WO2007089470A2 - Antigen-binding proteins targeting s. aureus orf0657n - Google Patents
Antigen-binding proteins targeting s. aureus orf0657n Download PDFInfo
- Publication number
- WO2007089470A2 WO2007089470A2 PCT/US2007/001687 US2007001687W WO2007089470A2 WO 2007089470 A2 WO2007089470 A2 WO 2007089470A2 US 2007001687 W US2007001687 W US 2007001687W WO 2007089470 A2 WO2007089470 A2 WO 2007089470A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- mab
- amino acids
- region
- binding protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/12—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from bacteria
- C07K16/1267—Gram-positive bacteria
- C07K16/1271—Micrococcaceae (F); Staphylococcaceae (F), e.g. Staphylococcus (G)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/72—Increased effector function due to an Fc-modification
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
Definitions
- Staphylococcus aureus is a pathogen responsible for a wide range of diseases and conditions.
- diseases and conditions caused by S. aureus include bacteremia, infective endocarditis, folliculitis, furuncle, carbuncle, impetigo, bullous impetigo, cellulitis, botryomyosis, toxic shock syndrome, scalded skin syndrome, central nervous system infections, infective and inflammatory eye disease, osteomyelitis and other infections of joints and bones, and respiratory tract infections.
- bacteremia infective endocarditis
- folliculitis furuncle
- carbuncle impetigo, bullous impetigo, cellulitis, botryomyosis
- toxic shock syndrome scalded skin syndrome
- central nervous system infections infective and inflammatory eye disease
- osteomyelitis and other infections of joints and bones, and respiratory tract infections ⁇ The Staphylococci in Human Disease, Crossley and Archer (eds.), Churchill Living
- Immunological based strategies can be employed to control S. aureus infections and the spread of S. aureus.
- Immunological based strategies include passive and active immunization. Passive immunization employs immunoglobulins targeting S. aureus. Active immunization induces immune responses against S. aureus.
- ORF0657n is an £ aureus protein.
- ORF0657n target regions are provided by the mAb 1G3.BD4, mAb 2H2.BE11, mAb 13C7.BC1, and mAb 13G11.BF3 binding sites.
- mAb 2H2.BE11 and mAb 13C7.BC1 provided for increased survival against S. aureus infection.
- Mouse hybridoma cell lines producing mAb 1 G3.BD4, mAb 2H2.BE11 , mAb 13C7.BC1, and mAb 13Gl 1.BF3 were deposited with the American Type Culture Collection, 10801 University Boulevard, Manassas, VA 20110-2209, in accordance with Budapest Treaty on September 30, 2005.
- the cells lines were designated: ATCC No. PTA-7124 (producing mAb 2H2.BE1 1), ATCC No. PTA-7125 (producing mAb 13C7.BC1), ATCC No. PTA-7126 (producing mAb 1G3.BD4), and ATCC No. PTA-7127 (producing mAb 13Gl 1.BF3).
- a first aspect of the present invention features an isolated antigen binding protein comprising a first variable region and a second variable region.
- the first and second variable regions bind one or more target regions selected from the group consisting of: mAb 1G3.BD4 target region, mAb 2H2.BE11 target region, mAb 13C7.BC1 target region, and mAb 13G11.BF3 target region.
- references to "isolated” indicates a different form than found in nature.
- the different form can be, for example, a different purity than found in nature and/or a structure that is not found in nature.
- a structure not found in nature includes recombinant structures where different regions are combined together, for example, humanized antibodies where one or more murine complementary determining regions is inserted onto a human framework scaffold or a murine antibody is resurfaced to resemble the surface residues of a human antibody, hybrid antibodies where one or more complementary determining regions from an antigen binding protein is inserted into a different framework scaffold, and antibodies derived from natural human sequences where genes coding for light and heavy variable domains were randomly combined together.
- the isolated protein is preferably substantially free of serum proteins.
- a protein substantially free of serum proteins is present in an environment lacking most or all serum proteins.
- a “variable region” has the structure of an antibody variable region from a heavy or light chain.
- Antibody heavy and light chain variable regions contain three complementary determining regions interspaced onto a framework. The complementary determining regions are primarily responsible for recognizing a particular epitope.
- a target region is defined with respect to the ORF0657n region (SEQ ID NO: 1) bound by mAb 1G3.BD4, mAb 2H2.BE11, mAb 13C7.BC1, or mAb 13G11.BF3.
- the mAb IG3.BD4 target region is the ORF0657n region to which mAb IG3.BD4 binds.
- a protein binding an identified target region competes with either mAb 1G3.BD4, mAb 2H2.BE11, mAb 13C7.BC1, or mAb 13Gl 1.BF3 for binding to the target region.
- mAb 1G3.BD4 binding to ORF0657n binds to the mAb 1G3.BD4 target region.
- mAb 13C7.D12 reduces binding of the monoclonal antibody to ORF0657n by at least about 20%, preferably at least about 50%, when excess and equal amounts of the competing protein and monoclonal antibody are employed.
- protein indicates a contiguous amino acid sequence and does not provide a minimum or maximum size limitation.
- One or more amino acids present in the protein may contain a post-translational modification, such as glycosylation or disulfide bond formation.
- a preferred antigen binding protein is a monoclonal antibody.
- “monoclonal antibody” indicates a collection of antibodies having the same, or substantially the same, complementary determining region, and binding specificity. The variation in the antibodies is that which would occur if the antibodies were produced from the same construct(s).
- Monoclonal antibodies can be produced, for example, from a particular hybridoma and from a recombinant cell containing one or more recombinant genes encoding the antibody.
- the antibody may be encoded by more than one recombinant gene where, for example, one gene encodes the heavy chain and one gene encodes the light chain.
- Another aspect of the present invention describes a nucleic acid containing a recombinant gene comprising a nucleotide sequence encoding an antibody variable region.
- the antibody variable region can bind a target region selected from the group consisting of: mAb IG3.BD4 target region, mAb 2H2.BE11 target region, mAb 13C7.BC1, and mAb 13Gl 1.BF3 target region.
- a recombinant gene contains recombinant nucleic acid encoding a protein along with regulatory elements for proper transcription and processing (which may include translational and post translational elements).
- the recombinant nucleic acid by virtue of its sequence and/or form does not occur in nature.
- Examples of recombinant nucleic acid include purified nucleic acid, two or more nucleic acid regions combined together providing a different nucleic acid than found in nature, and the absence of one or more nucleic acid regions ⁇ e.g., upstream or downstream regions) that are naturally associated with each other.
- Another aspect of the present invention describes a recombinant cell comprising one or more recombinant genes encoding an antibody variable region that binds to a target region selected from the group consisting of: mAb IG3.BD4 target region, mAb 2H2.BE11 target region, mAb 13C7.BC1, and mAb 13Gl 1.BF3 target region.
- Multiple recombinant genes are useful, for example, where one gene encodes an antibody heavy chain or fragment thereof containing the Vh region and another nucleic acid encodes an antibody light chain or fragment thereof containing the V ⁇ region.
- Another aspect of the present invention comprises a method of producing a protein comprising an antibody variable region.
- the method comprising the steps of: (a) growing a recombinant cell comprising recombinant nucleotide acid encoding for a protein under conditions wherein the protein is expressed; and (b) purifying the protein.
- compositions contain a therapeutically effective amount of an antigen binding protein and a pharmaceutically acceptable carrier.
- a therapeutically effective amount is an amount sufficient to provide a useful therapeutic or prophylactic effect.
- an effective amount is sufficient to achieve one or more of the following effects: reduce the ability of S. aureus to propagate in the patient or reduce the amount of 51 aureus in the patient.
- an effective amount is sufficient to achieve one or more of the following: a reduced susceptibility to 51 aureus infection or a reduced ability of the infecting bacterium to establish persistent infection for chronic disease.
- Another aspect of the present invention describes a method of detecting the presence of an OFR0657n antigen in a solution or on a cell.
- the method involves providing a binding protein described herein to the solution or cell and measuring the ability of the binding protein to bind to the antigen in the solution or cell. Measurements can be quantitative or qualitative.
- Reference to ORF0657n antigen includes full-length ORF0657n or a derivative thereof having an epitope that is recognized by mAb 1G3.B3, mAb 2H2.B8, mAb 13C7.D12, or mAb 13Gl 1.Cl 1.
- Examples of derivatives include truncated versions; and full-length or truncated versions of ORF0657n containing one or more of the following amino acid alterations: one or more additions, one or more substitutions, and one or more deletions.
- Another aspect of the present invention features a method of treating a patient against a S. aureus infection.
- the method comprises the step of administering to the patient an effective amount of an antigen binding protein described herein.
- the patient being treated may, or may not, be infected with S. aureus.
- the patient is a human.
- Another aspect of the present invention describes a cell line producing a protein that is either mAb 1G3.B3, mAb 2H2.B8, mAb 13C7.D12, or mAb 13Gl LCl 1, or that competes with either mAb IG3.B3, mAb 2H2.B8, mAb 13C7.D12, or mAb 13Gl 1.Cl 1 for binding to ORF0657n.
- Preferred cells lines are hybridomas, and recombinant cell lines containing recombinant nucleic acid encoding the protein.
- Figure 1 illustrates the structure of an IgG molecule.
- VL refers to a light chain variable region.
- VH refers to a heavy chain variable region.
- CL refers to a light chain constant region.
- CHj refers to a light chain constant region.
- CHj heavy chain constant regions. Dashed lines indicate disulfide bonds.
- Figure 2 illustrates a matrix outlining the reactivities of different monoclonal antibodies in a pair-wise binding study.
- the panel of monoclonal antibodies fell into three reactive areas by the BIACORE® method.
- Fig. 3A 0.49 mg mAb 13C7.BC1; 0.45 mg mAb 6G6.A8; and 9.8 x 10 8 CFU S. aureus Becker.
- Fig. 4A illustrates results with 2.09 X 10 8 CFU S. aureus UK58.
- Fig. 4B illustrates results with 2.15 X 10 s S. aureus UK 58.
- ORF0657n is an S. aureus protein located at the S. aureus outer membrane. ORF0657n has been found to be well conserved in different strains of S. aureus. (Anderson et al., International Publication No. WO 2005/009379, International Publication Date February 3, 2005.) Different ORF0657n derivatives can be used to produce a protective immune response against S. aureus infection. (Anderson et al, International Publication No. WO 2005/009379, International Publication Date February 3, 2005.)
- antigen binding proteins described herein can be used, for example, as a tool in the production, characterization, or study of ORF0657n based antigens.
- Antigen binding protein recognizing appropriate ORF0657n epitopes can also be used agent to treat S. aureus infection.
- Antigen binding proteins contain an antibody variable region providing for specific binding to an epitope.
- the antibody variable region can be present in, for example, a complete antibody, an antibody fragment, and a recombinant derivative of an antibody or antibody fragment.
- IgG IgG
- An IgG molecule contains four amino acid chains: two longer length heavy chains and two shorter light chains.
- the heavy and light chains each contain a constant region and a variable region.
- the hypervariable regions are interposed between more conserved flanking regions (also referred to as framework regions).
- Amino acids associated with framework regions and complementarity determining regions can be numbered and aligned as described by Kabat et al., Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services, 1991.
- the two heavy chain carboxyl regions are constant regions joined by disulfide binding to produce an Fc region.
- the Fc region is important for providing antibody biological activity such as complement and macrophage activation.
- Each of the two heavy chains making up the Fc region extend into different Fab regions through a hinge region.
- the light chains are either K or ⁇ .
- the heavy chains define the antibody class and are either ⁇ , ⁇ , ⁇ , ⁇ , or ⁇ .
- IgG has a ⁇ heavy chain.
- Subclasses also exist for different types of heavy chains such as human J 1 , J 2 , Jz, and ⁇ 4 . Heavy chains impart a distinctive conformation to hinge and tail regions. (Lewin, Genes IV, Oxford University Press and Cell Press, 1990.)
- Antibody fragments containing an antibody variable region include Fv, Fab, and Fab 2 regions.
- Each Fab region contains a light chain made up of a variable region and a constant region, and a heavy chain region containing a variable region and a constant region. A light chain is joined to a heavy chain by disulfide bonding through constant regions.
- the light and heavy chain variable regions of a Fab region provide for an Fv region that participates in antigen binding.
- the antibody variable region can be present in a recombinant derivative.
- recombinant derivatives include single-chain antibodies, diabody, triabody, tetrabody, and miniantibody. (Kipriyanov et al, Molecular Biotechnology 25:39-60, 2004.)
- the antigen binding protein can contain one or more variable regions recognizing the same or different epitopes. (Kipriyanov et al, Molecular Biotechnology 26:39-60, 2004.)
- 2H2.BE11 target region, mAb 13C7.BC1 target region, or mAb 13Gl 1.BF3 target region can be generated starting with the respective monoclonal antibody.
- the epitope recognized by a binding protein can be used to select additional binding proteins.
- the mAb 2H2.BE11 target region appears to be located at approximately amino acids
- ORF0657n can be used as a target antigen to select for antibodies.
- the target region of the generated antibodies can be determined.
- Examples of such techniques include use of phage display technology and hybridoma production.
- Human antibodies can be produced using chimeric mice such as a XenoMouse or Trans-Chromo mouse. ⁇ E.g., Azzazy et al, Clinical Biochemistry 55:425-445, 2002, Berger et al, Am. J. Med. ScI 324(1): ⁇ 4- 40, 2002.)
- the monoclonal antibodies mAb 1G3.BD4, mAb 2H2.BE11, mAb 13C7.BC1, and mAb 13Gl 1.BF3 contain variable regions recognizing ORF0675n. Additional binding proteins recognizing ORF0657n can be produced based on antibody variable regions. Additional binding proteins can, for example, be produced by modifying an existing monoclonal antibody and by using variable region sequence information. Protein construction and sequence manipulation can be performed using recombinant nucleic acid techniques.
- the monoclonal antibodies mAb 1G3.BD4, mAb 2H2.BE1 1, mAb 13C7.BC1, and mAb 13Gl 1.BF3 are murine antibodies.
- preferred binding proteins based on such mAb's are designed to reduce the potential generation of human anti-mouse antibodies recognizing the murine regions.
- human anti-mouse antibodies can be reduced using techniques such as murine antibody humanization, de-immunization, and chimeric antibody production.
- murine antibody humanization See, for example, O'Brien et al., Humanization of Monoclonal Antibodies by CDR Grafting, p 81-100, From Methods in Molecular Biology Vol. 207: Recombinant antibodies for Cancer Therapy: Methods and Protocols (Eds. Welschof and Krauss) Humana Press, Totowa, New Jersey, 2003; Kipriyanov et al., Molecular Biotechnology 26:39-60, 2004; Gonzales et al, Tumor Biol.
- Murine antibodies can be humanized using techniques such as grafting complementary determining regions into a framework region or resurfacing.
- Resurfacing also known as veneering
- modifying a variable region so the surface exposed regions are humanized.
- Grafting complementary determining regions involves taking such regions or a portion of such regions from, for example, a murine source and inserting the regions into a human variable region framework.
- the human framework used for grafting can be selected based on sequence homology to the variable region (e.g., murine) from which the region was obtained.
- Essential framework residues associated with grafted complementary determining regions should also be provided in the new framework.
- De-immunization involves altering potential linear T-cell epitopes present in the antibody.
- the epitopes can be identified based on a bioinformatics scan of know human HLA class I and/or class II epitopes. (Presto-, Advanced Drug Delivery Reviews 55:640-656, 2006.)
- a chimeric antibody contains a human constant region, along with a variable region from a different organism, such as a mouse.
- the human constant region provides an Fc region.
- Additional examples of alterations include providing a variable region in, for example, a single chain antibody, a diabody, a triabody. a tetrabody, and a miniantibody.
- the mAb 2H2.BE11 target region was further characterized and the amino acids sequence of the variable regions was determined. The identified target region and the sequence information facilitate obtaining different binding proteins directed to the mAb 2H2.BE11 target region.
- the binding protein binds to a polypeptide consisting of amino acids 76-357 of SEQ FD NO: 1.
- the binding protein is either a human antibody, a humanized antibody, a de-immunized antibody, or chimeric antibody.
- Preferred antibodies are isolated antibodies and monoclonal antibodies.
- the amino acids sequences of the mAb 2H2.BE1 1 variable regions are provided by SEQ ID NO: 20 (Vh) and SEQ ID NO: 21 (Vi).
- the complementary determining regions (CDR's) within Vh were identified at amino acids 36-45, 50-65, and 98-107.
- the CDR's within Vi were identified at amino acids 24-33, 49-55, and 88-96 of SEQ ID NO: 21.
- the binding protein binds the mAb 2H2.BE11 target region and comprises, consists, or consists essentially of: a first Vh CDR comprising, consisting, or consisting essentially of amino acids 36-45 of SEQ DD NO: 20 or a sequence differing from amino acids 36-45 by one amino acid; a second Vh CDR comprising, consisting, or consisting essentially of amino acids 50-65 of SEQ ID NO: 20 or a sequence differing from amino acids 50-65 by one amino acid; and a third Vh CDR comprising, consisting, or consisting essentially of amino acids 98-
- the binding protein binds the mAb 2H2.BE 11 target region and comprises, consists, or consists essentially of a first V[ CDR comprising, consisting, or consisting essentially of amino acids 24-33 of SEQ ID NO: 21 or a sequence differing from amino acids 24-33 by one amino acid; a second Vi CDR comprising, consisting, or consisting essentially of amino acids 49-55 of SEQ ID NO: 21 or a sequence differing from amino acids 49-55 by one amino acid; and a third V] CDR comprising, consisting, or consisting essentially of amino acids 88-
- amino acid difference can be an amino acid deletion, insertion, or substitution.
- the substituted amino acids should have one or more similar properties such as approximately the same charge, size, polarity and/or hydrophobicity.
- an amino acid substitution is a conservative substitution.
- the Vh region is either SEQ ID NO: 20, a humanized SEQ ID NO: 20 , or a de-immunized SEQ ID NO: 20; and/or the V] region is either SEQ ID NO: 21, a humanized SEQ ID NO: 21, or a de-immunized SEQ BD NO: 21.
- the antibody comprises, consists, or consists essentially of: (a) a heavy chain comprising a Vh region as described in this Section DI, and a human hinge, CH], CH2, and CH3 regions from an IgGi, IgG2 > IgG3 or IgG4, and (b) a light chain comprising a Vi region as described above in this section DI, and a human kappa CL or human lambda CL.
- the antibody comprises, consists, or consists essentially of: (a) a heavy chain comprising a Vh region as described in this Section DI, and a human hinge, CHi, CH2, and CH3 regions from an IgGi or IgG2 and (b) a light chain comprising a Vj region as described above in this Section TIT, and a human kappa CL; and the heavy chain consists essentially of the amino acid sequence of SEQ ID NO: 22 and/or the light chain consists essentially of the amino acid sequence of SEQ ID NO: 23.
- the antigen-binding protein described herein has Vh and Vl regions providing an affinity KD at least about 100 nM, preferably at least about 30 nM to the target antigen. Binding to the target antigen can be determined as described in Example 11, using an ORF0657n fragment from amino acids 42-486
- Preferred binding proteins for the different embodiments are an antibody. More preferably the antibody is isolated or a monoclonal antibody.
- Antigen binding protein are preferably produced using recombinant nucleic acid techniques or through the use of a hybridoma.
- Recombinant nucleic acid techniques involve constructing a nucleic acid template for protein synthesis.
- Hybridoma techniques involve using an immortalized cell line to produce the antigen binding protein.
- Suitable recombinant nucleic acid and hybridoma techniques are well known in the art. (See for example, Ausubel, Current Protocols in Molecular Biology, John Wiley, 2005, Harlow et al, Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, 1988.)
- Recombinant nucleic acid encoding an antigen binding protein can be expressed in a host cell that in effect serves as a factory for the encoded protein.
- the recombinant nucleic acid can provide a recombinant gene encoding the antigen binding protein that exists autonomously from a host cell genome or as part of the host cell genome.
- a recombinant gene contains nucleic acid encoding a protein along with regulatory elements for protein expression.
- the regulatory elements that are present in a recombinant gene include a transcriptional promoter, a ribosome binding site, a terminator, and an optionally present operator.
- a preferred element for processing in eukaryotic cells is a polyadenylation signal.
- Antibody associated introns may also be present. Examples of expression cassettes for antibody or antibody fragment production are well known in art. (E.g., Persic et al. Gene 187:9-18, 1997, Boel et al, J. Immunol. Methods 239: 153-166, 2000, Liang et al., J. Immunol. Methods 247: 119-130, 2001 , Tsurushita et al, Methods 36:69-83, 2005.)
- Expression of a recombinant gene in a cell is facilitated using an expression vector.
- the expression vector in addition to a recombinant gene, also contains an origin of replication for autonomous replication in a host cell, a selectable marker, a limited number of useful restriction enzyme sites, and a potential for high copy number.
- an origin of replication for autonomous replication in a host cell e.g., Persic et al, Gene 187:9-18, 1997, Boel et al, J. Immunol. Methods 239:153-166, 2000, Liang et al, J. Immunol Methods 247:1 19-130, 2001, Tsurushita et al, Methods 56:69-83, 2005.
- nucleic acid encoding an antibody may be integrated into the host chromosome using techniques well known in the art. (E.g., Ausubel, Current Protocols in Molecular Biology, John Wiley, 2005, Marks et al., International Application Number WO 95/17516, International Publication Date June 29, 1995.)
- a variety of different cell lines can be used for recombinant antigen binding protein expression, including those from prokaryotic organisms (e.g., E. coli, Bacillus sp, and Streptomyces sp. (or streptomycete) and from eukaryotic (e.g., yeast, Baculovirus, and mammalian).
- prokaryotic organisms e.g., E. coli, Bacillus sp, and Streptomyces sp. (or streptomycete
- eukaryotic e.g., yeast, Baculovirus, and mammalian.
- Preferred hosts for recombinant antigen binding protein expression provide for mammalian post translational modifications.
- Post translational modifications chemical modification such as glycosylation and disulfide bond formation.
- Another type of post translational modification is signal peptide cleavage.
- mammalian host cells can be used to provide for efficient post-translational modifications including mammalian host cells and non-mammalian cells.
- mammalian host cells include but are not limited to Chinese hamster ovary (Cho), HeLa, C6, PC 12, Human Embryonic Kidney (HEK293) and myeloma cells. (Yoo et al, Journal of Immunological Methods 261:1 -20, 2002, Persic et al, Gene /57:9-18, 1997.)
- Non-mammalian cells can be modified to replicate human glycosylation.
- Preferred recombinant genes comprise a nucleotide sequence encoding an antibody variable region that binds to a target region selected from the group consisting of: mAb IG3.BD4 target region, mAb 2H2.BE11 target region, mAb 13C7.BC1, and mAb 13Gl 1.BF3 target region.
- a particular recombinant gene can encode for a protein containing one variable region or both a Vh and Vi region.
- the recombinant gene can also encode for antibody constant regions and hinge region. If desired, an antibody can be produced using a combination of recombinant genes, where one gene encodes for a light chain and the second gene encodes for a heavy chain.
- nucleic acid encoding a protein described in Section ⁇ or HI supra examples of such embodiments are provided below.
- the nucleotide sequence encodes a variable region comprising, consisting, or consisting essentially of: a first Vh CDR comprising, consisting, or consisting essentially of amino acids 36-45 of SEQ ID NO: 20 or a sequence differing from amino acids 36-45 by one amino acid; a second Vh CDR comprising, consisting, or consisting essentially of amino acids 50-65 of SEQ ID NO: 20 or a sequence differing from amino acids 50-65 by one amino acid; and a third Vh CDR comprising, consisting, or consisting essentially of amino acids 98-
- the nucleotide sequence encodes a variable region comprising, consisting, or consisting essentially of a first Vj CDR comprising, consisting, or consisting essentially of amino acids 24-33 of SEQ ID NO: 21 or a sequence differing from amino acids 24-33 by one amino acid; a second Vj CDR comprising, consisting, or consisting essentially of amino acids 49-55 of SEQ ID NO: 21 or a sequence differing from amino acids 49-55 by one amino acid; and a third Vj CDR comprising, consisting, or consisting essentially of amino acids 88-96 of SEQ ID
- the Vh region is either SEQ TD " NO: 20, a humanized SEQ ID NO: 20 , or a de-immunized SEQ ID NO: 20; and the Vj region is either SEQ ID NO: 21, a humanized SEQ ID NO: 21, or a de-immunized SEQ ID NO: 21.
- the recombinant gene encodes either or both a protein comprising, consisting, or consisting essentially of: (a) a heavy chain comprising a Vh region as provided in Section DI supra, a human hinge, CHi, CH2, and CH3 from an IgGl, IgG2, IgG3 or IgG4 subtype or (b) a light chain comprising a Vi region as provided in Section DI supra, and a human kappa CL or lambda C ⁇ _,.
- the heavy chain consists essentially of the amino acid sequence of SEQ E) NO: 22; and the light chain consists essentially of the amino acid sequence of SEQ ID NO: 23.
- Antigens containing certain ORF0657n regions can be used to provide a protective immune response against S. aureus infection. (Anderson et al., International Publication No. WO 2005/009379, International Publication Date February 3, 2005.)
- An antigen binding protein recognizing an ORF0657n target region can be used to facilitate the production, characterization, or study of ORP0657n antigens and vaccines.
- Antigen binding protein recognizing appropriate epitopes can also have therapeutic applications.
- ORF0657n related antigens and vaccines examples include:
- the antibodies can be used in a lethal model to determine if a specific area of the ORF0657n protein confers protection;
- the assay can be used to monitor antigen quality, product production and stability;
- Serology assays can utilize a monoclonal antibody in a competitive format to identify an immune response to ORF0657n derived antigen vaccinated patients.
- the presence of an ORF0657n antigen in a solution, bound to a microsphere or on a cell is determined using an antigen binding protein.
- the ability of the binding protein to bind to a protein present in the solution or cell can be determined using different techniques such as a Western blot, enzyme-linked immunosorbent assay (ELTSA), flow cytometry, and Luminex immunoassay.
- Therapeutic and prophylactic treatment can be performed on a patient using an antigen binding protein binding to an appropriate target region.
- Therapeutic treatment is performed on those persons infected with S. aureus.
- Prophylactic treatment can be performed on the general population or a subset of the general population. A preferred subset of the general population are those persons at an increased risk of S. aureus infection.
- a "patient” refers to a mammal capable of being infected with S. aureus.
- the patient is a human.
- other types of mammals such as cows, pigs, sheep, goats, rabbits, horses, dogs, cats, monkeys, rats, and mice, can be infected with S. aureus.
- Treatment of non-human patients is useful in protecting pets and livestock, and in evaluating the efficacy of a particular treatment.
- Persons with an increased risk of S. aureus infection include health care workers; hospital patients; patients with a weakened immune system; patients undergoing surgery; patients receiving foreign body implants, such as a catheter or a vascular device; patients facing therapy leading to a weakened immunity; and persons in professions having an increased risk of burn or wound injury.
- a patient is administered an antigen binding protein in conjunction with surgery or a foreign body implant.
- Reference to "surgery or a foreign body implant” includes surgery with or without providing a foreign implant, and providing a foreign implant with or without surgery.
- the timing of administration can be designed to achieve prophylactic treatment and/or therapeutic treatment. Administration is preferably started around the same time as surgery or implantation.
- Pharmaceutically acceptable carriers facilitate storage or administration of an antigen binding protein.
- Substances used to stabilize protein solution formulations include carbohydrates, amino acids, and buffering salts. (Middaugh et al, Handbook of Experimental Pharmacology 757:33-58, 1999.)
- Antigen binding proteins can be administered by different routes such as intraveneous, subcutaneous, intramuscular, or mucosal.
- Subcutaneous and intramuscular administration can be • performed using, for example, needles or jet-injectors.
- Mucosal delivery such as nasal delivery, can involve using enhancers or mucoadhesives to produce a longer retention time at adsorption sites. (Middaugh et al, Handbook of Experimental Pharmacology 737:33-58, 1999.)
- Suitable dosing regimens are preferably determined taking into account factors well known in the art including age, weight, sex and medical condition of the patient; the route of administration; the desired effect; and the particular compound employed. It is expected that an effective dose range should be about 0.1 mg/kg to 20 mg/kg, or 0.5 mg/kg to 5 mg/kg.
- the dosing frequency can vary depending upon the effectiveness and stability of the compound. Examples of dosing frequencies include biweekly, weekly, monthly and bimonthly.
- Monoclonal antibodies directed to ORF0657n were generated using ORF0657n-C/e (SEQ ED NO: 2) or ORF0657n-H/y (SEQ ID NO: 3) as an antigen.
- the antibodies were identified and characterized by ELISA and flow cytometry.
- mice and Immunizations Female BALB/c mice, 4-5 weeks old, were purchased from Taconic (Germantown, N. Y.). Mice were immunized intramuscularly (i.m.) on days 0, 7, and 21, with 20 ⁇ g of E. coli produced ORF0657n-C/e antigen or Yeast expressed ORF0657n-H/y antigen, formulated on aluminum hydroxyphosphate adjuvant. (Anderson et al, International Publication No. WO 2005/009379, International Publication Date February 3, 2005.) A final intravenous injection (i.v.) of 20 ⁇ g of protein in phosphate buffered saline (PBS) was given to mice three days prior to the fusion. Mice were sacrificed and the spleens removed for cell fusion.
- PBS phosphate buffered saline
- Lymphocytes prepared from spleens were fused with the mouse myeloma partner SP2/0-Agl4 (ATCC 1581) by polyethylene glycol 1500 (Boehringer Mannheim) at a ratio of 3: 1.
- the fusions were plated into 96-well flat-bottomed microtiter plates in Dulbecco's Modification of Eagle's Medium, high glucose, pyruvate (DMEM) containing 20% fetal bovine serum, hypoxanthine (10 "4 M), thymidine (10 "5 M), Aminopterin (4 x 10 '7 M) was added 24 hours later.
- Supernatants from growing hybridomas were screened by ELISA for reactivity to ORF0657n as described below. Positive wells were cloned by limiting dilution and retested for ELISA reactivity.
- Monoclonal antibodies were classified with an antibody-isotyping kit (Roche Diagnostics Corporation, Indianapolis, IN).
- ELISA Costar medium binding microtiter plates were coated overnight at 2-8 0 C with 50 nanograms per well of E. coli expressed SEQ ID NO: 2 in PBS. The plate was washed three times with PBS, 0.05% Tween20 and blocked with 1% Bovine serum albumin, PBS, 0.05% Tween20 (assay diluent) for at least 1 hour. The plate was washed as before and supernatants from the fusion wells or cloned hybridomas were added and allowed to incubate for 2 hours at room temperature.
- the plate was washed as before and a Goat anti-mouse IgG (H+L)-HRP conjugate (Zymed) (1 :8000 in assay diluent) added and allowed to incubate for 1 hour at room temperature.
- Assay plates were developed with TMB substrate, the reaction stopped with 2.0 N H 2 SO 4 and read in a plate reader at OD 450 nm. Wells were considered positive that had an optical density at 450 nm of >1.0.
- the cells were washed by adding 1 mL of phosphate buffered saline; 1% bovine serum albumin; 0.1% sodium azide (PAA) to the tube.
- the cells were pelleted by centrifiigation (5500 rpm, 5 minutes). The supernatant was removed and the cells were mixed with 100 ⁇ L of secondary antibody (FITC-labeled goat anti-mouse Ig (BD Pharmingen) diluted 1:100 in PAAG). Incubation was for 1 hour at room temperature in the dark. After incubation, 1 mL PAA was added to the reaction mixture, the cells were pelleted (5500 rpm, 5 minutes) and supernatant removed. The pellets were resuspended in 1 mL of PBS and transferred to 12 x 75 mm tubes for FAC analysis.
- PAP phosphate buffered saline
- bovine serum albumin 0.1% sodium azide
- Tubes were run on a BD-FACSCalibur flow cytometer instrument gated for bacterial cells and measuring the amount of FITC associated with the cells.
- a standard antibody with known binding to the surface of S. aureus was run in every assay.
- a negative control was run as cells and the secondary conjugate alone. Hybridoma wells were considered positive if the geometric mean value was greater than 30.
- Fusion #1 was generated from E. coli produced ORF0657n-C/e antigen. Fusion #2 was generated with Yeast expressed ORF0657n-H/y antigen.
- mAb labeling kit (Molecular Probes) according to the manufacturer's instructions. The amount of mAb that would just saturate the surface of RPMI-grown bacterial cells was determined for both the labeled and unlabeled mAbs. Each of the mAbs in Table 3 (1 st column) were used labeled and unlabeled.
- the inhibition assay was performed by first incubating 5 X 10 7 cells with the unlabeled mAb at a concentration that would saturate the surface of the cells. This reaction was incubated at room temperature for 1 hour. After this incubation, the reactions were washed with 1 ml of PAA and spun at 6,000 RPM for 5 minutes in a microcentrifuge (Hermle). The supernatant was removed down to ⁇ 50 ul and the cells were resuspended in 100 ul of PAAG containing the amount of directly labeled mAb that would just saturate the surface of the cells.
- ORF0657n altered proteins were used to further characterize binding.
- Nucleic acid encoding ORF0657n was initially cloned into the expression vector pET-28a (Novagen) and expressed in E. coli with a C-terminal 6X his tag (SEQ BD NO: 2).
- the expression vector with the cloned gene was subjected to mutagenesis using Stratagene's QuikChange XL Site-Directed Mutagenesis Kit following the manufacturer's instructions. The gene was mutated with specific sequential amino acid changes.
- the resulting plasmid was transformed into Stratagene's XLlO-GoId competent cells following the manufacturer's protocol.
- Plasmids were isolated from transformants using Qiagen's QIAprep Spin Miniprep Kit. Transformants were screened by sequencing using ABI's 310 DNA Sequencer. Plasmid from the transformant exhibiting the greatest number of base changes was transformed into the expression host HMS 174(DE3) (Novagen). Transformants were expressed following Novagen's instructions.
- ORF0657n mAbs SEQ IDs 4-19. These proteins were screened with the 10 different mAbs in dot blots using standard procedures. Positive/negatives were confirmed by Western blots using standard procedures. By this approach antibodies were grouped according to their binding profile. Seven of the antibodies resolved to three groups; the three remaining antibodies (2H2.B8, 8A8.E11.H3 and 13G11.C11) had profiles that were similar but not identical to each other (Table 5).
- BIACORE ® incorporates microfiuidics technology and surface plasmon resonance (SPR) to detect changes in mass by monitoring changes in the refractive index of a polarized light aimed directly at the surface of a carboxyl methyl dextran coated (CM5) sensor chip.
- SPR surface plasmon resonance
- the changes in response, measured in Response Units, can be correlated to the amount of bound analyte ⁇ i.e. antigen or antibody).
- An anti-staphylococcal antibody (mAb 13C7.D12) was covalently bound (immobilized) on the surface of the CM5 sensor chip.
- the immobilized Ab was exposed first to the ORF0657n protein and subsequently to a pair of antibodies in a matrix format. After each cycle of ORF0657n protein + antibody pair, the surface of the sensor chip was regenerated back to the immobilized mAb 13C7.D12 using 20 mM HCl. Eight antibodies were tested against the ORF0657n protein in a matrix format so that all combinations of each antibody pair could be analyzed.
- Table 6 The matrix design for mAb pairs used in this experiment is summarized in Table 6.
- Test Antibody Response Units 1000 mRU Ab or ORF0657n protein Response Units RU Ag
- the percentage of available epitope remaining for each antibody can be calculated for the mapping pair as follows:
- FIG. 2 illustrates matrix resulting outlining the reactivities of the monoclonal antibodies in a pair-wise binding study.
- the panel of monoclonal antibodies fell into three reactive areas by the BIACORE® method (See Table 7).
- the monoclonal antibodies mAb 2H2.BE1 1 and mAb 13C7.BC1 were tested for their ability to provide protection against S. aureus infection. These antibodies recognize different epitopes on the ORF0657n protein. Controls included an isotype matched mAb and PBS-only.
- the mAbs or PBS were administered intraperitoneally (i.p.) 20 hours prior to bacterial challenge. Mice were then challenged with a LD 8 O -M dose of S. aureus Becker i.v. and monitored for survival. Each experiment was repeated three times with groups of 10 or 20 mice and was monitored for 10 days. The half life for the monoclonal antibodies in uninfected BALB/c mice is approximately eight days. A dose of 0.5 mg was found to be optimal. The results of experiments with the two monoclonal antibodies are presented in Figures 3A-C, 4A, 4B, and 5A-C.
- a murine indwelling catheter model was used with mAb 2H2.BE11.
- the S. aureus strain used in this model was the clinical isolate MCL8538. This strain was selected as lower inocula could be administered while still getting reproducible colonization of catheters compared to S. aureus Becker, the strain used in the murine sepsis model.
- mice had catheters (PE50 silicone rubber) surgically implanted into the jugular vein, held in place with sutures, and exiting with a port on the dorsal midline of the mouse. Mice were rested 9-11 days post surgery. At 24 hours prior to challenge, mice were passively immunized with a single injection of 600 meg of murine monoclonal antibody 2H2.BE11 administered i.p. At day 0, mice were challenged with S. aureus MCL8538 administered i.v. The inoculum dose was 2 -8 X 10 5 CFU in 100 ⁇ l volume (Experiments 1 to 3). This low dose was found to clear spontaneously from the catheters after 4 days. Therefore, catheters were assessed for bacteria at 24 hours post challenge. At that time, mice were sacrificed and catheters harvested. The presence of bacteria on the catheters was assessed by culturing the entire catheter on TSA. If any sign of outgrowth was observed on the plate the catheter was scored as culture positive.
- catheters PE50 silicone rubber
- Example 8 Ex-Vivo Pre-Opsonization of Bacteria Using anti-ORF0657n Monoclonal Antibodies 2H2.B8 (IgGl). 2H2.BE11 ⁇ gG2bt. or 13C7.IeG2b or Isotvpe Matched Control mAbs
- a quantity of bacteria sufficient for 6 Balb/c mice (6 X LDioo) was incubated with 800 ⁇ g IgG at 4 0 C for 1 hour, with gentle rocking. Bacteria were then pelleted and' any unbound mAb removed. Antibody-opsonized bacteria were re-suspended in 2.4 mL of PBS, and 0.4 mL (1 X LDioo) was injected into each of five mice. After challenge, each inoculum was quantitated by plating on TSA to insure that equivalent CFU was given to all groups of mice and that the mAbs had not aggregated the bacteria. Survival was monitored for 3 days post challenge.
- ORF0657n expression was monitored by flow cytometry using mAb 2H2.B8.
- the dose of opsonized bacteria injected into each mouse was 2-4 X 10 ⁇ CFU RN4220.0657n/mouse, or 1-2 X 10 ⁇ 9 CFU RN4220(2X RPMT)/ ⁇ iouse.
- mice When pre-opsonized with either 2H2.B8 or 2H2.BE11, but not an isotype matched control mAb, mice were protected from death from a lethal dose of RN4220.0657n staphylococci. The experiment was repeated twice for the IgGl isotype and three times for the IgG2b isotype with similar results (Table 9A). Table 9A: Ex-vivo Protection with Anti-0657n mAb
- TestmAbs murine anti-0657n 2H2.BE11 (IgG2b); 2H2.B8 (IgGl).
- mice When pre-opsonized with either mAb 2H2.B8 but not an isorype matched control mAb, mice were protected from death from a lethal dose of RN4220 (2X RPMI) staphylococci. The experiment was repeated six times with similar results (Table 9B).
- Murine anti-0657n 2H2 was very effective in preventing death in this lethal model.
- the 13C7 mAb was not effective in this model (as opposed to the previously described model illustrated in Figures 3-6). All (2H2.BE11, 2H2.B8 and 13C7.IgG2b ) of the anti-0657n mAb's bind RN4220 (as demonstrated using flow cytometery) and all have opsonizing activity in the in vitro OPA assay.
- This model reflects an additional requirement for epitope specificity for enhancing survival in the peritoneum of the mouse.
- Example 8 Epitope mapping studies performed with 2H2 mAb
- the experiments described in this example provide evidence that the monoclonal antibody 2H2.BE11 recognizes a conformational epitope within ORFO657n.
- the experiments localized the minimal sequence within ORPO657n required for displaying the conformational epitope in a three dimensional structure recognized by 2H2 mAb.
- the experiments identified distinct lysine residues within the minimal sequence of ORFO657n that become protected from reacting with small molecules when 2H2 mAb is bound to ORFO657n.
- 2H2 mAb The potential ability of 2H2 mAb to recognize linear epitopes of typically 9 to 14 amino acids in length within the sequence of ORFO657n was investigated using epitope extraction and starting with an ORF0657n fragment from amino acid 42 to amino acid 486 of SEQ ID NO: 1 ('ORF0657t").
- 30 ug of 2H2 mAb were immobilized by chemical cross linking to 10 mg of cyanogen bromide activated sepharose (Amersham cat. No. 17043001) for each of the epitope extraction experiments.
- Proteolytic digests of the ORF0657t were generated with GIuC (Roche Applied Science cat. No. 11 420 3997 001), Asp-N (Roche Applied Science cat. No.
- proteases GIu-C 5 Trypsin and a sequential combination of GIuC, AspN, Trypsin, Chymotrypsin, and Carboxy-peptidase Y were added for 5 hours or one hour per protease in the sequential combination. Peptides that were excised by the proteases during the incubation were thoroughly washed away and ORF0657t fragments that specifically bound to 2H2 mAb released with SDS loading buffer.
- the eluted sample showed a signal (total ion count) with the expected intensity at 82-87 minutes (40%- 45% acetonitrile) and multiple charge states ([M+67 H] 67+ to ([M-BO H] 30+ ) that deconvoluted to 42.628 kDa.
- a possible fragment of ORFO657t corresponding to this particular mass is sequence [012-382] of ORFO657t with a molecular weight of 42.6 kDa.
- reaction products produced with O or 3 molar excess 2H2 mAb were incubated with one of three proteases resulting in 2 x 9 reaction mixtures.
- Experiment 1 employed GIuC, AspN and Trypsin.
- Experiments 2 and 3 employed GIuC, AspN, and Chymotrypsin.
- the proteolytic peptides were then analyzed by 1D/LC-MS/MS.
- a ratio of acetylated and non-acetylated lysine residues was calculated based on the area under curve of the total ion count (TIC) of the individual peptides. Obtained ratios were then compared between the pairs (with and without 2H2 mAb) for identical reaction conditions.
- ORF0657t that is recognized by the 2H2 mAb is conformational.
- the fragment of ORP0657t that is recognized by 2H2 mAb has an N-term ⁇ nus located between amino acids 1 and 115 of ORF0675t and a carboxyl terminus located between amino acids 323-357 of ORF0657t.
- Vj variable light
- Vh variable heavy sequences of hybridoma expressed 2H2 IgG was accomplished by combining the degenerative primer PCR /overlap extension cloning process for single chain variable fragments (scFv) assembly (Krebber et al. JIM 201(I):35-55, 1997), with high throughput screening of soluble scFv fused to a human kappa light chain constant domain or scAb material via Biacore. This allowed for fine discrimination of mutations in Vi frameworks 1, 4 and Vj 1 frameworks 1, 4 generated by the degenerative primer method.
- scFv single chain variable fragments
- RNA material was purified from the hybridoma cell line using standard methods from a Total RNA KitTM (Ambion Inc.). This material was then reverse transcribed to cDNA and utilized as template in PCR to amplify the variable regions.
- the conditions for the PCR amplification of the Vj and Vj 1 chains was based upon the protocol described by Krebber et al. JIM20J(J):35-55, 1997.
- the primers are designed such that a (Gly4Ser) 4 linker (SEQ ED NO: 32) is added which provides domains for a third PCR reaction in which the Vh and Vj are overlapped to create a Vl-(Gly4Ser) 4 -Vh scFv.
- the first set of PCR reactions to amplify the variable chains individually were carried out in a volume of 100 ⁇ l containing 5 ⁇ l of the cDNA reaction, 2 ⁇ M each of the forward and reverse primer sets for amplification of Vj and Vh, and a high fidelity PCR master mix.
- the reactions were denatured for 4 minutes at 94°C followed by 30 cycles of 30 seconds at 94 0 C, 30 seconds at 50°C, 1 minute at 72°C, and finished at a final cycle of 5 minutes at 72°C.
- the full length PCR products were gel purified.
- DNA and a high fidelity PCR master mix was denatured for 5 minutes at 94°C, followed by 3 cycles of 30 seconds at 94°C, 30 s at 6O 0 C 7 and 30 seconds at 72 0 C in the absence of primers.
- the modified PCR. primers, SEQ ID NO: 33 and SEQ ED NO: 34 were added at a final concentration of 1 uM, and 30 cycles of 30 seconds at 94°C, 1 minutes at 6O 0 C, and 1 minute at 72°C were performed, followed by 7 minutes at 72 0 C.
- the expected full length scFv PCR products were gel purified.
- the amplified scFv material was cloned into the MPl 6 soluble expression vector for scAb production (Hayhurst et ah, JIM 276(1 -2,): 185-196, 2003) and sequence analysis.
- a single restriction enzyme digest with Sfil was used for directional cloning into the MPl 6 vector.
- Clones with apparent full length variable heavy and variable light chains present were then expressed as scAbs in XLl -Blue cells and recovered from the periplasm using a standard osmotic shock procedure. Briefly, clones were grown at 37 0 C overnight in growth media containing 2% glucose and 100 ⁇ g/ml ampicillin in a 96 well format.
- the underlined portions are the CDR 1 S. CDR's were identified based on the Kabat definition.
- the encoding nucleic acid sequence is provided by SEQ ED NO: 24 (Vh) and SEQ ID NO: 25 (Vi).
- variable regions for 2H2 mAb were cloned from mouse hybridoma as described in Example 9.
- the sequences for the variable regions were PCR amplified and DNA encoding the heavy chain variable regions were fused in-frame with DNA encoding the IgGl constant region whereas DNA encoding the light chain variable region were fused in-frame with DNA encoding the kappa constant region.
- the cloning procedure for the resulting antibody expression vectors is described below.
- variable regions were PCR amplified. PCR reactions were carried out in a volume of 25 ⁇ l containing high fidelity PCR master mix, template volume 1 ⁇ l and forward and reverse primers: 1 ⁇ l each. PCR condition was 1 cycle of 94°C, 2 minutes, 25 cycles of 94°C, 1.5 minutes; 60 0 C, 1.5 minutes; 72°C, 1.5 minutes and 72°C, 7 minutes; 4°C until removed and cloned in-frame with leader sequence at the 5 '-end and constant region at the 3 '-end using In-Fusion strategy.
- the following primers were used: Light chain forward, 5'- ACAGATGCCAGATGCGATATTGTGATGACCCAGTCT (SEQ ID NO: 28); Light chain reverse, 5'- TGCAGCCACCGTACGTTTTATTTCCAGCTTGGTCCC (SEQ IDNO: 29); Heavy chain forward, 5'- ACAGGTGTCCACTCGGATGTGCACCTGGTGGAGTCA (SEQ ID NO: 30); and Heavy chain reverse, 5'- GCCCTTGGTGGATGCCGAGGAGACTGTGAGAGTGGT (SEQ ID NO: 31).
- the DNA sequences for all the clones were confirmed by sequencing.
- amino acid sequences deduced from DNA sequences are:
- variable regions are underlined.
- the antibodies were expressed in 293EBNA monolayer cells.
- the plasmids were transfected using PEI based transfection reagents.
- the transfected cells were incubated in Opti-MEM serum free medium and the secreted antibodies were purified from medium using protein A/G affinity chromatography.
- the concentration of purified antibodies was determined by OD280 nm and the purity was measured by LabChipTM capillary electrophoresis.
- the expression of both light and heavy chains was driven by human CMV promoter and bovine growth hormone polyadenylation signal. (Shiver et al., Ann. N.Y. Acad. ScL, 772:198-208, 1995.)
- the leader sequence in the front mediated the secretion of antibodies into the culture medium.
- the leader sequence for the heavy chain was MEWSWVFLFFLSVTTGVHS (SEQ ED NO: 26) and for the light chain was MSVPTQVLGLLLLWLTDARC (SEQ ID NO: 27).
- the expression vectors carry oriP from EBV viral genome for prolonged expression in 293EBNA cells and the bacterial sequences for kanamycin selection marker and replication origin in E. coli.
- the antibodies were expressed in 293EBNA monolayer cells.
- the plasmids were transfected using PEI based transfection reagents.
- the transfected cells were incubated in Opti-MEM serum free medium and the secreted antibodies were purified from medium using protein A/G affinity chromatography.
- the concentration of purified antibodies was determined by OD280nm and the purity by LabChip capillary electrophoresis.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Communicable Diseases (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oncology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2007210170A AU2007210170A1 (en) | 2006-01-27 | 2007-01-23 | Antigen-binding proteins targeting S. aureus ORF0657n |
| CA002637152A CA2637152A1 (en) | 2006-01-27 | 2007-01-23 | Antigen-binding proteins targeting s. aureus orf0657n |
| JP2008552351A JP2009524428A (ja) | 2006-01-27 | 2007-01-23 | スタヒロコッカス・アウレウスorf0657nを標的とする抗原結合タンパク質 |
| US12/223,110 US20110091480A1 (en) | 2006-01-27 | 2007-01-23 | Antigen-Binding Proteins Targeting S. Aureus Orf0657n |
| EP07716897A EP1982185A4 (en) | 2006-01-27 | 2007-01-23 | ON S. AUREUS ORF0657N OBJECTIVE ANTIGEN-BINDING PROTEINS |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US76302306P | 2006-01-27 | 2006-01-27 | |
| US60/763,023 | 2006-01-27 |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| WO2007089470A2 true WO2007089470A2 (en) | 2007-08-09 |
| WO2007089470A9 WO2007089470A9 (en) | 2007-11-01 |
| WO2007089470A3 WO2007089470A3 (en) | 2008-01-24 |
Family
ID=38327867
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2007/001687 Ceased WO2007089470A2 (en) | 2006-01-27 | 2007-01-23 | Antigen-binding proteins targeting s. aureus orf0657n |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20110091480A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP1982185A4 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2009524428A (cg-RX-API-DMAC7.html) |
| CN (1) | CN101375161A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2007210170A1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2637152A1 (cg-RX-API-DMAC7.html) |
| WO (1) | WO2007089470A2 (cg-RX-API-DMAC7.html) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009029132A3 (en) * | 2007-05-31 | 2009-05-14 | Merck & Co Inc | Antigen-binding proteins targeting s. aureus orf0657n |
| US8758765B2 (en) | 2008-07-29 | 2014-06-24 | The University Of Chicago | Compositions and methods related to Staphylococcal bacterium proteins |
| US8840906B2 (en) | 2007-08-31 | 2014-09-23 | The University Of Chicago | Methods and compositions related to immunizing against Staphylococcal lung disease and conditions |
| US9181329B2 (en) | 2007-08-31 | 2015-11-10 | The University Of Chicago | Methods and compositions related to immunizing against Staphylococcal lung diseases and conditions |
| US10464971B2 (en) | 2010-07-02 | 2019-11-05 | The University Of Chicago | Compositions and methods related to Protein A (SpA) Variants |
| US12514914B2 (en) | 2019-05-14 | 2026-01-06 | The University Of Chicago | Methods and compositions comprising Staphylococcus protein a (SpA) variants |
| US12528882B2 (en) | 2019-09-13 | 2026-01-20 | The University Of Chicago | Methods and compositions for treating staphylococcal infections |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| HUE026855T2 (en) | 2009-04-03 | 2016-07-28 | Univ Chicago | Compositions and methods related to protein a (spa) variants |
| US8945588B2 (en) | 2011-05-06 | 2015-02-03 | The University Of Chicago | Methods and compositions involving protective staphylococcal antigens, such as EBH polypeptides |
| CA3191184A1 (en) * | 2020-08-28 | 2022-03-03 | Jiangsu Hengrui Pharmaceuticals Co., Ltd. | Signal peptide for reducing end heterogeneity of heterologous polypeptide |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6916605B1 (en) * | 1990-07-10 | 2005-07-12 | Medical Research Council | Methods for producing members of specific binding pairs |
| PT1377314E (pt) * | 2001-01-26 | 2012-01-02 | Inhibitex Inc | Anticorpos monoclonais para a proteína clfa e método de utilização no tratamento ou prevenção de infecções |
| US20070275460A1 (en) * | 2003-03-03 | 2007-11-29 | Xencor.Inc. | Fc Variants With Optimized Fc Receptor Binding Properties |
| KR20060065643A (ko) * | 2003-07-24 | 2006-06-14 | 머크 앤드 캄파니 인코포레이티드 | 스타필로코쿠스 아우레우스에 대한 방어 면역 반응을유도하는 폴리펩타이드 |
| WO2005009378A2 (en) * | 2003-07-24 | 2005-02-03 | Merck & Co., Inc. | Polypeptides for inducing a protective immune response against staphylococcus aureus |
| AU2006206577B2 (en) * | 2005-01-21 | 2012-03-08 | Merck Sharp & Dohme Corp. | Polypeptides for inducing a protective immune response against Staphylococcus aureus |
| AU2008251982A1 (en) * | 2007-01-24 | 2008-11-20 | Merck Sharp & Dohme Corp. | Polypeptides for inducing a protective immune response against Staphylococcus epidermidis |
| JP2010521965A (ja) * | 2007-03-19 | 2010-07-01 | メルク・シャープ・エンド・ドーム・コーポレイション | スタフィロコッカス・エピデルミディス(Staphylococcusepidermidis)に対する防御免疫応答を誘発するポリペプチド |
| WO2009029132A2 (en) * | 2007-05-31 | 2009-03-05 | Merck & Co., Inc. | Antigen-binding proteins targeting s. aureus orf0657n |
-
2007
- 2007-01-23 CA CA002637152A patent/CA2637152A1/en not_active Abandoned
- 2007-01-23 WO PCT/US2007/001687 patent/WO2007089470A2/en not_active Ceased
- 2007-01-23 US US12/223,110 patent/US20110091480A1/en not_active Abandoned
- 2007-01-23 JP JP2008552351A patent/JP2009524428A/ja not_active Withdrawn
- 2007-01-23 EP EP07716897A patent/EP1982185A4/en not_active Withdrawn
- 2007-01-23 AU AU2007210170A patent/AU2007210170A1/en not_active Abandoned
- 2007-01-23 CN CNA2007800036232A patent/CN101375161A/zh active Pending
Non-Patent Citations (1)
| Title |
|---|
| See references of EP1982185A4 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009029132A3 (en) * | 2007-05-31 | 2009-05-14 | Merck & Co Inc | Antigen-binding proteins targeting s. aureus orf0657n |
| US8840906B2 (en) | 2007-08-31 | 2014-09-23 | The University Of Chicago | Methods and compositions related to immunizing against Staphylococcal lung disease and conditions |
| US9181329B2 (en) | 2007-08-31 | 2015-11-10 | The University Of Chicago | Methods and compositions related to immunizing against Staphylococcal lung diseases and conditions |
| US11639379B2 (en) | 2007-08-31 | 2023-05-02 | The University Of Chicago | Methods and compositions related to immunizing against Staphylococcal lung diseases and conditions |
| US8758765B2 (en) | 2008-07-29 | 2014-06-24 | The University Of Chicago | Compositions and methods related to Staphylococcal bacterium proteins |
| US10464971B2 (en) | 2010-07-02 | 2019-11-05 | The University Of Chicago | Compositions and methods related to Protein A (SpA) Variants |
| US11059866B2 (en) | 2010-07-02 | 2021-07-13 | The University Of Chicago | Compositions and methods related to protein A (SpA) variants |
| US11939358B2 (en) | 2010-07-02 | 2024-03-26 | The University Of Chicago | Compositions and methods related to protein A (SpA) variants |
| US12514914B2 (en) | 2019-05-14 | 2026-01-06 | The University Of Chicago | Methods and compositions comprising Staphylococcus protein a (SpA) variants |
| US12528882B2 (en) | 2019-09-13 | 2026-01-20 | The University Of Chicago | Methods and compositions for treating staphylococcal infections |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2007089470A3 (en) | 2008-01-24 |
| JP2009524428A (ja) | 2009-07-02 |
| US20110091480A1 (en) | 2011-04-21 |
| WO2007089470A9 (en) | 2007-11-01 |
| EP1982185A4 (en) | 2010-04-28 |
| AU2007210170A1 (en) | 2007-08-09 |
| CN101375161A (zh) | 2009-02-25 |
| CA2637152A1 (en) | 2007-08-09 |
| EP1982185A2 (en) | 2008-10-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20110091480A1 (en) | Antigen-Binding Proteins Targeting S. Aureus Orf0657n | |
| AU2008333985B2 (en) | Antibodies to the PcrV antigen of pseudomonas aeruginosa | |
| US8653242B2 (en) | Therapeutic antibodies against flagellated Pseudomonas aeruginosa | |
| CN101679516B (zh) | 靶向金黄色葡萄球菌ORF0657n的抗原结合蛋白 | |
| CN113015745B (zh) | 针对金黄色葡萄球菌白细胞毒素的抗体 | |
| WO2014028748A1 (en) | Interleukin 2 antibodies and antibody complexes | |
| JP2023554557A (ja) | 抗il-4r抗体又はその抗原結合断片の複合物及び医薬用途 | |
| US20240059764A1 (en) | ANTIGEN-BINDING PROTEIN TARGETING STAPHYLOCOCCUS AUREUS a-HEMOLYSIS AND APPLICATION THEREOF | |
| CN114957460A (zh) | 交叉中和金黄色葡萄球菌毒素的抗原结合蛋白及其用途 | |
| US20240174736A1 (en) | Antigen-binding protein targeting pneumolysin and use thereof | |
| TW202506731A (zh) | 治療多重抗藥性細菌感染之方法 | |
| OA21922A (en) | Antigen-binding protein targeting streptococcus pneumoniae hemolysin protein and use thereof. | |
| HK40009426A (en) | Anti-o1 antibodies and uses thereof | |
| NZ618266B2 (en) | Anti-pseudomonas psl binding molecules and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2007210170 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2637152 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007716897 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12223110 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200780003623.2 Country of ref document: CN Ref document number: 2008552351 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 6761/DELNP/2008 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 2007210170 Country of ref document: AU Date of ref document: 20070123 Kind code of ref document: A |