WO2007090911A1 - Secuencia de nucleótidos y péptidos gse 24.2 de la disquerina inductores de la actividad telomerasa, procedimiento de obtención, composiciones terapéuticas y sus aplicaciones - Google Patents

Secuencia de nucleótidos y péptidos gse 24.2 de la disquerina inductores de la actividad telomerasa, procedimiento de obtención, composiciones terapéuticas y sus aplicaciones Download PDF

Info

Publication number
WO2007090911A1
WO2007090911A1 PCT/ES2006/070152 ES2006070152W WO2007090911A1 WO 2007090911 A1 WO2007090911 A1 WO 2007090911A1 ES 2006070152 W ES2006070152 W ES 2006070152W WO 2007090911 A1 WO2007090911 A1 WO 2007090911A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
gse
nucleotide sequence
cells
pharmaceutical composition
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/ES2006/070152
Other languages
English (en)
Spanish (es)
French (fr)
Inventor
Rosario PERONA ABELLÓN
Rosario Machado Pinilla
Leandro SASTRE GARZÓN
Isabel SÁNCHEZ PÉREZ
José Ramón MURGUIA IBÁÑEZ
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Consejo Superior de Investigaciones Cientificas CSIC
Universidad Politecnica de Valencia
Universidad Autonoma de Madrid
Original Assignee
Consejo Superior de Investigaciones Cientificas CSIC
Universidad Politecnica de Valencia
Universidad Autonoma de Madrid
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Consejo Superior de Investigaciones Cientificas CSIC, Universidad Politecnica de Valencia, Universidad Autonoma de Madrid filed Critical Consejo Superior de Investigaciones Cientificas CSIC
Priority to CA002625981A priority Critical patent/CA2625981A1/en
Priority to DK06849419.4T priority patent/DK1947175T3/da
Priority to EP06849419A priority patent/EP1947175B1/en
Priority to US12/090,215 priority patent/US9074194B2/en
Priority to JP2008535049A priority patent/JP5560398B2/ja
Priority to AT06849419T priority patent/ATE469212T1/de
Priority to DE602006014574T priority patent/DE602006014574D1/de
Publication of WO2007090911A1 publication Critical patent/WO2007090911A1/es
Anticipated expiration legal-status Critical
Priority to US14/740,890 priority patent/US9587002B2/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • C07K14/4705Regulators; Modulating activity stimulating, promoting or activating activity
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06Antianaemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/14Vasoprotectives; Antihaemorrhoidals; Drugs for varicose therapy; Capillary stabilisers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241Nucleotidyltransferases (2.7.7)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • Figure 1 STATE OF THE TECHNIQUE Dyskerin ( Figure 1) is a 58 Kd nucleolar protein that is associated with the H / ACA box in SnoRNAs, present in the small ribonucleoprotein particles that are responsible for pseudouridinizing the ribosomal RNA. On the other hand, it is also a component of the telomerase complex, which is responsible for maintaining telomeric repeats in chromosomal endings.
  • Congenital dyskeratosis linked to the X chromosome (Marrone et al., 2003; Besseler et al., 2004), is a congenital syndrome that causes bone marrow failure and is associated with increased susceptibility to cancer.
  • dyskeratosis is caused by a timely mutation of the DKCl gene which codes for dyskerin.
  • this disease is associated with mutations in the telomerase component RNA (hTR) (Heiss et al., 1998).
  • hTR telomerase component RNA
  • telomerase activity is lower and telomeres are shorter than those of non-cell affected by the disease (Siriniavin et al., 1975; Trowbridge et al., 1977).
  • telomerase defects have been overcome experimentally by expressing hTERT ectopically (Mitchell et al., 1999).
  • hTERT ectopically In congenital dyskeratosis caused by mutations in hTR, the only way to recover telomerase activity is to restate hTR (Fu et al., 2003).
  • Telomeres are composed of 500-2000 repetitions of the conserved sequence TTAGGG at the 3 'end of the chromosomes and their shortening with successive divisions becomes a limitation for the proliferative capacity of the cell. Telomeres are susceptible to DNA damage caused by exogenous agents, including cisplatin. It is described that cisplatin is capable of inhibiting telomerase activity in different cell lines (Ishibashi et al., 1998; Burger et al., 1997). There are several hypotheses about how this inhibition can occur. One possibility is the formation of G-Pt-G adducts, typical of cisplatin, in the repeated sequence of TTAGGG telomeres. Alternatively, cisplatin interactions with sulfydryl groups essential for the reverse transcriptase catalytic subunit (hTERT) and could even be due to decreased hTERT expression (Burger et al., 1997).
  • hTERT reverse transcriptase catalytic
  • An object of the present invention is an inducing or activating compound of telomerase activity, hereinafter an activating compound of the present invention, based on the nucleotide sequence of the GSE fragment.
  • dyskerin or protein or peptide sequence encoded by said nucleotide sequence that is capable of recovering telomerase activity inside the cells of a mammal, preferably human.
  • a particular object of the invention is a nucleotide sequence, hereinafter GSE gene sequence
  • GSE 24.2 of the present invention which allows the expression of a protein or peptide inducing the recovery of telomerase activity inside the cells of a mammal, preferably human, and which is constituted by one or several GSE 24.2 nucleotide sequences belonging to the following group: a) a nucleotide sequence consisting of a human GSE 24.2 nucleotide sequence (SEQ ID NO1), b) a nucleotide sequence analogous to the sequence of a), c) a fragment of any one of the sequences of a) and b), and d) a nucleotide sequence, genetic construct, comprising any sequence belonging to a), b) and e).
  • nucleotide sequence refers to a sequence of DNA, cDNA or mRNA.
  • a particular embodiment of the present invention is the nucleotide sequence of the GSE 24.2 sequence of a) constituted by SEQ ID NO1.
  • Another particular embodiment of the present invention is the nucleotide sequence of the GSE 24.2 sequence of b) consisting of SEQ ID NOIl or SEQ ID NOI
  • Another particular object of the present invention is a GSE 24.2 genetic construct comprising the GSE 24.2 nucleotide sequence.
  • Another particular object of the present invention is a GSE 24.2 expression vector comprising a GSE 24.2 nucleotide sequence or a GSE 24.2 genetic construct, described in the present invention, and which allows the expression of a protein or peptide capable of recovering the Telomerase activity inside mammalian cells, preferably human.
  • An example of a particular embodiment is the expression vector of the invention pLNCX 24.2 (see examples).
  • GSE protein 24.2 of the present invention which exhibits telomerase recovery activity inside the cells of a mammal, preferably human, and comprising one or more amino acid sequences belonging to the following group: a) an amino acid sequence consisting of a human GSE 24.2 amino acid sequence (SEQ ID N02), b) an amino acid sequence analogous to the sequence of a), c) a fragment of any one of the sequences of a) and b), and d) an amino acid sequence comprising any sequence belonging to a), b) and c).
  • Another particular embodiment of the present invention is a protein whose amino acid sequence of a) is constituted by SEQ ID N02.
  • Another particular embodiment of the present invention is a protein whose amino acid sequence of c), fragment of is constituted by SEQ ID NO12 or SEQ ID NO14.
  • another additional object of the present invention are cells, whether eukaryotic - preferably human - or prokaryotic, hereinafter GSE 24.2 cells of the invention, genetically modified and comprising the nucleotide sequence, the construction and the vector of GSE 24.2 expression of the invention and wherein the GSE 24.2 peptide or protein of the invention can be adequately expressed.
  • another object of the invention is the use of the GSE 24.2 activator compound of the present invention in the preparation of a medicament or pharmaceutical composition for the treatment of a disease caused by an alteration, preferably a reduction, of telomerase activity , belonging, by way of illustration and without limiting the scope of the invention, to the following group: aging or acceleration of aging, neurodegenerative diseases and congenital dyskeratosis.
  • Another object of the present invention is a pharmaceutical composition or medicament for the treatment of diseases, disorders or pathologies that occur with alterations of telomerase activity, preferably a reduction in activity, hereinafter pharmaceutical composition of the present invention, which comprises a compound or agent capable of recovering telomerase activity, in therapeutically effective amount together with, optionally, one or more pharmaceutically acceptable adjuvants and / or vehicles and which is capable of stimulating the generation and maintenance of telomerase activity.
  • Another particular object of the present invention is a pharmaceutical composition of the invention in which the compound or agent capable of recovering telomerase activity belongs to the following group: sequence, genetic construction or GSE 24.2 vector that allow the expression of a protein or peptide capable of recovering telomerase activity inside maraifer cells, preferably human.
  • a particular embodiment of the invention is a pharmaceutical composition of the invention in which the compound or agent capable of recovering telomerase activity is one or more GSE 24.2 sequences belonging to the following group: a) a nucleotide sequence consisting of a sequence of Human GSE 24.2 nucleotides (SEQ ID NO: a) a nucleotide sequence consisting of a sequence of Human GSE 24.2 nucleotides (SEQ ID NO:
  • nucleotide sequence analogous to the sequence of a), c) a fragment of any one of the sequences of a) and b), and d) a nucleotide sequence, genetic construct, comprising any sequence belonging to a), b) and e).
  • nucleotide sequence of a) is the nucleotide sequence GSE 24.2 (SEQ ID NO1).
  • nucleotide sequence of c is the nucleotide sequence SEQ ID NOIl or SEQ ID NO 13.
  • nucleotide sequence is a vector, preferably the pLNCX 24.2 vector.
  • Another particular object of the present invention is a pharmaceutical composition of the invention in which the compound or agent capable of recovering telomerase activity is a protein or peptide encoded by the GSE 24.2 sequence, genetic construct or vector of the invention.
  • a particular embodiment of the invention is a pharmaceutical composition of the invention in which the GSE 24.2 protein or peptide belongs to the following group: a) an amino acid sequence consisting of a human GSE 24.2 amino acid sequence (SEQ ID N02), b ) an amino acid sequence analogous to the sequence of a), c) a fragment of any one of the sequences of a) and b), and d) an amino acid sequence comprising any sequence belonging to a), b) and c) -
  • Another particular embodiment of the present invention is the pharmaceutical composition of the invention in which the amino acid sequence of a) is the sequence SEQ ID N02.
  • Another particular embodiment of the present invention is the pharmaceutical composition of the invention in which the amino acid sequence of c) is the sequence SEQ ID N012 or SEQ ID N014.
  • Another particular object of the present invention is a pharmaceutical composition of the invention in which the telomerase activating compound or agent is a cell, preferably human, transformed by the GSE 24.2 sequence, construct or vector.
  • Another object of the invention is the use of the pharmaceutical composition of the invention, hereinafter use of the pharmaceutical composition of the invention, in a method of treatment or prophylaxis of a mammal, preferably a human being, affected by a disease, disorder or pathology that involves alterations in telomerase activity consisting of the administration of said therapeutic composition in adequate dose that allows the recovery of telomerase activity inside its cells.
  • Another particular object of the present invention is the use of the pharmaceutical composition of the invention in a method of treating a disease or disorder that involves alterations in telomerase activity that affects human beings, belonging, by way of illustration and without limit the scope of the invention to the following group: aging or acceleration of aging, neurodegenerative diseases, congenital dyskeratosis, Cri du chat, ataxia gelangiectasia, Nijmegen breakage syndrome, Bloom syndrome, Werner syndrome, Fanconi anemia, ulcerative colitis, vascular aging, arteriosclerosis and cancer.
  • Another particular embodiment of the present invention is the use of the pharmaceutical composition of the invention in a method of treatment of a neurodegenerative disease belonging to the following group: Alzheimer's disease, Parkinson's disease, cerebellar ataxia and spinal cord degeneration.
  • Another particular embodiment of the present invention is the use of the pharmaceutical composition of the invention in a method of treatment of congenital dyskeratosis linked to the X chromosome.
  • Another particular embodiment of the present invention is the use of the pharmaceutical composition of the invention in a method of treating autosomal dominant congenital dyskeratosis.
  • the present invention faces the problem of providing new therapeutic tools for the treatment of diseases that occur with alterations of telomerase activity, and more specifically congenital dyskeratosis.
  • the present invention is based on the fact that the inventors have demonstrated that the expression of a dyskerin cDNA fragment, GSE 24.2 (SEQ ID NO1), which expresses an internal sequence of dyskerin (SEQ ID NO2), compensates in patients with congenital dyskeratosis and in VA13 cells defects in telomerase activity (Example 3).
  • the hTERT protein promoter, but not hTR, in cells transfected with the GSE 24.2 peptide is constitutively activated in a manner dependent on c-myc expression, and more specifically through its binding to the NHEIII region located in the Pl region of the purine-rich promoter (Pu27, see Example 2) allowing a change of secondary conformation of the DNA so that transcription factors can access the DNA. Any change in the sequence of this region that modifies its secondary structure alters the activity of the GSE 24.2 peptide.
  • this GSE 24.2 peptide confers ability to survive cisplatin in human cell lines (Example 1).
  • the 24.2 cell line increases the viability against the telomerase 1 inhibitor.
  • This inhibitor has a mechanism of action similar to cisplatin forming
  • GSEs Gene suppressor elements are biologically active cDNA fragments encoding inhibitory antisense peptides or RNAs, which act dominant on gene expression in mammalian cells.
  • GSE 24.2 is a 165 bp fragment that spans from nucleotide 268 to 433 and corresponds to a sequence formed by two domains highly conserved in different species, called TRUB ( Figure 2b, see SEQ ID N012 and 14, respectively).
  • domains appear to have an important function in the pseudouridinilization of snoRNA (Zucchini et al., 2003; Pan et al., 2003) and, what is more surprising, nucleotide sequences made with said domains cloned separately increased the basal activity of the telomerase promoter as well as the entire initially described 55 amino acid sequence (Example 1.7, Figure 8c). It is interesting that this activity inducing resistance to cisplatin and compensating for defects in telomerase activity is only located in the region of dyskerin that is in the GSE 24.2 sequence, since the complete protein (see SEQ ID 4) or aminoterminal fragment, they have no activity.
  • an object of the present invention is an inducing or activating compound of telomerase activity, hereinafter an activating compound of the present invention, based on the nucleotide sequence of the GSE 24.2 fragment of the dyskerin or the protein or peptide sequence. encoded by said nucleotide sequence that is capable of recovering telomerase activity inside the cells of a mammal, preferably human.
  • the term "telomerase inducing or activating compound” refers to a molecule that increases the intensity or prolongs the duration of the biological activity thereof. This definition also includes those compounds or molecules that allow the expression of a nucleotide sequence encoding a GSE 24.2 protein.
  • An activator compound may consist of a peptide, a protein or a nucleotide sequence.
  • a particular object of the invention is a nucleotide sequence, hereinafter referred to as the GSE 24.2 gene sequence of the present invention, which allows the expression of a protein or peptide inducing the recovery of telomerase activity inside the cells of a mammal, preferably human, and consisting of one or several GSE 24.2 nucleotide sequences belonging to the following group: a) a nucleotide sequence consisting of a human GSE 24.2 nucleotide sequence (SEQ ID NO: a nucleotide sequence consisting of a human GSE 24.2 nucleotide sequence (SEQ ID NO:
  • nucleotide sequence analogous to the sequence of a), c) a fragment of any one of the sequences of a) and b), and d) a nucleotide sequence, genetic construct, comprising any sequence belonging to a), b) and e).
  • analogous is intended to include any nucleotide sequence that can be isolated or constructed based on the sequence shown herein, for example, by introducing conservative or non-conservative nucleotide substitutions. , including the insertion of one or more nucleotides, the addition of one or more nucleotides at any of the ends of the molecule or the deletion of one or more nucleotides at any end or within the sequence, and allowing the coding of a peptide or protein capable of mimicking the activity of the GSE 24.2 sequence (SEQ ID N02) or fragments thereof (SEQ ID N012 and SEQ ID NOl4).
  • the enzyme dyskerin belongs to a family of pseuridine synthase present in several organisms (see Figure 3B, Mitchel et al, 1999). From the information described in the present invention and from various organisms existing in nature, a technician skilled in the art can isolate or construct a nucleotide sequence analogous to those described in the present invention.
  • nucleotide sequence is substantially homologous to the nucleotide sequence discussed above.
  • substantially homologous means that the nucleotide sequences in question have a degree of identity of at least 30%, preferably of at least 85%, or more preferably of At least 95%.
  • nucleotide sequence refers to a sequence of DNA, cDNA or mRNA.
  • a particular embodiment of the present invention is the nucleotide sequence of the GSE 24.2 sequence of a) constituted by SEQ ID NO1.
  • Another particular embodiment of the present invention is the nucleotide sequence of the GSE 24.2 sequence of b) constituted by SEQ ID NOlI or SEQ ID NOl3, which encode the Trub I and Trub II peptide domains, respectively (Example 1.7).
  • the GSE 24.2 nucleotide sequence identified as d) corresponds to a GSE 24.2 gene construct.
  • This GSE 24.2 gene construct of the invention also it may comprise, if necessary and to allow a better isolation, detection or secretion to the cytoplasm of the expressed peptide, to a nucleotide sequence encoding a peptide capable of being used for the purpose of isolation, detection or secretion of said peptide.
  • another particular object of the present invention is a GSE 24.2 genetic construct that comprises, in addition to the GSE 24.2 nucleotide sequence, any other nucleotide sequence encoding a peptide or peptide sequence that allows isolation, detection or secretion to the cellular cytoplasm of the peptide expressed, for example, by way of illustration and without limiting the scope of the invention, a polyhistidine sequence ( ⁇ xHis), a peptide sequence recognizable by a monoclonal antibody (for example, for identification, or any another that serves to purify the resulting fusion protein by immunoaffinity chromatography: tag peptides such as c-myc, HA, E-tag) (Using antibodies: a laboratory manual. Ed. Harlow and David La ⁇ e (1999). CoId Spring Harbor Laboratory Press, New York, Chapter: Tagging proteins, Pp. 347-377).
  • ⁇ xHis polyhistidine sequence
  • tag peptides such as c-myc, HA, E-tag
  • the GSE 24.2 nucleotide sequence and the GSE 24.2 genetic construct described previously can be obtained by an expert by employing techniques widely known in the state of the art (Sambrook et al. "Molecular cloning, a Laboratory Manual 2 nd ed., CoId Sping Harbor Laboratory Press, NY, 1989 vol 1-3) Said nucleotide sequences can be integrated into a gene expression vector that allows regulation of the expression thereof under suitable conditions inside the cells.
  • another particular object of the present invention is a GSE 24.2 expression vector comprising a GSE 24.2 nucleotide sequence or a GSE 24.2 genetic construct, described in the present invention, and which allows the expression of a capable protein or peptide to recover telomerase activity inside mammalian cells, preferably human.
  • An example of a particular embodiment is the expression vector of the invention pLNCX 24.2 (see example 1 and 2).
  • an expression vector comprises, in addition to the GSE 24.2 nucleotide sequence or the 24.2 genetic construct. described in the invention, a promoter that directs its transcription (for example, pT7, plac, ptrc, ptac, pBAD, zet, etc.), to which it is operatively linked, and other necessary or appropriate sequences that control and regulate said transcription and , where appropriate, the translation of the product of interest, for example, transcription initiation and termination signals (tlt2, etc.), polyadenylation signal, origin of replication, ribosome binding sequences (RBS), regulator coding sequences transcriptional (enhancers), transcriptional silencers (silencers), repressors, etc.
  • a promoter that directs its transcription for example, pT7, plac, ptrc, ptac, pBAD, zet, etc.
  • a promoter that directs its transcription for example, pT7, plac, ptrc,
  • expression vectors can be selected according to the conditions and needs of each specific case among expression plasmids, viral vectors (DNA or RNA), cosmids, artificial chromosomes, etc. which may also contain markers that can be used to select cells transfected or transformed with the gene or genes of interest.
  • the choice of the vector will depend on the host cell and the type of use to be performed. Therefore, according to a particular embodiment of the The present invention said vector is a plasmid or a viral vector.
  • the obtaining of said vector can be carried out by conventional methods known to those skilled in the art, as well as for the transformation of microorganisms and eukaryotic cells different widely known methods can be used - chemical transformation, electroporation, microinjection, etc.
  • GSE protein 24.2 of the present invention which exhibits telomerase recovery activity inside the cells of a mammal, preferably human, and comprising one or more amino acid sequences belonging to the following group: a) an amino acid sequence consisting of a human GSE 24.2 amino acid sequence (SEQ ID NO: a)
  • analogous is intended to include any amino acid sequence that can be isolated or constructed based on the sequence shown herein, for example, by introducing conservative or non-conservative amino acid substitutions. , including the insertion of one or more amino acids, the addition of one or more amino acids at any end of the molecule or the deletion of one or more amino acids at any end or inside the sequence, and that mimics the telomerase recovery activity of SEQ ID N02.
  • the enzyme dyskerin belongs to a family of pseuridine synthase present in several organisms (see Figure 3B, Mitchel et al, 1999). From the information described in the present invention and from different organisms existing in nature, a technician skilled in the art can isolate or construct an amino acid sequence analogous to those described in the present invention.
  • an analogous amino acid sequence is substantially homologous to the amino acid sequence discussed above.
  • substantially homologous means that the amino acid sequences in question have an identity degree of at least • 30%, preferably of at least 85%, or more preferably of at least 95%.
  • Another particular embodiment of the present invention is a protein whose amino acid sequence of a) is constituted by SEQ ID NO2.
  • Another particular embodiment of the present invention is a protein whose amino acid sequence of c), fragment of is constituted by SEQ ID N012 or SEQ ID N014.
  • GSE 24.2 cells of the invention are cells, whether eukaryotic - preferably human - or prokaryotic, hereinafter GSE 24.2 cells of the invention, genetically modified and comprising the nucleotide sequence, the construction and the vector of GSE 24.2 expression of the invention and where the GSE 24.2 peptide or protein of the invention can be adequately expressed.
  • GSE 24.2 cells of the invention genetically modified and comprising the nucleotide sequence, the construction and the vector of GSE 24.2 expression of the invention and where the GSE 24.2 peptide or protein of the invention can be adequately expressed.
  • These cells can be transformed, infected or transfected by said nucleotide sequences by genetic engineering techniques known to a person skilled in the art.
  • These cells may be useful for the production of peptides with recovery activity of telomerase activity that may be the basis of a pharmaceutical composition, for recombinant amplification of said nucleotide sequences or may be useful per se as cells in gene therapy, etc. .
  • a particular embodiment would be a human cell transformed by these GSE 24.2 nucleotide sequences of different cell lines, which can be used as regenerating cells of human tissues.
  • Gene expression systems may or may not allow the integration of the new genetic material into the genome of the host cell.
  • both the nucleotide sequence, gene construct or GSE 24.2 expression vector can be used as a medicament to protect host cells, preferably human cells affected by an alteration in telomerase activity, in a treatment procedure and therapy prophylaxis. gene of a human being affected by a disease that involves alterations in telomerase activity.
  • the GSE 24.2 cells of the invention can be used as a medicament for the regeneration or implantation of tissues or cells in humans.
  • Biopharmaceutical tools and gene therapy procedures are sufficiently known by an expert of the technical sector in such a way that with the information described in the present invention they can be developed without excessive effort.
  • proteins or peptides and the cells themselves can become biopharmaceuticals.
  • another object of the invention is the use of the GSE 24.2 activator compound of the present invention in the preparation of a medicament or pharmaceutical composition for the treatment of a disease caused by an alteration, preferably a reduction, of telomerase activity , belonging, by way of illustration and without limiting the scope of the invention, to the following group: aging or acceleration of aging, neurodegenerative diseases, congenital dyskeratosis, Cri du chat (CdC, OMIM 123450), ataxia gelangiectasia (AT, OMIM 208900) , Nijmegen breakage syndrome (NBS, OMIM 251260), Bloom syndrome (BS, OMIM, 210900), Werner syndrome (WS, OMIM 277900), Fanconi anemia (FA OMIM 227650, ulcerative colitis, vascular aging, arteriosclerosis and cancer.
  • aging or acceleration of aging neurodegenerative diseases, congenital dyskeratosis, Cri du chat (CdC, OMIM 123450), ataxi
  • telomere activity is a failure in the bone marrow caused by opportunistic infections or hemorrhages (in 70% of cases). Other causes of death are lung disease and cancer.
  • Cri du chat disease (CdC, OMIM 123450) is an inherited congenital syndrome associated with deletions of the short arm of chromosome 5 and appears with a frequency of 1: 20,000 and 1: 50,000 and the frequency in affected patients with deep mental retardation (IQ less than 20) it reaches 1%.
  • Ataxia gelangiectasia (AT, OMIM 208900) is an autosomal recessive syndrome caused by mutations in the ATM gene.
  • the problems appear between the second and fifth year of life and are a progressive neuronal degeneration (cerebral ataxia), ocular telangiectasia, immunodeficiency, hypogonadism, genomic instability, premature aging, mild diabetes mellitus, small stature, and predisposition to cancer (lymph nodes and leukemia) ).
  • Nijmegen breakage syndrome (NBS, OMIM 251260) is an autosomal recessive disease caused by mutations or losses of the Nibrina gene. The syndrome is characterized by microcephaly, destructive facial appearance, growth retardation, progressive mental retardation and strong predisposition to lymphomas and respiratory tract infections.
  • Bloom's syndrome (BS, OMIM, 210900) and Werner's syndrome (WS, OMIM 277900).
  • BS is an autosomal recessive syndrome induced by mutations in the recQ gene, a protein with helicase activity.
  • WS is also an autosomal recessive syndrome caused by mutations in the recQL2 helicase. Both diseases are characterized by accelerated aging and the symptoms include arteriosclerosis, osteoporosis, diabetes mellitus, biocular cataracts, and predisposition to some types of tumors, particularly sarcomas (WS) and leukemia (BS).
  • WS sarcomas
  • BS leukemia
  • Fanconi anemia (FA OMIM 227650) is an autosomal recessive disease characterized by a high number of developmental defects, bone marrow failures and a thousandfold increase in the incidence of myeloid leukemia and a high predisposition to develop solid tumors .
  • the frequency of disease development among carriers of mutations is 1: 100. Ulcerative colitis is emearmedad affects one in 100 Vietnameserds. It is a disease]] whose origin is thought to be auto-immune and in which genetic and environmental factors intervene.
  • the risk of cancer combines with the duration of the disease and occurs in numerous organs such as colon and lymph nodes.
  • telomeric dysfunction is pervasive in blood vessels with arteriosclerotic plaques.
  • the reactivation of telomerase in progeny-vascular cells increases the ability to divide these cells and vasculogenesis.
  • a loss of these pmijenitora cells contributes to an important vascular dysfunctionAr ⁇ for which an anti-senescence therapy will serve as a new approach to alleviate the vascular effects of aging and arteriosclerosis.
  • element GSE 44.4 of the invention can be wide once the mechanism is known, or one of them, whereby this element carries out its biological activity.
  • the present invention is described for the first time: joining the NHEIII region.
  • this region of polyurines is found in lasji (promotions for the CCR5 and PDGFA genes, among others)
  • the nm23Hl metastatic suppressor peptide should be highlighted (Yoshiro 0 et al. 2001; Grand et al. 2004).
  • element GSE 24.2 of the invention could be used as a suppressor of tumor growth and metastasis propagation, an application that is part of the present invention.
  • neurodegenerative disease refers to a disease belonging, among others by way of illustration, to the following group: Alzheimer's disease, Parkinson's disease, cerebellar ataxia and spinal cord degeneration.
  • Another object of the present invention is a pharmaceutical composition or medicament for the treatment of diseases, disorders or pathologies that occur with alterations of telomerase activity, preferably a reduction in activity, hereinafter pharmaceutical composition of the present invention, which comprises a compound or agent capable of recovering telomerase activity, in therapeutically effective amount together with, optionally, one or more pharmaceutically acceptable adjuvants and / or vehicles and which is capable of stimulating the generation and maintenance of telomerase activity.
  • compositions are the adjuvants and vehicles known to those skilled in the art and commonly used in the elaboration of therapeutic compositions.
  • the term "therapeutically effective amount” refers to the amount of the agent or compound capable of recovering telomerase activity, calculated to produce the desired effect and, in general, will be determined, among others. causes, due to the characteristics of the compounds, including the age, condition of the patient, the severity of the alteration or disorder, and the route and frequency of administration.
  • said therapeutic composition is prepared in the form of a solid form or aqueous suspension, in a pharmaceutically acceptable diluent.
  • the therapeutic composition provided by this invention may be administered by any appropriate route of administration, for which said composition will be formulated in the pharmaceutical form appropriate to the route of administration chosen.
  • the administration of the therapeutic composition provided by this invention is carried out parenterally, orally, intraperitoneally, subcutaneously, etc.
  • a review of the different pharmaceutical forms of drug administration and of the excipients necessary to obtain them can be found, for example, in the "Galician Pharmacy Treaty", C. Faul ⁇ i Trillo, 1993, Luzán 5, SA Ediations , Madrid.
  • Another particular object of the present invention is a pharmaceutical composition of the invention in which the compound or agent capable of recovering telomerase activity belongs to the following group: sequence, genetic construction or GSE 24.2 vector that allow the expression of a protein or peptide capable of recovering telomerase activity inside mammalian cells, preferably human.
  • a particular embodiment of the invention is a pharmaceutical composition of the invention in which the compound or agent capable of recovering the Telomerase activity is one or several GSE 24.2 sequences belonging to the following group: a) a nucleotide sequence consisting of a human GSE 24.2 nucleotide sequence (SEQ ID NO1), b) a nucleotide sequence analogous to the sequence of a), c ) a fragment of any one of the sequences of a) and b), and d) a nucleotide sequence, genetic construct, comprising any sequence belonging to a), b) and e).
  • GSE 24.2 sequences belonging to the following group: a) a nucleotide sequence consisting of a human GSE 24.2 nucleotide sequence (SEQ ID NO1), b) a nucleotide sequence analogous to the sequence of a), c ) a fragment of any one of the sequences of a) and b), and d) a nucleotide sequence
  • nucleotide sequence of a) is the nucleotide sequence GSE 24.2 (SEQ ID NO1).
  • nucleotide sequence of c is the nucleotide sequence SEQ ID NOIl or SEQ ID NO 13.
  • nucleotide sequence is a vector, preferably the pLNCX 24.2 vector.
  • nucleotide sequence is a vector, preferably the pLNCX 24.2 vector.
  • compound or agent capable of recovering telomerase activity is a protein or peptide encoded by the GSE 24.2 sequence, genetic construct or vector of the invention.
  • a particular embodiment of the invention is constituted by a pharmaceutical composition of the invention in which the GSE 24.2 protein or peptide belongs to the following group: a) an amino acid sequence consisting of a human GSE 24.2 amino acid sequence (SEQ ID N02), b) an amino acid sequence analogous to the sequence of a), c) a fragment of any one of the sequences of a) and b), and d) an amino acid sequence comprising any sequence belonging to a), b) and c) -
  • Another particular embodiment of the present invention is the pharmaceutical composition of the invention in which the amino acid sequence of a) is the sequence SEQ ID NO2.
  • Another particular embodiment of the present invention is the pharmaceutical composition of the invention in which the amino acid sequence of c) is the sequence SEQ ID N012 or SEQ ID NOl4.
  • Another particular object of the present invention is a pharmaceutical composition of the invention in which the telomerase activating compound or agent is a cell, preferably human, transformed by the GSE 24.2 sequence, construct or vector.
  • Another object of the invention is the use of the pharmaceutical composition of the invention, hereinafter use of the pharmaceutical composition of the invention, in a method of treatment or prophylaxis of a mammal, preferably a human being, affected by a disease, disorder or pathology that involves alterations in telomerase activity consisting of the administration of said therapeutic composition in adequate dose that allows the recovery of telomerase activity inside your cells.
  • the pharmaceutical composition of the present invention can be used in a form treatment method.
  • Another particular object of the present invention is the use of the pharmaceutical composition of the invention in a method of treating a disease or disorder that causes alterations of the
  • Telomerase activity that affects human beings, belonging, by way of illustration and without limiting the scope of the invention, to the following group: aging or acceleration of aging, neurodegenerative diseases, congenital dyskeratosis, Cri du, chat
  • NBS Nijmegen Breakage Syndrome
  • OMIM 227650 ulcerative colitis
  • vascular aging vascular aging
  • 0 arteriosclerosis cancer.
  • Another particular embodiment of the present invention is the use of the pharmaceutical composition of the invention in a method of treating a neurodegenerative disease belonging to the following group: Alzheimer's disease, Parkinson's disease, cerebellar ataxia and spinal cord degeneration.
  • Another particular embodiment of the present invention is the use of the pharmaceutical composition of the invention in a method of treating dyskeratosis or congenital X-linked dyskeratosis.
  • Another particular embodiment of the present invention is the use of the pharmaceutical composition of the invention in a method of treatment of autosomal dominant congenital dyskeratosis.
  • telomerase component is defective in the human disease dyskeratosis congenita. Nature Dec 2; 402 (6761): 551-5. Mochizuki Y, He J, Kulkarni S, Bessler M, Mason PJ. 2004. Mouse dyskerin mutations affect accumulation of telomerase RNA and small nucleolar RNA, telomerase activity, and ribosomal RNA processing. Proc Nati Acad Sci US A. 20; 101 (29): 10756-61. Oh S, Song YH, Kim UJ, Yim J, Kim TK. 1999.
  • Figure 1 Schematic structure of the telomerase complex.
  • hTERT dyskerin
  • p23 hsp90 and TEP1 proteins together with the hTR RNA constitute the ribonucleoproteic complex of telomerase.
  • Figure 4.- Viability of the 293T cell lines pLNCX, 24.2, DSK5 'and DSK treated with cisplatin.
  • the cell lines described above have been used (pLNCX and 24.2), the DSK 5'-cell line that expresses a fragment of the dyskerin described in the previous figure and a fourth one that overexpresses the complete cDNA of dyskerin (DSK). Viability was determined as indicated in Figure 1 A. The data represents the average of two experiments performed in quadruplicate.
  • FIG. 5 - Telomerase activity of the 293T cell lines: pLNCX and 24.2 after treatment with cisplatin.
  • the cells were seeded on 60 mm plates, pretreated with 0.5 ⁇ g / ml of cisplatin for 3 days and subsequently treated with cisplatin at the dose of 3 ⁇ g / ml.
  • Figure 6 Cell viability and telomerase activity of the 293T cell lines: pLNCX and 24.2 treated with the Telomerase Inhibitor I.
  • telomere activity was measured by the Intergen TRAPeze assay.
  • RNA extraction was performed with oligos specific for hTERT, hTR and dyskerin to study the expression levels of messenger RNAs. Oligos were used as a control for starting RNA for amplification of GAPDH.
  • Figure 8. Activity of the hTERT promoter in the 293T cell lines: pLNCX and 24.2 and in 293T cells transiently transfected with the pLNCX-24.2 construct and the empty pLNCX plasmid.
  • 293T cells were transfected with the pLNCX vector and plasmid 24.2 (5 ⁇ g) and both were co-transfected with 0.25 ⁇ g of hTERT-luc reporter vector. After seeding the cells as in A, they were transfected with pLNCX and 24-2 and co-transfected with the hTERT-luc reporter vector, subsequently treated as in A.
  • the transfection vector used the CMV-Renilla reporter vector.
  • the data correspond to the ratio relative units of luciferase with respect to non-transfected cells. Each point represents with ⁇ the standard deviation obtained from 3 independent experiments.
  • C) 293T cells were transfected with the different GSE 24.4, DSK, TRUB I, TRUB II and empty plasmid pLNCX (5 ⁇ g) constructs and co-transfected with 0.25 ⁇ g of hTERT-luc reporter vector.
  • the cells were seeded in 60 mm plates 24 hours after transfection, the cells were used and the luciferase activity of 10 ⁇ g of total protein was quantified.
  • As a transfection control the cells were co-transfected with a CMV-Renilla reporter vector.
  • the data correspond to the ratio relative units of luciferase with respect to non-transfected cells. Each point represents with ⁇ the standard deviation obtained from 3 independent experiments.
  • Both the pLNCX cell line and the 24.2 cell line were transiently transfected with 0.25 ⁇ g of the hTERT-luc reporter vector. 24 hours after transfection, they were treated with 3 ⁇ g / ml cisplatin for 8 hours. Cells were seeded on 60mm plates 24 hours after transfection and after treatment with cDDP cells were used and the luciferase activity of 10 ⁇ g of total protein was quantified. As a transfection control, the cells were co-transfected with a CMV-Renilla reporter vector.
  • telomere activity and expression levels of hTERT and hTR in cells of patients with congenital dyskeratosis and in VA13 cells transiently transfected with plasmid 24.2 or with the empty vector pLNCX A) Telomerase activity measured by TRAP assay in cells of patients with congenital dyskeratosis (DC-I, DC-2 and DC-3) and in the carrier mother (DC-C) after electroporation of 45 ⁇ g of the empty plasmid pLNCX (- ) or the vector pLNCX 24.2 (+) per 15 million cells.
  • RNA of cells of one of the patients of dyskeratosis congenita DC3 transfected with the vector vacuum and DC3 transfected with plasmid 24.2 using specific oligos of hTERT and hTR. Oligos were used as a control for starting RNA for amplification of GAPDH.
  • C Telomerase activity in VAl3 cells. The cells were transiently transfected with 16 ⁇ g of the empty control vector pLNCX, expressing DKC or the 24.2 GSE peptide per million cells. 24 hours later, telomerase activity was analyzed as described above using dilutions of protein extracts from each transfection.
  • FIG. 11 The GSE 24.2 peptide increases the activity of the hTERT promoter regulated by c-MYC.
  • A 293T cells were co-transfected with different constructs (10 ⁇ g / DNA per million cells) and hTERT-luc reporter (1 ⁇ g per million cells).
  • B The indicated cell lines were co-transfected with the hTERT-luc reporter and different amounts of the Mad / myc expression vector.
  • C The indicated cell lines were co-transfected with the HIV-luc reporter and with different amounts of the Mad / myc expression vector. After 24 hrs of the transfection the cells were stimulated with 50 ng / ml of TNF- ⁇ for 6 hours and luciferase activity was analyzed as described above.
  • CMV-Renilla (0.1 ⁇ g / ml per million cells) was used as a control of transfection efficiency. The data represent the average of two experiments performed in quadruplicates.
  • Figure 12.- The promoter activity of c-MYC is induced by the GSE 24.2 peptide.
  • A schematic representation of the c-MYC promoter indicating the different constructs used in the experiments.
  • B 293T cells were co-transfected with the indicated plasmids (10 ⁇ g / DNA per million cells) and with the reporter px3.2 c-MYC-luc (1 ⁇ g per million cells).
  • C The indicated cell lines were transfected with the px3.2 c-MYC-luc reporter (1 ⁇ g per million cells).
  • Figure 13 The activity of the c-MYC promoter induced by the GSE 24.2 peptide is dependent on the NHE III element.
  • A Schematic representation of the mutations generated in the NHE III element.
  • B 293T cells were co-transfected with different constructs (10 ⁇ g / DNA per million cells) and with the different mutants of the px3.2 reporter plasmid (1 ⁇ g per million cells).
  • C The cell lines indicated in the figure were transfected with the different mutants of the px3.2 reporter (1 ⁇ g per million cells). After 24 hrs of transfection, luciferase activity was analyzed as indicated above. CMV-Renilla (0.1 ⁇ g / ml per million cells) was used as a control of transfection efficiency. The data represent the average of two experiments performed in quadruplicates.
  • Chemotherapy resistance is one of the biggest limitations in cancer treatment.
  • sequences from a cDNA library that confer resistance to cisplatin were isolated by means of a screening of gene suppressor elements. This methodology described previously (Roninson et al., 1995) consists in the expression of cDNA constructs from a human placenta library, normalized to match the abundance in gene expression. About 100 different clones that confer resistance to cisplatin were isolated. After amplifying the cDNA inserts, they were subcloned into plasmid pLNCX and transfected again to ensure they conferred resistance.
  • GSEs were a 165 bp fragment called 24.2 (see SEQ ID NO1) that corresponded to an internal sequence of human dyskerin.
  • 24.2 see SEQ ID NO1
  • Plasmid pLNCX24-2 containing the GSE of the same name was stably transfected into 293T cells and as a control the empty vector pLNCX was transfected. After verifying by PCR, that the 24.2 cell line contained this insert (data not shown), the cisplatin response was studied by performing a viability curve with this drug.
  • Figure 2a shows the viability curve of the two cell lines against different doses of cisplatin after 72 hours. It shows how the cells that express the GSE 24.2 stably have a greater viability against cisplatin in relation to those that express the empty vector, especially at low doses close to the selection dose of the GSEs.
  • JNK and p38 are MAPK activated in response to genotoxic agents (Sánchez-Pérez et al., 1998).
  • the activation kinetics of these two proteins in response to cisplatin is related to the induction capacity of cell death, so the activation of these kinases in the two cell lines was studied ( Figure 2b) and it was observed that a greater dose of cisplatin to activate both kinases in those cells that stably express GSE 24.2 suggesting that the expression of GSE 24-2 attenuates the signal of cellular damage that activates both kinases.
  • Figure 4 shows the viability curve of the four cell lines against different doses of cisplatin. It shows how cells that express construction 24.2 (SEQ ID NO1) stably have a greater viability against cisplatin compared to those that express the empty vector, complete dyskerin (DSK) or the 5'-fragment of dyskerin (SEQ ID N03). Therefore, we can say that the increased viability against cisplatin is restricted to the cDNA sequence included in the GSE 24.2 fragment.
  • GSE 24.2 corresponds to an internal sequence of dyskerin and is part of the ribonucleoproteic complex of telomerase
  • the effect of cisplatin on telomerase activity in the cell line expressing GSE 24.2 was studied and whether this effect varied with respect to to the cell line that expresses in empty vector.
  • telomerase activity test was performed using the TRAP method with the pLNCX and pLNCX24.2 cell lines ( Figure 5) by pretreating them for 3 days with 0.5 ⁇ g / ml of cisplatin, after which it was treated with 3 ⁇ g / ml of cisplatin for 3 and 7 days.
  • the treatment for three days was performed since it was described that an inhibitor Specific telomerase needed to act during this time for efficient enzyme inhibition (Kim et al., 2003), (Bednarek et al., 1999), (Gowan et al., 2002).
  • Telomerase I Inhibitor is a compound that forms G-quadruplex in telomeres inhibiting telomerase activity (Thompson et al., 1997).
  • GSE 24.2 against the telomerase I inhibitor.
  • a viability curve was performed in which the pLNCX and 24.2 cell lines were treated with increasing concentrations of telomerase I inhibitor.
  • Figure 6a shows how 24.2 cells are more resistant to telomerase I inhibitor than parental ones. To verify whether this protection was accompanied by changes in sensitivity in telomerase activity, this activity was studied in pLNCX and pLNCX24.2 cells treated with different doses of Telomerase I Inhibitor for 3 days ( Figure 6b). It is observed how the inhibition of telomerase activity in the pLNCX cell line is greater than in pLNCX 24.2 cells. Telomerase activity was also studied by treating pLNCX and pLNCX 4.2 cells with a dose (5 ⁇ M) and at various times (0-5 days.
  • the TRUB pseudouridine synthase domain of dyskerin comprises two structural subdomains: Trub I and II motif (Zucchini et al., 2003). These two domains are critical for maintaining the overall protein structure of dyskerin.
  • motif II contains at least one residue (aspl25) essential for enzymatic activity.
  • the hTERT-luc reporter vector containing a 3402 bp sequence (Song et al., 1999) of the human hTERT promoter in cell lines: pLNCX 24.2 and pLNCX was transfected.
  • Figure 8a) it can be seen how in the pLNCX 24.2 cell line the activity of the hTERT promoter is greater than in cells expressing the empty vector (pLNCX).
  • Example 2. The NHEIII fragment of the c-MYC gene promoter is the target of the GSE 24-2 peptide.
  • the hTERT promoter contains two E-boxes (CACGTG) regions, binding points to myc / max heterodimers (Oh et al., 1999; Wu et al., 1999) as well as five spl regions.
  • CACGTG E-boxes
  • a transfection of the control cells and cells expressing the dyskerin protein (DKC) and the GSE24-2 peptide was carried out with incremental amounts of said hybrid molecule.
  • the expression of the mad / myc fusion protein inhibited the basal activity of the hTERT promoter in a dose-dependent manner, both in the control group and in DKC cells.
  • the expression of the myc / mad fusion protein was able to block the transcription mediated by the GSE 24.2 peptide in the GSE24-2 cells, indicating that the activation of the hTERT transcription induced by GSE 24-2 is dependent on c -myc ( Figure llb). This inhibition was specific since the transfection of the myc / mad construct in conjunction with an NFKB-dependent promoter (HIVLuc) did not affect transcription after TNF ⁇ stimulation in any of the cell lines ( Figure lie).
  • NHEIII region Since the NHEIII region has been described as a c-myc transcription inhibitor, several mutants of the NHEIII region were constructed by Guanine modification of the purine-rich region.
  • the 27 Guanines present in the NHEIII region are involved in the maintenance of the secondary structure of the G-quadruplexes of the purine-rich region (Pu27).
  • the G12A found in the second guanine of the second quartet, the G17A in the second triplet of Guaninas and finally two consecutive Guaninas (G26A / G27A) at the end of the purine-rich region (Figure 13a) were mutilated.
  • Example 3 Expression of GSE 24.2 in cells of patients with congenital dyskeratosis linked to the X chromosome and in VA13 cells. Since in the X chromosome-linked congenital dyskeratosis there are defects in telomerase activity, with low levels of telomerase RNA, the effect of the expression of this GSE 24.2 in cells of patients with congenital dyskeratosis was tested. To do this, cells from patients with congenital dyskeratosis (DC-I, DC-2, DC-3) and commercially available carrier mother (DC-C) cells were transfected with the GSE 24.2 vector or with the empty vector. These cells are deadly and usually grow old.
  • DC-I, DC-2, DC-3 commercially available carrier mother
  • telomerase activity was measured and an increase in telomerase activity was observed in both the cells of the carrier mother and in those of congenital dyskeratosis patients by expressing the GSE 24.2 fragment ( Figure 10a). Curiously, no increase in telomerase activity was observed by expression of complete dyskerin (data not shown). On the other hand, hTR levels are low in DC cells that express a mutated form of the dyskerin gene (Mochizuki et al., 2004). It was investigated whether this increase in activity was the result of an increase in the expression of any of the components of the telomerase complex, hTERT and hTR. For this, an RT-PCR assay was made 24 hours after transfection using specific oligos of hTER h and hTR. ( Figure 10b) and in both cases an increase in expression levels is observed after GSE 24.2 expression.
  • the cell lines of patients with X-linked congenital dyskeratosis were obtained from Corriel CeIl Repository and maintained in RPMI 20% FBS.
  • the VAl3 line was obtained from Dr. M Serrano.
  • the DKC family was described clinically (Sirinavin et al., 1975; Trowbridge et al., 1977) and affected individuals have a T66A amino acid substitution (data not shown) (DC-I, DC-2, DC-3).
  • the carrier mother cell line (DC-C) expresses a messenger RNA without mutation
  • the DSK construct contains the complete human dyskerin cDNA and the 5 'DSK construct (SEQ ID NO5) contains the first 500 nucleotides of the human dyskerin. Both constructs as well as GSE 24.2 (SEQ ID NO1) were cloned into the CIaI site of plasmid pLNCX (BD Biosciences Clontech).
  • Cells derived from patients with DC and their respective control were transiently transfected by electroporation using 3 ⁇ g of the pLNCX or pLNCX 24.2 construct per million cells.
  • the 293T cell line was obtained from the American Type Culture Collection and the cells were grown in DMEM (Dulbeco Modified Eagle Culture Medium) (Gibco) supplemented with 10% fetal bovine serum (Gibco) and 2 mM Glutamine.
  • This cell line was stably transfected using the calcium chloride method, 10 ⁇ g of plasmid per million cells. These cells were co-transfected with pBABEpur 1 ⁇ g of vector per million cells. 24 hours after transfection the cells were treated with puromycin to select stable clones. It was confirmed that the cells expressed the GSE 24.2 fragment, stably by genomic DNA PCR (Data not shown).
  • the hTERT-luc construct was cloned into plasmid pGL3 basic (Promega) and has been assigned by Tae Kook Kim (Kim et al., 1999). Drugs Both cisplatin and Telomerase I Inhibitor were obtained from Calbiochem and were used at the doses indicated in each figure.
  • telomerase activity was measured using the TRAPeze (Intergen) telomerase detection kit according to the instruction manual.
  • the protein concentration of each extract was quantified using the Bradford method using the BIORAD reagent and after performing a PCR according to the instructions in the manual, with the reaction products a polyacrylamide gel electrophoresis was performed under non-denaturing conditions and after that stained for 30 minutes with ethidium bromide.
  • the cells were used after washing with PBS to remove traces of medium.
  • the lysis buffer was prepared according to standard protocols and protein inhibitors were added: ABSF, orthovanadate, Leupeptin, pepstatin A, aprotinin and DTT
  • RNA extraction from cells was performed using Trizol reagent (Life technologies) following the manufacturer's instructions. In each reaction 2 ⁇ g of total RNA was transcribed to cDNA using the reverse transcriptase M-MIv (Promega).
  • the oligos used were the following:
  • Oligo A 5'-CGGAAGAGTGTCTGGAGCAA-S '(SEQ ID NO5)
  • Oligo B 5'- GGATGAAGCGGAGTCGGA -3 '(SEQ ID NO6) for hTERT; Oligo C: 5'- TCTAACCCTAACTGAGAAGGGCGTAG -3 '(SEQ ID NO7) and
  • Oligo D 5'- GTTTGCTCTAGAATGAACGGTGGAAG -3 '(SEQ ID NO8) for hTR;
  • Oligo E 5'- ATGGCGGATGCGGAAGTAATT- 3 '(SEQ ID NO9) and Oligo F: 5'- CCCCTTCAATAGCATTGTGC - 3' (SEQ ID NOO) for Disquerina
  • the PCR conditions for hTERT amplification were as follows: 94 ° C, 45s; 60 0 C, 45s; 72 ° C, 9Os for 31 cycles.
  • the PCR conditions for hTR were: 94 ° C, 45 seconds; 55 ° C, 45 seconds; 72 ° C, 90 seconds for 28 cycles.
  • the conditions for dyskerin were: 94 ° C 40 seconds, 60 0 C 60 seconds, 72 ° C 120 seconds for 28 cycles (Zhang et al., 2002).
  • Luciferase assay The transcriptional regulation of hTERT was measured by the Luciferase reporter gene, preceded by a 3402 bp sequence of the hTERT promoter.
  • the cells were used with the commercial Repórter Lysis Buffer buffer (Promega). Cellular ones were centrifuged and with 10 ⁇ g of supernatant protein, luciferase expression was quantified using a Berthold luminometer. As a transfection control, a CMV promoter construct followed by the renilla gene was used. Luciferase activity expresses by microgram of protein and is normalized with the luminescence of renila in the same extract.
  • the number of cells was determined by estimating the absorbance at 595 nm.
  • the figures show the% viability with respect to the cells without treatment, representing the average of 2 experiments carried out in quadruplicate with their corresponding deviations.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Vascular Medicine (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Urology & Nephrology (AREA)
  • Hospice & Palliative Care (AREA)
  • Dermatology (AREA)
  • Psychiatry (AREA)
  • Diabetes (AREA)
  • Psychology (AREA)
  • Hematology (AREA)
PCT/ES2006/070152 2005-10-14 2006-10-11 Secuencia de nucleótidos y péptidos gse 24.2 de la disquerina inductores de la actividad telomerasa, procedimiento de obtención, composiciones terapéuticas y sus aplicaciones Ceased WO2007090911A1 (es)

Priority Applications (8)

Application Number Priority Date Filing Date Title
CA002625981A CA2625981A1 (en) 2005-10-14 2006-10-11 Sequence of nucleotides and peptides gse 24.2 of dyskerin, which can induce telomerase activity, method for obtaining same, therapeutic compositions and applications thereof
DK06849419.4T DK1947175T3 (da) 2005-10-14 2006-10-11 Sekvens af nukleotider og peptider GSE 24,2 af dyskerin, der kan fremkalde telomeraseaktivitet, fremgangsmåde til fremstilling deraf, terapeutiske sammensætninger og anvendelser deraf
EP06849419A EP1947175B1 (en) 2005-10-14 2006-10-11 Sequence of nucleotides and peptides gse 24.2 of dyskerin, which can induce telomerase activity, method for obtaining same, therapeutic compositions and applications thereof
US12/090,215 US9074194B2 (en) 2005-10-14 2006-10-11 Sequence of nucleotides and peptides GSE 24.2 of dyskerin, which can induce telomerase activity, method for obtaining same, therapeutic compositions and applications thereof
JP2008535049A JP5560398B2 (ja) 2005-10-14 2006-10-11 テロメラーゼ活性を誘導するジスケリンのgse24.2ポリヌクレオチドおよびペプチドの配列、その取得方法、医薬組成物およびその使用方法
AT06849419T ATE469212T1 (de) 2005-10-14 2006-10-11 Sequenz von nukleotiden und peptiden gse 24.2 aus dyskerin zur herbeiführung von telomerase- aktivität, herstellungsverfahren dafür sowie therapeutische zusammensetzungen und anwendungen davon
DE602006014574T DE602006014574D1 (de) 2005-10-14 2006-10-11 Sequenz von nukleotiden und peptiden gse 24.2 aus dyskerin zur herbeiführung von telomerase-aktivität, herstellungsverfahren dafür sowie therapeutische zusammensetzungen und anwendungen davon
US14/740,890 US9587002B2 (en) 2005-10-14 2015-06-16 Sequence of nucleotides and peptides GSE 24.2 of dyskerin, which can induce telomerase activity, method for obtaining same, therapeutic compositions and applications thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ES200502511A ES2325431B1 (es) 2005-10-14 2005-10-14 Secuencia de nucleotidos y peptidos gse 24.2 de la disquerina inductores de la actividad telomerasa, procedimiento de obtencion, composiciones terapeuticas y sus aplicaciones.
ESP200502511 2005-10-14

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US12/090,215 A-371-Of-International US9074194B2 (en) 2005-10-14 2006-10-11 Sequence of nucleotides and peptides GSE 24.2 of dyskerin, which can induce telomerase activity, method for obtaining same, therapeutic compositions and applications thereof
US14/740,890 Division US9587002B2 (en) 2005-10-14 2015-06-16 Sequence of nucleotides and peptides GSE 24.2 of dyskerin, which can induce telomerase activity, method for obtaining same, therapeutic compositions and applications thereof

Publications (1)

Publication Number Publication Date
WO2007090911A1 true WO2007090911A1 (es) 2007-08-16

Family

ID=38344881

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2006/070152 Ceased WO2007090911A1 (es) 2005-10-14 2006-10-11 Secuencia de nucleótidos y péptidos gse 24.2 de la disquerina inductores de la actividad telomerasa, procedimiento de obtención, composiciones terapéuticas y sus aplicaciones

Country Status (10)

Country Link
US (2) US9074194B2 (https=)
EP (1) EP1947175B1 (https=)
JP (1) JP5560398B2 (https=)
AT (1) ATE469212T1 (https=)
CA (1) CA2625981A1 (https=)
DE (1) DE602006014574D1 (https=)
DK (1) DK1947175T3 (https=)
ES (2) ES2325431B1 (https=)
PT (1) PT1947175E (https=)
WO (1) WO2007090911A1 (https=)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009065994A1 (es) * 2007-11-23 2009-05-28 Consejo Superior De Investigaciones Cientificas Uso de agentes inductores gse24.2 para la elaboración de composiciones farmaceuticas para el tratamiento de enfermedades que cursan con senescencia celular
WO2015059338A1 (es) 2013-10-25 2015-04-30 Consejo Superior De Investigaciones Científicas (Csic) Péptidos derivados de gse24.2 para tratar enfermedades producidas por estrés oxidativo y daño al adn
WO2024194500A1 (es) 2023-03-17 2024-09-26 Consejo Superior De Investigaciones Científicas (Csic) Péptido derivado de gse24.2 y usos del mismo

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014122346A1 (es) * 2013-02-05 2014-08-14 Consejo Superior De Investigaciones Cientificas (Csic) Bionanopartículas biodegradables para liberación del péptido gse24-2, procedimiento de obtención y utilización
US20220313782A1 (en) * 2019-05-02 2022-10-06 Board Of Regents, The University Of Texas System Methods and compositions involving tert activating therapies
ES2989543A1 (es) * 2023-05-22 2024-11-26 Alodia Farm S L U Peptidos para su uso en la prevencion y/o tratamiento de radiodermitis

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999054449A2 (de) * 1998-04-17 1999-10-28 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Dyskerin und dafür codierende dna-moleküle, diese enthaltende vektoren, antikörper gegen dyskerin und die verwendung dieser gegenstände

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5350836A (en) * 1989-10-12 1994-09-27 Ohio University Growth hormone antagonists

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999054449A2 (de) * 1998-04-17 1999-10-28 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Dyskerin und dafür codierende dna-moleküle, diese enthaltende vektoren, antikörper gegen dyskerin und die verwendung dieser gegenstände

Non-Patent Citations (35)

* Cited by examiner, † Cited by third party
Title
"Dyskeratosis congenita and telomerase", CURR OPIN PEDIATR., vol. 16, no. 1, pages 23 - 8
"Using antibodies: a laboratory manual", 1999, COLD SPRING HARBOR LABORATORY PRESS, pages: 347 - 377
BESSLER M; WILSON DB; MASON PJ.: "4-(hydroxyphenyl)retinamide-treated mammary tumors", CARCINOGENESIS, vol. 20, no. 5, 2004, pages 879
BURGER AM; DOUBLE JA; NEWELL DR.: "Inhibition of Telomerase Activity by Cisplatin in Human Testicular Cancer Cells", EUR J CANCER., vol. 33, no. 4, 1997, pages 638 - 44
CESARE AJ; GRIFFITH JD.: "Telomeric DNA in ALT cells is characterized by free telomeric circles and heterogeneous t-loops", MOL. CELL. BIOL., vol. 24, no. 22, 2004, pages 9948 - 9957
CHENG H ET AL.: "Inhibition on telomerase activity and cytotoxic effects by cisplatin in cultured human choroidal melanoma cells", YAN KE XUE BAO., vol. 19, no. 1, 2003, pages 54 - 9
FU D; COLLINS K.: "Distinct biogenesis pathways for human telomerase RNA and H/ACA small nucleolar RNAs", MOL CELL, vol. 11, no. 5, 2003, pages 1361 - 72
GRAND CL ET AL.: "Mutations in the G-quadruplex silencer element and their relationship to c-MYC overexpression, NM23 repression, and therapeutic rescue", PROC NATL ACAD SCI USA., vol. 101, no. 16, 2004, pages 6140 - 6145
HEISS NS ET AL.: "X-linked dyskeratosis congenita is caused by mutations in a highly conserved gene with putative nucleolar functions", NAT GENET., vol. 19, no. 1, 1998, pages 32 - 8
ISHIBASHI T; LIPPARD SJ: "1998 Telomere loss in cells treated with cisplatin", PROC NATL ACAD SCI USA., vol. 95, no. 8, pages 4219 - 23
JUN HYUN KIM ET AL.: "Identification of a quinoxaline derivative that is a potent telomerase inhibitor leading to cellular senescence of human cancer cells.", BIOCHEM J., vol. 15, no. 2, 2003, pages 523 - 9
KNIGHT S.W. ET AL.: "X-linked dyskeratosis congenita is predominantly caused by missense mutations in the DKC1 gene", AM. J. HUM. GENET., vol. 65, 27 May 1999 (1999-05-27), pages 50 - 58, XP008129458 *
LEMARTELEUR T ET AL.: "Stabilization of the c-myc gene promoter quadruplex by specific ligands' inhibitors of telomerase", BIOCHEM BIOPHYS RES COMMUN. 22, vol. 323, no. 3, 2004, pages 802 - 8
MARRONE A; MASON PJ.: "Dyskeratosis congenita", CELL MOL LIFE SCI, vol. 60, no. 3, 2003, pages 507 - 17
MESE H ET AL.: "Inhibition of telomerase activity as a measure of tumor cell killing by cisplatin in squamous cell carcinoma cell line", CHEMOTHERAPY, vol. 47, no. 2, 2001, pages 136 - 42
MITCHELL JR; WOOD E; COLLINS K: "A telomerase component is defective in the human disease dyskeratosis congenita", NATURE, vol. 402, no. 6761, 2 December 1999 (1999-12-02), pages 551 - 5
MOCHIZUKI Y ET AL.: "Mouse dyskerin mutations affect accumulation of telomerase RNA and small nucleolar RNA, telomerase activity, and ribosomal RNA processing", PROC NATL ACAD SCI USA., vol. 20, 2004, pages 10756 - 61
OH S ET AL.: "vivo and in vitro analyses of Myc for differential promoter activities of the human telomerase (hTERT) gene in normal and tumor cells", BIOCHEM BIOPHYS RES COMMUN., vol. 263, no. 2, 1999, pages 361 - 5
PAN H ET AL.: "Structure of tRNA pseudouridine synthase TruB and its RNA complex: RNA recognition through a combination of rigid docking and induced fit", PROC NATL ACAD SCI USA 28, vol. 100, no. 22, 2003, pages 12648 - 53
POOLE JC; ANDREWS LG; TOLLEFSBOL TO: "Activity, function, and gene regulation of the catalytic subunit of telomerase (hTERT", GENE, vol. 16, 2001, pages 1 - 12
REDON S ET AL.: "Platination of the (T2G4)4 telomeric sequence: a structural and crosslinking study", BIOCHEMISTRY, vol. 40, no. 29, 2001, pages 8463 - 70
RONINSON IB ET AL.: "Genetic suppressor elements: new tools for molecular oncology", CANCER RES. 15, vol. 55, no. 18, 1995, pages 4023 - 8
SAMBROOK ET AL.: "Molecular cloning, a Laboratory Manual", vol. 1-3, 1989, COLD SPRING HARBOR LABORATORY PRESS
SAMBROOK, J.; FRITSCH, E.F.; MANIATIS, T.: "Molecular cloning: a laboratory manual", 1989, COLD SPRING HARBOR LABORATORY
SAMBROOK, J.; FRITSCH, E.F.; MANIATIS, T.: "Molecular cloning: a laboratory manual.", 1989, COLD SPRING HARBOR LABORATORY
SANCHEZ-PEREZ; MURGUIA JR; PERONA R.: "Cisplatin induces a persistent activation of JNK that is related to cell death", ONCOGENE, vol. 29, 1998, pages 533 - 40
SIDDIQUI-JAIN A ET AL.: "Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription", PROC NATL ACAD SCI USA., vol. 3;99, no. 18, 2002, pages 11593 - 8
SIRINAVIN C; TROWBRIDGE A.: "Dyskeratosis congenita: clinical features and genetic aspects", J. MED. GENET., vol. 12, 1975, pages 339 - 354
SUN D ET AL.: "Inhibition of human telomerase by a G-quadruplex-interactive compound", J MED CHEM., vol. 4, 1997, pages 2113 - 6
TROWBRIDGE AA; SIRINAVIN C; LINMAN JW.: "Dyskeratosis congenita: hematologic evaluation of a sibship and review of the literature", AM. J. HEMATOL., vol. 3, 1977, pages 143 - 152
VULLIAMY T.J. ET AL.: "Dyskeratosis congenita caused by a 3' deletion: Germline and somatic mosaicism in a female carrier", BLOOD, vol. 94, no. 4, 15 August 1999 (1999-08-15), pages 1254 - 1260, XP008129696 *
WRIGHT WE; SHAY JW; PIATYSZEK MA: "Modifications of a telomeric repeat amplification protocol (TRAP) result in increased reliability, linearity and sensitivity", NUCLEIC ACIDS RES, vol. 25; 23, no. 18, 1995, pages 3794 - 5
YOSHIRO 0 ET AL.: "Tumor metastasis suppressor nm23H1 regulates Rac1 G interaction with Tiam1", PROC NATL ACAD SCI USA, vol. 98, no. 8, 2001, pages 4385 - 4390
ZHANG RG ET AL.: "Effects of cisplatin on telomerase activity and telomere length in BEL-7404 human hepatoma cells.", CELL RES, vol. 12, no. 1, 2002, pages 55 - 62
ZUCCHINI C ET AL.: "The human TruB family of pseudouridine synthase genes, including the Dyskeratosis Congenita 1 gene and the novel member TRUB1", INT J MOL MED., vol. 11, no. 6, 2003, pages 697 - 704

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009065994A1 (es) * 2007-11-23 2009-05-28 Consejo Superior De Investigaciones Cientificas Uso de agentes inductores gse24.2 para la elaboración de composiciones farmaceuticas para el tratamiento de enfermedades que cursan con senescencia celular
ES2334736A1 (es) * 2007-11-23 2010-03-15 Consejo Superior De Investigaciones Cientificas (Titular Al 90%) Uso de agentes inductores gse24.2 para la elaboracion de composiciones farmaceuticas para el tratamiento de enfermedades que cursan con senescencia celular.
ES2334736B1 (es) * 2007-11-23 2011-02-02 Consejo Superior De Investigaciones Cientificas (Titular Al 90%) Uso de agentes inductores gse24.2 para la elaboracion de composiciones farmaceuticas para el tratamiento de enfermedades que cursan con senescencia celular.
WO2015059338A1 (es) 2013-10-25 2015-04-30 Consejo Superior De Investigaciones Científicas (Csic) Péptidos derivados de gse24.2 para tratar enfermedades producidas por estrés oxidativo y daño al adn
US20160340656A1 (en) * 2013-10-25 2016-11-24 Consejo Superior De Investigaciones Científicas (Csic) Peptides derived from gse 24.2 for treating diseases caused by oxidative stress and damage to dna
WO2024194500A1 (es) 2023-03-17 2024-09-26 Consejo Superior De Investigaciones Científicas (Csic) Péptido derivado de gse24.2 y usos del mismo
EP4681700A1 (en) 2023-03-17 2026-01-21 Consejo Superior De Investigaciones Científicas - CSIC Gse24.2-derived peptide and uses thereof

Also Published As

Publication number Publication date
DE602006014574D1 (de) 2010-07-08
JP5560398B2 (ja) 2014-07-23
US9074194B2 (en) 2015-07-07
US20090202503A1 (en) 2009-08-13
JP2009511036A (ja) 2009-03-19
US9587002B2 (en) 2017-03-07
ES2325431B1 (es) 2010-06-28
PT1947175E (pt) 2010-09-02
CA2625981A1 (en) 2007-08-16
EP1947175A1 (en) 2008-07-23
ATE469212T1 (de) 2010-06-15
US20150337022A1 (en) 2015-11-26
EP1947175B1 (en) 2010-05-26
ES2360238T3 (es) 2011-06-02
ES2325431A1 (es) 2009-09-03
DK1947175T3 (da) 2010-09-27

Similar Documents

Publication Publication Date Title
US20250360129A1 (en) Compositions and methods of using tyrosine kinase inhibitors
ES2335368T3 (es) Gen de fusion eml4-alk.
US9587002B2 (en) Sequence of nucleotides and peptides GSE 24.2 of dyskerin, which can induce telomerase activity, method for obtaining same, therapeutic compositions and applications thereof
JP5973035B2 (ja) 腫瘍の治療に使用できるptenの細胞外形態の同定
WO2017208174A2 (en) Methods of treating disease with pfkfb3 inhibitors
ES2376239T3 (es) Procedimiento de cultivo de células mioc�?rdicas.
KR102127218B1 (ko) 뇌 신경 교종 치료용 약물 제조에서의 화합물의 용도
ES2334736B1 (es) Uso de agentes inductores gse24.2 para la elaboracion de composiciones farmaceuticas para el tratamiento de enfermedades que cursan con senescencia celular.
WO2017029206A1 (en) Use of k2p potassium channel for altering the electrophysiology of the heart
Rapisarda et al. Antiangiogenic agents and HIF-1 inhibitors meet at the crossroads
US9234018B2 (en) Compositions and methods for the treatment of VprBP-related cancers
Perona Abellón et al. Sequence of nucleotides and peptides GSE 24.2 of dyskerin, which can induce telomerase activity, method for obtaining same, therapeutic compositions and applications thereof
SÁNCHEZ PÉREZ TELOMERASE ACTIVITY, METHOD FOR OBTAINING SAME, THERAPEUTIC COMPOSITIONS
KR101527749B1 (ko) miR-186, miR-216b, miR-337-3p 및 miR-760 억제제를 유효성분으로 포함하는 세포 노화 예방 또는 치료용 조성물
US7186530B1 (en) Protein associated with cell stress response
US12275759B2 (en) Hepatitis B virus replication inhibitor and pharmaceutical composition for treating hepatitis B comprising the same
JP4805641B2 (ja) 頭頚部癌抑制剤および医薬組成物
US20090047672A1 (en) Telomerase RNA Subunit and Methods of Use Thereof
CA2974958C (en) Compositions and methods of using tyrosine kinase inhibitors
JPWO2006070804A1 (ja) テロメレース活性阻害方法および阻害剤
JP2007169223A (ja) アポトーシス促進剤およびそれを用いた医薬製剤
KR20220035526A (ko) 암질환 예방 또는 치료용 조성물
Yimam Identification and characterization of primate P-glycoprotein
JP2012012330A (ja) 癌転移抑制剤及び医薬組成物

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2008535049

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2625981

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2006849419

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2006849419

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 12090215

Country of ref document: US