | 2017-01-30 | 2025-04-01 | 10X Genomics, Inc. | Methods and systems for droplet-based single cell barcoding |
| US11155810B2 (en) | 2017-05-26 | 2021-10-26 | 10X Genomics, Inc. | Single cell analysis of transposase accessible chromatin |
| US11773389B2 (en) | 2017-05-26 | 2023-10-03 | 10X Genomics, Inc. | Single cell analysis of transposase accessible chromatin |
| US10400235B2 (en) | 2017-05-26 | 2019-09-03 | 10X Genomics, Inc. | Single cell analysis of transposase accessible chromatin |
| US10927370B2 (en) | 2017-05-26 | 2021-02-23 | 10X Genomics, Inc. | Single cell analysis of transposase accessible chromatin |
| US10844372B2 (en) | 2017-05-26 | 2020-11-24 | 10X Genomics, Inc. | Single cell analysis of transposase accessible chromatin |
| US11198866B2 (en) | 2017-05-26 | 2021-12-14 | 10X Genomics, Inc. | Single cell analysis of transposase accessible chromatin |
| US11840737B2 (en) | 2017-11-03 | 2023-12-12 | Oxford BioDynamics PLC | Genetic regulation of immunoresponse by chromosome interactions |
| US10876147B2 (en) | 2017-11-15 | 2020-12-29 | 10X Genomics, Inc. | Functionalized gel beads |
| US11884962B2 (en) | 2017-11-15 | 2024-01-30 | 10X Genomics, Inc. | Functionalized gel beads |
| US10745742B2 (en) | 2017-11-15 | 2020-08-18 | 10X Genomics, Inc. | Functionalized gel beads |
| US10829815B2 (en) | 2017-11-17 | 2020-11-10 | 10X Genomics, Inc. | Methods and systems for associating physical and genetic properties of biological particles |
| US12378592B2 (en) | 2018-01-31 | 2025-08-05 | Dovetail Genomics, Llc. | Sample prep for DNA linkage recovery |
| US12377396B2 (en) | 2018-02-05 | 2025-08-05 | The Board Of Trustees Of The Leland Stanford Junior University | Systems and methods for multiplexed measurements in single and ensemble cells |
| US11155881B2 (en) | 2018-04-06 | 2021-10-26 | 10X Genomics, Inc. | Systems and methods for quality control in single cell processing |
Also Published As
| Publication number | Publication date |
|---|---|
| MY182608A (en) | 2021-01-26 |
| JP2009526543A (ja) | 2009-07-23 |
| DK1991697T3 (da) | 2011-09-19 |
| HK1125416A1 (en) | 2009-08-07 |
| CA2642331A1 (en) | 2007-08-23 |
| JP5345857B2 (ja) | 2013-11-20 |
| ZA200807948B (en) | 2009-11-25 |
| AU2007216315B2 (en) | 2012-10-04 |
| CA2642331C (en) | 2018-06-19 |
| EP1991697B1 (en) | 2011-08-10 |
| ATE519864T1 (de) | 2011-08-15 |
| NO343718B1 (no) | 2019-05-20 |
| US11384396B2 (en) | 2022-07-12 |
| CN101384734B (zh) | 2013-10-30 |
| ES2368767T3 (es) | 2011-11-22 |
| AU2007216315A1 (en) | 2007-08-23 |
| US9777327B2 (en) | 2017-10-03 |
| US20180080081A1 (en) | 2018-03-22 |
| GB0603251D0 (en) | 2006-03-29 |
| CN101384734A (zh) | 2009-03-11 |
| EP1991697A2 (en) | 2008-11-19 |
| NO20083957L (no) | 2008-11-14 |
| US20090186352A1 (en) | 2009-07-23 |
| NZ571201A (en) | 2011-07-29 |
| WO2007093819A3 (en) | 2007-10-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11384396B2 (en) | DNA conformation (loop structures) in normal and abnormal gene expression | |
| Michiels et al. | Genes differentially expressed in medulloblastoma and fetal brain | |
| KR20140105836A (ko) | 다유전자 바이오마커의 확인 | |
| Rauhala et al. | Clusterin is epigenetically regulated in prostate cancer | |
| WO2012097053A1 (en) | Methods, systems, databases, kits and arrays for screening for and predicting the risk of and identifying the presence of tumors and cancers | |
| KR20180108820A (ko) | 암 후생유전적 프로파일링 | |
| EP3122905A2 (en) | Circulating micrornas as biomarkers for endometriosis | |
| US20160355887A1 (en) | Gene expression profiling for the diagnosis of prostate cancer | |
| CN109735623B (zh) | 一种结直肠癌生物标志物 | |
| Glinsky et al. | Microarray analysis of xenograft‐derived cancer cell lines representing multiple experimental models of human prostate cancer | |
| Shibata et al. | Detection of DNA fusion junctions for BCR-ABL translocations by Anchored ChromPET | |
| CN111187840A (zh) | 一种用于早期乳腺癌诊断的生物标志物 | |
| Hasan et al. | Over expression of brain and acute leukemia, cytoplasmic and ETS‐related gene is associated with poor outcome in acute myeloid leukemia | |
| US20180105878A1 (en) | Biomarker of detecting a biological sample, probe, kit and method of non-invasively and qualitatively determining severity of endometriosis | |
| HK1125416B (en) | Dna conformation (loop structures) in normal and abnormal gene expression | |
| CN110592227B (zh) | 生物标志物在乳腺癌中的应用 | |
| US20160340745A1 (en) | Gene expression profiling for the diagnosis of prostate cancer | |
| EP3842552A1 (en) | Kit for in vitro testing panel of genes in pap smear samples for endometriosis and method of non-invasively and qualitatively determining severity of endometriosis | |
| Ooi | Post-GWAS functional characterisation of colorectal cancer risk loci | |
| CN108866198B (zh) | 标志物loc105376380在直肠腺癌诊断和治疗中的应用 | |
| US20200172976A1 (en) | Kit for in vitro testing panel of genes in pap smear samples for endometriosis and method of non-invasively and qualitatively determining severity of endometriosis using the kit | |
| Balsamo | M. Scatolini, MM Grand, E. Grosso, T. Venesio, A. Pisacane, A. Balsamo, R. Sirovich, M. Risio and G. Chiorino. Altered molecular pathways in melanocytic lesions. International Journal of Cancer, 126, 8, 2010, 10.1002/ijc. 24899. | |
| HK40049419A (en) | Circulating micrornas as biomarkers for endometriosis | |
| Mahas | Distinguishing Melanocytic Nevi From Melanoma by DNA Copy Number Changes: Array-Comparative Genomic Hybridization As a Research Tool | |
| Jewell | Predictors of treatment benefit and prognosis in cutaneous malignant melanoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2642331 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008554852 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200780005799.1 Country of ref document: CN |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 7636/DELNP/2008 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 571201 Country of ref document: NZ Ref document number: 2007712741 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007216315 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2007216315 Country of ref document: AU Date of ref document: 20070219 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12279133 Country of ref document: US |